2018-01-01
ABSTRACT The complete genome sequence of Bacillus cereus strain TG1-6, which is a highly salt-tolerant rhizobacterium that enhances plant tolerance to drought stress, is reported here. The sequencing process was performed based on a combination of pyrosequencing and single-molecule sequencing. The complete genome is estimated to be approximately 5.42 Mb, containing a total of 5,610 predicted protein-coding DNA sequences (CDSs). PMID:29748401
Smith, Colin A; Kortemme, Tanja
2011-01-01
Predicting the set of sequences that are tolerated by a protein or protein interface, while maintaining a desired function, is useful for characterizing protein interaction specificity and for computationally designing sequence libraries to engineer proteins with new functions. Here we provide a general method, a detailed set of protocols, and several benchmarks and analyses for estimating tolerated sequences using flexible backbone protein design implemented in the Rosetta molecular modeling software suite. The input to the method is at least one experimentally determined three-dimensional protein structure or high-quality model. The starting structure(s) are expanded or refined into a conformational ensemble using Monte Carlo simulations consisting of backrub backbone and side chain moves in Rosetta. The method then uses a combination of simulated annealing and genetic algorithm optimization methods to enrich for low-energy sequences for the individual members of the ensemble. To emphasize certain functional requirements (e.g. forming a binding interface), interactions between and within parts of the structure (e.g. domains) can be reweighted in the scoring function. Results from each backbone structure are merged together to create a single estimate for the tolerated sequence space. We provide an extensive description of the protocol and its parameters, all source code, example analysis scripts and three tests applying this method to finding sequences predicted to stabilize proteins or protein interfaces. The generality of this method makes many other applications possible, for example stabilizing interactions with small molecules, DNA, or RNA. Through the use of within-domain reweighting and/or multistate design, it may also be possible to use this method to find sequences that stabilize particular protein conformations or binding interactions over others.
DOE Office of Scientific and Technical Information (OSTI.GOV)
McIlwain, Sean J.; Peris, Davis; Sardi, Maria
The genome sequences of more than 100 strains of the yeast Saccharomyces cerevisiae have been published. Unfortunately, most of these genome assemblies contain dozens to hundreds of gaps at repetitive sequences, including transposable elements, tRNAs, and subtelomeric regions, which is where novel genes generally reside. Relatively few strains have been chosen for genome sequencing based on their biofuel production potential, leaving an additional knowledge gap. Here, we describe the nearly complete genome sequence of GLBRCY22-3 (Y22-3), a strain of S. cerevisiae derived from the stress-tolerant wild strain NRRL YB-210 and subsequently engineered for xylose metabolism. After benchmarking several genome assemblymore » approaches, we developed a pipeline to integrate Pacific Biosciences (PacBio) and Illumina sequencing data and achieved one of the highest quality genome assemblies for any S. cerevisiae strain. Specifically, the contig N50 is 693 kbp, and the sequences of most chromosomes, the mitochondrial genome, and the 2-micron plasmid are complete. Our annotation predicts 92 genes that are not present in the reference genome of the laboratory strain S288c, over 70% of which were expressed. We predicted functions for 43 of these genes, 28 of which were previously uncharacterized and unnamed. Remarkably, many of these genes are predicted to be involved in stress tolerance and carbon metabolism and are shared with a Brazilian bioethanol production strain, even though the strains differ dramatically at most genetic loci. Lastly, the Y22-3 genome sequence provides an exceptionally high-quality resource for basic and applied research in bioenergy and genetics.« less
McIlwain, Sean J.; Peris, Davis; Sardi, Maria; ...
2016-04-20
The genome sequences of more than 100 strains of the yeast Saccharomyces cerevisiae have been published. Unfortunately, most of these genome assemblies contain dozens to hundreds of gaps at repetitive sequences, including transposable elements, tRNAs, and subtelomeric regions, which is where novel genes generally reside. Relatively few strains have been chosen for genome sequencing based on their biofuel production potential, leaving an additional knowledge gap. Here, we describe the nearly complete genome sequence of GLBRCY22-3 (Y22-3), a strain of S. cerevisiae derived from the stress-tolerant wild strain NRRL YB-210 and subsequently engineered for xylose metabolism. After benchmarking several genome assemblymore » approaches, we developed a pipeline to integrate Pacific Biosciences (PacBio) and Illumina sequencing data and achieved one of the highest quality genome assemblies for any S. cerevisiae strain. Specifically, the contig N50 is 693 kbp, and the sequences of most chromosomes, the mitochondrial genome, and the 2-micron plasmid are complete. Our annotation predicts 92 genes that are not present in the reference genome of the laboratory strain S288c, over 70% of which were expressed. We predicted functions for 43 of these genes, 28 of which were previously uncharacterized and unnamed. Remarkably, many of these genes are predicted to be involved in stress tolerance and carbon metabolism and are shared with a Brazilian bioethanol production strain, even though the strains differ dramatically at most genetic loci. Lastly, the Y22-3 genome sequence provides an exceptionally high-quality resource for basic and applied research in bioenergy and genetics.« less
Swarnkar, Mohit Kumar; Vyas, Pratibha; Rahi, Praveen; Thakur, Rishu; Thakur, Namika; Singh, Anil Kumar
2015-01-01
The complete genome sequence of 6.45 Mb is reported here for Pseudomonas trivialis strain IHBB745 (MTCC 5336), which is an efficient, stress-tolerant, and broad-spectrum plant growth-promoting rhizobacterium. The gene-coding clusters predicted the genes for phosphate solubilization, siderophore production, 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, indole-3-acetic acid (IAA) production, and stress response. PMID:26337878
Schmöckel, Sandra M.; Lightfoot, Damien J.; Razali, Rozaimi; Tester, Mark; Jarvis, David E.
2017-01-01
Chenopodium quinoa (quinoa) is an emerging crop that produces nutritious grains with the potential to contribute to global food security. Quinoa can also grow on marginal lands, such as soils affected by high salinity. To identify candidate salt tolerance genes in the recently sequenced quinoa genome, we used a multifaceted approach integrating RNAseq analyses with comparative genomics and topology prediction. We identified 219 candidate genes by selecting those that were differentially expressed in response to salinity, were specific to or overrepresented in quinoa relative to other Amaranthaceae species, and had more than one predicted transmembrane domain. To determine whether these genes might underlie variation in salinity tolerance in quinoa and its close relatives, we compared the response to salinity stress in a panel of 21 Chenopodium accessions (14 C. quinoa, 5 C. berlandieri, and 2 C. hircinum). We found large variation in salinity tolerance, with one C. hircinum displaying the highest salinity tolerance. Using genome re-sequencing data from these accessions, we investigated single nucleotide polymorphisms and copy number variation (CNV) in the 219 candidate genes in accessions of contrasting salinity tolerance, and identified 15 genes that could contribute to the differences in salinity tolerance of these Chenopodium accessions. PMID:28680429
Gulati, Arvind; Swarnkar, Mohit Kumar; Vyas, Pratibha; Rahi, Praveen; Thakur, Rishu; Thakur, Namika; Singh, Anil Kumar
2015-09-03
The complete genome sequence of 6.45 Mb is reported here for Pseudomonas trivialis strain IHBB745 (MTCC 5336), which is an efficient, stress-tolerant, and broad-spectrum plant growth-promoting rhizobacterium. The gene-coding clusters predicted the genes for phosphate solubilization, siderophore production, 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity, indole-3-acetic acid (IAA) production, and stress response. Copyright © 2015 Gulati et al.
Vílchez, Juan Ignacio; Tang, Qiming; Kaushal, Richa; Wang, Wei; Lv, Suhui; He, Danxia; Chu, Zhaoqing; Zhang, Heng; Liu, Renyi; Zhang, Huiming
2018-06-21
Here, we report the complete genome sequence for Bacillus megaterium strain YC4-R4, a highly salt-tolerant rhizobacterium that promotes growth in plants. The sequencing process was performed by combining pyrosequencing and single-molecule sequencing techniques. The complete genome is estimated to be approximately 5.44 Mb, containing a total of 5,673 predicted protein-coding DNA sequences (CDSs). Copyright © 2018 Vílchez et al.
Community-Level Analysis of psbA Gene Sequences and Irgarol Tolerance in Marine Periphyton▿
Eriksson, K. M.; Clarke, A. K.; Franzen, L.-G.; Kuylenstierna, M.; Martinez, K.; Blanck, H.
2009-01-01
This study analyzes psbA gene sequences, predicted D1 protein sequences, species relative abundance, and pollution-induced community tolerance in marine periphyton communities exposed to the antifouling compound Irgarol 1051. The mechanism of action of Irgarol is the inhibition of photosynthetic electron transport at photosystem II by binding to the D1 protein. The metagenome of the communities was used to produce clone libraries containing fragments of the psbA gene encoding the D1 protein. Community tolerance was quantified with a short-term test for the inhibition of photosynthesis. The communities were established in a continuous flow of natural seawater through microcosms with or without added Irgarol. The selection pressure from Irgarol resulted in an altered species composition and an inducted community tolerance to Irgarol. Moreover, there was a very high diversity in the psbA gene sequences in the periphyton, and the composition of psbA and D1 fragments within the communities was dramatically altered by increased Irgarol exposure. Even though tolerance to this type of compound in land plants often depends on a single amino acid substitution (Ser264→Gly) in the D1 protein, this was not the case for marine periphyton species. Instead, the tolerance mechanism likely involves increased degradation of D1. When we compared sequences from low and high Irgarol exposure, differences in nonconserved amino acids were found only in the so-called PEST region of D1, which is involved in regulating its degradation. Our results suggest that environmental contamination with Irgarol has led to selection for high-turnover D1 proteins in marine periphyton communities at the west coast of Sweden. PMID:19088321
Gostinčar, Cene; Ohm, Robin A; Kogej, Tina; Sonjak, Silva; Turk, Martina; Zajc, Janja; Zalar, Polona; Grube, Martin; Sun, Hui; Han, James; Sharma, Aditi; Chiniquy, Jennifer; Ngan, Chew Yee; Lipzen, Anna; Barry, Kerrie; Grigoriev, Igor V; Gunde-Cimerman, Nina
2014-07-01
Aureobasidium pullulans is a black-yeast-like fungus used for production of the polysaccharide pullulan and the antimycotic aureobasidin A, and as a biocontrol agent in agriculture. It can cause opportunistic human infections, and it inhabits various extreme environments. To promote the understanding of these traits, we performed de-novo genome sequencing of the four varieties of A. pullulans. The 25.43-29.62 Mb genomes of these four varieties of A. pullulans encode between 10266 and 11866 predicted proteins. Their genomes encode most of the enzyme families involved in degradation of plant material and many sugar transporters, and they have genes possibly associated with degradation of plastic and aromatic compounds. Proteins believed to be involved in the synthesis of pullulan and siderophores, but not of aureobasidin A, are predicted. Putative stress-tolerance genes include several aquaporins and aquaglyceroporins, large numbers of alkali-metal cation transporters, genes for the synthesis of compatible solutes and melanin, all of the components of the high-osmolarity glycerol pathway, and bacteriorhodopsin-like proteins. All of these genomes contain a homothallic mating-type locus. The differences between these four varieties of A. pullulans are large enough to justify their redefinition as separate species: A. pullulans, A. melanogenum, A. subglaciale and A. namibiae. The redundancy observed in several gene families can be linked to the nutritional versatility of these species and their particular stress tolerance. The availability of the genome sequences of the four Aureobasidium species should improve their biotechnological exploitation and promote our understanding of their stress-tolerance mechanisms, diverse lifestyles, and pathogenic potential.
The correlations and sequence of plant stomatal, hydraulic, and wilting responses to drought
Bartlett, Megan K.; Klein, Tamir; Jansen, Steven; Choat, Brendan; Sack, Lawren
2016-01-01
Climate change is expected to exacerbate drought for many plants, making drought tolerance a key driver of species and ecosystem responses. Plant drought tolerance is determined by multiple traits, but the relationships among traits, either within individual plants or across species, have not been evaluated for general patterns across plant diversity. We synthesized the published data for stomatal closure, wilting, declines in hydraulic conductivity in the leaves, stems, and roots, and plant mortality for 262 woody angiosperm and 48 gymnosperm species. We evaluated the correlations among the drought tolerance traits across species, and the general sequence of water potential thresholds for these traits within individual plants. The trait correlations across species provide a framework for predicting plant responses to a wide range of water stress from one or two sampled traits, increasing the ability to rapidly characterize drought tolerance across diverse species. Analyzing these correlations also identified correlations among the leaf and stem hydraulic traits and the wilting point, or turgor loss point, beyond those expected from shared ancestry or independent associations with water stress alone. Further, on average, the angiosperm species generally exhibited a sequence of drought tolerance traits that is expected to limit severe tissue damage during drought, such as wilting and substantial stem embolism. This synthesis of the relationships among the drought tolerance traits provides crucial, empirically supported insight into representing variation in multiple traits in models of plant and ecosystem responses to drought. PMID:27807136
The correlations and sequence of plant stomatal, hydraulic, and wilting responses to drought.
Bartlett, Megan K; Klein, Tamir; Jansen, Steven; Choat, Brendan; Sack, Lawren
2016-11-15
Climate change is expected to exacerbate drought for many plants, making drought tolerance a key driver of species and ecosystem responses. Plant drought tolerance is determined by multiple traits, but the relationships among traits, either within individual plants or across species, have not been evaluated for general patterns across plant diversity. We synthesized the published data for stomatal closure, wilting, declines in hydraulic conductivity in the leaves, stems, and roots, and plant mortality for 262 woody angiosperm and 48 gymnosperm species. We evaluated the correlations among the drought tolerance traits across species, and the general sequence of water potential thresholds for these traits within individual plants. The trait correlations across species provide a framework for predicting plant responses to a wide range of water stress from one or two sampled traits, increasing the ability to rapidly characterize drought tolerance across diverse species. Analyzing these correlations also identified correlations among the leaf and stem hydraulic traits and the wilting point, or turgor loss point, beyond those expected from shared ancestry or independent associations with water stress alone. Further, on average, the angiosperm species generally exhibited a sequence of drought tolerance traits that is expected to limit severe tissue damage during drought, such as wilting and substantial stem embolism. This synthesis of the relationships among the drought tolerance traits provides crucial, empirically supported insight into representing variation in multiple traits in models of plant and ecosystem responses to drought.
Gostinčar, Cene; Ohm, Robin A.; Kogej, Tina; ...
2014-07-01
Aureobasidium pullulans is a black-yeast-like fungus used for production of the polysaccharide pullulan and the antimycotic aureobasidin A, and as a biocontrol agent in agriculture. It can cause opportunistic human infections, and it inhabits various extreme environments. To promote the understanding of these traits, we performed de-novo genome sequencing of the four varieties of A. pullulans. The 25.43-29.62 Mb genomes of these four varieties of A. pullulans encode between 10266 and 11866 predicted proteins. Their genomes encode most of the enzyme families involved in degradation of plant material and many sugar transporters, and they have genes possibly associated with degradationmore » of plastic and aromatic compounds. Proteins believed to be involved in the synthesis of pullulan and siderophores, but not of aureobasidin A, are predicted. Putative stress-tolerance genes include several aquaporins and aquaglyceroporins, large numbers of alkali-metal cation transporters, genes for the synthesis of compatible solutes and melanin, all of the components of the high-osmolarity glycerol pathway, and bacteriorhodopsin-like proteins. All of these genomes contain a homothallic mating-type locus. The differences between these four varieties of A. pullulans are large enough to justify their redefinition as separate species: A. pullulans, A. melanogenum, A. subglaciale and A. namibiae. We observed redundancy in several gene families that can be linked to the nutritional versatility of these species and their particular stress tolerance. In conclusions, the availability of the genome sequences of the four Aureobasidium species should improve their biotechnological exploitation and promote our understanding of their stress-tolerance mechanisms, diverse lifestyles, and pathogenic potential.« less
Branham, Sandra E; Stansell, Zachary J; Couillard, David M; Farnham, Mark W
2017-03-01
Five quantitative trait loci and one epistatic interaction were associated with heat tolerance in a doubled haploid population of broccoli evaluated in three summer field trials. Predicted rising global temperatures due to climate change have generated a demand for crops that are resistant to yield and quality losses from heat stress. Broccoli (Brassica oleracea var. italica) is a cool weather crop with high temperatures during production decreasing both head quality and yield. Breeding for heat tolerance in broccoli has potential to both expand viable production areas and extend the growing season but breeding efficiency is constrained by limited genetic information. A doubled haploid (DH) broccoli population segregating for heat tolerance was evaluated for head quality in three summer fields in Charleston, SC, USA. Multiple quantitative trait loci (QTL) mapping of 1,423 single nucleotide polymorphisms developed through genotyping-by-sequencing identified five QTL and one positive epistatic interaction that explained 62.1% of variation in heat tolerance. The QTL identified here can be used to develop markers for marker-assisted selection and to increase our understanding of the molecular mechanisms underlying plant response to heat stress.
Wagner, Josiah T; Herrejon Chavez, Florisela; Podrabsky, Jason E
2016-01-01
The annual killifish Austrofundulus limnaeus inhabits ephemeral ponds in regions of Venezuela, South America. Permanent populations of A. limnaeus are maintained by production of stress-tolerant embryos that are able to persist in the desiccated sediment. Previous work has demonstrated that A. limnaeus have a remarkable ability to tolerate extended periods of anoxia and desiccating conditions. After considering temperature, A. limnaeus embryos have the highest known tolerance to anoxia when compared to any other vertebrate yet studied. Oxygen is completely essential for the process of oxidative phosphorylation by mitochondria, the intracellular organelle responsible for the majority of adenosine triphosphate production. Thus, understanding the unique properties of A. limnaeus mitochondria is of great interest. In this work, we describe the first complete mitochondrial genome (mtgenome) sequence of a single adult A. limnaeus individual and compare both coding and non-coding regions to several other closely related fish mtgenomes. Mitochondrial features were predicted using MitoAnnotator and polyadenylation sites were predicted using RNAseq mapping. To estimate the responsiveness of A. limnaeus mitochondria to anoxia treatment, we measure relative mitochondrial DNA copy number and total citrate synthase activity in both relatively anoxia-tolerant and anoxia-sensitive embryonic stages. Our cross-species comparative approach identifies unique features of ND1, ND5, ND6, and ATPase-6 that may facilitate the unique phenotype of A. limnaeus embryos. Additionally, we do not find evidence for mitochondrial degradation or biogenesis during anoxia/reoxygenation treatment in A. limnaeus embryos, suggesting that anoxia-tolerant mitochondria do not respond to anoxia in a manner similar to anoxia-sensitive mitochondria.
Kashuk, Carl S.; Stone, Eric A.; Grice, Elizabeth A.; Portnoy, Matthew E.; Green, Eric D.; Sidow, Arend; Chakravarti, Aravinda; McCallion, Andrew S.
2005-01-01
The ability to discriminate between deleterious and neutral amino acid substitutions in the genes of patients remains a significant challenge in human genetics. The increasing availability of genomic sequence data from multiple vertebrate species allows inclusion of sequence conservation and physicochemical properties of residues to be used for functional prediction. In this study, the RET receptor tyrosine kinase serves as a model disease gene in which a broad spectrum (≥116) of disease-associated mutations has been identified among patients with Hirschsprung disease and multiple endocrine neoplasia type 2. We report the alignment of the human RET protein sequence with the orthologous sequences of 12 non-human vertebrates (eight mammalian, one avian, and three teleost species), their comparative analysis, the evolutionary topology of the RET protein, and predicted tolerance for all published missense mutations. We show that, although evolutionary conservation alone provides significant information to predict the effect of a RET mutation, a model that combines comparative sequence data with analysis of physiochemical properties in a quantitative framework provides far greater accuracy. Although the ability to discern the impact of a mutation is imperfect, our analyses permit substantial discrimination between predicted functional classes of RET mutations and disease severity even for a multigenic disease such as Hirschsprung disease. PMID:15956201
Genome sequencing of the winged midge, Parochlus steinenii, from the Antarctic Peninsula
Kim, Sanghee; Oh, Mijin; Jung, Woongsic; Park, Joonho; Choi, Han-Gu
2017-01-01
Abstract Background: In the Antarctic, only two species of Chironomidae occur naturally—the wingless midge, Belgica antarctica, and the winged midge, Parochlus steinenii. B. antarctica is an extremophile with unusual adaptations. The larvae of B. antarctica are desiccation- and freeze-tolerant and the adults are wingless. Recently, the compact genome of B. antarctica was reported and it is the first Antarctic eukaryote to be sequenced. Although P. steinenii occurs naturally in the Antarctic with B. antarctica, the larvae of P. steinenii are cold-tolerant but not freeze-tolerant and the adults are winged. Differences in adaptations in the Antarctic midges are interesting in terms of evolutionary processes within an extreme environment. Herein, we provide the genome of another Antarctic midge to help elucidate the evolution of these species. Results: The draft genome of P. steinenii had a total size of 138 Mbp, comprising 9513 contigs with an N50 contig size of 34,110 bp, and a GC content of 32.2%. Overall, 13,468 genes were predicted using the MAKER annotation pipeline, and gene ontology classified 10,801 (80.2%) predicted genes to a function. Compared with the assembled genome architecture of B. antarctica, that of P. steinenii was approximately 50 Mbp longer with 6.2-fold more repeat sequences, whereas gene regions were as similarly compact as in B. antarctica. Conclusions: We present an annotated draft genome of the Antarctic midge, P. steinenii. The genomes of P. steinenii and B. antarctica will aid in the elucidation of evolution in harsh environments and provide new resources for functional genomic analyses of the order Diptera. PMID:28327954
USDA-ARS?s Scientific Manuscript database
Predicted rising global temperatures due to climate change have generated a demand for crops that are resistant to yield and quality losses from heat stress. Broccoli (Brassica oleracea var. italica) is a cool weather crop with high temperatures during production decreasing both head quality and yie...
Dias, Kaio Olímpio Das Graças; Gezan, Salvador Alejandro; Guimarães, Claudia Teixeira; Nazarian, Alireza; da Costa E Silva, Luciano; Parentoni, Sidney Netto; de Oliveira Guimarães, Paulo Evaristo; de Oliveira Anoni, Carina; Pádua, José Maria Villela; de Oliveira Pinto, Marcos; Noda, Roberto Willians; Ribeiro, Carlos Alexandre Gomes; de Magalhães, Jurandir Vieira; Garcia, Antonio Augusto Franco; de Souza, João Cândido; Guimarães, Lauro José Moreira; Pastina, Maria Marta
2018-07-01
Breeding for drought tolerance is a challenging task that requires costly, extensive, and precise phenotyping. Genomic selection (GS) can be used to maximize selection efficiency and the genetic gains in maize (Zea mays L.) breeding programs for drought tolerance. Here, we evaluated the accuracy of genomic selection (GS) using additive (A) and additive + dominance (AD) models to predict the performance of untested maize single-cross hybrids for drought tolerance in multi-environment trials. Phenotypic data of five drought tolerance traits were measured in 308 hybrids along eight trials under water-stressed (WS) and well-watered (WW) conditions over two years and two locations in Brazil. Hybrids' genotypes were inferred based on their parents' genotypes (inbred lines) using single-nucleotide polymorphism markers obtained via genotyping-by-sequencing. GS analyses were performed using genomic best linear unbiased prediction by fitting a factor analytic (FA) multiplicative mixed model. Two cross-validation (CV) schemes were tested: CV1 and CV2. The FA framework allowed for investigating the stability of additive and dominance effects across environments, as well as the additive-by-environment and the dominance-by-environment interactions, with interesting applications for parental and hybrid selection. Results showed differences in the predictive accuracy between A and AD models, using both CV1 and CV2, for the five traits in both water conditions. For grain yield (GY) under WS and using CV1, the AD model doubled the predictive accuracy in comparison to the A model. Through CV2, GS models benefit from borrowing information of correlated trials, resulting in an increase of 40% and 9% in the predictive accuracy of GY under WS for A and AD models, respectively. These results highlight the importance of multi-environment trial analyses using GS models that incorporate additive and dominance effects for genomic predictions of GY under drought in maize single-cross hybrids.
Öhrmalm, Christina; Jobs, Magnus; Eriksson, Ronnie; Golbob, Sultan; Elfaitouri, Amal; Benachenhou, Farid; Strømme, Maria; Blomberg, Jonas
2010-01-01
One of the main problems in nucleic acid-based techniques for detection of infectious agents, such as influenza viruses, is that of nucleic acid sequence variation. DNA probes, 70-nt long, some including the nucleotide analog deoxyribose-Inosine (dInosine), were analyzed for hybridization tolerance to different amounts and distributions of mismatching bases, e.g. synonymous mutations, in target DNA. Microsphere-linked 70-mer probes were hybridized in 3M TMAC buffer to biotinylated single-stranded (ss) DNA for subsequent analysis in a Luminex® system. When mismatches interrupted contiguous matching stretches of 6 nt or longer, it had a strong impact on hybridization. Contiguous matching stretches are more important than the same number of matching nucleotides separated by mismatches into several regions. dInosine, but not 5-nitroindole, substitutions at mismatching positions stabilized hybridization remarkably well, comparable to N (4-fold) wobbles in the same positions. In contrast to shorter probes, 70-nt probes with judiciously placed dInosine substitutions and/or wobble positions were remarkably mismatch tolerant, with preserved specificity. An algorithm, NucZip, was constructed to model the nucleation and zipping phases of hybridization, integrating both local and distant binding contributions. It predicted hybridization more exactly than previous algorithms, and has the potential to guide the design of variation-tolerant yet specific probes. PMID:20864443
A hierarchical approach to reliability modeling of fault-tolerant systems. M.S. Thesis
NASA Technical Reports Server (NTRS)
Gossman, W. E.
1986-01-01
A methodology for performing fault tolerant system reliability analysis is presented. The method decomposes a system into its subsystems, evaluates vent rates derived from the subsystem's conditional state probability vector and incorporates those results into a hierarchical Markov model of the system. This is done in a manner that addresses failure sequence dependence associated with the system's redundancy management strategy. The method is derived for application to a specific system definition. Results are presented that compare the hierarchical model's unreliability prediction to that of a more complicated tandard Markov model of the system. The results for the example given indicate that the hierarchical method predicts system unreliability to a desirable level of accuracy while achieving significant computational savings relative to component level Markov model of the system.
BG7: A New Approach for Bacterial Genome Annotation Designed for Next Generation Sequencing Data
Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Pareja, Eduardo; Tobes, Raquel
2012-01-01
BG7 is a new system for de novo bacterial, archaeal and viral genome annotation based on a new approach specifically designed for annotating genomes sequenced with next generation sequencing technologies. The system is versatile and able to annotate genes even in the step of preliminary assembly of the genome. It is especially efficient detecting unexpected genes horizontally acquired from bacterial or archaeal distant genomes, phages, plasmids, and mobile elements. From the initial phases of the gene annotation process, BG7 exploits the massive availability of annotated protein sequences in databases. BG7 predicts ORFs and infers their function based on protein similarity with a wide set of reference proteins, integrating ORF prediction and functional annotation phases in just one step. BG7 is especially tolerant to sequencing errors in start and stop codons, to frameshifts, and to assembly or scaffolding errors. The system is also tolerant to the high level of gene fragmentation which is frequently found in not fully assembled genomes. BG7 current version – which is developed in Java, takes advantage of Amazon Web Services (AWS) cloud computing features, but it can also be run locally in any operating system. BG7 is a fast, automated and scalable system that can cope with the challenge of analyzing the huge amount of genomes that are being sequenced with NGS technologies. Its capabilities and efficiency were demonstrated in the 2011 EHEC Germany outbreak in which BG7 was used to get the first annotations right the next day after the first entero-hemorrhagic E. coli genome sequences were made publicly available. The suitability of BG7 for genome annotation has been proved for Illumina, 454, Ion Torrent, and PacBio sequencing technologies. Besides, thanks to its plasticity, our system could be very easily adapted to work with new technologies in the future. PMID:23185310
Genome sequencing of the winged midge, Parochlus steinenii, from the Antarctic Peninsula.
Kim, Sanghee; Oh, Mijin; Jung, Woongsic; Park, Joonho; Choi, Han-Gu; Shin, Seung Chul
2017-03-01
In the Antarctic, only two species of Chironomidae occur naturally-the wingless midge, Belgica antarctica , and the winged midge, Parochlus steinenii . B. antarctica is an extremophile with unusual adaptations. The larvae of B. antarctica are desiccation- and freeze-tolerant and the adults are wingless. Recently, the compact genome of B. antarctica was reported and it is the first Antarctic eukaryote to be sequenced. Although P. steinenii occurs naturally in the Antarctic with B. antarctica , the larvae of P. steinenii are cold-tolerant but not freeze-tolerant and the adults are winged. Differences in adaptations in the Antarctic midges are interesting in terms of evolutionary processes within an extreme environment. Herein, we provide the genome of another Antarctic midge to help elucidate the evolution of these species. The draft genome of P. steinenii had a total size of 138 Mbp, comprising 9513 contigs with an N50 contig size of 34,110 bp, and a GC content of 32.2%. Overall, 13,468 genes were predicted using the MAKER annotation pipeline, and gene ontology classified 10,801 (80.2%) predicted genes to a function. Compared with the assembled genome architecture of B. antarctica , that of P. steinenii was approximately 50 Mbp longer with 6.2-fold more repeat sequences, whereas gene regions were as similarly compact as in B. antarctica . We present an annotated draft genome of the Antarctic midge, P. steinenii . The genomes of P. steinenii and B. antarctica will aid in the elucidation of evolution in harsh environments and provide new resources for functional genomic analyses of the order Diptera. © The Authors 2017. Published by Oxford University Press.
Hu, Maolong; Pu, Huiming; Gao, Jianqin; Long, Weihua; Chen, Feng; Zhang, Wei; Zhou, Xiaoyin; Peng, Qi; Chen, Song; Zhang, Jiefu
2017-01-01
Acetohydroxyacid synthase (AHAS), also called acetolactate synthase, is a key enzyme involved in the first step of the biosynthesis of the branched-chain amino acids valine, isoleucine and leucine. Acetohydroxyacid synthase-inhibiting herbicides (AHAS herbicides) are five chemical families of herbicides that inhibit AHAS enzymes, including imidazolinones (IMI), sulfonylureas (SU), pyrimidinylthiobenzoates, triazolinones and triazolopyrimidines. Five AHAS genes have been identified in rapeseed, but little information is available regarding the role of miRNAs in response to AHAS herbicides. In this study, an AHAS herbicides tolerant genotype and a sensitive genotype were used for miRNA comparative analysis. A total of 20 small RNA libraries were obtained of these two genotypes at three time points (0h, 24 h and 48 h) after spraying SU and IMI herbicides with two replicates. We identified 940 conserved miRNAs and 1515 novel candidate miRNAs in Brassica napus using high-throughput sequencing methods combined with computing analysis. A total of 3284 genes were predicted to be targets of these miRNAs, and their functions were shown using GO, KOG and KEGG annotations. The differentiation expression results of miRNAs showed almost twice as many differentiated miRNAs were found in tolerant genotype M342 (309 miRNAs) after SU herbicide application than in sensitive genotype N131 (164 miRNAs). In additiond 177 and 296 miRNAs defined as differentiated in sensitive genotype and tolerant genotype in response to SU herbicides. The miR398 family was observed to be associated with AHAS herbicide tolerance because their expression increased in the tolerant genotype but decreased in the sensitive genotype. Moreover, 50 novel miRNAs from 39 precursors were predicted. There were 8 conserved miRNAs, 4 novel miRNAs and 3 target genes were validated by quantitative real-time PCR experiment. This study not only provides novel insights into the miRNA content of AHAS herbicides tolerant rapeseed in response to AHAS herbicides, but also demonstrates that miRNAs may be involved in AHAS herbicides tolerance.
Hu, Maolong; Pu, Huiming; Gao, Jianqin; Long, Weihua; Chen, Feng; Zhang, Wei; Zhou, Xiaoyin; Peng, Qi; Chen, Song; Zhang, Jiefu
2017-01-01
Acetohydroxyacid synthase (AHAS), also called acetolactate synthase, is a key enzyme involved in the first step of the biosynthesis of the branched-chain amino acids valine, isoleucine and leucine. Acetohydroxyacid synthase-inhibiting herbicides (AHAS herbicides) are five chemical families of herbicides that inhibit AHAS enzymes, including imidazolinones (IMI), sulfonylureas (SU), pyrimidinylthiobenzoates, triazolinones and triazolopyrimidines. Five AHAS genes have been identified in rapeseed, but little information is available regarding the role of miRNAs in response to AHAS herbicides. In this study, an AHAS herbicides tolerant genotype and a sensitive genotype were used for miRNA comparative analysis. A total of 20 small RNA libraries were obtained of these two genotypes at three time points (0h, 24 h and 48 h) after spraying SU and IMI herbicides with two replicates. We identified 940 conserved miRNAs and 1515 novel candidate miRNAs in Brassica napus using high-throughput sequencing methods combined with computing analysis. A total of 3284 genes were predicted to be targets of these miRNAs, and their functions were shown using GO, KOG and KEGG annotations. The differentiation expression results of miRNAs showed almost twice as many differentiated miRNAs were found in tolerant genotype M342 (309 miRNAs) after SU herbicide application than in sensitive genotype N131 (164 miRNAs). In additiond 177 and 296 miRNAs defined as differentiated in sensitive genotype and tolerant genotype in response to SU herbicides. The miR398 family was observed to be associated with AHAS herbicide tolerance because their expression increased in the tolerant genotype but decreased in the sensitive genotype. Moreover, 50 novel miRNAs from 39 precursors were predicted. There were 8 conserved miRNAs, 4 novel miRNAs and 3 target genes were validated by quantitative real-time PCR experiment. This study not only provides novel insights into the miRNA content of AHAS herbicides tolerant rapeseed in response to AHAS herbicides, but also demonstrates that miRNAs may be involved in AHAS herbicides tolerance. PMID:28950015
Inferring patterns in mitochondrial DNA sequences through hypercube independent spanning trees.
Silva, Eduardo Sant Ana da; Pedrini, Helio
2016-03-01
Given a graph G, a set of spanning trees rooted at a vertex r of G is said vertex/edge independent if, for each vertex v of G, v≠r, the paths of r to v in any pair of trees are vertex/edge disjoint. Independent spanning trees (ISTs) provide a number of advantages in data broadcasting due to their fault tolerant properties. For this reason, some studies have addressed the issue by providing mechanisms for constructing independent spanning trees efficiently. In this work, we investigate how to construct independent spanning trees on hypercubes, which are generated based upon spanning binomial trees, and how to use them to predict mitochondrial DNA sequence parts through paths on the hypercube. The prediction works both for inferring mitochondrial DNA sequences comprised of six bases as well as infer anomalies that probably should not belong to the mitochondrial DNA standard. Copyright © 2016 Elsevier Ltd. All rights reserved.
Heuristic reusable dynamic programming: efficient updates of local sequence alignment.
Hong, Changjin; Tewfik, Ahmed H
2009-01-01
Recomputation of the previously evaluated similarity results between biological sequences becomes inevitable when researchers realize errors in their sequenced data or when the researchers have to compare nearly similar sequences, e.g., in a family of proteins. We present an efficient scheme for updating local sequence alignments with an affine gap model. In principle, using the previous matching result between two amino acid sequences, we perform a forward-backward alignment to generate heuristic searching bands which are bounded by a set of suboptimal paths. Given a correctly updated sequence, we initially predict a new score of the alignment path for each contour to select the best candidates among them. Then, we run the Smith-Waterman algorithm in this confined space. Furthermore, our heuristic alignment for an updated sequence shows that it can be further accelerated by using reusable dynamic programming (rDP), our prior work. In this study, we successfully validate "relative node tolerance bound" (RNTB) in the pruned searching space. Furthermore, we improve the computational performance by quantifying the successful RNTB tolerance probability and switch to rDP on perturbation-resilient columns only. In our searching space derived by a threshold value of 90 percent of the optimal alignment score, we find that 98.3 percent of contours contain correctly updated paths. We also find that our method consumes only 25.36 percent of the runtime cost of sparse dynamic programming (sDP) method, and to only 2.55 percent of that of a normal dynamic programming with the Smith-Waterman algorithm.
Jia, Z P; McCullough, N; Martel, R; Hemmingsen, S; Young, P G
1992-01-01
We have identified a new locus, sodium 2 (sod2) based on selection for increased LiCl tolerance in fission yeast, Schizosaccharomyces pombe. Tolerant strains have enhanced pH-dependent Na+ export capacity and sodium transport experiments suggest that the gene encodes an Na+/H+ antiport. The predicted sod2 gene product can be placed in the broad class of transporters which possess 12 hydrophobic transmembrane domains. The protein shows some sequence similarity to the human and bacterial Na+/H+ antiporters. Overexpression of sod2 increased Na+ export capacity and conferred sodium tolerance. Osmotolerance was not affected and sod2 cells were unaffected for growth in K+. In a sod2 disruption strain cells were incapable of exporting sodium. They were hypersensitive to Na+ or Li+ and could not grow under conditions that approximate pH7. The sod2 gene amplification could be selected stepwise and the degree of such amplification correlated with the level of Na+ or Li+ tolerance. Images PMID:1314171
Controlling the Surface Chemistry of Graphite by Engineered Self-Assembled Peptides
Khatayevich, Dmitriy; So, Christopher R.; Hayamizu, Yuhei; Gresswell, Carolyn; Sarikaya, Mehmet
2012-01-01
The systematic control over surface chemistry is a long-standing challenge in biomedical and nanotechnological applications for graphitic materials. As a novel approach, we utilize graphite-binding dodecapeptides that self-assemble into dense domains to form monolayer thick long-range ordered films on graphite. Specifically, the peptides are rationally designed through their amino acid sequences to predictably display hydrophilic and hydrophobic characteristics while maintaining their self-assembly capabilities on the solid substrate. The peptides are observed to maintain a high tolerance for sequence modification, allowing the control over surface chemistry via their amino acid sequence. Furthermore, through a single step co-assembly of two different designed peptides, we predictably and precisely tune the wettability of the resulting functionalized graphite surfaces from 44 to 83 degrees. The modular molecular structures and predictable behavior of short peptides demonstrated here give rise to a novel platform for functionalizing graphitic materials that offers numerous advantages, including non-invasive modification of the substrate, bio-compatible processing in an aqueous environment, and simple fusion with other functional biological molecules. PMID:22428620
Permanent draft genome of the malachite-green-tolerant bacterium Rhizobium sp. MGL06.
Liu, Yang; Wang, Runping; Zeng, Runying
2014-12-01
Rhizobium sp. MGL06, the first Rhizobium isolate from a marine environment, is a malachite-green-tolerant bacterium with a broader salinity tolerance (range: 0.5% to 9%) than other rhizobia. This study sequences and annotates the draft genome sequence of this strain. Genome sequence information provides a basis for analyzing the malachite green tolerance, broad salinity adaptation, nitrogen fixation properties, and taxonomic classification of the isolate. Copyright © 2014 Elsevier B.V. All rights reserved.
Can natural proteins designed with 'inverted' peptide sequences adopt native-like protein folds?
Sridhar, Settu; Guruprasad, Kunchur
2014-01-01
We have carried out a systematic computational analysis on a representative dataset of proteins of known three-dimensional structure, in order to evaluate whether it would possible to 'swap' certain short peptide sequences in naturally occurring proteins with their corresponding 'inverted' peptides and generate 'artificial' proteins that are predicted to retain native-like protein fold. The analysis of 3,967 representative proteins from the Protein Data Bank revealed 102,677 unique identical inverted peptide sequence pairs that vary in sequence length between 5-12 and 18 amino acid residues. Our analysis illustrates with examples that such 'artificial' proteins may be generated by identifying peptides with 'similar structural environment' and by using comparative protein modeling and validation studies. Our analysis suggests that natural proteins may be tolerant to accommodating such peptides.
Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F
2015-10-01
The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.
Issotta, Francisco; Galleguillos, Pedro A; Moya-Beltrán, Ana; Davis-Belmar, Carol S; Rautenbach, George; Covarrubias, Paulo C; Acosta, Mauricio; Ossandon, Francisco J; Contador, Yasna; Holmes, David S; Marín-Eliantonio, Sabrina; Quatrini, Raquel; Demergasso, Cecilia
2016-01-01
Leptospirillum ferriphilum Sp-Cl is a Gram negative, thermotolerant, curved, rod-shaped bacterium, isolated from an industrial bioleaching operation in northern Chile, where chalcocite is the major copper mineral and copper hydroxychloride atacamite is present in variable proportions in the ore. This strain has unique features as compared to the other members of the species, namely resistance to elevated concentrations of chloride, sulfate and metals. Basic microbiological features and genomic properties of this biotechnologically relevant strain are described in this work. The 2,475,669 bp draft genome is arranged into 74 scaffolds of 74 contigs. A total of 48 RNA genes and 2,834 protein coding genes were predicted from its annotation; 55 % of these were assigned a putative function. Release of the genome sequence of this strain will provide further understanding of the mechanisms used by acidophilic bacteria to endure high osmotic stress and high chloride levels and of the role of chloride-tolerant iron-oxidizers in industrial bioleaching operations.
Chen, Huatao; He, Hui; Yu, Deyue
2011-01-01
Salt is an important factor affecting the growth and development of soybean in saline soil. In this study, a novel soybean gene encoding a transporter (GmHKT1) was identified and its function analyzed using transgenic plants. GmHKT1 encoded a protein of 419 amino acids, with a potential molecular mass of 47.06 kDa and a predicted pI value of 8.59. Comparison of the genomic and cDNA sequences of GmHKT1 identified no intron. The deduced amino acid sequence of GmHKT1 showed 38-49% identity with other plant HKT-like sequences. RT-PCR analysis showed that the expression of GmHKT1 was upregulated by salt stress (150 mM NaCl) in roots and leaves but not in stems. Overexpression of GmHKT1 significantly enhanced the tolerance of transgenic tobacco plants to salt stress, compared with non-transgenic plants. To investigate the role of GmHKT1 in K(+) and Na(+) transport, we compared K(+) and Na(+) accumulation in roots and shoots of wild-type and transgenic tobacco plants. The results suggested that GmHKT1 is a transporter that affected K(+) and Na(+) transport in roots and shoots, and regulated Na(+) /K(+) homeostasis in these organs. Our findings suggest that GmHKT1 plays an important role in response to salt stress and would be useful in engineering crop plants for enhanced tolerance to salt stress. Copyright © Physiologia Plantarum 2010.
Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H
2013-11-18
Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.
Katiyar, Amit; Smita, Shuchi; Muthusamy, Senthilkumar K.; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.
2015-01-01
Small non-coding RNAs (sRNAs) namely microRNAs (miRNAs) and trans-acting small interfering RNAs (tasi-RNAs) play a crucial role in post-transcriptional regulation of gene expression and thus the control plant development and stress responses. In order to identify drought-responsive miRNAs and tasi-RNAs in sorghum, we constructed small RNA libraries from a drought tolerant (M35-1) and susceptible (C43) sorghum genotypes grown under control and drought stress conditions, and sequenced by Illumina Genome Analyzer IIx. Ninety seven conserved and 526 novel miRNAs representing 472 unique miRNA families were identified from sorghum. Ninety-six unique miRNAs were found to be regulated by drought stress, of which 32 were up- and 49 were down-regulated (fold change ≥ 2 or ≤ −2) at least in one genotype, while the remaining 15 miRNAs showed contrasting drought-regulated expression pattern between genotypes. A maximum of 17 and 18 miRNAs was differentially regulated under drought stress condition in the sensitive and tolerant genotypes, respectively. These results suggest that genotype dependent stress responsive regulation of miRNAs may contribute, at least in part, to the differential drought tolerance of sorghum genotypes. We also identified two miR390-directed TAS3 gene homologs and the auxin response factors as tasi-RNA targets. We predicted more than 1300 unique target genes for the novel and conserved miRNAs. These target genes were predicted to be involved in different cellular, metabolic, response to stimulus, biological regulation, and developmental processes. Genome-wide identification of stress-responsive miRNAs, tasi-RNAs and their targets identified in this study will be useful in unraveling the molecular mechanisms underlying drought stress responses and genetic improvement of biomass production and stress tolerance in sorghum. PMID:26236318
Wiel, Laurens; Venselaar, Hanka; Veltman, Joris A.; Vriend, Gert
2017-01-01
Abstract Whole exomes of patients with a genetic disorder are nowadays routinely sequenced but interpretation of the identified genetic variants remains a major challenge. The increased availability of population‐based human genetic variation has given rise to measures of genetic tolerance that have been used, for example, to predict disease‐causing genes in neurodevelopmental disorders. Here, we investigated whether combining variant information from homologous protein domains can improve variant interpretation. For this purpose, we developed a framework that maps population variation and known pathogenic mutations onto 2,750 “meta‐domains.” These meta‐domains consist of 30,853 homologous Pfam protein domain instances that cover 36% of all human protein coding sequences. We find that genetic tolerance is consistent across protein domain homologues, and that patterns of genetic tolerance faithfully mimic patterns of evolutionary conservation. Furthermore, for a significant fraction (68%) of the meta‐domains high‐frequency population variation re‐occurs at the same positions across domain homologues more often than expected. In addition, we observe that the presence of pathogenic missense variants at an aligned homologous domain position is often paired with the absence of population variation and vice versa. The use of these meta‐domains can improve the interpretation of genetic variation. PMID:28815929
Qin, Yu-Xiang; Qin, Fangyuan
2016-02-01
Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Soler, Miguel A; de Marco, Ario; Fortuna, Sara
2016-10-10
Nanobodies (VHHs) have proved to be valuable substitutes of conventional antibodies for molecular recognition. Their small size represents a precious advantage for rational mutagenesis based on modelling. Here we address the problem of predicting how Camelidae nanobody sequences can tolerate mutations by developing a simulation protocol based on all-atom molecular dynamics and whole-molecule docking. The method was tested on two sets of nanobodies characterized experimentally for their biophysical features. One set contained point mutations introduced to humanize a wild type sequence, in the second the CDRs were swapped between single-domain frameworks with Camelidae and human hallmarks. The method resulted in accurate scoring approaches to predict experimental yields and enabled to identify the structural modifications induced by mutations. This work is a promising tool for the in silico development of single-domain antibodies and opens the opportunity to customize single functional domains of larger macromolecules.
NASA Astrophysics Data System (ADS)
Soler, Miguel A.; De Marco, Ario; Fortuna, Sara
2016-10-01
Nanobodies (VHHs) have proved to be valuable substitutes of conventional antibodies for molecular recognition. Their small size represents a precious advantage for rational mutagenesis based on modelling. Here we address the problem of predicting how Camelidae nanobody sequences can tolerate mutations by developing a simulation protocol based on all-atom molecular dynamics and whole-molecule docking. The method was tested on two sets of nanobodies characterized experimentally for their biophysical features. One set contained point mutations introduced to humanize a wild type sequence, in the second the CDRs were swapped between single-domain frameworks with Camelidae and human hallmarks. The method resulted in accurate scoring approaches to predict experimental yields and enabled to identify the structural modifications induced by mutations. This work is a promising tool for the in silico development of single-domain antibodies and opens the opportunity to customize single functional domains of larger macromolecules.
2013-01-01
Background Chrysanthemum is one of the most important ornamental crops in the world and drought stress seriously limits its production and distribution. In order to generate a functional genomics resource and obtain a deeper understanding of the molecular mechanisms regarding chrysanthemum responses to dehydration stress, we performed large-scale transcriptome sequencing of chrysanthemum plants under dehydration stress using the Illumina sequencing technology. Results Two cDNA libraries constructed from mRNAs of control and dehydration-treated seedlings were sequenced by Illumina technology. A total of more than 100 million reads were generated and de novo assembled into 98,180 unique transcripts which were further extensively annotated by comparing their sequencing to different protein databases. Biochemical pathways were predicted from these transcript sequences. Furthermore, we performed gene expression profiling analysis upon dehydration treatment in chrysanthemum and identified 8,558 dehydration-responsive unique transcripts, including 307 transcription factors and 229 protein kinases and many well-known stress responsive genes. Gene ontology (GO) term enrichment and biochemical pathway analyses showed that dehydration stress caused changes in hormone response, secondary and amino acid metabolism, and light and photoperiod response. These findings suggest that drought tolerance of chrysanthemum plants may be related to the regulation of hormone biosynthesis and signaling, reduction of oxidative damage, stabilization of cell proteins and structures, and maintenance of energy and carbon supply. Conclusions Our transcriptome sequences can provide a valuable resource for chrysanthemum breeding and research and novel insights into chrysanthemum responses to dehydration stress and offer candidate genes or markers that can be used to guide future studies attempting to breed drought tolerant chrysanthemum cultivars. PMID:24074255
Developing Rice with High Yield under Phosphorus Deficiency: Pup1 Sequence to Application1[W][OA
Chin, Joong Hyoun; Gamuyao, Rico; Dalid, Cheryl; Bustamam, Masdiar; Prasetiyono, Joko; Moeljopawiro, Sugiono; Wissuwa, Matthias; Heuer, Sigrid
2011-01-01
The major quantitative trait locus (QTL) Phosphorus uptake1 (Pup1) confers tolerance of phosphorus deficiency in soil and is currently one of the most promising QTLs for the development of tolerant rice (Oryza sativa) varieties. To facilitate targeted introgression of Pup1 into intolerant varieties, the gene models predicted in the Pup1 region in the donor variety Kasalath were used to develop gene-based molecular markers that are evenly distributed over the fine-mapped 278-kb QTL region. To validate the gene models and optimize the markers, gene expression analyses and partial allelic sequencing were conducted. The markers were tested in more than 80 diverse rice accessions revealing three main groups with different Pup1 allele constitution. Accessions with tolerant (group I) and intolerant (group III) Pup1 alleles were distinguished from genotypes with Kasalath alleles at some of the analyzed loci (partial Pup1; group II). A germplasm survey additionally confirmed earlier data showing that Pup1 is largely absent from irrigated rice varieties but conserved in varieties and breeding lines adapted to drought-prone environments. A core set of Pup1 markers has been defined, and sequence polymorphisms suitable for single-nucleotide polymorphism marker development for high-throughput genotyping were identified. Following a marker-assisted backcrossing approach, Pup1 was introgressed into two irrigated rice varieties and three Indonesian upland varieties. First phenotypic evaluations of the introgression lines suggest that Pup1 is effective in different genetic backgrounds and environments and that it has the potential to significantly enhance grain yield under field conditions. PMID:21602323
Chen, Chengjie; Zhang, Yafeng; Xu, Zhiqiang; Luan, Aiping; Mao, Qi; Feng, Junting; Xie, Tao; Gong, Xue; Wang, Xiaoshuang; Chen, Hao; He, Yehua
2016-01-01
The pineapple (Ananas comosus) is cold sensitive. Most cultivars are injured during winter periods, especially in sub-tropical regions. There is a lack of molecular information on the pineapple’s response to cold stress. In this study, high-throughput transcriptome sequencing and gene expression analysis were performed on plantlets of a cold-tolerant genotype of the pineapple cultivar ‘Shenwan’ before and after cold treatment. A total of 1,186 candidate cold responsive genes were identified, and their credibility was confirmed by RT-qPCR. Gene set functional enrichment analysis indicated that genes related to cell wall properties, stomatal closure and ABA and ROS signal transduction play important roles in pineapple cold tolerance. In addition, a protein association network of CORs (cold responsive genes) was predicted, which could serve as an entry point to dissect the complex cold response network. Our study found a series of candidate genes and their association network, which will be helpful to cold stress response studies and pineapple breeding for cold tolerance. PMID:27656892
Draft genome sequence of pigeonpea (Cajanus cajan), an orphan legume crop of resource-poor farmers.
Varshney, Rajeev K; Chen, Wenbin; Li, Yupeng; Bharti, Arvind K; Saxena, Rachit K; Schlueter, Jessica A; Donoghue, Mark T A; Azam, Sarwar; Fan, Guangyi; Whaley, Adam M; Farmer, Andrew D; Sheridan, Jaime; Iwata, Aiko; Tuteja, Reetu; Penmetsa, R Varma; Wu, Wei; Upadhyaya, Hari D; Yang, Shiaw-Pyng; Shah, Trushar; Saxena, K B; Michael, Todd; McCombie, W Richard; Yang, Bicheng; Zhang, Gengyun; Yang, Huanming; Wang, Jun; Spillane, Charles; Cook, Douglas R; May, Gregory D; Xu, Xun; Jackson, Scott A
2011-11-06
Pigeonpea is an important legume food crop grown primarily by smallholder farmers in many semi-arid tropical regions of the world. We used the Illumina next-generation sequencing platform to generate 237.2 Gb of sequence, which along with Sanger-based bacterial artificial chromosome end sequences and a genetic map, we assembled into scaffolds representing 72.7% (605.78 Mb) of the 833.07 Mb pigeonpea genome. Genome analysis predicted 48,680 genes for pigeonpea and also showed the potential role that certain gene families, for example, drought tolerance-related genes, have played throughout the domestication of pigeonpea and the evolution of its ancestors. Although we found a few segmental duplication events, we did not observe the recent genome-wide duplication events observed in soybean. This reference genome sequence will facilitate the identification of the genetic basis of agronomically important traits, and accelerate the development of improved pigeonpea varieties that could improve food security in many developing countries.
Sun, Yepeng; Wang, Fawei; Wang, Nan; Dong, Yuanyuan; Liu, Qi; Zhao, Lei; Chen, Huan; Liu, Weican; Yin, Hailong; Zhang, Xiaomei; Yuan, Yanxi; Li, Haiyan
2013-01-01
Background Leymus chinensis (Trin.) Tzvel. is a high saline-alkaline tolerant forage grass genus of the tribe Gramineae family, which also plays an important role in protection of natural environment. To date, little is known about the saline-alkaline tolerance of L. chinensis on the molecular level. To better understand the molecular mechanism of saline-alkaline tolerance in L. chinensis, 454 pyrosequencing was used for the transcriptome study. Results We used Roche-454 massive parallel pyrosequencing technology to sequence two different cDNA libraries that were built from the two samples of control and under saline-alkaline treatment (optimal stress concentration-Hoagland solution with 100 mM NaCl and 200 mM NaHCO3). A total of 363,734 reads in control group and 526,267 reads in treatment group with an average length of 489 bp and 493 bp were obtained, respectively. The reads were assembled into 104,105 unigenes with MIRA sequence assemable software, among which, 73,665 unigenes were in control group, 88,016 unigenes in treatment group and 57,576 unigenes in both groups. According to the comparative expression analysis between the two groups with the threshold of “log2 Ratio ≥1”, there were 36,497 up-regulated unegenes and 18,218 down-regulated unigenes predicted to be the differentially expressed genes. After gene annotation and pathway enrichment analysis, most of them were involved in stress and tolerant function, signal transduction, energy production and conversion, and inorganic ion transport. Furthermore, 16 of these differentially expressed genes were selected for real-time PCR validation, and they were successfully confirmed with the results of 454 pyrosequencing. Conclusions This work is the first time to study the transcriptome of L. chinensis under saline-alkaline treatment based on the 454-FLX massively parallel DNA sequencing platform. It also deepened studies on molecular mechanisms of saline-alkaline in L. chinensis, and constituted a database for future studies. PMID:23365637
Vatansever, Recep; Ozyigit, Ibrahim Ilker; Filiz, Ertugrul; Gozukirmizi, Nermin
2017-04-01
Silicon (Si) is a nonessential, beneficial micronutrient for plants. It increases the plant stress tolerance in relation to its accumulation capacity. In this work, root Si transporter genes were characterized in 17 different plants and inferred for their Si-accumulation status. A total of 62 Si transporter genes (31 Lsi1 and 31 Lsi2) were identified in studied plants. Lsi1s were 261-324 residues protein with a MIP family domain whereas Lsi2s were 472-547 residues with a citrate transporter family domain. Lsi1s possessed characteristic sequence features that can be employed as benchmark in prediction of Si-accumulation status/capacity of the plants. Silicic acid selectivity in Lsi1s was associated with two highly conserved NPA (Asn-Pro-Ala) motifs and a Gly-Ser-Gly-Arg (GSGR) ar/R filter. Two NPA regions were present in all Lsi1 members but some Ala substituted with Ser or Val. GSGR filter was only available in the proposed high and moderate Si accumulators. In phylogeny, Lsi1s formed three clusters as low, moderate and high Si accumulators based on tree topology and availability of GSGR filter. Low-accumulators contained filters WIGR, AIGR, FAAR, WVAR and AVAR, high-accumulators only with GSGR filter, and moderate-accumulators mostly with GSGR but some with A/CSGR filters. A positive correlation was also available between sequence homology and Si-accumulation status of the tested plants. Thus, availability of GSGR selectivity filter and sequence homology degree could be used as signatures in prediction of Si-accumulation status in experimentally uncharacterized plants. Moreover, interaction partner and expression profile analyses implicated the involvement of Si transporters in plant stress tolerance.
Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.
2011-01-01
Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xi, T; Jones, I M; Mohrenweiser, H W
2003-11-03
Over 520 different amino acid substitution variants have been previously identified in the systematic screening of 91 human DNA repair genes for sequence variation. Two algorithms were employed to predict the impact of these amino acid substitutions on protein activity. Sorting Intolerant From Tolerant (SIFT) classified 226 of 508 variants (44%) as ''Intolerant''. Polymorphism Phenotyping (PolyPhen) classed 165 of 489 amino acid substitutions (34%) as ''Probably or Possibly Damaging''. Another 9-15% of the variants were classed as ''Potentially Intolerant or Damaging''. The results from the two algorithms are highly associated, with concordance in predicted impact observed for {approx}62% of themore » variants. Twenty one to thirty one percent of the variant proteins are predicted to exhibit reduced activity by both algorithms. These variants occur at slightly lower individual allele frequency than do the variants classified as ''Tolerant'' or ''Benign''. Both algorithms correctly predicted the impact of 26 functionally characterized amino acid substitutions in the APE1 protein on biochemical activity, with one exception. It is concluded that a substantial fraction of the missense variants observed in the general human population are functionally relevant. These variants are expected to be the molecular genetic and biochemical basis for the associations of reduced DNA repair capacity phenotypes with elevated cancer risk.« less
Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.
Schmidt, Mariane; Priemé, Anders; Stougaard, Peter
2006-12-01
Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.
Oakenfull, Rachael J.; Baxter, Robert; Knight, Marc R.
2013-01-01
Freezing stress affects all plants from temperate zones to the poles. Global climate change means such freezing events are becoming less predictable. This in turn reduces the ability of plants to predict the approaching low temperatures and cold acclimate. This has consequences for crop yields and distribution of wild plant species. C-repeat binding factors (CBFs) are transcription factors previously shown to play a vital role in the acclimation process of Arabidopsis thaliana, controlling the expression of hundreds of genes whose products are necessary for freezing tolerance. Work in other plant species cements CBFs as key determinants in the trait of freezing tolerance in higher plants. To test the function of CBFs from highly freezing tolerant plants species we cloned and sequenced CBF transcription factors from three Vaccinium species (Vaccinium myrtillus, Vaccinium uliginosum and Vaccinium vitis-idaea) which we collected in the Arctic. We tested the activity of CBF transcription factors from the three Vaccinium species by producing transgenic Arabidopsis lines overexpressing them. Only the Vaccinium myrtillus CBF was able to substantially activate COR (CBF-target) gene expression in the absence of cold. Correspondingly, only the lines expressing the Vaccinium myrtillus CBF were constitutively freezing tolerant. The basis for the differences in potency of the three Vaccinium CBFs was tested by observing cellular localisation and protein levels. All three CBFs were correctly targeted to the nucleus, but Vaccinium uliginosum CBF appeared to be relatively unstable. The reasons for lack of potency for Vaccinium vitis-idaea CBF were not due to stability or targeting, and we speculate that this was due to altered transcription factor function. PMID:23349799
Ali, Zulfiqar; Zhang, Da Yong; Xu, Zhao Long; Xu, Ling; Yi, Jin Xin; He, Xiao Lan; Huang, Yi Hong; Liu, Xiao Qing; Khan, Asif Ali; Trethowan, Richard M.; Ma, Hong Xiang
2012-01-01
Soil salinity has very adverse effects on growth and yield of crop plants. Several salt tolerant wild accessions and cultivars are reported in soybean. Functional genomes of salt tolerant Glycine soja and a salt sensitive genotype of Glycine max were investigated to understand the mechanism of salt tolerance in soybean. For this purpose, four libraries were constructed for Tag sequencing on Illumina platform. We identify around 490 salt responsive genes which included a number of transcription factors, signaling proteins, translation factors and structural genes like transporters, multidrug resistance proteins, antiporters, chaperons, aquaporins etc. The gene expression levels and ratio of up/down-regulated genes was greater in tolerant plants. Translation related genes remained stable or showed slightly higher expression in tolerant plants under salinity stress. Further analyses of sequenced data and the annotations for gene ontology and pathways indicated that soybean adapts to salt stress through ABA biosynthesis and regulation of translation and signal transduction of structural genes. Manipulation of these pathways may mitigate the effect of salt stress thus enhancing salt tolerance. PMID:23209559
Vipsita, Swati; Rath, Santanu Kumar
2015-01-01
Protein superfamily classification deals with the problem of predicting the family membership of newly discovered amino acid sequence. Although many trivial alignment methods are already developed by previous researchers, but the present trend demands the application of computational intelligent techniques. As there is an exponential growth in size of biological database, retrieval and inference of essential knowledge in the biological domain become a very cumbersome task. This problem can be easily handled using intelligent techniques due to their ability of tolerance for imprecision, uncertainty, approximate reasoning, and partial truth. This paper discusses the various global and local features extracted from full length protein sequence which are used for the approximation and generalisation of the classifier. The various parameters used for evaluating the performance of the classifiers are also discussed. Therefore, this review article can show right directions to the present researchers to make an improvement over the existing methods.
Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun
2017-01-01
The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p < 0.001) enhanced cold tolerance relative to those harboring a premature stop codon (PMSC) in this gene. Similarly, isolates possessing a plasmid demonstrated significantly (p = 0.013) enhanced acid tolerance. We also identified nine new L. monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased sequencing of L. monocytogenes isolates in combination with stress tolerance profiling, will enhance the ability to identify genetic elements associated with higher risk strains. PMID:28337186
Yang, Yumei; Luo, Zhu; Zhang, Mengru; Liu, Chang; Gong, Ming; Zou, Zhurong
2016-04-01
H(+)-pyrophosphatase (H(+)-PPase) is a primary pyrophosphate (PPi)-energized proton pump to generate electrochemical H(+) gradient for ATP production and substance translocations across membranes. It plays an important role in stress adaptation that was intensively substantiated by numerous transgenic plants overexpressing H(+)-PPases yet devoid of any correlated studies pointing to the elite energy plant, Jatropha curcas. Herein, we cloned the full length of J. curcas H(+)-PPase (JcVP1) complementary DNA (cDNA) by reverse transcription PCR, based on the assembled sequence of its ESTs highly matched to Hevea brasiliensis H(+)-PPase. This gene encodes a polypeptide of 765 amino acids that was predicted as a K(+)-dependent H(+)-PPase evolutionarily closest to those of other Euphorbiaceae plants. Many cis-regulatory elements relevant to environmental stresses, molecular signals, or tissue-specificity were identified by promoter prediction within the 1.5-kb region upstream of JcVP1 coding sequence. Meanwhile, the responses of JcVP1 expression to several common abiotic stresses (salt, drought, heat, cold) were characterized with a considerable accordance with the inherent stress tolerance of J. curcas. Moreover, we found that the heterologous expression of JcVP1 could significantly improve the salt tolerance in both recombinant Escherichia coli and Saccharomyces cerevisiae, and this effect could be further fortified in yeast by N-terminal addition of a vacuole-targeting signal peptide from the H(+)-PPase of Trypanosoma cruzi.
2014-01-01
Background Syntrichia caninervis is a desiccation-tolerant moss and the dominant bryophyte of the Biological Soil Crusts (BSCs) found in the Mojave and Gurbantunggut deserts. Next generation high throughput sequencing technologies offer an efficient and economic choice for characterizing non-model organism transcriptomes with little or no prior molecular information available. Results In this study, we employed next generation, high-throughput, Illumina RNA-Seq to analyze the poly-(A) + mRNA from hydrated, dehydrating and desiccated S. caninervis gametophores. Approximately 58.0 million paired-end short reads were obtained and 92,240 unigenes were assembled with an average size of 493 bp, N50 value of 662 bp and a total size of 45.48 Mbp. Sequence similarity searches against five public databases (NR, Swiss-Prot, COSMOSS, KEGG and COG) found 54,125 unigenes (58.7%) with significant similarity to an existing sequence (E-value ≤ 1e-5) and could be annotated. Gene Ontology (GO) annotation assigned 24,183 unigenes to the three GO terms: Biological Process, Cellular Component or Molecular Function. GO comparison between P. patens and S. caninervis demonstrated similar sequence enrichment across all three GO categories. 29,370 deduced polypeptide sequences were assigned Pfam domain information and categorized into 4,212 Pfam domains/families. Using the PlantTFDB, 778 unigenes were predicted to be involved in the regulation of transcription and were classified into 49 transcription factor families. Annotated unigenes were mapped to the KEGG pathways and further annotated using MapMan. Comparative genomics revealed that 44% of protein families are shared in common by S. caninervis, P. patens and Arabidopsis thaliana and that 80% are shared by both moss species. Conclusions This study is one of the first comprehensive transcriptome analyses of the moss S. caninervis. Our data extends our knowledge of bryophyte transcriptomes, provides an insight to plants adapted to the arid regions of central Asia, and continues the development of S. caninervis as a model for understanding the molecular aspects of desiccation-tolerance. PMID:25086984
Gacesa, Ranko; Taketani, Rodrigo Gouvêa; Long, Paul F.; Melo, Itamar Soares
2015-01-01
The genome sequence of the first Streptomyces species isolated from the Brazilian Caatinga is reported here. Genes related to environmental stress tolerance were prevalent and included many secondary metabolic gene clusters. PMID:26358601
Phenotypic and phylogenetic characterization of ruminal tannin-tolerant bacteria.
Nelson, K E; Thonney, M L; Woolston, T K; Zinder, S H; Pell, A N
1998-10-01
The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed.
Phenotypic and Phylogenetic Characterization of Ruminal Tannin-Tolerant Bacteria
Nelson, Karen E.; Thonney, Michael L.; Woolston, Tina K.; Zinder, Stephen H.; Pell, Alice N.
1998-01-01
The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed. PMID:9758806
Ollikainen, Noah; de Jong, René M; Kortemme, Tanja
2015-01-01
Interactions between small molecules and proteins play critical roles in regulating and facilitating diverse biological functions, yet our ability to accurately re-engineer the specificity of these interactions using computational approaches has been limited. One main difficulty, in addition to inaccuracies in energy functions, is the exquisite sensitivity of protein-ligand interactions to subtle conformational changes, coupled with the computational problem of sampling the large conformational search space of degrees of freedom of ligands, amino acid side chains, and the protein backbone. Here, we describe two benchmarks for evaluating the accuracy of computational approaches for re-engineering protein-ligand interactions: (i) prediction of enzyme specificity altering mutations and (ii) prediction of sequence tolerance in ligand binding sites. After finding that current state-of-the-art "fixed backbone" design methods perform poorly on these tests, we develop a new "coupled moves" design method in the program Rosetta that couples changes to protein sequence with alterations in both protein side-chain and protein backbone conformations, and allows for changes in ligand rigid-body and torsion degrees of freedom. We show significantly increased accuracy in both predicting ligand specificity altering mutations and binding site sequences. These methodological improvements should be useful for many applications of protein-ligand design. The approach also provides insights into the role of subtle conformational adjustments that enable functional changes not only in engineering applications but also in natural protein evolution.
The Evolution of Sulfide Tolerance in the Cyanobacteria
NASA Technical Reports Server (NTRS)
Miller, Scott R.; Bebout, Brad M.; DeVincenzi, Donald L. (Technical Monitor)
2000-01-01
Understanding how the function of extant microorganisms has recorded both their evolutionary histories and their past interactions with the environment is a stated goal of astrobiology. We are taking a multidisciplinary approach to investigate the diversification of sulfide tolerance mechanisms in the cyanobacteria, which vary both in their degree of exposure to sulfide and in their capacity to tolerate this inhibitor of photosynthetic electron transport. Since conditions were very reducing during the first part of Earth's history and detrital sulfides have been found in Archean sediments, mechanisms conferring sulfide tolerance may have been important for the evolutionary success of the ancestors of extant cyanobacteria. Two tolerance mechanisms have been identified in this group: (1) resistance of photosystem II, the principal target of sulfide toxicity; and (2) maintenance of the ability to fix carbon despite photosystem II inhibition by utilizing sulfide as an electron donor in photosystem I - dependent, anoxygenic photosynthesis. We are presently collecting comparative data on aspects of sulfide physiology for laboratory clones isolated from a variety of habitats. These data will be analyzed within a phylogenetic framework inferred from molecular sequence data collected for these clones to test how frequently different mechanisms of tolerance have evolved and which tolerance mechanism evolved first. In addition, by analyzing these physiological data together with environmental sulfide data collected from our research sites using microelectrodes, we can also test whether the breadth of an organism's sulfide tolerance can be predicted from the magnitude of variation in environmental sulfide concentration it has experienced in its recent evolutionary past and whether greater average sulfide concentration and/or temporal variability in sulfide favors the evolution of a particular mechanism of sulfide tolerance.
Tsukagoshi, Hironaka; Suzuki, Takamasa; Nishikawa, Kouki; Agarie, Sakae; Ishiguro, Sumie; Higashiyama, Tetsuya
2015-01-01
Understanding the molecular mechanisms that convey salt tolerance in plants is a crucial issue for increasing crop yield. The ice plant (Mesembryanthemum crystallinum) is a halophyte that is capable of growing under high salt conditions. For example, the roots of ice plant seedlings continue to grow in 140 mM NaCl, a salt concentration that completely inhibits Arabidopsis thaliana root growth. Identifying the molecular mechanisms responsible for this high level of salt tolerance in a halophyte has the potential of revealing tolerance mechanisms that have been evolutionarily successful. In the present study, deep sequencing (RNAseq) was used to examine gene expression in ice plant roots treated with various concentrations of NaCl. Sequencing resulted in the identification of 53,516 contigs, 10,818 of which were orthologs of Arabidopsis genes. In addition to the expression analysis, a web-based ice plant database was constructed that allows broad public access to the data. The results obtained from an analysis of the RNAseq data were confirmed by RT-qPCR. Novel patterns of gene expression in response to high salinity within 24 hours were identified in the ice plant when the RNAseq data from the ice plant was compared to gene expression data obtained from Arabidopsis plants exposed to high salt. Although ABA responsive genes and a sodium transporter protein (HKT1), are up-regulated and down-regulated respectively in both Arabidopsis and the ice plant; peroxidase genes exhibit opposite responses. The results of this study provide an important first step towards analyzing environmental tolerance mechanisms in a non-model organism and provide a useful dataset for predicting novel gene functions. PMID:25706745
Suppression of a NAC-like transcription factor gene improves boron-toxicity tolerance in rice.
Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru
2011-07-01
We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity.
Suppression of a NAC-Like Transcription Factor Gene Improves Boron-Toxicity Tolerance in Rice1
Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru
2011-01-01
We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity. PMID:21543724
Santos, Suikinai Nobre; Gacesa, Ranko; Taketani, Rodrigo Gouvêa; Long, Paul F; Melo, Itamar Soares
2015-09-10
The genome sequence of the first Streptomyces species isolated from the Brazilian Caatinga is reported here. Genes related to environmental stress tolerance were prevalent and included many secondary metabolic gene clusters. Copyright © 2015 Santos et al.
Recombinant yeast with improved ethanol tolerance and related methods of use
Gasch, Audrey P [Madison, WI; Lewis, Jeffrey A [Madison, WI
2012-05-15
The present invention provides isolated Elo1 and Mig3 nucleic acid sequences capable of conferring increased ethanol tolerance on recombinant yeast and methods of using same in biofuel production, particularly ethanol production. Methods of bioengineering yeast using the Elo1 and, or, Mig3 nucleic acid sequences are also provided.
Vandenberghe, Nadia; Vallet, Anne-Evelyne; Petitjean, Thierry; Le Cam, Pierre; Peysson, Stéphane; Guérin, Claude; Dailler, Frédéric; Jay, Sylvie; Cadiergue, Vincent; Bouhour, Françoise; Court-Fortune, Isabelle; Camdessanche, Jean-Philippe; Antoine, Jean-Christophe; Philit, François; Beuret, Pascal; Bin-Dorel, Sylvie; Vial, Christophe; Broussolle, Emmanuel
2013-09-01
To assess factors that predict good tolerance of noninvasive ventilation (NIV), in order to improve survival and quality of life in subjects with amyotrophic lateral sclerosis. We conducted a prospective study in subjects with amyotrophic lateral sclerosis and requiring NIV. The primary end point was NIV tolerance at 1 month. Subjects, several of whom failed to complete the study, were classified as "tolerant" or "poorly tolerant," according to the number of hours of NIV use (more or less than 4 h per night, respectively). Eighty-one subjects, 73 of whom also attended the 1-month follow-up visit, participated over 34 months. NIV tolerance after the first day of utilization predicted tolerance at 1 month (77.6% and 75.3% of subjects, respectively). Multivariate analysis disclosed 3 factors predicting good NIV tolerance: absence of airway secretions accumulation prior to NIV onset (odds ratio 11.5); normal bulbar function at initiation of NIV (odds ratio 8.5); and older age (weakly significant, odds ratio 1.1). Our study reveals 3 factors that are predictive of good NIV tolerance, in particular the absence of airway secretion accumulation, which should prompt NIV initiation before its appearance.
Ma, Yazhen; Xu, Ting; Wan, Dongshi; Ma, Tao; Shi, Sheng; Liu, Jianquan; Hu, Quanjun
2015-03-17
Soil salinity is a significant factor that impairs plant growth and agricultural productivity, and numerous efforts are underway to enhance salt tolerance of economically important plants. Populus species are widely cultivated for diverse uses. Especially, they grow in different habitats, from salty soil to mesophytic environment, and are therefore used as a model genus for elucidating physiological and molecular mechanisms of stress tolerance in woody plants. The Salinity Tolerant Poplar Database (STPD) is an integrative database for salt-tolerant poplar genome biology. Currently the STPD contains Populus euphratica genome and its related genetic resources. P. euphratica, with a preference of the salty habitats, has become a valuable genetic resource for the exploitation of tolerance characteristics in trees. This database contains curated data including genomic sequence, genes and gene functional information, non-coding RNA sequences, transposable elements, simple sequence repeats and single nucleotide polymorphisms information of P. euphratica, gene expression data between P. euphratica and Populus tomentosa, and whole-genome alignments between Populus trichocarpa, P. euphratica and Salix suchowensis. The STPD provides useful searching and data mining tools, including GBrowse genome browser, BLAST servers and genome alignments viewer, which can be used to browse genome regions, identify similar sequences and visualize genome alignments. Datasets within the STPD can also be downloaded to perform local searches. A new Salinity Tolerant Poplar Database has been developed to assist studies of salt tolerance in trees and poplar genomics. The database will be continuously updated to incorporate new genome-wide data of related poplar species. This database will serve as an infrastructure for researches on the molecular function of genes, comparative genomics, and evolution in closely related species as well as promote advances in molecular breeding within Populus. The STPD can be accessed at http://me.lzu.edu.cn/stpd/ .
40 CFR 264.97 - General ground-water monitoring requirements.
Code of Federal Regulations, 2012 CFR
2012-07-01
... background median levels for each constituent. (3) A tolerance or prediction interval procedure in which an... each constituent in each compliance well is compared to the upper tolerance or prediction limit. (4) A... must be maintained. This performance standard does not apply to tolerance intervals, prediction...
NASA Technical Reports Server (NTRS)
Coats, Timothy W.; Harris, Charles E.
1995-01-01
The durability and damage tolerance of laminated composites are critical design considerations for airframe composite structures. Therefore, the ability to model damage initiation and growth and predict the life of laminated composites is necessary to achieve structurally efficient and economical designs. The purpose of this research is to experimentally verify the application of a continuum damage model to predict progressive damage development in a toughened material system. Damage due to monotonic and tension-tension fatigue was documented for IM7/5260 graphite/bismaleimide laminates. Crack density and delamination surface area were used to calculate matrix cracking and delamination internal state variables to predict stiffness loss in unnotched laminates. A damage dependent finite element code predicted the stiffness loss for notched laminates with good agreement to experimental data. It was concluded that the continuum damage model can adequately predict matrix damage progression in notched and unnotched laminates as a function of loading history and laminate stacking sequence.
USDA-ARS?s Scientific Manuscript database
: In this study, we used a diverse panel of alfalfa accessions to identify molecular markers associated with salt tolerance during germination by genome-wide association (GWA) mapping and genotyping-by-sequencing (GBS). Three levels of salt treatments were applied during seed germination. Phenotypic...
Famoso, Adam N.; Zhao, Keyan; Clark, Randy T.; Tung, Chih-Wei; Wright, Mark H.; Bustamante, Carlos; Kochian, Leon V.; McCouch, Susan R.
2011-01-01
Aluminum (Al) toxicity is a primary limitation to crop productivity on acid soils, and rice has been demonstrated to be significantly more Al tolerant than other cereal crops. However, the mechanisms of rice Al tolerance are largely unknown, and no genes underlying natural variation have been reported. We screened 383 diverse rice accessions, conducted a genome-wide association (GWA) study, and conducted QTL mapping in two bi-parental populations using three estimates of Al tolerance based on root growth. Subpopulation structure explained 57% of the phenotypic variation, and the mean Al tolerance in Japonica was twice that of Indica. Forty-eight regions associated with Al tolerance were identified by GWA analysis, most of which were subpopulation-specific. Four of these regions co-localized with a priori candidate genes, and two highly significant regions co-localized with previously identified QTLs. Three regions corresponding to induced Al-sensitive rice mutants (ART1, STAR2, Nrat1) were identified through bi-parental QTL mapping or GWA to be involved in natural variation for Al tolerance. Haplotype analysis around the Nrat1 gene identified susceptible and tolerant haplotypes explaining 40% of the Al tolerance variation within the aus subpopulation, and sequence analysis of Nrat1 identified a trio of non-synonymous mutations predictive of Al sensitivity in our diversity panel. GWA analysis discovered more phenotype–genotype associations and provided higher resolution, but QTL mapping identified critical rare and/or subpopulation-specific alleles not detected by GWA analysis. Mapping using Indica/Japonica populations identified QTLs associated with transgressive variation where alleles from a susceptible aus or indica parent enhanced Al tolerance in a tolerant Japonica background. This work supports the hypothesis that selectively introgressing alleles across subpopulations is an efficient approach for trait enhancement in plant breeding programs and demonstrates the fundamental importance of subpopulation in interpreting and manipulating the genetics of complex traits in rice. PMID:21829395
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bao, Guanhui; University of Chinese Academy of Sciences, Beijing; Dong, Hongjun
Highlights: • Genomes of a butanol tolerant strain and its parent strain were deciphered. • Comparative genomic and proteomic was applied to understand butanol tolerance. • None differentially expressed proteins have mutations in its corresponding genes. • Mutations in ribosome might be responsible for the global difference of proteomics. - Abstract: Clostridium acetobutylicum strain Rh8 is a butanol-tolerant mutant which can tolerate up to 19 g/L butanol, 46% higher than that of its parent strain DSM 1731. We previously performed comparative cytoplasm- and membrane-proteomic analyses to understand the mechanism underlying the improved butanol tolerance of strain Rh8. In this work,more » we further extended this comparison to the genomic level. Compared with the genome of the parent strain DSM 1731, two insertion sites, four deletion sites, and 67 single nucleotide variations (SNVs) are distributed throughout the genome of strain Rh8. Among the 67 SNVs, 16 SNVs are located in the predicted promoters and intergenic regions; while 29 SNVs are located in the coding sequence, affecting a total of 21 proteins involved in transport, cell structure, DNA replication, and protein translation. The remaining 22 SNVs are located in the ribosomal genes, affecting a total of 12 rRNA genes in different operons. Analysis of previous comparative proteomic data indicated that none of the differentially expressed proteins have mutations in its corresponding genes. Rchange Algorithms analysis indicated that the mutations occurred in the ribosomal genes might change the ribosome RNA thermodynamic characteristics, thus affect the translation strength of these proteins. Take together, the improved butanol tolerance of C. acetobutylicum strain Rh8 might be acquired through regulating the translational process to achieve different expression strength of genes involved in butanol tolerance.« less
Genomic Selection Improves Heat Tolerance in Dairy Cattle
Garner, J. B.; Douglas, M. L.; Williams, S. R. O; Wales, W. J.; Marett, L. C.; Nguyen, T. T. T.; Reich, C. M.; Hayes, B. J.
2016-01-01
Dairy products are a key source of valuable proteins and fats for many millions of people worldwide. Dairy cattle are highly susceptible to heat-stress induced decline in milk production, and as the frequency and duration of heat-stress events increases, the long term security of nutrition from dairy products is threatened. Identification of dairy cattle more tolerant of heat stress conditions would be an important progression towards breeding better adapted dairy herds to future climates. Breeding for heat tolerance could be accelerated with genomic selection, using genome wide DNA markers that predict tolerance to heat stress. Here we demonstrate the value of genomic predictions for heat tolerance in cohorts of Holstein cows predicted to be heat tolerant and heat susceptible using controlled-climate chambers simulating a moderate heatwave event. Not only was the heat challenge stimulated decline in milk production less in cows genomically predicted to be heat-tolerant, physiological indicators such as rectal and intra-vaginal temperatures had reduced increases over the 4 day heat challenge. This demonstrates that genomic selection for heat tolerance in dairy cattle is a step towards securing a valuable source of nutrition and improving animal welfare facing a future with predicted increases in heat stress events. PMID:27682591
Sharma, Amit K; Gohel, Sangeeta; Singh, Satya P
2012-01-01
Actinobase is a relational database of molecular diversity, phylogeny and biocatalytic potential of haloalkaliphilic actinomycetes. The main objective of this data base is to provide easy access to range of information, data storage, comparison and analysis apart from reduced data redundancy, data entry, storage, retrieval costs and improve data security. Information related to habitat, cell morphology, Gram reaction, biochemical characterization and molecular features would allow researchers in understanding identification and stress adaptation of the existing and new candidates belonging to salt tolerant alkaliphilic actinomycetes. The PHP front end helps to add nucleotides and protein sequence of reported entries which directly help researchers to obtain the required details. Analysis of the genus wise status of the salt tolerant alkaliphilic actinomycetes indicated 6 different genera among the 40 classified entries of the salt tolerant alkaliphilic actinomycetes. The results represented wide spread occurrence of salt tolerant alkaliphilic actinomycetes belonging to diverse taxonomic positions. Entries and information related to actinomycetes in the database are publicly accessible at http://www.actinobase.in. On clustalW/X multiple sequence alignment of the alkaline protease gene sequences, different clusters emerged among the groups. The narrow search and limit options of the constructed database provided comparable information. The user friendly access to PHP front end facilitates would facilitate addition of sequences of reported entries. The database is available for free at http://www.actinobase.in.
Hezroni, Hadas; Koppstein, David; Schwartz, Matthew G; Avrutin, Alexandra; Bartel, David P; Ulitsky, Igor
2015-05-19
The inability to predict long noncoding RNAs from genomic sequence has impeded the use of comparative genomics for studying their biology. Here, we develop methods that use RNA sequencing (RNA-seq) data to annotate the transcriptomes of 16 vertebrates and the echinoid sea urchin, uncovering thousands of previously unannotated genes, most of which produce long intervening noncoding RNAs (lincRNAs). Although in each species, >70% of lincRNAs cannot be traced to homologs in species that diverged >50 million years ago, thousands of human lincRNAs have homologs with similar expression patterns in other species. These homologs share short, 5'-biased patches of sequence conservation nested in exonic architectures that have been extensively rewired, in part by transposable element exonization. Thus, over a thousand human lincRNAs are likely to have conserved functions in mammals, and hundreds beyond mammals, but those functions require only short patches of specific sequences and can tolerate major changes in gene architecture. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Gupta, A; Morby, A P; Turner, J S; Whitton, B A; Robinson, N J
1993-01-01
Genomic rearrangements involving amplification of metallothionein (MT) genes have been reported in metal-tolerant eukaryotes. Similarly, we have recently observed amplification and rearrangement of a prokaryotic MT locus, smt, in cells of Synechococcus PCC 6301 selected for Cd tolerance. Following the characterization of this locus, the altered smt region has now been isolated from a Cd-tolerant cell line, C3.2, and its nucleotide sequence determined. This has identified a deletion within smtB, which encodes a trans-acting repressor of smt transcription. Two identical palindromic octanucleotides (5'-GCGATC-GC-3') traverse both borders of the excised element. This palindromic sequence is highly represented in the smt locus (7 occurrences in 1326 nucleotides) and analysis of the GenBank/EMBL/DDBJ DNA Nucleotide Sequence Data Libraries reveals that this is a highly iterated palindrome (HIP1) in other known sequences from Synechococcus strains (estimated to occur at an average frequency of once every c. 664 bp). HIP1 is also abundant in the genomes of other cyanobacteria. The functional significance of smtB deletion and the possible role of HIP1 in genome plasticity and adaptation in cyanobacteria are discussed.
Shu, Yongjun; Liu, Ying; Li, Wei; Song, Lili; Zhang, Jun; Guo, Changhong
2016-01-01
Winter damage, especially in northern climates, is a major limitation of the utilization of perennial forages such as alfalfa. Therefore, improving freezing tolerance is imperative in alfalfa genetic breeding. However, freezing tolerance is a complex trait that is determined by many genes. To understand the complex regulation mechanisms of freezing tolerance in alfalfa, we performed small RNA sequencing analysis under cold (4°) and freezing (−8°) stress. The sequencing results revealed that 173 known, and 24 novel miRNAs were expressed, and that the expression of 35 miRNAs was affected by cold and/or freezing stress. Meanwhile, 105 target genes cleaved by these miRNAs were characterized by degradome sequencing. These targets were associated with biological regulation, cellular processes, metabolic processes, and response to stress. Interestingly, most of them were characterized as transcription factors (TFs), including auxin response factors, SBP, NAC, AP2/ERF, and GRF, which play important roles in plant abiotic responses. In addition, important miRNAs and mRNAs involved in nodulation were also identified, for example, the relationship between miR169 and the TF CCAAT (also named as NF-YA/HAP2), which suggested that nodulation has an important function in freezing tolerance in alfalfa. Our results provide valuable information to help determine the molecular mechanisms of freezing tolerance in alfalfa, which will aid the application of these miRNAs and their targets in the improvement of freezing tolerance in alfalfa and related plants. PMID:26801649
Perceived ambiguity as a barrier to intentions to learn genome sequencing results
Taber, Jennifer M.; Klein, William M.P.; Ferrer, Rebecca A.; Han, Paul K. J.; Lewis, Katie L.; Biesecker, Leslie G.; Biesecker, Barbara B.
2015-01-01
Many variants that could be returned from genome sequencing may be perceived as ambiguous—lacking reliability, credibility, or adequacy. Little is known about how perceived ambiguity influences thoughts about sequencing results. Participants (n=494) in an NIH genome sequencing study completed a baseline survey before sequencing results were available. We examined how perceived ambiguity regarding sequencing results and individual differences in medical ambiguity aversion and tolerance for uncertainty were associated with cognitions and intentions concerning sequencing results. Perceiving sequencing results as more ambiguous was associated with less favorable cognitions about results and lower intentions to learn and share results. Among participants low in tolerance for uncertainty or optimism, greater perceived ambiguity was associated with lower intentions to learn results for non-medically actionable diseases; medical ambiguity aversion did not moderate any associations. Results are consistent with the phenomenon of “ambiguity aversion” and may influence whether people learn and communicate genomic information. PMID:26003053
Perceived ambiguity as a barrier to intentions to learn genome sequencing results.
Taber, Jennifer M; Klein, William M P; Ferrer, Rebecca A; Han, Paul K J; Lewis, Katie L; Biesecker, Leslie G; Biesecker, Barbara B
2015-10-01
Many variants that could be returned from genome sequencing may be perceived as ambiguous-lacking reliability, credibility, or adequacy. Little is known about how perceived ambiguity influences thoughts about sequencing results. Participants (n = 494) in an NIH genome sequencing study completed a baseline survey before sequencing results were available. We examined how perceived ambiguity regarding sequencing results and individual differences in medical ambiguity aversion and tolerance for uncertainty were associated with cognitions and intentions concerning sequencing results. Perceiving sequencing results as more ambiguous was associated with less favorable cognitions about results and lower intentions to learn and share results. Among participants low in tolerance for uncertainty or optimism, greater perceived ambiguity was associated with lower intentions to learn results for non-medically actionable diseases; medical ambiguity aversion did not moderate any associations. Results are consistent with the phenomenon of "ambiguity aversion" and may influence whether people learn and communicate genomic information.
Cycle-time determination and process control of sequencing batch membrane bioreactors.
Krampe, J
2013-01-01
In this paper a method to determine the cycle time for sequencing batch membrane bioreactors (SBMBRs) is introduced. One of the advantages of SBMBRs is the simplicity of adapting them to varying wastewater composition. The benefit of this flexibility can only be fully utilised if the cycle times are optimised for the specific inlet load conditions. This requires either proactive and ongoing operator adjustment or active predictive instrument-based control. Determination of the cycle times for conventional sequencing batch reactor (SBR) plants is usually based on experience. Due to the higher mixed liquor suspended solids concentrations in SBMBRs and the limited experience with their application, a new approach to calculate the cycle time had to be developed. Based on results from a semi-technical pilot plant, the paper presents an approach for calculating the cycle time in relation to the influent concentration according to the Activated Sludge Model No. 1 and the German HSG (Hochschulgruppe) Approach. The approach presented in this paper considers the increased solid contents in the reactor and the resultant shortened reaction times. This allows for an exact calculation of the nitrification and denitrification cycles with a tolerance of only a few minutes. Ultimately the same approach can be used for a predictive control strategy and for conventional SBR plants.
NAKANO, KENJI; SATO, YASUYOSHI; TOSHIYASU, TAKASHI; SATO, YUKIKO; INAGAKI, LINA; TOMOMATSU, JUNICHI; SASAKI, TORU; SHIMBASHI, WATARU; FUKUSHIMA, HIROFUMI; YONEKAWA, HIROYUKI; MITANI, HIROKI; KAWABATA, KAZUYOSHI; TAKAHASHI, SHUNJI
2016-01-01
Although high-dose cisplatin is the standard regimen of concurrent chemoradiotherapy (CCRT) for locally advanced head and neck squamous cell carcinoma (HNSCC), varying levels of patient tolerance towards cisplatin have been reported, and the predictive factors of cisplatin tolerance remain to be elucidated. The present study retrospectively reviewed newly diagnosed HNSCC patients who received CCRT. Cisplatin (80 mg/m2) was administered every 3 weeks. The proportion of high-dose cisplatin-tolerant patients (cumulative cisplatin dose, ≥200 mg/m2) was determined, and the predictive factors of cisplatin tolerance were analyzed in a logistic regression analysis. Between June 2006 and March 2013, a total of 159 patients were treated with CCRT. The median follow-up time was 36.7 months. A total of 73 patients (46%) tolerated a cumulative cisplatin dose ≥200 mg/m2; male gender [odds ratio (OR), 25.00; P=0.005] and high body surface area (BSA) (>1.80 m2; OR, 2.21; P=0.032) were significantly predictive of high-dose cisplatin tolerance. The high-dose cisplatin-tolerant patients had a significantly higher complete response (CR) rate (82 vs. 67%, P=0.045); however, there were no significant between-group differences in the 3-year OS (79.5 vs. 81.2%, P=0.59) or PFS (70.4 vs. 44.6%, P=0.076) by cisplatin tolerance. In clinical practice, approximately one-half of the patients tolerated high-dose cisplatin in CCRT. Male gender and high BSA could be predictive of cisplatin tolerance. PMID:26893880
Cania, Barbara; Zadel, Urška; Schöler, Anne; Płaza, Grażyna A.; Schloter, Michael
2017-01-01
ABSTRACT We report here the complete genome sequences of two Pseudomonas putida isolates recovered from surface-sterilized roots of Sida hermaphrodita. The two isolates were characterized by an increased tolerance to zinc, cadmium, and lead. Furthermore, the strains showed typical plant growth-promoting properties, such as the production of indole acetic acid, cellulolytic enzymes, and siderophores. PMID:29167255
Kothari, V V; Kothari, R K; Kothari, C R; Bhatt, V D; Nathani, N M; Koringa, P G; Joshi, C G; Vyas, B R M
2013-09-05
Bacillus safensis strain VK was isolated from the rhizosphere of a cumin plant growing in the saline desert of Radhanpar, Gujarat, India. Here, we provide the 3.68-Mb draft genome sequence of B. safensis VK, which might provide information about the salt tolerance and genes encoding enzymes for the strain's plant growth-promoting potential.
O'Dell, Kaela; Woo, Hannah L.; Utturkar, Sagar M.; ...
2015-05-07
Halomonas sp. strain KO116 was isolated from Nile Delta Mediterranean Sea surface water enriched with insoluble organosolv lignin. It was further screened for growth on alkali lignin minimal salts medium agar. The strain tolerates the ionic liquid 1-ethyl-3-methylimidazolium acetate. Its complete genome sequence is presented in this report.
Feki, Kaouthar; Kamoun, Yosra; Ben Mahmoud, Rihem; Farhat-Khemakhem, Ameny; Gargouri, Ali; Brini, Faiçal
2015-12-01
Catalases are reactive oxygen species scavenging enzymes involved in response to abiotic and biotic stresses. In this study, we described the isolation and functional characterization of a novel catalase from durum wheat, designed TdCAT1. Molecular Phylogeny analyses showed that wheat TdCAT1 exhibited high amino acids sequence identity to other plant catalases. Sequence homology analysis showed that TdCAT1 protein contained the putative calmodulin binding domain and a putative conserved internal peroxisomal targeting signal PTS1 motif around its C-terminus. Predicted three-dimensional structural model revealed the presence of four putative distinct structural regions which are the N-terminal arm, the β-barrel, the wrapping and the α-helical domains. TdCAT1 protein had the heme pocket that was composed by five essential residues. TdCAT1 gene expression analysis showed that this gene was induced by various abiotic stresses in durum wheat. The expression of TdCAT1 in yeast cells and Arabidopsis plants conferred tolerance to several abiotic stresses. Compared with the non-transformed plants, the transgenic lines maintained their growth and accumulated more proline under stress treatments. Furthermore, the amount of H2O2 was lower in transgenic lines, which was due to the high CAT and POD activities. Taken together, these data provide the evidence for the involvement of durum wheat catalase TdCAT1 in tolerance to multiple abiotic stresses in crop plants. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Oldach, Klaus H; Peck, David M; Nair, Ramakrishnan M; Sokolova, Maria; Harris, John; Bogacki, Paul; Ballard, Ross
2014-04-17
The nematode Pratylenchus neglectus has a wide host range and is able to feed on the root systems of cereals, oilseeds, grain and pasture legumes. Under the Mediterranean low rainfall environments of Australia, annual Medicago pasture legumes are used in rotation with cereals to fix atmospheric nitrogen and improve soil parameters. Considerable efforts are being made in breeding programs to improve resistance and tolerance to Pratylenchus neglectus in the major crops wheat and barley, which makes it vital to develop appropriate selection tools in medics. A strong source of tolerance to root damage by the root lesion nematode (RLN) Pratylenchus neglectus had previously been identified in line RH-1 (strand medic, M. littoralis). Using RH-1, we have developed a single seed descent (SSD) population of 138 lines by crossing it to the intolerant cultivar Herald. After inoculation, RLN-associated root damage clearly segregated in the population. Genetic analysis was performed by constructing a genetic map using simple sequence repeat (SSR) and gene-based SNP markers. A highly significant quantitative trait locus (QTL), QPnTolMl.1, was identified explaining 49% of the phenotypic variation in the SSD population. All SSRs and gene-based markers in the QTL region were derived from chromosome 1 of the sequenced genome of the closely related species M. truncatula. Gene-based markers were validated in advanced breeding lines derived from the RH-1 parent and also a second RLN tolerance source, RH-2 (M. truncatula ssp. tricycla). Comparative analysis to sequenced legume genomes showed that the physical QTL interval exists as a synteny block in Lotus japonicus, common bean, soybean and chickpea. Furthermore, using the sequenced genome information of M. truncatula, the QTL interval contains 55 genes out of which five are discussed as potential candidate genes responsible for the mapped tolerance. The closely linked set of SNP-based PCR markers is directly applicable to select for two different sources of RLN tolerance in breeding programs. Moreover, genome sequence information has allowed proposing candidate genes for further functional analysis and nominates QPnTolMl.1 as a target locus for RLN tolerance in economically important grain legumes, e.g. chickpea.
Vatansever, Recep; Filiz, Ertugrul; Eroglu, Seckin
2017-04-01
Metal transport process in plants is a determinant of quality and quantity of the harvest. Although it is among the most important of staple crops, knowledge about genes that encode for membrane-bound metal transporters is scarce in wheat. Metal tolerance proteins (MTPs) are involved in trace metal homeostasis at the sub-cellular level, usually by providing metal efflux out of the cytosol. Here, by using various bioinformatics approaches, genes that encode for MTPs in the hexaploid wheat genome (Triticum aestivum, abbreviated as Ta) were identified and characterized. Based on the comparison with known rice MTPs, the wheat genome contained 20 MTP sequences; named as TaMTP1-8A, B and D. All TaMTPs contained a cation diffusion facilitator (CDF) family domain and most members harbored a zinc transporter dimerization domain. Based on motif, phylogeny and alignment analysis, A, B and D genomes of TaMTP3-7 sequences demonstrated higher homology compared to TaMTP1, 2 and 8. With reference to their rice orthologs, TaMTP1s and TaMTP8s belonged to Zn-CDFs, TaMTP2s to Fe/Zn-CDFs and TaMTP3-7s to Mn-CDFs. Upstream regions of TaMTP genes included diverse cis-regulatory motifs, indicating regulation by developmental stage, tissue type and stresses. A scan of the coding sequences of 20 TaMTPs against published miRNAs predicted a total of 14 potential miRNAs, mainly targeting the members of most diverged groups. Expression analysis showed that several TaMTPs were temporally and spatially regulated during the developmental time-course. In grains, MTPs were preferentially expressed in the aleurone layer, which is known as a reservoir for high concentrations of iron and zinc. The work identified and characterized metal tolerance proteins in common wheat and revealed a potential involvement of MTPs in providing a sink for trace element storage in wheat grains.
Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams
Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N.; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun
2013-01-01
UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar ‘Sasanishiki’) that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined. PMID:23381954
Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams.
Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun
2013-07-01
UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar 'Sasanishiki') that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined.
Shah, Syed Tariq; Pang, Chaoyou; Fan, Shuli; Song, Meizhen; Arain, Saima; Yu, Shuxun
2013-12-01
NAC (NAM, ATAF, and CUC) is a plant-specific transcription factor family with diverse roles in plant development and stress regulation. In this report, stress-responsive NAC genes (GhNAC8-GhNAC17) isolated from cotton (Gossypium hirsutum L.) were characterised in the context of leaf senescence and stress tolerance. The characterisation of NAC genes during leaf senescence has not yet been reported for cotton. Based on the sequence characterisation, these GhNACs could be classified into three groups belonging to three known NAC sub-families. Their predicted amino acid sequences exhibited similarities to NAC genes from other plant species. Senescent leaves were the sites of maximum expression for all GhNAC genes except GhNAC10 and GhNAC13, which showed maximum expression in fibres, collected from 25 days post anthesis (DPA) plants. The ten GhNAC genes displayed differential expression patterns and levels during natural and induced leaf senescence. Quantitative RT-PCR and promoter analyses suggest that these genes are induced by ABA, ethylene, drought, salinity, cold, heat, and other hormonal treatments. These results support a role for cotton GhNAC genes in transcriptional regulation of leaf senescence, stress tolerance and other developmental stages of cotton. © 2013.
In Silico Prediction Analysis of Idiotope-Driven T–B Cell Collaboration in Multiple Sclerosis
Høglund, Rune A.; Lossius, Andreas; Johansen, Jorunn N.; Homan, Jane; Benth, Jūratė Šaltytė; Robins, Harlan; Bogen, Bjarne; Bremel, Robert D.; Holmøy, Trygve
2017-01-01
Memory B cells acting as antigen-presenting cells are believed to be important in multiple sclerosis (MS), but the antigen they present remains unknown. We hypothesized that B cells may activate CD4+ T cells in the central nervous system of MS patients by presenting idiotopes from their own immunoglobulin variable regions on human leukocyte antigen (HLA) class II molecules. Here, we use bioinformatics prediction analysis of B cell immunoglobulin variable regions from 11 MS patients and 6 controls with other inflammatory neurological disorders (OINDs), to assess whether the prerequisites for such idiotope-driven T–B cell collaboration are present. Our findings indicate that idiotopes from the complementarity determining region (CDR) 3 of MS patients on average have high predicted affinities for disease associated HLA-DRB1*15:01 molecules and are predicted to be endosomally processed by cathepsin S and L in positions that allows such HLA binding to occur. Additionally, complementarity determining region 3 sequences from cerebrospinal fluid (CSF) B cells from MS patients contain on average more rare T cell-exposed motifs that could potentially escape tolerance and stimulate CD4+ T cells than CSF B cells from OIND patients. Many of these features were associated with preferential use of the IGHV4 gene family by CSF B cells from MS patients. This is the first study to combine high-throughput sequencing of patient immune repertoires with large-scale prediction analysis and provides key indicators for future in vitro and in vivo analyses. PMID:29038659
In Silico Prediction Analysis of Idiotope-Driven T-B Cell Collaboration in Multiple Sclerosis.
Høglund, Rune A; Lossius, Andreas; Johansen, Jorunn N; Homan, Jane; Benth, Jūratė Šaltytė; Robins, Harlan; Bogen, Bjarne; Bremel, Robert D; Holmøy, Trygve
2017-01-01
Memory B cells acting as antigen-presenting cells are believed to be important in multiple sclerosis (MS), but the antigen they present remains unknown. We hypothesized that B cells may activate CD4 + T cells in the central nervous system of MS patients by presenting idiotopes from their own immunoglobulin variable regions on human leukocyte antigen (HLA) class II molecules. Here, we use bioinformatics prediction analysis of B cell immunoglobulin variable regions from 11 MS patients and 6 controls with other inflammatory neurological disorders (OINDs), to assess whether the prerequisites for such idiotope-driven T-B cell collaboration are present. Our findings indicate that idiotopes from the complementarity determining region (CDR) 3 of MS patients on average have high predicted affinities for disease associated HLA-DRB1*15:01 molecules and are predicted to be endosomally processed by cathepsin S and L in positions that allows such HLA binding to occur. Additionally, complementarity determining region 3 sequences from cerebrospinal fluid (CSF) B cells from MS patients contain on average more rare T cell-exposed motifs that could potentially escape tolerance and stimulate CD4 + T cells than CSF B cells from OIND patients. Many of these features were associated with preferential use of the IGHV4 gene family by CSF B cells from MS patients. This is the first study to combine high-throughput sequencing of patient immune repertoires with large-scale prediction analysis and provides key indicators for future in vitro and in vivo analyses.
Associative diazotrophic bacteria in grass roots and soils from heavy metal contaminated sites.
Moreira, Fátima M S; Lange, Anderson; Klauberg-Filho, Osmar; Siqueira, José O; Nóbrega, Rafaela S A; Lima, Adriana S
2008-12-01
This work aimed to evaluate density of associative diazotrophic bacteria populations in soil and grass root samples from heavy metal contaminated sites, and to characterize isolates from these populations, both, phenotypically (Zinc, Cadmium and NaCl tolerance in vitro, and protein profiles) and genotypically (16S rDNA sequencing), as compared to type strains of known diazotrophic species. Densities were evaluated by using NFb, Fam and JNFb media, commonly used for enrichment cultures of diazotrophic bacteria. Bacterial densities found in soil and grass root samples from contaminated sites were similar to those reported for agricultural soils. Azospirillum spp. isolates from contaminated sites and type strains from non-contaminated sites varied substantially in their in vitro tolerance to Zn+2 and Cd+2, being Cd+2 more toxic than Zn+2. Among the most tolerant isolates (UFLA 1S, 1R, S181, S34 and S22), some (1R, S34 and S22) were more tolerant to heavy metals than rhizobia from tropical and temperate soils. The majority of the isolates tolerant to heavy metals were also tolerant to salt stress as indicated by their ability to grow in solid medium supplemented with 30 g L(-1) NaCl. Five isolates exhibited high dissimilarity in protein profiles, and the 16S rDNA sequence analysis of two of them revealed new sequences for Azospirillum.
Ahmad, Aftab; Niwa, Yasuo; Goto, Shingo; Ogawa, Takeshi; Shimizu, Masanori; Suzuki, Akane; Kobayashi, Kyoko; Kobayashi, Hirokazu
2015-01-01
An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8) as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO) lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX) of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP) fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'). The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.
Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T
2014-10-01
A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.
Genetics of Combined Pituitary Hormone Deficiency: Roadmap into the Genome Era.
Fang, Qing; George, Akima S; Brinkmeier, Michelle L; Mortensen, Amanda H; Gergics, Peter; Cheung, Leonard Y M; Daly, Alexandre Z; Ajmal, Adnan; Pérez Millán, María Ines; Ozel, A Bilge; Kitzman, Jacob O; Mills, Ryan E; Li, Jun Z; Camper, Sally A
2016-12-01
The genetic basis for combined pituitary hormone deficiency (CPHD) is complex, involving 30 genes in a variety of syndromic and nonsyndromic presentations. Molecular diagnosis of this disorder is valuable for predicting disease progression, avoiding unnecessary surgery, and family planning. We expect that the application of high throughput sequencing will uncover additional contributing genes and eventually become a valuable tool for molecular diagnosis. For example, in the last 3 years, six new genes have been implicated in CPHD using whole-exome sequencing. In this review, we present a historical perspective on gene discovery for CPHD and predict approaches that may facilitate future gene identification projects conducted by clinicians and basic scientists. Guidelines for systematic reporting of genetic variants and assigning causality are emerging. We apply these guidelines retrospectively to reports of the genetic basis of CPHD and summarize modes of inheritance and penetrance for each of the known genes. In recent years, there have been great improvements in databases of genetic information for diverse populations. Some issues remain that make molecular diagnosis challenging in some cases. These include the inherent genetic complexity of this disorder, technical challenges like uneven coverage, differing results from variant calling and interpretation pipelines, the number of tolerated genetic alterations, and imperfect methods for predicting pathogenicity. We discuss approaches for future research in the genetics of CPHD.
Mutations that Cause Human Disease: A Computational/Experimental Approach
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beernink, P; Barsky, D; Pesavento, B
International genome sequencing projects have produced billions of nucleotides (letters) of DNA sequence data, including the complete genome sequences of 74 organisms. These genome sequences have created many new scientific opportunities, including the ability to identify sequence variations among individuals within a species. These genetic differences, which are known as single nucleotide polymorphisms (SNPs), are particularly important in understanding the genetic basis for disease susceptibility. Since the report of the complete human genome sequence, over two million human SNPs have been identified, including a large-scale comparison of an entire chromosome from twenty individuals. Of the protein coding SNPs (cSNPs), approximatelymore » half leads to a single amino acid change in the encoded protein (non-synonymous coding SNPs). Most of these changes are functionally silent, while the remainder negatively impact the protein and sometimes cause human disease. To date, over 550 SNPs have been found to cause single locus (monogenic) diseases and many others have been associated with polygenic diseases. SNPs have been linked to specific human diseases, including late-onset Parkinson disease, autism, rheumatoid arthritis and cancer. The ability to predict accurately the effects of these SNPs on protein function would represent a major advance toward understanding these diseases. To date several attempts have been made toward predicting the effects of such mutations. The most successful of these is a computational approach called ''Sorting Intolerant From Tolerant'' (SIFT). This method uses sequence conservation among many similar proteins to predict which residues in a protein are functionally important. However, this method suffers from several limitations. First, a query sequence must have a sufficient number of relatives to infer sequence conservation. Second, this method does not make use of or provide any information on protein structure, which can be used to understand how an amino acid change affects the protein. The experimental methods that provide the most detailed structural information on proteins are X-ray crystallography and NMR spectroscopy. However, these methods are labor intensive and currently cannot be carried out on a genomic scale. Nonetheless, Structural Genomics projects are being pursued by more than a dozen groups and consortia worldwide and as a result the number of experimentally determined structures is rising exponentially. Based on the expectation that protein structures will continue to be determined at an ever-increasing rate, reliable structure prediction schemes will become increasingly valuable, leading to information on protein function and disease for many different proteins. Given known genetic variability and experimentally determined protein structures, can we accurately predict the effects of single amino acid substitutions? An objective assessment of this question would involve comparing predicted and experimentally determined structures, which thus far has not been rigorously performed. The completed research leveraged existing expertise at LLNL in computational and structural biology, as well as significant computing resources, to address this question.« less
Nesme, Joseph; Cania, Barbara; Zadel, Urška; Schöler, Anne; Płaza, Grażyna A; Schloter, Michael
2017-11-22
We report here the complete genome sequences of two Pseudomonas putida isolates recovered from surface-sterilized roots of Sida hermaphrodita The two isolates were characterized by an increased tolerance to zinc, cadmium, and lead. Furthermore, the strains showed typical plant growth-promoting properties, such as the production of indole acetic acid, cellulolytic enzymes, and siderophores. Copyright © 2017 Nesme et al.
Yu, Bo; Su, Fei; Wang, Limin; Xu, Ke; Zhao, Bo; Xu, Ping
2011-01-01
Sporolactobacillus inulinus CASD is an efficient d-lactic acid producer with high optical purity. Here we report for the first time the draft genome sequence of S. inulinus (2,930,096 bp). The large number of annotated two-component system genes makes it possible to explore the mechanism of extraordinary lactate tolerance of S. inulinus CASD. PMID:21952540
Yu, Bo; Su, Fei; Wang, Limin; Xu, Ke; Zhao, Bo; Xu, Ping
2011-10-01
Sporolactobacillus inulinus CASD is an efficient D-lactic acid producer with high optical purity. Here we report for the first time the draft genome sequence of S. inulinus (2,930,096 bp). The large number of annotated two-component system genes makes it possible to explore the mechanism of extraordinary lactate tolerance of S. inulinus CASD.
Hardiness, psychosocial factors and shift work tolerance among nurses - a 2-year follow-up study.
Saksvik-Lehouillier, Ingvild; Bjorvatn, Bjørn; Magerøy, Nils; Pallesen, Ståle
2016-08-01
To examine the predictive power of the subfactors of hardiness (commitment, control and challenge) on shift work tolerance (measured with sleepiness, fatigue, anxiety and depression) over 2 years in nurses working shifts. We also investigated the direct effects of psychosocial variables such as role conflict, social support and fair leadership on shift work tolerance, as well as their moderating role on the relationship between hardiness and shift work tolerance. Several scholars have discussed the role of individual differences and psychosocial variables in predicting shift work tolerance. The conclusions are not clear. Longitudinal questionnaire study. A sample of Norwegian nurses employed in shift work including nights participated in this longitudinal questionnaire study: 1877 at baseline, 1228 at 1-year follow-up and 659 nurses at 2-year follow-up. Data were collected in three waves, first wave in 2008 and third in 2011 and were analysed with a series of hierarchical multiple regression analyses. We found that the subfactor commitment could predict fatigue over 1 year and anxiety and depression over 2 years. Challenge could predict anxiety over 1 year. Control was unrelated to shift work intolerance. Hardiness did not predict sleepiness. Social support, role conflict and fair leadership were important for some aspects of shift work tolerance; however, hardiness seemed to be more eminent for shift work tolerance than the psychosocial variables. Social support moderated the relationship between hardiness and shift work tolerance to some degree, but this interaction was weak. Hardiness can to some degree predict shift work tolerance over 2 years among nurses. © 2016 John Wiley & Sons Ltd.
Chaturvedi, Navaneet; Kajsik, Michal; Forsythe, Stephen; Pandey, Paras Nath
2015-12-01
The recently annotated genome of the bacterium Cronobacter sakazakii BAA-894 suggests that the organism has the ability to bind heavy metals. This study demonstrates heavy metal tolerance in C. sakazakii, in which proteins with the heavy metal interaction were recognized by computational and experimental study. As the result, approximately one-fourth of proteins encoded on the plasmid pESA3 are proposed to have potential interaction with heavy metals. Interaction between heavy metals and predicted proteins was further corroborated using protein crystal structures from protein data bank database and comparison of metal-binding ligands. In addition, a phylogenetic study was undertaken for the toxic heavy metals, arsenic, cadmium, lead and mercury, which generated relatedness clustering for lead, cadmium and arsenic. Laboratory studies confirmed the organism's tolerance to tellurite, copper and silver. These experimental and computational study data extend our understanding of the genes encoding for proteins of this important neonatal pathogen and provide further insights into the genotypes associated with features that can contribute to its persistence in the environment. The information will be of value for future environmental protection from heavy toxic metals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gordon, Sean; Reguera, Maria; Sade, Nir
2015-03-20
We are using the perennial model grass Brachypodium sylvaticum to identify combinations of transgenes that enhance tolerance to multiple, simultaneous abiotic stresses. The most successful transgene combinations will ultimately be used to create improved switchgrass (Panicum virgatum L.) cultivars. To further develop B. sylvaticum as a perennial model grass, and facilitate our planned transcriptional profiling, we are sequencing and annotating the genome. We have generated ~40x genome coverage using PacBio sequencing of the largest possible size selected libraries (18, 22, 25 kb). Our initial assembly using only long-read sequence contained 320 Mb of sequence with an N50 contig length ofmore » 315 kb and an N95 contig length of 40 kb. This assembly consists of 2,430 contigs, the largest of which was 1.6 Mb. The estimated genome size based on c-values is 340 Mb indicating that about 20 Mb of presumably repetitive DNA remains yet unassembled. Significantly, this assembly is far superior to an assembly created from paired-end short-read sequence, ~100x genome coverage. The short-read-only assembly contained only 226 Mb of sequence in 19k contigs. To aid the assembly of the scaffolds into chromosome-scale assemblies we produced an F2 mapping population and have genotyped 480 individuals using a genotype by sequence approach. One of the reasons for using B. sylvaticum as a model system is to determine if the transgenes adversely affect perenniality and winter hardiness. Toward this goal, we examined the freezing tolerance of wild type B. sylvaticum lines to determine the optimal conditions for testing the freezing tolerance of the transgenics. A survey of seven accessions noted significant natural variation in freezing tolerance. Seedling or adult Ain-1 plants, the line used for transformation, survived an 8 hour challenge down to -6 oC and 50% survived a challenge down to -9 oC. Thus, we will be able to easily determine if the transgenes compromise freezing tolerance. In the effort to develop biotechnological tools for perennial grass improvement, we have completed the transformation of B. sylvaticum with constructs containing 20 genes shown to be associated with enhanced abiotic stress tolerance in monocots. In addition, we have transformed plants with constructs containing a combination of genes (i.e. SARK::IPT- Ubi::HSR1::Ubi::NHX1) in order to simultaneously overexpress genes associated with drought + heat tolerance + salt tolerance. We generated single copy insert T1 lines for all constructs and the generation and bulking of homozygous T2 lines is well underway. In addition to our B. sylvaticum transgenics, we transformed B. distachyon with many of the same genes. Some of the transgenic B. distachyon plants subjected to a combined stress of both drought and salinity were able to produced higher yields than wild type plants. Our results indicate a great potential for the development of grasses with improved performance and yield in water-limited areas.« less
Exploring Human Diseases and Biological Mechanisms by Protein Structure Prediction and Modeling.
Wang, Juexin; Luttrell, Joseph; Zhang, Ning; Khan, Saad; Shi, NianQing; Wang, Michael X; Kang, Jing-Qiong; Wang, Zheng; Xu, Dong
2016-01-01
Protein structure prediction and modeling provide a tool for understanding protein functions by computationally constructing protein structures from amino acid sequences and analyzing them. With help from protein prediction tools and web servers, users can obtain the three-dimensional protein structure models and gain knowledge of functions from the proteins. In this chapter, we will provide several examples of such studies. As an example, structure modeling methods were used to investigate the relation between mutation-caused misfolding of protein and human diseases including epilepsy and leukemia. Protein structure prediction and modeling were also applied in nucleotide-gated channels and their interaction interfaces to investigate their roles in brain and heart cells. In molecular mechanism studies of plants, rice salinity tolerance mechanism was studied via structure modeling on crucial proteins identified by systems biology analysis; trait-associated protein-protein interactions were modeled, which sheds some light on the roles of mutations in soybean oil/protein content. In the age of precision medicine, we believe protein structure prediction and modeling will play more and more important roles in investigating biomedical mechanism of diseases and drug design.
2016-09-09
evaluating 18 mutants using either the A or B conformer is only r = ~ 0.2. Given the poor performance of approximating the observed experimental ...1 Sequence Tolerance of a Highly Stable Single Domain Antibody: Comparison of Computational and Experimental Profiles Mark A. Olson,1 Patricia...unusually high thermal stability is explored by a combined computational and experimental study. Starting with the crystallographic structure
Enhancement of Plant Productivity in the Post-Genomics Era.
Thao, Nguyen Phuong; Tran, Lam-Son Phan
2016-08-01
Obtaining high plant yield is not always achievable in agricultural activity as it is determined by various factors, including cultivar quality, nutrient and water supplies, degree of infection by pathogens, natural calamities and soil conditions, which affect plant growth and development. More noticeably, sustainable plant productivity to provide sufficient food for the increasing human population has become a thorny issue to scientists in the era of unpredictable global climatic changes, appearance of more tremendous or multiple stresses, and land restriction for cultivation. Well-established agricultural management by agrotechnological means has shown no longer to be effective enough to confront with this challenge. Instead, in order to maximize the production, it is advisable to implement such practices in combination with biological applications. Nowadays, high technologies are widely adopted into agricultural production, biological diversity conservation and crop improvement. Wang et al. has nicely outlined the utilization of DNA-based technologies in this field. Among these are the applications of (i) DNA markers into cultivar identification, seed purity analysis, germplasm resource evaluation, heterosis prediction, genetic mapping, cloning and breeding; and (ii) gene expression data in supporting the description of crop phenology, the analytic comparison of crop growth under stress versus non-stress conditions, or the study of fertilizer effects. Besides, various purposes of using transgenic technologies in agriculture, such as generating cultivars with better product quality, better tolerance to biotic or abiotic stress, are also discussed in the review. One of the important highlights in this issue is the review of the benefits brought by high-throughput sequencing technology, which is also known as next-generation sequencing (NGS). It is not so difficult to recognize that its application has allowed us to carry out biological studies at much deeper level and larger scale. In their article, Onda and Mochida detailed how to use these technologies in fully characterizing the genetic diversity or multigenecity within a particular plant species. The authors discussed the constant innovation of sequencing platforms which has made sequencing technologies become more superior and more powerful than ever before. Additionally, the efforts result in not only further cut down of the sequencing cost and increase in the sequencing speed, but also improvement in sequencing accuracy and extended sequencing application to studies at both DNA and RNA levels. Such knowledge will help the scientists interpret, at least partially, how plants can adapt to various environmental conditions, or how different cultivars can respond differently to the same stress. Another article by Ong et al. also laid emphasis on the importance of various high-throughput sequencing platforms, thanks to which a large number of genomic databases supplied with detailed annotation and useful bioinformatics tools have been established to assist geneticists. Readers can find in this review the summary of available plant-specific genomic databases up-to-date and popular web-based resources that are relevant for comparative genomics, plant evolution and phylogenomics studies. These, along with other approaches, such as quantitative trait locus and genome-wide association study, will lay foundation for prediction and identification of genes or alleles responsible for valuable agronomic traits, contributing to the enhancement of plant productivity by genetic engineering approach. In this thematic issue, specific examples for crop improvement are also demonstrated. The first showcase is given by Nongpiur et al. who provided evidence that synergistic employment of genomics approaches and high-throughput gene expression methods have aided in dissecting the salinity-responsive signaling pathway, identifying genes involved in the stress response and selecting candidate genes for further characterization aimed at generating new cultivars with better salinity stress tolerance. This paper is also a good reference source for readers who wish to get an overview about the general process from gene prediction to validation by experiments, including the details on techniques and approaches used. Another demonstration is provided by Khan et al. whose interest is enhancement of drought tolerance in crops. The focus of this article is to overview our current understanding of mechanisms regulating plants responses to drought. Evaluation of plant performance to drought and production of new elite varieties with better drought tolerance on the basis of using phenotyping and genomics-assisted breeding are also well discussed. In addition to the topics of environmental stress tolerance in plants, current knowledge on improving biotic stress tolerance is also summarized in our issue. Current picture on crosstalk of signaling mechanisms in rice between its immune system and symbiosis with microorganisms is presented by Akamatsu et al. Rice responses to bacteria and fungi via interactions between the plant pattern recognition receptors and the molecular microbe-associated molecular patterns are described in detail and suggested as targets for manipulation in order to increase disease resistance in crops. On the other hand, Bouain et al. are concerned about nutrient deficiency; specifically, how plant root system develops under growing conditions with inadequate phosphate. The authors overviewed our current understanding of the low phosphate-responsive mechanisms in Arabidopsis model plant, which was gained by using a combination of various advanced methods, including high-througput phenotyping, system biology analysis and "omics" technologies. Stress management in plants is proposed to be also achievable by regulating activities of cyclic nucleotide-gated ion channels. As emphasized in the paper of Jha et al., the application of such channels is important in mediating cellular ion homeostasis and plant tolerance to both biotic and abiotic stresses. In summary, with recent progresses in biological and biotechnological areas, especially rapid development of advanced technologies in biological system modeling, functional genomics, computer-based analyzing tools, genetic engineering and molecular breeding, biological control and biotechnological applications in agriculture have brought about an extraordinary revolution and have been considered the most powerful approaches in maintaining or even increasing crop yield. Therefore, in this issue, we would like to introduce to the audience a collection of various strategies used for enhancing crop productivity, with the focus on advanced biological-biotechnological platforms in the post-genomics era.
Lee, Mei-Chong Wendy; Lopez-Diaz, Fernando J; Khan, Shahid Yar; Tariq, Muhammad Akram; Dayn, Yelena; Vaske, Charles Joseph; Radenbaugh, Amie J; Kim, Hyunsung John; Emerson, Beverly M; Pourmand, Nader
2014-11-04
The acute cellular response to stress generates a subpopulation of reversibly stress-tolerant cells under conditions that are lethal to the majority of the population. Stress tolerance is attributed to heterogeneity of gene expression within the population to ensure survival of a minority. We performed whole transcriptome sequencing analyses of metastatic human breast cancer cells subjected to the chemotherapeutic agent paclitaxel at the single-cell and population levels. Here we show that specific transcriptional programs are enacted within untreated, stressed, and drug-tolerant cell groups while generating high heterogeneity between single cells within and between groups. We further demonstrate that drug-tolerant cells contain specific RNA variants residing in genes involved in microtubule organization and stabilization, as well as cell adhesion and cell surface signaling. In addition, the gene expression profile of drug-tolerant cells is similar to that of untreated cells within a few doublings. Thus, single-cell analyses reveal the dynamics of the stress response in terms of cell-specific RNA variants driving heterogeneity, the survival of a minority population through generation of specific RNA variants, and the efficient reconversion of stress-tolerant cells back to normalcy.
Lee, Mei-Chong Wendy; Lopez-Diaz, Fernando J.; Khan, Shahid Yar; Tariq, Muhammad Akram; Dayn, Yelena; Vaske, Charles Joseph; Radenbaugh, Amie J.; Kim, Hyunsung John; Emerson, Beverly M.; Pourmand, Nader
2014-01-01
The acute cellular response to stress generates a subpopulation of reversibly stress-tolerant cells under conditions that are lethal to the majority of the population. Stress tolerance is attributed to heterogeneity of gene expression within the population to ensure survival of a minority. We performed whole transcriptome sequencing analyses of metastatic human breast cancer cells subjected to the chemotherapeutic agent paclitaxel at the single-cell and population levels. Here we show that specific transcriptional programs are enacted within untreated, stressed, and drug-tolerant cell groups while generating high heterogeneity between single cells within and between groups. We further demonstrate that drug-tolerant cells contain specific RNA variants residing in genes involved in microtubule organization and stabilization, as well as cell adhesion and cell surface signaling. In addition, the gene expression profile of drug-tolerant cells is similar to that of untreated cells within a few doublings. Thus, single-cell analyses reveal the dynamics of the stress response in terms of cell-specific RNA variants driving heterogeneity, the survival of a minority population through generation of specific RNA variants, and the efficient reconversion of stress-tolerant cells back to normalcy. PMID:25339441
Fault tree models for fault tolerant hypercube multiprocessors
NASA Technical Reports Server (NTRS)
Boyd, Mark A.; Tuazon, Jezus O.
1991-01-01
Three candidate fault tolerant hypercube architectures are modeled, their reliability analyses are compared, and the resulting implications of these methods of incorporating fault tolerance into hypercube multiprocessors are discussed. In the course of performing the reliability analyses, the use of HARP and fault trees in modeling sequence dependent system behaviors is demonstrated.
Managing the On-Board Data Storage, Acknowledgment and Retransmission System for Spitzer
NASA Technical Reports Server (NTRS)
Sarrel, Marc A.; Carrion, Carlos; Hunt, Joseph C., Jr.
2006-01-01
The Spitzer Space Telescope has a two-phase downlink system. Data are transmitted during one telecom session. Then commands are sent during the next session to delete those data that were received and to retransmit those data that were missed. We must build sequences that are as efficient as possible to make the best use of our finite supply of liquid helium, One way to improve efficiency is to use only the minimum time needed during telecom sessions to transmit the predicted volume of data. But, we must also not fill the onboard storage and must allow enough time margin to retransmit missed data. We describe tools and procedures that allow us to build observatory sequences that are single-fault tolerant in this regard and that allow us to recover quickly and safely from anomalies that affect the receipt or acknowledgment of data.
Managing the On-Board Data Storage, Acknowledgement and Retransmission System for Spitzer
NASA Technical Reports Server (NTRS)
Sarrel, Marc A.; Carrion, Carlos; Hunt, Joseph C., Jr.
2006-01-01
The Spitzer Space Telescope has a two-phase downlink system. Recorded data are transmitted during one telecom session. Then commands are sent during the next session to delete those data that were received on the ground and to retransmit those data that were missed. We must build science sequences that are as efficient as possible to make the best use of our supply of liquid helium. One way to improve efficiency is to use only the minimum time needed during telecom sessions to transmit the predicted volume of data. But, we must also not fill the on-board storage and must allow enough time margin to retransmit missed data. We describe tools and procedures that allow us to build science sequences that are single-fault tolerant in this regard and that allow us to recover quickly and safely from anomalies that affect the receipt or acknowledgment (i.e. deletion) of data.
Kulik, Natallia; Slámová, Kristýna; Ettrich, Rüdiger; Křen, Vladimír
2015-01-28
β-N-Acetylhexosaminidase (GH20) from the filamentous fungus Talaromyces flavus, previously identified as a prominent enzyme in the biosynthesis of modified glycosides, lacks a high resolution three-dimensional structure so far. Despite of high sequence identity to previously reported Aspergillus oryzae and Penicilluim oxalicum β-N-acetylhexosaminidases, this enzyme tolerates significantly better substrate modification. Understanding of key structural features, prediction of effective mutants and potential substrate characteristics prior to their synthesis are of general interest. Computational methods including homology modeling and molecular dynamics simulations were applied to shad light on the structure-activity relationship in the enzyme. Primary sequence analysis revealed some variable regions able to influence difference in substrate affinity of hexosaminidases. Moreover, docking in combination with consequent molecular dynamics simulations of C-6 modified glycosides enabled us to identify the structural features required for accommodation and processing of these bulky substrates in the active site of hexosaminidase from T. flavus. To access the reliability of predictions on basis of the reported model, all results were confronted with available experimental data that demonstrated the principal correctness of the predictions as well as the model. The main variable regions in β-N-acetylhexosaminidases determining difference in modified substrate affinity are located close to the active site entrance and engage two loops. Differences in primary sequence and the spatial arrangement of these loops and their interplay with active site amino acids, reflected by interaction energies and dynamics, account for the different catalytic activity and substrate specificity of the various fungal and bacterial β-N-acetylhexosaminidases.
Diversity in boron toxicity tolerance of Australian barley (Hordeum vulgare L.) genotypes.
Hayes, Julie E; Pallotta, Margaret; Garcia, Melissa; Öz, Mehmet Tufan; Rongala, Jay; Sutton, Tim
2015-09-26
Boron (B) is an important micronutrient for plant growth, but is toxic when levels are too high. This commonly occurs in environments with alkaline soils and relatively low rainfall, including many of the cereal growing regions of southern Australia. Four major genetic loci controlling tolerance to high soil B have been identified in the landrace barley, Sahara 3771. Genes underlying two of the loci encode the B transporters HvBot1 and HvNIP2;1. We investigated sequence and expression level diversity in HvBot1 and HvNIP2;1 across barley germplasm, and identified five novel coding sequence alleles for HvBot1. Lines were identified containing either single or multiple copies of the Sahara HvBot1 allele. We established that only the tandemly duplicated Sahara allele conferred B tolerance, and this duplicated allele was found only in a set of nine lines accessioned in Australian collections as Sahara 3763-3771. HvNIP2;1 coding sequences were highly conserved across barley germplasm. We identified the likely causative SNP in the 5'UTR of Sahara HvNIP2;1, and propose that the creation of a small upstream open reading frame interferes with HvNIP2;1 translation in Sahara 3771. Similar to HvBot1, the tolerant HvNIP2;1 allele was unique to the Sahara barley accessions. We identified a new source of the 2H B tolerance allele controlling leaf symptom development, in the landrace Ethiopia 756. Ethiopia 756, as well as the cultivar Sloop Vic which carries both the 2H and HvBot1 B tolerance alleles derived from Sahara 3771, may be valuable as alternative parents in breeding programs targeted to high soil B environments. There is significant diversity in B toxicity tolerance among contemporary Australian barley varieties but this is not related to variation at any of the four known B tolerance loci, indicating that novel, as yet undiscovered, sources of tolerance exist.
Fan, Xinqi; Guo, Qi; Xu, Peng; Gong, YuanYong; Shu, Hongmei; Yang, Yang; Ni, Wanchao; Zhang, Xianggui; Shen, Xinlian
2015-01-01
WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs) in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III), as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.
2014-01-01
Background The nematode Pratylenchus neglectus has a wide host range and is able to feed on the root systems of cereals, oilseeds, grain and pasture legumes. Under the Mediterranean low rainfall environments of Australia, annual Medicago pasture legumes are used in rotation with cereals to fix atmospheric nitrogen and improve soil parameters. Considerable efforts are being made in breeding programs to improve resistance and tolerance to Pratylenchus neglectus in the major crops wheat and barley, which makes it vital to develop appropriate selection tools in medics. Results A strong source of tolerance to root damage by the root lesion nematode (RLN) Pratylenchus neglectus had previously been identified in line RH-1 (strand medic, M. littoralis). Using RH-1, we have developed a single seed descent (SSD) population of 138 lines by crossing it to the intolerant cultivar Herald. After inoculation, RLN-associated root damage clearly segregated in the population. Genetic analysis was performed by constructing a genetic map using simple sequence repeat (SSR) and gene-based SNP markers. A highly significant quantitative trait locus (QTL), QPnTolMl.1, was identified explaining 49% of the phenotypic variation in the SSD population. All SSRs and gene-based markers in the QTL region were derived from chromosome 1 of the sequenced genome of the closely related species M. truncatula. Gene-based markers were validated in advanced breeding lines derived from the RH-1 parent and also a second RLN tolerance source, RH-2 (M. truncatula ssp. tricycla). Comparative analysis to sequenced legume genomes showed that the physical QTL interval exists as a synteny block in Lotus japonicus, common bean, soybean and chickpea. Furthermore, using the sequenced genome information of M. truncatula, the QTL interval contains 55 genes out of which five are discussed as potential candidate genes responsible for the mapped tolerance. Conclusion The closely linked set of SNP-based PCR markers is directly applicable to select for two different sources of RLN tolerance in breeding programs. Moreover, genome sequence information has allowed proposing candidate genes for further functional analysis and nominates QPnTolMl.1 as a target locus for RLN tolerance in economically important grain legumes, e.g. chickpea. PMID:24742262
Ramkumar, Hema L; Gudiseva, Harini V; Kishaba, Kameron T; Suk, John J; Verma, Rohan; Tadimeti, Keerti; Thorson, John A; Ayyagari, Radha
2017-02-01
To test the utility of targeted sequencing as a method of clinical molecular testing in patients diagnosed with inherited retinal degeneration (IRD). After genetic counseling, peripheral blood was drawn from 188 probands and 36 carriers of IRD. Single gene testing was performed on each patient in a Clinical Laboratory Improvement Amendment (CLIA) certified laboratory. DNA was isolated, and all exons in the gene of interest were analyzed along with 20 base pairs of flanking intronic sequence. Genetic testing was most often performed on ABCA4, CTRP5, ELOV4, BEST1, CRB1, and PRPH2. Pathogenicity of novel sequence changes was predicted by PolyPhen2 and sorting intolerant from tolerant (SIFT). Of the 225 genetic tests performed, 150 were for recessive IRD, and 75 were for dominant IRD. A positive molecular diagnosis was made in 70 (59%) of probands with recessive IRD and 19 (26%) probands with dominant IRD. Analysis confirmed 12 (34%) of individuals as carriers of familial mutations associated with IRD. Thirty-two novel variants were identified; among these, 17 sequence changes in four genes were predicted to be possibly or probably damaging including: ABCA4 (14), BEST1 (2), PRPH2 (1), and TIMP3 (1). Targeted analysis of clinically suspected genes in 225 subjects resulted in a positive molecular diagnosis in 26% of patients with dominant IRD and 59% of patients with recessive IRD. Novel damaging mutations were identified in four genes. Single gene screening is not an ideal method for diagnostic testing given the phenotypic and genetic heterogeneity among IRD cases. High-throughput sequencing of all genes associated with retinal degeneration may be more efficient for molecular diagnosis.
Analysis of expressed sequence tags from a NaHCO(3)-treated alkali-tolerant plant, Chloris virgata.
Nishiuchi, Shunsaku; Fujihara, Kazumasa; Liu, Shenkui; Takano, Tetsuo
2010-04-01
Chloris virgata Swartz (C. virgata) is a gramineous wild plant that can survive in saline-alkali areas in northeast China. To examine the tolerance mechanisms of C. virgata, we constructed a cDNA library from whole plants of C. virgata that had been treated with 100 mM NaHCO(3) for 24 h and sequenced 3168 randomly selected clones. Most (2590) of the expressed sequence tags (ESTs) showed significant similarity to sequences in the NCBI database. Of the 2590 genes, 1893 were unique. Gene Ontology (GO) Slim annotations were obtained for 1081 ESTs by BLAST2GO and it was found that 75 genes of them were annotated with GO terms "response to stress", "response to abiotic stimulus", and "response to biotic stimulus", indicating these genes were likely to function in tolerance mechanism of C. virgata. In a separate experiment, 24 genes that are known from previous studies to be associated with abiotic stress tolerance were further examined by real-time RT-PCR to see how their expressions were affected by NaHCO(3) stress. NaHCO(3) treatment up-regulated the expressions of pathogenesis-related gene (DC998527), Win1 precursor gene (DC998617), catalase gene (DC999385), ribosome inactivating protein 1 (DC999555), Na(+)/H(+) antiporter gene (DC998043), and two-component regulator gene (DC998236). Copyright 2010 Elsevier Masson SAS. All rights reserved.
The Relation Between Death Attitude and Distress: Tolerance, Aggression, and Anger.
Esnaashari, Fatemeh; Kargar, Flor Rezaei
2018-06-01
The aim of this research was to determine the relation between death attitude and distress tolerance and aggression and anger. For this, 135 subjects among 7,535 professional and specialist members of the Iran National Library were selected using convenience sampling method. They replied to Death Attitudes Profile-Revised, distress tolerance questionnaire, and aggression questionnaire. The results showed that the attitudes of approach acceptance, neutral acceptance, and escape acceptance had positive relation to distress tolerance and negative relation to aggression and anger while the attitudes of fear of death and death avoidance had negative relation to distress tolerance and positive relation to aggression and anger. Furthermore, all death attitudes predicted distress tolerance. But only the attitudes of approach acceptance, escape acceptance, fear of death, and death avoidance predicted aggression, and only approach acceptance, neutral acceptance, fear of death, and death avoidance predicted anger.
Metabolic Response of Clostridium ljungdahlii to Oxygen Exposure
Whitham, Jason M.; Tirado-Acevedo, Oscar; Chinn, Mari S.; Pawlak, Joel J.
2015-01-01
Clostridium ljungdahlii is an important synthesis gas-fermenting bacterium used in the biofuels industry, and a preliminary investigation showed that it has some tolerance to oxygen when cultured in rich mixotrophic medium. Batch cultures not only continue to grow and consume H2, CO, and fructose after 8% O2 exposure, but fermentation product analysis revealed an increase in ethanol concentration and decreased acetate concentration compared to non-oxygen-exposed cultures. In this study, the mechanisms for higher ethanol production and oxygen/reactive oxygen species (ROS) detoxification were identified using a combination of fermentation, transcriptome sequencing (RNA-seq) differential expression, and enzyme activity analyses. The results indicate that the higher ethanol and lower acetate concentrations were due to the carboxylic acid reductase activity of a more highly expressed predicted aldehyde oxidoreductase (CLJU_c24130) and that C. ljungdahlii's primary defense upon oxygen exposure is a predicted rubrerythrin (CLJU_c39340). The metabolic responses of higher ethanol production and oxygen/ROS detoxification were found to be linked by cofactor management and substrate and energy metabolism. This study contributes new insights into the physiology and metabolism of C. ljungdahlii and provides new genetic targets to generate C. ljungdahlii strains that produce more ethanol and are more tolerant to syngas contaminants. PMID:26431975
Ramsay, Douglas S.; Kaiyala, Karl J.; Leroux, Brian G.; Woods, Stephen C.
2006-01-01
Rationale: A preventive strategy for drug addiction would benefit from being able to identify vulnerable individuals. Understanding how an individual responds during an initial drug exposure may be useful for predicting how that individual will respond to repeated drug administrations. Objectives: This study investigated whether individual differences in initial drug sensitivity and acute tolerance can predict how chronic tolerance develops. Methods: During an initial 3-h administration of 60% nitrous oxide (N2O), male Long-Evans rats were screened for N2O’s hypothermic effect into subsets based on being initially insensitive (II), sensitive with acute tolerance (AT), or sensitive with no intrasessional recovery (NR). Animals in each individual difference category were randomly assigned to receive six 90-min exposures of either 60% N2O or placebo gas. Core temperature was measured telemetrically. Results: Rats that exhibited a comparable degree of hypothermia during an initial N2O exposure, but differed in acute tolerance development, developed different patterns of chronic tolerance. Specifically, the NR group did not become fully tolerant over repeated N2O exposures while the AT group developed an initial hyperthermia followed by a return of core temperature to control levels indicative of full tolerance development. By the second N2O exposure, the II group breathing N2O became hyperthermic relative to the placebo control group and this hyperthermia persisted throughout the multiple N2O exposures. Conclusions: Individual differences in initial drug sensitivity and acute tolerance development predict different patterns of chronic tolerance. The hypothesis is suggested that individual differences in opponent adaptive responses may mediate this relationship. PMID:15778887
Combining dynamical decoupling with fault-tolerant quantum computation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ng, Hui Khoon; Preskill, John; Lidar, Daniel A.
2011-07-15
We study how dynamical decoupling (DD) pulse sequences can improve the reliability of quantum computers. We prove upper bounds on the accuracy of DD-protected quantum gates and derive sufficient conditions for DD-protected gates to outperform unprotected gates. Under suitable conditions, fault-tolerant quantum circuits constructed from DD-protected gates can tolerate stronger noise and have a lower overhead cost than fault-tolerant circuits constructed from unprotected gates. Our accuracy estimates depend on the dynamics of the bath that couples to the quantum computer and can be expressed either in terms of the operator norm of the bath's Hamiltonian or in terms of themore » power spectrum of bath correlations; we explain in particular how the performance of recursively generated concatenated pulse sequences can be analyzed from either viewpoint. Our results apply to Hamiltonian noise models with limited spatial correlations.« less
Khan, Abdur Rahim; Park, Gun-Seok; Asaf, Sajjad; Hong, Sung-Jun; Jung, Byung Kwon
2017-01-01
Serratia marcescens RSC-14 is a Gram-negative bacterium that was previously isolated from the surface-sterilized roots of the Cd-hyperaccumulator Solanum nigrum. The strain stimulates plant growth and alleviates Cd stress in host plants. To investigate the genetic basis for these traits, the complete genome of RSC-14 was obtained by single-molecule real-time sequencing. The genome of S. marcescens RSC-14 comprised a 5.12-Mbp-long circular chromosome containing 4,593 predicted protein-coding genes, 22 rRNA genes, 88 tRNA genes, and 41 pseudogenes. It contained genes with potential functions in plant growth promotion, including genes involved in indole-3-acetic acid (IAA) biosynthesis, acetoin synthesis, and phosphate solubilization. Moreover, annotation using NCBI and Rapid Annotation using Subsystem Technology identified several genes that encode antioxidant enzymes as well as genes involved in antioxidant production, supporting the observed resistance towards heavy metals, such as Cd. The presence of IAA pathway-related genes and oxidative stress-responsive enzyme genes may explain the plant growth-promoting potential and Cd tolerance, respectively. This is the first report of a complete genome sequence of Cd-tolerant S. marcescens and its plant growth promotion pathway. The whole-genome analysis of this strain clarified the genetic basis underlying its phenotypic and biochemical characteristics, underpinning the beneficial interactions between RSC-14 and plants. PMID:28187139
Yang, Xu; Hang, Xiaomin; Tan, Jing; Yang, Hong
2015-06-01
Bifidobacteria are common inhabitants of the human gastrointestinal tract, and their application has increased dramatically in recent years due to their health-promoting effects. The ability of bifidobacteria to tolerate acidic environments is particularly important for their function as probiotics because they encounter such environments in food products and during passage through the gastrointestinal tract. In this study, we generated a derivative, Bifidobacterium breve BB8dpH, which displayed a stable, acid-resistant phenotype. To investigate the possible reasons for the higher acid tolerance of B. breve BB8dpH, as compared with its parental strain B. breve BB8, a combined transcriptome and physiological approach was used to characterize differences between the two strains. An analysis of the transcriptome by RNA-sequencing indicated that the expression of 121 genes was increased by more than 2-fold, while the expression of 146 genes was reduced more than 2-fold, in B. breve BB8dpH. Validation of the RNA-sequencing data using real-time quantitative PCR analysis demonstrated that the RNA-sequencing results were highly reliable. The comparison analysis, based on differentially expressed genes, suggested that the acid tolerance of B. breve BB8dpH was enhanced by regulating the expression of genes involved in carbohydrate transport and metabolism, energy production, synthesis of cell envelope components (peptidoglycan and exopolysaccharide), synthesis and transport of glutamate and glutamine, and histidine synthesis. Furthermore, an analysis of physiological data showed that B. breve BB8dpH displayed higher production of exopolysaccharide and lower H(+)-ATPase activity than B. breve BB8. The results presented here will improve our understanding of acid tolerance in bifidobacteria, and they will lead to the development of new strategies to enhance the acid tolerance of bifidobacterial strains. Copyright © 2015 Elsevier Ltd. All rights reserved.
Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping
2016-01-01
Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses. PMID:27446182
Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping
2016-01-01
Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses.
NASA Technical Reports Server (NTRS)
Lambertsen, C. J.; Clark, J. M.
1992-01-01
The Predictive Studies VI (Biochemical, endocrine, and hematological factors in human oxygen tolerance extension) Program consisted of two related areas of research activity, integrated in design and performance, that were each based on an ongoing analysis of human organ oxygen tolerance data obtained for the continuous oxygen exposures of the prior Predictive Studies V Program. The two research areas effectively blended broad investigation of systematically varied intermittent exposure patterns in animals with very selective evaluation of specific exposure patterns in man.
Identification of Mild Freezing Shock Response Pathways in Barley Based on Transcriptome Profiling.
Wang, Xiaolei; Wu, Dezhi; Yang, Qian; Zeng, Jianbin; Jin, Gulei; Chen, Zhong-Hua; Zhang, Guoping; Dai, Fei
2016-01-01
Low temperature is a major abiotic stress affecting crop growth and productivity. A better understanding of low temperature tolerance mechanisms is imperative for developing the crop cultivars with improved tolerance. We herein performed an Illumina RNA-sequencing experiment using two barley genotypes differing in freezing tolerance (Nure, tolerant and Tremois, sensitive), to determine the transcriptome profiling and genotypic difference under mild freezing shock treatment after a very short acclimation for gene induction. A total of 6474 differentially expressed genes, almost evenly distributed on the seven chromosomes, were identified. The key DEGs could be classified into six signaling pathways, i.e., Ca(2+) signaling, PtdOH signaling, CBFs pathway, ABA pathway, jasmonate pathway, and amylohydrolysis pathway. Expression values of DEGs in multiple signaling pathways were analyzed and a hypothetical model of mild freezing shock tolerance mechanism was proposed. Expression and sequence profile of HvCBFs cluster within Frost resistance-H2, a major quantitative trait locus on 5H being closely related to low temperature tolerance in barley, were further illustrated, considering the crucial role of HvCBFs on freezing tolerance. It may be concluded that multiple signaling pathways are activated in concert when barley is exposed to mild freezing shock. The pathway network we presented may provide a platform for further exploring the functions of genes involved in low temperature tolerance in barley.
Welker, F
2018-02-20
The study of ancient protein sequences is increasingly focused on the analysis of older samples, including those of ancient hominins. The analysis of such ancient proteomes thereby potentially suffers from "cross-species proteomic effects": the loss of peptide and protein identifications at increased evolutionary distances due to a larger number of protein sequence differences between the database sequence and the analyzed organism. Error-tolerant proteomic search algorithms should theoretically overcome this problem at both the peptide and protein level; however, this has not been demonstrated. If error-tolerant searches do not overcome the cross-species proteomic issue then there might be inherent biases in the identified proteomes. Here, a bioinformatics experiment is performed to test this using a set of modern human bone proteomes and three independent searches against sequence databases at increasing evolutionary distances: the human (0 Ma), chimpanzee (6-8 Ma) and orangutan (16-17 Ma) reference proteomes, respectively. Incorrectly suggested amino acid substitutions are absent when employing adequate filtering criteria for mutable Peptide Spectrum Matches (PSMs), but roughly half of the mutable PSMs were not recovered. As a result, peptide and protein identification rates are higher in error-tolerant mode compared to non-error-tolerant searches but did not recover protein identifications completely. Data indicates that peptide length and the number of mutations between the target and database sequences are the main factors influencing mutable PSM identification. The error-tolerant results suggest that the cross-species proteomics problem is not overcome at increasing evolutionary distances, even at the protein level. Peptide and protein loss has the potential to significantly impact divergence dating and proteome comparisons when using ancient samples as there is a bias towards the identification of conserved sequences and proteins. Effects are minimized between moderately divergent proteomes, as indicated by almost complete recovery of informative positions in the search against the chimpanzee proteome (≈90%, 6-8 Ma). This provides a bioinformatic background to future phylogenetic and proteomic analysis of ancient hominin proteomes, including the future description of novel hominin amino acid sequences, but also has negative implications for the study of fast-evolving proteins in hominins, non-hominin animals, and ancient bacterial proteins in evolutionary contexts.
Genetics of Combined Pituitary Hormone Deficiency: Roadmap into the Genome Era
Fang, Qing; George, Akima S.; Brinkmeier, Michelle L.; Mortensen, Amanda H.; Gergics, Peter; Cheung, Leonard Y. M.; Daly, Alexandre Z.; Ajmal, Adnan; Pérez Millán, María Ines; Ozel, A. Bilge; Kitzman, Jacob O.; Mills, Ryan E.; Li, Jun Z.
2016-01-01
The genetic basis for combined pituitary hormone deficiency (CPHD) is complex, involving 30 genes in a variety of syndromic and nonsyndromic presentations. Molecular diagnosis of this disorder is valuable for predicting disease progression, avoiding unnecessary surgery, and family planning. We expect that the application of high throughput sequencing will uncover additional contributing genes and eventually become a valuable tool for molecular diagnosis. For example, in the last 3 years, six new genes have been implicated in CPHD using whole-exome sequencing. In this review, we present a historical perspective on gene discovery for CPHD and predict approaches that may facilitate future gene identification projects conducted by clinicians and basic scientists. Guidelines for systematic reporting of genetic variants and assigning causality are emerging. We apply these guidelines retrospectively to reports of the genetic basis of CPHD and summarize modes of inheritance and penetrance for each of the known genes. In recent years, there have been great improvements in databases of genetic information for diverse populations. Some issues remain that make molecular diagnosis challenging in some cases. These include the inherent genetic complexity of this disorder, technical challenges like uneven coverage, differing results from variant calling and interpretation pipelines, the number of tolerated genetic alterations, and imperfect methods for predicting pathogenicity. We discuss approaches for future research in the genetics of CPHD. PMID:27828722
Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan
2016-01-01
Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.
Diray-Arce, Joann; Clement, Mark; Gul, Bilquees; Khan, M Ajmal; Nielsen, Brent L
2015-05-06
Improvement of crop production is needed to feed the growing world population as the amount and quality of agricultural land decreases and soil salinity increases. This has stimulated research on salt tolerance in plants. Most crops tolerate a limited amount of salt to survive and produce biomass, while halophytes (salt-tolerant plants) have the ability to grow with saline water utilizing specific biochemical mechanisms. However, little is known about the genes involved in salt tolerance. We have characterized the transcriptome of Suaeda fruticosa, a halophyte that has the ability to sequester salts in its leaves. Suaeda fruticosa is an annual shrub in the family Chenopodiaceae found in coastal and inland regions of Pakistan and Mediterranean shores. This plant is an obligate halophyte that grows optimally from 200-400 mM NaCl and can grow at up to 1000 mM NaCl. High throughput sequencing technology was performed to provide understanding of genes involved in the salt tolerance mechanism. De novo assembly of the transcriptome and analysis has allowed identification of differentially expressed and unique genes present in this non-conventional crop. Twelve sequencing libraries prepared from control (0 mM NaCl treated) and optimum (300 mM NaCl treated) plants were sequenced using Illumina Hiseq 2000 to investigate differential gene expression between shoots and roots of Suaeda fruticosa. The transcriptome was assembled de novo using Velvet and Oases k-45 and clustered using CDHIT-EST. There are 54,526 unigenes; among these 475 genes are downregulated and 44 are upregulated when samples from plants grown under optimal salt are compared with those grown without salt. BLAST analysis identified the differentially expressed genes, which were categorized in gene ontology terms and their pathways. This work has identified potential genes involved in salt tolerance in Suaeda fruticosa, and has provided an outline of tools to use for de novo transcriptome analysis. The assemblies that were used provide coverage of a considerable proportion of the transcriptome, which allows analysis of differential gene expression and identification of genes that may be involved in salt tolerance. The transcriptome may serve as a reference sequence for study of other succulent halophytes.
Skin testing with raw egg does not predict tolerance to baked egg in egg-allergic children.
Turner, P J; Kumar, K; Fox, A T
2014-11-01
Most children with egg allergy tolerate egg in baked foods, such as cake, but tolerance cannot be predicted with conventional allergy testing. We hypothesized that the skin prick test (SPT) wheal to unprocessed raw egg might predict tolerance of baked egg at formal oral food challenge (OFC). We conducted a retrospective chart review to assess the utility of SPT wheal to egg extract (EE), raw egg (RE), and the ratio of EE:RE in predicting outcome of baked-egg OFC in children presenting to our tertiary referral centers with a physician diagnosis of egg allergy and following complete egg avoidance in their diet, between 2009 and 2013. OFC were performed following a standardized protocol using baked egg in cake, to a total dose equivalent to 3g egg protein. Data were analyzed from 186 completed challenges: OFC was positive in 64 (34%) children and negative in 122 (66%). Six children experienced anaphylaxis at OFC. Children tolerant to baked egg were more likely to have a lower SPT to egg extract/raw egg and EE:RE (median 0.56) than their allergic counterparts (0.70, p < 0.05). However, ROC curve analysis demonstrated poor predictivity of challenge outcome, with AUC for SPT to egg extract, raw egg and EE:ER equal to 0.71, 0.63 and 0.60, respectively. EE:RE was not helpful in predicting outcome of baked-egg OFC. Indeed, SPT to egg extract was slightly better at predicting outcome than either SPT to raw egg or EE:RE. Unfortunately, tolerance to baked egg can only be predicted from previous history or through controlled exposure. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Li, Jian-Yong; Liu, Jiping; Dong, Dekun; Jia, Xiaomin; McCouch, Susan R.; Kochian, Leon V.
2014-01-01
Aluminum (Al) toxicity is a major constraint for crop production on acid soils which compose ∼40% of arable land in the tropics and subtropics. Rice is the most Al-tolerant cereal crop and offers a good model for identifying Al tolerance genes and mechanisms. Here we investigated natural variation in the rice Nramp aluminum transporter (NRAT1) gene encoding a root plasma membrane Al uptake transporter previously hypothesized to underlie a unique Al tolerance mechanism. DNA sequence variation in the NRAT1 coding and regulatory regions was associated with changes in NRAT1 expression and NRAT1 Al transport properties. These sequence changes resulted in significant differences in Al tolerance that were found to be associated with changes in the Al content of root cell wall and cell sap in 24 representative rice lines from a rice association panel. Expression of the tolerant OsNRAT1 allele in yeast resulted in higher Al uptake than did the sensitive allele and conferred greater Al tolerance when expressed in transgenic Arabidopsis. These findings indicate that NRAT1 plays an important role in rice Al tolerance by reducing the level of toxic Al in the root cell wall and transporting Al into the root cell, where it is ultimately sequestered in the vacuole. Given its ability to enhance Al tolerance in rice and Arabidopsis, this work suggests that the NRAT1 gene or its orthologs may be useful tools for enhancing Al tolerance in a wide range of plant species. PMID:24728832
Selles, Robert R; Franklin, Martin; Sapyta, Jeffrey; Compton, Scott N; Tommet, Doug; Jones, Richard N; Garcia, Abbe; Freeman, Jennifer
2018-04-01
The present study explored the concept of tolerance for child distress in 46 children (ages 5-8), along with their mothers and fathers, who received family-based CBT for OCD. The study sought to describe baseline tolerance, changes in tolerance with treatment, and the predictive impact of tolerance on symptom improvement. Tolerance was rated by clinicians on a single item and the CY-BOCS was used to measure OCD severity. Descriptive results suggested that all participants had some difficulty tolerating the child's distress at baseline while paired t tests indicated large improvements were made over treatment (d = 1.2-2.0). Fathers' initial tolerance was significantly related to symptom improvement in a multivariate regression as were fathers' and children's changes in distress tolerance over the course of treatment. Overall, results provide support for examining tolerance of child distress including its predictive impact and potential as a supplemental intervention target.
Fu, Xing-Zheng; Tong, Ya-Hua; Zhou, Xue; Ling, Li-Li; Chun, Chang-Pin; Cao, Li; Zeng, Ming; Peng, Liang-Zhi
2017-09-20
Plant metal tolerance proteins (MTPs) play important roles in heavy metal homeostasis; however, related information in citrus plants is limited. Citrus genome sequencing and assembly have enabled us to perform a systematic analysis of the MTP gene family. We identified 12 MTP genes in sweet orange, which we have named as CitMTP1 and CitMTP3 to CitMTP12 based on their sequence similarity to Arabidopsis thaliana MTPs. The CitMTPs were predicted to encode proteins of 864 to 2556 amino acids in length that included 4 to 6 putative transmembrane domains (TMDs). Furthermore, all the CitMTPs contained a highly conserved signature sequence encompassing the TMD-II and the start of the TMD-III. Phylogenetic analysis further classified the CitMTPs into Fe/Zn-MTP, Mn-MTP, and Zn-MTP subgroups, which coincided with the MTPs of A. thaliana and rice. The closely clustered CitMTPs shared a similar gene structure. Expression analysis indicated that most CitMTP transcripts were upregulated to various extents under heavy metal stress. Among these, CitMTP5 in the roots and CitMTP11 in the leaves during Zn stress, CitMTP8 in the roots and CitMTP8.1 in the leaves during Mn stress, CitMTP12 in the roots and CitMTP1 in the leaves during Cu stress, and CitMTP11 in the roots and CitMTP1 in the leaves during Cd stress showed the highest extent of upregulation. These findings are suggestive of their individual roles in heavy metal detoxification. Copyright © 2017 Elsevier B.V. All rights reserved.
The systematic evolution of a NASA software technology, Appendix C
NASA Technical Reports Server (NTRS)
Deregt, M. P.; Dulfer, J. E.
1972-01-01
A long range program is described whose ultimate purpose is to make possible the production of software in NASA within predictable schedule and budget constraints and with major characteristics such as size, run-time, and correctness predictable within reasonable tolerances. As part of the program a pilot NASA computer center will be chosen to apply software development and management techniques systematically and determine a set which is effective. The techniques will be developed by a Technology Group, which will guide the pilot project and be responsible for its success. The application of the technology will involve a sequence of NASA programming tasks graduated from simpler ones at first to complex systems in late phases of the project. The evaluation of the technology will be made by monitoring the operation of the software at the users' installations. In this way a coherent discipline for software design, production maintenance, and management will be evolved.
Multiple objects tracking with HOGs matching in circular windows
NASA Astrophysics Data System (ADS)
Miramontes-Jaramillo, Daniel; Kober, Vitaly; Díaz-Ramírez, Víctor H.
2014-09-01
In recent years tracking applications with development of new technologies like smart TVs, Kinect, Google Glass and Oculus Rift become very important. When tracking uses a matching algorithm, a good prediction algorithm is required to reduce the search area for each object to be tracked as well as processing time. In this work, we analyze the performance of different tracking algorithms based on prediction and matching for a real-time tracking multiple objects. The used matching algorithm utilizes histograms of oriented gradients. It carries out matching in circular windows, and possesses rotation invariance and tolerance to viewpoint and scale changes. The proposed algorithm is implemented in a personal computer with GPU, and its performance is analyzed in terms of processing time in real scenarios. Such implementation takes advantage of current technologies and helps to process video sequences in real-time for tracking several objects at the same time.
MicroRNAs As Potential Targets for Abiotic Stress Tolerance in Plants
Shriram, Varsha; Kumar, Vinay; Devarumath, Rachayya M.; Khare, Tushar S.; Wani, Shabir H.
2016-01-01
The microRNAs (miRNAs) are small (20–24 nt) sized, non-coding, single stranded riboregulator RNAs abundant in higher organisms. Recent findings have established that plants assign miRNAs as critical post-transcriptional regulators of gene expression in sequence-specific manner to respond to numerous abiotic stresses they face during their growth cycle. These small RNAs regulate gene expression via translational inhibition. Usually, stress induced miRNAs downregulate their target mRNAs, whereas, their downregulation leads to accumulation and function of positive regulators. In the past decade, investigations were mainly aimed to identify plant miRNAs, responsive to individual or multiple environmental factors, profiling their expression patterns and recognizing their roles in stress responses and tolerance. Altered expressions of miRNAs implicated in plant growth and development have been reported in several plant species subjected to abiotic stress conditions such as drought, salinity, extreme temperatures, nutrient deprivation, and heavy metals. These findings indicate that miRNAs may hold the key as potential targets for genetic manipulations to engineer abiotic stress tolerance in crop plants. This review is aimed to provide recent updates on plant miRNAs, their biogenesis and functions, target prediction and identification, computational tools and databases available for plant miRNAs, and their roles in abiotic stress-responses and adaptive mechanisms in major crop plants. Besides, the recent case studies for overexpressing the selected miRNAs for miRNA-mediated enhanced abiotic stress tolerance of transgenic plants have been discussed. PMID:27379117
Buitrago, Lorena; Rendon, Augusto; Liang, Yupu; Simeoni, Ilenia; Negri, Ana; Filizola, Marta; Ouwehand, Willem H.; Coller, Barry S.; Alessi, Marie-Christine; Ballmaier, Matthias; Bariana, Tadbir; Bellissimo, Daniel; Bertoli, Marta; Bray, Paul; Bury, Loredana; Carrell, Robin; Cattaneo, Marco; Collins, Peter; French, Deborah; Favier, Remi; Freson, Kathleen; Furie, Bruce; Germeshausen, Manuela; Ghevaert, Cedric; Gomez, Keith; Goodeve, Anne; Gresele, Paolo; Guerrero, Jose; Hampshire, Dan J.; Hadinnapola, Charaka; Heemskerk, Johan; Henskens, Yvonne; Hill, Marian; Hogg, Nancy; Johnsen, Jill; Kahr, Walter; Kerr, Ron; Kunishima, Shinji; Laffan, Michael; Natwani, Amit; Neerman-Arbez, Marguerite; Nurden, Paquita; Nurden, Alan; Ormiston, Mark; Othman, Maha; Ouwehand, Willem; Perry, David; Vilk, Shoshana Ravel; Reitsma, Pieter; Rondina, Matthew; Simeoni, Ilenia; Smethurst, Peter; Stephens, Jonathan; Stevenson, William; Szkotak, Artur; Turro, Ernest; Van Geet, Christel; Vries, Minka; Ward, June; Waye, John; Westbury, Sarah; Whiteheart, Sidney; Wilcox, David; Zhang, Bi
2015-01-01
Next-generation sequencing is transforming our understanding of human genetic variation but assessing the functional impact of novel variants presents challenges. We analyzed missense variants in the integrin αIIbβ3 receptor subunit genes ITGA2B and ITGB3 identified by whole-exome or -genome sequencing in the ThromboGenomics project, comprising ∼32,000 alleles from 16,108 individuals. We analyzed the results in comparison with 111 missense variants in these genes previously reported as being associated with Glanzmann thrombasthenia (GT), 20 associated with alloimmune thrombocytopenia, and 5 associated with aniso/macrothrombocytopenia. We identified 114 novel missense variants in ITGA2B (affecting ∼11% of the amino acids) and 68 novel missense variants in ITGB3 (affecting ∼9% of the amino acids). Of the variants, 96% had minor allele frequencies (MAF) < 0.1%, indicating their rarity. Based on sequence conservation, MAF, and location on a complete model of αIIbβ3, we selected three novel variants that affect amino acids previously associated with GT for expression in HEK293 cells. αIIb P176H and β3 C547G severely reduced αIIbβ3 expression, whereas αIIb P943A partially reduced αIIbβ3 expression and had no effect on fibrinogen binding. We used receiver operating characteristic curves of combined annotation-dependent depletion, Polyphen 2-HDIV, and sorting intolerant from tolerant to estimate the percentage of novel variants likely to be deleterious. At optimal cut-off values, which had 69–98% sensitivity in detecting GT mutations, between 27% and 71% of the novel αIIb or β3 missense variants were predicted to be deleterious. Our data have implications for understanding the evolutionary pressure on αIIbβ3 and highlight the challenges in predicting the clinical significance of novel missense variants. PMID:25827233
Ventura, Marco; Turroni, Francesca; Zomer, Aldert; Foroni, Elena; Giubellini, Vanessa; Bottacini, Francesca; Canchaya, Carlos; Claesson, Marcus J.; He, Fei; Mantzourani, Maria; Mulas, Laura; Ferrarini, Alberto; Gao, Beile; Delledonne, Massimo; Henrissat, Bernard; Coutinho, Pedro; Oggioni, Marco; Gupta, Radhey S.; Zhang, Ziding; Beighton, David; Fitzgerald, Gerald F.; O'Toole, Paul W.; van Sinderen, Douwe
2009-01-01
Bifidobacteria, one of the relatively dominant components of the human intestinal microbiota, are considered one of the key groups of beneficial intestinal bacteria (probiotic bacteria). However, in addition to health-promoting taxa, the genus Bifidobacterium also includes Bifidobacterium dentium, an opportunistic cariogenic pathogen. The genetic basis for the ability of B. dentium to survive in the oral cavity and contribute to caries development is not understood. The genome of B. dentium Bd1, a strain isolated from dental caries, was sequenced to completion to uncover a single circular 2,636,368 base pair chromosome with 2,143 predicted open reading frames. Annotation of the genome sequence revealed multiple ways in which B. dentium has adapted to the oral environment through specialized nutrient acquisition, defences against antimicrobials, and gene products that increase fitness and competitiveness within the oral niche. B. dentium Bd1 was shown to metabolize a wide variety of carbohydrates, consistent with genome-based predictions, while colonization and persistence factors implicated in tissue adhesion, acid tolerance, and the metabolism of human saliva-derived compounds were also identified. Global transcriptome analysis demonstrated that many of the genes encoding these predicted traits are highly expressed under relevant physiological conditions. This is the first report to identify, through various genomic approaches, specific genetic adaptations of a Bifidobacterium taxon, Bifidobacterium dentium Bd1, to a lifestyle as a cariogenic microorganism in the oral cavity. In silico analysis and comparative genomic hybridization experiments clearly reveal a high level of genome conservation among various B. dentium strains. The data indicate that the genome of this opportunistic cariogen has evolved through a very limited number of horizontal gene acquisition events, highlighting the narrow boundaries that separate commensals from opportunistic pathogens. PMID:20041198
Deep Super-SAGE transcriptomic analysis of cold acclimation in lentil (Lens culinaris Medik.).
Barrios, Abel; Caminero, Constantino; García, Pedro; Krezdorn, Nicolas; Hoffmeier, Klaus; Winter, Peter; Pérez de la Vega, Marcelino
2017-06-30
Frost is one of the main abiotic stresses limiting plant distribution and crop production. To cope with the stress, plants evolved adaptations known as cold acclimation or chilling tolerance to maximize frost tolerance. Cold acclimation is a progressive acquisition of freezing tolerance by plants subjected to low non-freezing temperatures which subsequently allows them to survive exposure to frost. Lentil is a cool season grain legume that is challenged by winter frost in some areas of its cultivation. To better understand the genetic base of frost tolerance differential gene expression in response to cold acclimation was investigated. Recombinant inbred lines (RILs) from the cross Precoz x WA8649041 were first classified as cold tolerant or cold susceptible according to their response to temperatures between -3 to -15 °C. Then, RILs from both extremes of the response curve were cold acclimated and the leaf transcriptomes of two bulks each of eight frost tolerant and seven cold susceptible RILs were investigated by Deep Super-SAGE transcriptome profiling. Thus, four RNA bulks were analysed: the acclimated susceptible, the acclimated tolerant and the respective controls (non-acclimated susceptible and non-acclimated tolerant). Approximately 16.5 million 26 nucleotide long Super-SAGE tags were sequenced in the four sets (between ~3 and 5.4 millions). In total, 133,077 different unitags, each representing a particular transcript isoform, were identified in these four sets. Tags which showed a significantly different abundance in any of the bulks (fold change ≥4.0 and a significant p-value <0.001) were selected and used to identify the corresponding lentil gene sequence. Three hundred of such lentil sequences were identified. Most of their known homologs coded for glycine-rich, cold and drought-regulated proteins, dormancy-associated proteins, proline-rich proteins (PRPs) and other membrane proteins. These were generally but not exclusively over-expressed in the acclimated tolerant lines. This set of candidate genes implicated in the response to frost in lentil represents an useful base for deeper and more detailed investigations into this important agronomic trait in future.
Lin, Jing; Bruni, Francesca M.; Fu, Zhiyan; Maloney, Jennifer; Bardina, Ludmilla; Boner, Attilio L.; Gimenez, Gustavo; Sampson, Hugh A.
2013-01-01
Background Peanut allergy is relatively common, typically permanent, and often severe. Double-blind, placebo-controlled food challenge is considered the gold standard for the diagnosis of food allergy–related disorders. However, the complexity and potential of double-blind, placebo-controlled food challenge to cause life-threatening allergic reactions affects its clinical application. A laboratory test that could accurately diagnose symptomatic peanut allergy would greatly facilitate clinical practice. Objective We sought to develop an allergy diagnostic method that could correctly predict symptomatic peanut allergy by using peptide microarray immunoassays and bioinformatic methods. Methods Microarray immunoassays were performed by using the sera from 62 patients (31 with symptomatic peanut allergy and 31 who had outgrown their peanut allergy or were sensitized but were clinically tolerant to peanut). Specific IgE and IgG4 binding to 419 overlapping peptides (15 mers, 3 offset) covering the amino acid sequences of Ara h 1, Ara h 2, and Ara h 3 were measured by using a peptide microarray immunoassay. Bioinformatic methods were applied for data analysis. Results Individuals with peanut allergy showed significantly greater IgE binding and broader epitope diversity than did peanut-tolerant individuals. No significant difference in IgG4 binding was found between groups. By using machine learning methods, 4 peptide biomarkers were identified and prediction models that can predict the outcome of double-blind, placebo-controlled food challenges with high accuracy were developed by using a combination of the biomarkers. Conclusions In this study, we developed a novel diagnostic approach that can predict peanut allergy with high accuracy by combining the results of a peptide microarray immunoassay and bioinformatic methods. Further studies are needed to validate the efficacy of this assay in clinical practice. PMID:22444503
Chen, Xin; Zhang, Jin; Liu, Qingzhong; Guo, Wei; Zhao, Tiantian; Ma, Qinghua; Wang, Guixi
2014-01-01
The genus Corylus is an important woody species in Northeast China. Its products, hazelnuts, constitute one of the most important raw materials for the pastry and chocolate industry. However, limited genetic research has focused on Corylus because of the lack of genomic resources. The advent of high-throughput sequencing technologies provides a turning point for Corylus research. In the present study, we performed de novo transcriptome sequencing for the first time to produce a comprehensive database for the Corylus heterophylla Fisch floral buds. The C. heterophylla Fisch floral buds transcriptome was sequenced using the Illumina paired-end sequencing technology. We produced 28,930,890 raw reads and assembled them into 82,684 contigs. A total of 40,941 unigenes were identified, among which 30,549 were annotated in the NCBI Non-redundant (Nr) protein database and 18,581 were annotated in the Swiss-Prot database. Of these annotated unigenes, 25,311 and 10,514 unigenes were assigned to gene ontology (GO) categories and clusters of orthologous groups (COG), respectively. We could map 17,207 unigenes onto 128 pathways using the Kyoto Encyclopedia of Genes and Genomes Pathway (KEGG) database. Additionally, based on the transcriptome, we constructed a candidate cold tolerance gene set of C. heterophylla Fisch floral buds. The expression patterns of selected genes during four stages of cold acclimation suggested that these genes might be involved in different cold responsive stages in C. heterophylla Fisch floral buds. The transcriptome of C. heterophylla Fisch floral buds was deep sequenced, de novo assembled, and annotated, providing abundant data to better understand the C. heterophylla Fisch floral buds transcriptome. Candidate genes potentially involved in cold tolerance were identified, providing a material basis for future molecular mechanism analysis of C. heterophylla Fisch floral buds tolerant to cold stress.
Yu, Yue; Liu, Hongwei; Tu, Maolin; Qiao, Meiling; Wang, Zhenyu; Du, Ming
2017-12-01
Ruditapes philippinarum is nutrient-rich and widely-distributed, but little attention has been paid to the identification and characterization of the bioactive peptides in the bivalve. In the present study, we evaluated the peptides of the R. philippinarum that were enzymolysised by trypsin using a combination of ultra-performance liquid chromatography separation and electrospray ionization quadrupole time-of-flight tandem mass spectrometry, followed by data processing and sequence-similarity database searching. The potential allergenicity of the peptides was assessed in silico. The enzymolysis was performed under the conditions: E:S 3:100 (w/w), pH 9.0, 45 °C for 4 h. After separation and detection, the Swiss-Prot database and a Ruditapes philippinarum sequence database were used: 966 unique peptides were identified by non-error tolerant database searching; 173 peptides matching 55 precursor proteins comprised highly conserved cytoskeleton proteins. The remaining 793 peptides were identified from the R. philippinarum sequence database. The results showed that 510 peptides were labeled as allergens and 31 peptides were potential allergens; 425 peptides were predicted to be nonallergenic. The abundant peptide information contributes to further investigations of the structure and potential function of R. philippinarum. Additional in vitro studies are required to demonstrate and ensure the correct production of the hydrolysates for use in the food industry with respect to R. philippinarum. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Bailey, Allison; De Wit, Pierre; Thor, Peter; Browman, Howard I; Bjelland, Reidun; Shema, Steven; Fields, David M; Runge, Jeffrey A; Thompson, Cameron; Hop, Haakon
2017-09-01
Ocean acidification is the increase in seawater p CO 2 due to the uptake of atmospheric anthropogenic CO 2 , with the largest changes predicted to occur in the Arctic seas. For some marine organisms, this change in p CO 2 , and associated decrease in pH, represents a climate change-related stressor. In this study, we investigated the gene expression patterns of nauplii of the Arctic copepod Calanus glacialis cultured at low pH levels. We have previously shown that organismal-level performance (development, growth, respiration) of C. glacialis nauplii is unaffected by low pH. Here, we investigated the molecular-level response to lowered pH in order to elucidate the physiological processes involved in this tolerance. Nauplii from wild-caught C. glacialis were cultured at four pH levels (8.05, 7.9, 7.7, 7.5). At stage N6, mRNA was extracted and sequenced using RNA-seq. The physiological functionality of the proteins identified was categorized using Gene Ontology and KEGG pathways. We found that the expression of 151 contigs varied significantly with pH on a continuous scale (93% downregulated with decreasing pH). Gene set enrichment analysis revealed that, of the processes downregulated, many were components of the universal cellular stress response, including DNA repair, redox regulation, protein folding, and proteolysis. Sodium:proton antiporters were among the processes significantly upregulated, indicating that these ion pumps were involved in maintaining cellular pH homeostasis. C. glacialis significantly alters its gene expression at low pH, although they maintain normal larval development. Understanding what confers tolerance to some species will support our ability to predict the effects of future ocean acidification on marine organisms.
Method and apparatus for faulty memory utilization
Cher, Chen-Yong; Andrade Costa, Carlos H.; Park, Yoonho; Rosenburg, Bryan S.; Ryu, Kyung D.
2016-04-19
A method for faulty memory utilization in a memory system includes: obtaining information regarding memory health status of at least one memory page in the memory system; determining an error tolerance of the memory page when the information regarding memory health status indicates that a failure is predicted to occur in an area of the memory system affecting the memory page; initiating a migration of data stored in the memory page when it is determined that the data stored in the memory page is non-error-tolerant; notifying at least one application regarding a predicted operating system failure and/or a predicted application failure when it is determined that data stored in the memory page is non-error-tolerant and cannot be migrated; and notifying at least one application regarding the memory failure predicted to occur when it is determined that data stored in the memory page is error-tolerant.
CRISPR interference and priming varies with individual spacer sequences
Xue, Chaoyou; Seetharam, Arun S.; Musharova, Olga; Severinov, Konstantin; J. Brouns, Stan J.; Severin, Andrew J.; Sashital, Dipali G.
2015-01-01
CRISPR–Cas (clustered regularly interspaced short palindromic repeats-CRISPR associated) systems allow bacteria to adapt to infection by acquiring ‘spacer’ sequences from invader DNA into genomic CRISPR loci. Cas proteins use RNAs derived from these loci to target cognate sequences for destruction through CRISPR interference. Mutations in the protospacer adjacent motif (PAM) and seed regions block interference but promote rapid ‘primed’ adaptation. Here, we use multiple spacer sequences to reexamine the PAM and seed sequence requirements for interference and priming in the Escherichia coli Type I-E CRISPR–Cas system. Surprisingly, CRISPR interference is far more tolerant of mutations in the seed and the PAM than previously reported, and this mutational tolerance, as well as priming activity, is highly dependent on spacer sequence. We identify a large number of functional PAMs that can promote interference, priming or both activities, depending on the associated spacer sequence. Functional PAMs are preferentially acquired during unprimed ‘naïve’ adaptation, leading to a rapid priming response following infection. Our results provide numerous insights into the importance of both spacer and target sequences for interference and priming, and reveal that priming is a major pathway for adaptation during initial infection. PMID:26586800
Renard, Bernhard Y.; Xu, Buote; Kirchner, Marc; Zickmann, Franziska; Winter, Dominic; Korten, Simone; Brattig, Norbert W.; Tzur, Amit; Hamprecht, Fred A.; Steen, Hanno
2012-01-01
Currently, the reliable identification of peptides and proteins is only feasible when thoroughly annotated sequence databases are available. Although sequencing capacities continue to grow, many organisms remain without reliable, fully annotated reference genomes required for proteomic analyses. Standard database search algorithms fail to identify peptides that are not exactly contained in a protein database. De novo searches are generally hindered by their restricted reliability, and current error-tolerant search strategies are limited by global, heuristic tradeoffs between database and spectral information. We propose a Bayesian information criterion-driven error-tolerant peptide search (BICEPS) and offer an open source implementation based on this statistical criterion to automatically balance the information of each single spectrum and the database, while limiting the run time. We show that BICEPS performs as well as current database search algorithms when such algorithms are applied to sequenced organisms, whereas BICEPS only uses a remotely related organism database. For instance, we use a chicken instead of a human database corresponding to an evolutionary distance of more than 300 million years (International Chicken Genome Sequencing Consortium (2004) Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432, 695–716). We demonstrate the successful application to cross-species proteomics with a 33% increase in the number of identified proteins for a filarial nematode sample of Litomosoides sigmodontis. PMID:22493179
Hua, Jessica; Jones, Devin K; Mattes, Brian M; Cothran, Rickey D; Relyea, Rick A; Hoverman, Jason T
2015-11-01
We examined 10 wood frog populations distributed along an agricultural gradient for their tolerance to six pesticides (carbaryl, malathion, cypermethrin, permethrin, imidacloprid, and thiamethoxam) that differed in date of first registration (pesticide novelty) and mode-of-action (MOA). Our goals were to assess whether: 1) tolerance was correlated with distance to agriculture for each pesticide, 2) pesticide novelty predicted the likelihood of evolved tolerance, and 3) populations display cross-tolerance between pesticides that share and differ in MOA. Wood frog populations located close to agriculture were more tolerant to carbaryl and malathion than populations far from agriculture. Moreover, the strength of the relationship between distance to agriculture and tolerance was stronger for older pesticides compared to newer pesticides. Finally, we found evidence for cross-tolerance between carbaryl and malathion (two pesticides that share MOA). This study provides one of the most comprehensive approaches for understanding patterns of evolved tolerance in non-pest species. Copyright © 2015 Elsevier Ltd. All rights reserved.
Novel AroA from Pseudomonas putida Confers Tobacco Plant with High Tolerance to Glyphosate
Yan, Hai-Qin; Chang, Su-Hua; Tian, Zhe-Xian; Zhang, Le; Sun, Yi-Cheng; Li, Yan; Wang, Jing; Wang, Yi-Ping
2011-01-01
Glyphosate is a non-selective broad-spectrum herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, also designated as AroA), a key enzyme in the aromatic amino acid biosynthesis pathway in microorganisms and plants. Previously, we reported that a novel AroA (PpAroA1) from Pseudomonas putida had high tolerance to glyphosate, with little homology to class I or class II glyphosate-tolerant AroA. In this study, the coding sequence of PpAroA1 was optimized for tobacco. For maturation of the enzyme in chloroplast, a chloroplast transit peptide coding sequence was fused in frame with the optimized aroA gene (PparoA1optimized) at the 5′ end. The PparoA1optimized gene was introduced into the tobacco (Nicotiana tabacum L. cv. W38) genome via Agrobacterium-mediated transformation. The transformed explants were first screened in shoot induction medium containing kanamycin. Then glyphosate tolerance was assayed in putative transgenic plants and its T1 progeny. Our results show that the PpAroA1 from Pseudomonas putida can efficiently confer tobacco plants with high glyphosate tolerance. Transgenic tobacco overexpressing the PparoA1optimized gene exhibit high tolerance to glyphosate, which suggest that the novel PpAroA1 is a new and good candidate applied in transgenic crops with glyphosate tolerance in future. PMID:21611121
Singh, Dinkar; Yadav, Narendra Singh; Tiwari, Vivekanand; Agarwal, Pradeep K.; Jha, Bhavanath
2016-01-01
About 1000 salt-responsive ESTs were identified from an extreme halophyte Salicornia brachiata. Among these, a novel salt-inducible gene SbSLSP (Salicornia brachiata SNARE-like superfamily protein), showed up-regulation upon salinity and dehydration stress. The presence of cis-regulatory motifs related to abiotic stress in the putative promoter region supports our finding that SbSLSP gene is inducible by abiotic stress. The SbSLSP protein showed a high sequence identity to hypothetical/uncharacterized proteins from Beta vulgaris, Spinacia oleracea, Eucalyptus grandis, and Prunus persica and with SNARE-like superfamily proteins from Zostera marina and Arabidopsis thaliana. Bioinformatics analysis predicted a clathrin adaptor complex small-chain domain and N-myristoylation site in the SbSLSP protein. Subcellular localization studies indicated that the SbSLSP protein is mainly localized in the plasma membrane. Using transgenic tobacco lines, we establish that overexpression of SbSLSP resulted in elevated tolerance to salt and drought stress. The improved tolerance was confirmed by alterations in a range of physiological parameters, including high germination and survival rate, higher leaf chlorophyll contents, and reduced accumulation of Na+ ion and reactive oxygen species (ROS). Furthermore, overexpressing lines also showed lower water loss, higher cell membrane stability, and increased accumulation of proline and ROS-scavenging enzymes. Overexpression of SbSLSP also enhanced the transcript levels of ROS-scavenging and signaling enzyme genes. This study is the first investigation of the function of the SbSLSP gene as a novel determinant of salinity/drought tolerance. The results suggest that SbSLSP could be a potential candidate to increase salinity and drought tolerance in crop plants for sustainable agriculture in semi-arid saline soil. PMID:27313584
Kondo, M; Nagao, Y; Mahbub, M H; Tanabe, T; Tanizawa, Y
2018-04-29
To identify factors predicting early postpartum glucose intolerance in Japanese women with gestational diabetes mellitus, using decision-curve analysis. A retrospective cohort study was performed. The participants were 123 Japanese women with gestational diabetes who underwent 75-g oral glucose tolerance tests at 8-12 weeks after delivery. They were divided into a glucose intolerance and a normal glucose tolerance group based on postpartum oral glucose tolerance test results. Analysis of the pregnancy oral glucose tolerance test results showed predictive factors for postpartum glucose intolerance. We also evaluated the clinical usefulness of the prediction model based on decision-curve analysis. Of 123 women, 78 (63.4%) had normoglycaemia and 45 (36.6%) had glucose intolerance. Multivariable logistic regression analysis showed insulinogenic index/fasting immunoreactive insulin and summation of glucose levels, assessed during pregnancy oral glucose tolerance tests (total glucose), to be independent risk factors for postpartum glucose intolerance. Evaluating the regression models, the best discrimination (area under the curve 0.725) was obtained using the basic model (i.e. age, family history of diabetes, BMI ≥25 kg/m 2 and use of insulin during pregnancy) plus insulinogenic index/fasting immunoreactive insulin <1.1. Decision-curve analysis showed that combining insulinogenic index/fasting immunoreactive insulin <1.1 with basic clinical information resulted in superior net benefits for prediction of postpartum glucose intolerance. Insulinogenic index/fasting immunoreactive insulin calculated using oral glucose tolerance test results during pregnancy is potentially useful for predicting early postpartum glucose intolerance in Japanese women with gestational diabetes. © 2018 Diabetes UK.
Nitrification and occurrence of salt-tolerant nitrifying bacteria in the Negev desert soils.
Nejidat, Ali
2005-03-01
Ammonia oxidation potential, major ammonia oxidizers and occurrence of salt-tolerant nitrifying bacteria were studied in soil samples collected from diverse ecosystems along the northern Negev desert. Great diversity in ammonia oxidation potential was observed among the soil samples, and ammonia oxidizers were the rate-limiting step of nitrification. Denaturing gradient gel electrophoresis and partial 16S rRNA gene sequences indicate that members of the genus Nitrosospira are the major ammonia oxidizers in the natural desert soil samples. Upon enrichment with different salt concentrations, salt-tolerant nitrifying enrichments were established from several soil samples. In two enrichments, nitrification was not inhibited by 400 mM NaCl. Electrophoretic analysis and partial 16S rRNA gene sequences indicate that Nitrosomonas species were dominant in the 400 mM salt enrichment. The results point towards the potential of the desert ecosystem as a source of stress-tolerant nitrifying bacteria or other microorganisms with important properties.
Badhan, Sapna; Kole, Pravas; Ball, Andrew; Mantri, Nitin
2018-06-13
Chickpea (Cicer arietinum L.) is the second most important winter crop which is consumed globally due to its high nutritional value. Chickpea as one of the leguminous crop is important in crop rotation with cereal crops like wheat and barley. The main constraints for chickpea production are abiotic stresses such as drought, salinity, and heat. Among these, drought is a major cause of the decline in chickpea production in worldwide. Studies conducted so far have provided a limited insight into different genetic pathways associated with drought tolerance/response. In this study, the leaf tissue from shoots apical meristem stage of drought tolerant (ICC8261) and drought sensitive (ICC283) genotypes were analysed using RNA sequencing to identify genes/pathways associated with drought tolerance/sensitivity in both genotypes. It was observed that genes related to ethylene response, MYB-related protein, xyloglucan endotransglycosylase, alkane hydroxylase MAH-like, BON-1 associated, peroxidase 3, cysteine-rich and transmembrane domain, vignain and mitochondrial uncoupling were specifically up-regulated in the tolerant genotype whereas, same genes were down-regulated in sensitive genotype. The crosstalk between the different hormones and transcriptional factors involved in drought tolerance and sensitivity in both genotypes make them great candidates for future research. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Profiling of drought-responsive microRNA and mRNA in tomato using high-throughput sequencing.
Liu, Minmin; Yu, Huiyang; Zhao, Gangjun; Huang, Qiufeng; Lu, Yongen; Ouyang, Bo
2017-06-26
Abiotic stresses cause severe loss of crop production. Among them, drought is one of the most frequent environmental stresses, which limits crop growth, development and productivity. Plant drought tolerance is fine-tuned by a complex gene regulatory network. Understanding the molecular regulation of this polygenic trait is crucial for the eventual success to improve plant yield and quality. Recent studies have demonstrated that microRNAs play critical roles in plant drought tolerance. However, little is known about the microRNA in drought response of the model plant tomato. Here, we described the profiling of drought-responsive microRNA and mRNA in tomato using high-throughput next-generation sequencing. Drought stress was applied on the seedlings of M82, a drought-sensitive cultivated tomato genotype, and IL9-1, a drought-tolerant introgression line derived from the stress-resistant wild species Solanum pennellii LA0716 and M82. Under drought, IL9-1 performed superior than M82 regarding survival rate, H 2 O 2 elimination and leaf turgor maintenance. A total of four small RNA and eight mRNA libraries were constructed and sequenced using Illumina sequencing technology. 105 conserved and 179 novel microRNAs were identified, among them, 54 and 98 were differentially expressed upon drought stress, respectively. The majority of the differentially-expressed conserved microRNAs was up-regulated in IL9-1 whereas down-regulated in M82. Under drought stress, 2714 and 1161 genes were found to be differentially expressed in M82 and IL9-1, respectively, and many of their homologues are involved in plant stress, such as genes encoding transcription factor and protein kinase. Various pathways involved in abiotic stress were revealed by Gene Ontology and pathway analysis. The mRNA sequencing results indicated that most of the target genes were regulated by their corresponding microRNAs, which suggested that microRNAs may play essential roles in the drought tolerance of tomato. In this study, numerous microRNAs and mRNAs involved in the drought response of tomato were identified using high-throughput sequencing, which will provide new insights into the complex regulatory network of plant adaption to drought stress. This work will also help to exploit new players functioning in plant drought-stress tolerance.
Shukla, Aayushi; Pagán, Israel; García-Arenal, Fernando
2018-06-01
Plant viruses often harm their hosts, which have developed mechanisms to prevent or minimize the effects of virus infection. Resistance and tolerance are the two main plant defences to pathogens. Although resistance to plant viruses has been studied extensively, tolerance has received much less attention. Theory predicts that tolerance to low-virulent parasites would be achieved through resource reallocation from growth to reproduction, whereas tolerance to high-virulent parasites would be attained through shortening of the pre-reproductive period. We have shown previously that the tolerance of Arabidopsis thaliana to Cucumber mosaic virus (CMV), a relatively low-virulent virus in this host, accords to these predictions. However, whether other viruses trigger the same response, and how A. thaliana copes with highly virulent virus infections remains unexplored. To address these questions, we challenged six A. thaliana wild genotypes with five viruses with different genomic structures, life histories and transmission modes. In these plants, we quantified virus multiplication, virulence, and the effects of infection on plant growth and reproduction, and on the developmental schedule. Our results indicate that virus multiplication varies according to the virus × host genotype interaction. Conversely, effective tolerance is observed only on CMV infection, and is associated with resource reallocation from growth to reproduction. Tolerance to the other viruses is observed only in specific host-virus combinations and, at odds with theoretical predictions, is linked to longer pre-reproductive periods. These findings only partially agree with theoretical predictions, and contribute to a better understanding of pathogenic processes in plant-virus interactions. © 2017 BSPP AND JOHN WILEY & SONS LTD.
Impact Damage and Strain Rate Effects for Toughened Epoxy Composite Structures
NASA Technical Reports Server (NTRS)
Chamis, Christos C.; Minnetyan, Levon
2006-01-01
Structural integrity of composite systems under dynamic impact loading is investigated herein. The GENOA virtual testing software environment is used to implement the effects of dynamic loading on fracture progression and damage tolerance. Combinations of graphite and glass fibers with a toughened epoxy matrix are investigated. The effect of a ceramic coating for the absorption of impact energy is also included. Impact and post impact simulations include verification and prediction of (1) Load and Impact Energy, (2) Impact Damage Size, (3) Maximum Impact Peak Load, (4) Residual Strength, (5) Maximum Displacement, (6) Contribution of Failure Modes to Failure Mechanisms, (7) Prediction of Impact Load Versus Time, and (8) Damage, and Fracture Pattern. A computer model is utilized for the assessment of structural response, progressive fracture, and defect/damage tolerance characteristics. Results show the damage progression sequence and the changes in the structural response characteristics due to dynamic impact. The fundamental premise of computational simulation is that the complete evaluation of composite fracture requires an assessment of ply and subply level damage/fracture processes as the structure is subjected to loads. Simulation results for the graphite/epoxy composite were compared with the impact and tension failure test data, correlation and verification was obtained that included: (1) impact energy, (2) damage size, (3) maximum impact peak load, (4) residual strength, (5) maximum displacement, and (6) failure mechanisms of the composite structure.
Tolerance as a function of disapproval and respect: The case of Muslims.
Simon, Bernd; Schaefer, Christoph Daniel
2016-06-01
The article assesses a disapproval-respect model of tolerance according to which tolerance is made possible when disapproval of others' beliefs, preferences, or practices is balanced by respect for them as equal fellow citizens. Employing a sample of Muslims living in Germany, we predicted and found that such respect was more predictive of outgroup toleration when respondents disapproved rather than approved of the outgroups' beliefs, preferences, or practices. Moreover, respondents who displayed the critical combination of extreme disapproval and full respect indeed showed outgroup toleration. A parallel pattern of results was observed for willingness to engage in intergroup cooperation. Practical implications are discussed. © 2015 The British Psychological Society.
DNA targeting specificity of RNA-guided Cas9 nucleases.
Hsu, Patrick D; Scott, David A; Weinstein, Joshua A; Ran, F Ann; Konermann, Silvana; Agarwala, Vineeta; Li, Yinqing; Fine, Eli J; Wu, Xuebing; Shalem, Ophir; Cradick, Thomas J; Marraffini, Luciano A; Bao, Gang; Zhang, Feng
2013-09-01
The Streptococcus pyogenes Cas9 (SpCas9) nuclease can be efficiently targeted to genomic loci by means of single-guide RNAs (sgRNAs) to enable genome editing. Here, we characterize SpCas9 targeting specificity in human cells to inform the selection of target sites and avoid off-target effects. Our study evaluates >700 guide RNA variants and SpCas9-induced indel mutation levels at >100 predicted genomic off-target loci in 293T and 293FT cells. We find that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches. We also show that SpCas9-mediated cleavage is unaffected by DNA methylation and that the dosage of SpCas9 and sgRNA can be titrated to minimize off-target modification. To facilitate mammalian genome engineering applications, we provide a web-based software tool to guide the selection and validation of target sequences as well as off-target analyses.
Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun
2017-04-01
Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.
Dey, Avishek; Samanta, Milan Kumar; Gayen, Srimonta; Sen, Soumitra K.; Maiti, Mrinal K.
2016-01-01
Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE) and gene-silencing (RNAi). Analyses of the coding DNA sequence (CDS) of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5’-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS) of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene expression rather than natural polymorphism in coding sequence of OsbZIP23 is accountable for improved drought tolerance and yield performance in rice genotypes. PMID:26959651
Zhang, Tiejun; Yu, Long-Xi; Zheng, Ping; Li, Yajun; Rivera, Martha; Main, Dorrie; Greene, Stephanie L
2015-01-01
Drought resistance is an important breeding target for enhancing alfalfa productivity in arid and semi-arid regions. Identification of genes involved in drought tolerance will facilitate breeding for improving drought resistance and water use efficiency in alfalfa. Our objective was to use a diversity panel of alfalfa accessions comprised of 198 cultivars and landraces to identify genes involved in drought tolerance. The panel was selected from the USDA-ARS National Plant Germplasm System alfalfa collection and genotyped using genotyping by sequencing. A greenhouse procedure was used for phenotyping two important traits associated with drought tolerance: drought resistance index (DRI) and relative leaf water content (RWC). Marker-trait association identified nineteen and fifteen loci associated with DRI and RWC, respectively. Alignments of target sequences flanking to the resistance loci against the reference genome of M. truncatula revealed multiple chromosomal locations. Markers associated with DRI are located on all chromosomes while markers associated with RWC are located on chromosomes 1, 2, 3, 4, 5, 6 and 7. Co-localizations of significant markers between DRI and RWC were found on chromosomes 3, 5 and 7. Most loci associated with DRI in this work overlap with the reported QTLs associated with biomass under drought in alfalfa. Additional significant markers were targeted to several contigs with unknown chromosomal locations. BLAST search using their flanking sequences revealed homology to several annotated genes with functions in stress tolerance. With further validation, these markers may be used for marker-assisted breeding new alfalfa varieties with drought resistance and enhanced water use efficiency.
Hernández-Hernández, Betsabé; Figueroa-Gallaga, Luis; Sánchez-Castrillo, Christian; Belmonte-Montes, Carlos
2007-01-01
to evaluate the usefulness of bowel sounds, flatus and bowel movement presence to predict tolerance of oral intake in patients following major abdominal surgery. nutrition is one of the most important factors in the management of postoperative care. The early oral intake has shown to contribute to a faster recovery. Traditionally the beginning of postoperative feeding after major abdominal surgery is delayed until bowel sounds, flatus and/or bowel movement are present although there is no enough medical evidence for their usefulness. We studied 88 patients following major abdominal surgery. We registered the presence of bowel sounds, flatus and bowel movement each 24 hours in the postoperative period. We analized the relationship between the presence of these signs and the ability to tolerate oral intake. Predictive values, sensitivity, specificity and ROC curves were calculated. results shown that bowel sounds have an acCeptable sensibility but a very low specificity to predict the ability to tolerate oral intake. Unlike bowel sounds, bowel movements shown a low sensibility and a high specificity. Flatus turned out to have and intermediate sensitivity and specificity in the prediction of tolerance of oral feeding. in this study any of these signs were shown as a reliable indicator for beginning oral feeding because they have a moderate to low usefulness.
Ordóñez-Baquera, Perla Lucía; González-Rodríguez, Everardo; Aguado-Santacruz, Gerardo Armando; Rascón-Cruz, Quintín; Conesa, Ana; Moreno-Brito, Verónica; Echavarria, Raquel; Dominguez-Viveros, Joel
2017-02-01
MicroRNAs (miRNAs) are small non-coding RNA molecules that regulate signal transduction, development, metabolism, and stress responses in plants through post-transcriptional degradation and/or translational repression of target mRNAs. Several studies have addressed the role of miRNAs in model plant species, but miRNA expression and function in economically important forage crops, such as Bouteloua gracilis (Poaceae), a high-quality and drought-resistant grass distributed in semiarid regions of the United States and northern Mexico remain unknown. We applied high-throughput sequencing technology and bioinformatics analysis and identified 31 conserved miRNA families and 53 novel putative miRNAs with different abundance of reads in chlorophyllic cell cultures derived from B. gracilis. Some conserved miRNA families were highly abundant and possessed predicted targets involved in metabolism, plant growth and development, and stress responses. We also predicted additional identified novel miRNAs with specific targets, including B. gracilis ESTs, which were detected under drought stress conditions. Here we report 31 conserved miRNA families and 53 putative novel miRNAs in B. gracilis. Our results suggested the presence of regulatory miRNAs involved in modulating physiological and stress responses in this grass species. Copyright © 2016 Elsevier Ltd. All rights reserved.
Roden, Christine; Gaillard, Jonathan; Kanoria, Shaveta; Rennie, William; Barish, Syndi; Cheng, Jijun; Pan, Wen; Liu, Jun; Cotsapas, Chris; Ding, Ye; Lu, Jun
2017-01-01
Mature microRNAs (miRNAs) are processed from hairpin-containing primary miRNAs (pri-miRNAs). However, rules that distinguish pri-miRNAs from other hairpin-containing transcripts in the genome are incompletely understood. By developing a computational pipeline to systematically evaluate 30 structural and sequence features of mammalian RNA hairpins, we report several new rules that are preferentially utilized in miRNA hairpins and govern efficient pri-miRNA processing. We propose that a hairpin stem length of 36 ± 3 nt is optimal for pri-miRNA processing. We identify two bulge-depleted regions on the miRNA stem, located ∼16–21 nt and ∼28–32 nt from the base of the stem, that are less tolerant of unpaired bases. We further show that the CNNC primary sequence motif selectively enhances the processing of optimal-length hairpins. We predict that a small but significant fraction of human single-nucleotide polymorphisms (SNPs) alter pri-miRNA processing, and confirm several predictions experimentally including a disease-causing mutation. Our study enhances the rules governing mammalian pri-miRNA processing and suggests a diverse impact of human genetic variation on miRNA biogenesis. PMID:28087842
Complete Genome Sequence of the Soil Actinomycete Kocuria rhizophila▿
Takarada, Hiromi; Sekine, Mitsuo; Kosugi, Hiroki; Matsuo, Yasunori; Fujisawa, Takatomo; Omata, Seiha; Kishi, Emi; Shimizu, Ai; Tsukatani, Naofumi; Tanikawa, Satoshi; Fujita, Nobuyuki; Harayama, Shigeaki
2008-01-01
The soil actinomycete Kocuria rhizophila belongs to the suborder Micrococcineae, a divergent bacterial group for which only a limited amount of genomic information is currently available. K. rhizophila is also important in industrial applications; e.g., it is commonly used as a standard quality control strain for antimicrobial susceptibility testing. Sequencing and annotation of the genome of K. rhizophila DC2201 (NBRC 103217) revealed a single circular chromosome (2,697,540 bp; G+C content of 71.16%) containing 2,357 predicted protein-coding genes. Most of the predicted proteins (87.7%) were orthologous to actinobacterial proteins, and the genome showed fairly good conservation of synteny with taxonomically related actinobacterial genomes. On the other hand, the genome seems to encode much smaller numbers of proteins necessary for secondary metabolism (one each of nonribosomal peptide synthetase and type III polyketide synthase), transcriptional regulation, and lateral gene transfer, reflecting the small genome size. The presence of probable metabolic pathways for the transformation of phenolic compounds generated from the decomposition of plant materials, and the presence of a large number of genes associated with membrane transport, particularly amino acid transporters and drug efflux pumps, may contribute to the organism's utilization of root exudates, as well as the tolerance to various organic compounds. PMID:18408034
Autonomous safety and reliability features of the K-1 avionics system
NASA Astrophysics Data System (ADS)
Mueller, George E.; Kohrs, Dick; Bailey, Richard; Lai, Gary
2004-03-01
Kistler Aerospace Corporation is developing the K-1, a fully reusable, two-stage-to-orbit launch vehicle. Both stages return to the launch site using parachutes and airbags. Initial flight operations will occur from Woomera, Australia. K-1 guidance is performed autonomously. Each stage of the K-1 employs a triplex, fault tolerant avionics architecture, including three fault tolerant computers and three radiation hardened Embedded GPS/INS units with a hardware voter. The K-1 has an Integrated Vehicle Health Management (IVHM) system on each stage residing in the three vehicle computers based on similar systems in commercial aircraft. During first-stage ascent, the IVHM system performs an Instantaneous Impact Prediction (IIP) calculation 25 times per second, initiating an abort in the event the vehicle is outside a predetermined safety corridor for at least 3 consecutive calculations. In this event, commands are issued to terminate thrust, separate the stages, dump all propellant in the first-stage, and initiate a normal landing sequence. The second-stage flight computer calculates its ability to reach orbit along its state vector, initiating an abort sequence similar to the first stage if it cannot. On a nominal mission, following separation, the second-stage also performs calculations to assure its impact point is within a safety corridor. The K-1's guidance and control design is being tested through simulation with hardware-in-the-loop at Draper Laboratory. Kistler's verification strategy assures reliable and safe operation of the K-1.
The Reference Genome of the Halophytic Plant Eutrema salsugineum
Yang, Ruolin; Jarvis, David E.; Chen, Hao; Beilstein, Mark A.; Grimwood, Jane; Jenkins, Jerry; Shu, ShengQiang; Prochnik, Simon; Xin, Mingming; Ma, Chuang; Schmutz, Jeremy; Wing, Rod A.; Mitchell-Olds, Thomas; Schumaker, Karen S.; Wang, Xiangfeng
2013-01-01
Halophytes are plants that can naturally tolerate high concentrations of salt in the soil, and their tolerance to salt stress may occur through various evolutionary and molecular mechanisms. Eutrema salsugineum is a halophytic species in the Brassicaceae that can naturally tolerate multiple types of abiotic stresses that typically limit crop productivity, including extreme salinity and cold. It has been widely used as a laboratorial model for stress biology research in plants. Here, we present the reference genome sequence (241 Mb) of E. salsugineum at 8× coverage sequenced using the traditional Sanger sequencing-based approach with comparison to its close relative Arabidopsis thaliana. The E. salsugineum genome contains 26,531 protein-coding genes and 51.4% of its genome is composed of repetitive sequences that mostly reside in pericentromeric regions. Comparative analyses of the genome structures, protein-coding genes, microRNAs, stress-related pathways, and estimated translation efficiency of proteins between E. salsugineum and A. thaliana suggest that halophyte adaptation to environmental stresses may occur via a global network adjustment of multiple regulatory mechanisms. The E. salsugineum genome provides a resource to identify naturally occurring genetic alterations contributing to the adaptation of halophytic plants to salinity and that might be bioengineered in related crop species. PMID:23518688
Tissue-specific expression of the gene for a putative plasma membrane H(+)-ATPase in a seagrass.
Fukuhara, T; Pak, J Y; Ohwaki, Y; Tsujimura, H; Nitta, T
1996-01-01
A cDNA clone corresponding to the gene (ZHA1) for a putative plasma membrane H(+)-ATPase of a seagrass (Zostera marina L.) was isolated and sequenced. Comparison of the amino acid predicted sequence from the nucleotide sequence of ZHA1 with those encoded by known genes for plasma membrane H(+)-ATPases from other plants indicated that ZHA1 is most similar to the gene (PMA4) for a plasma membrane H(+)-ATPase in a tobacco (84.4%). Northern hybridization indicated that ZHA1 was strongly expressed in mature leaves, which are exposed to seawater and have the ability of tolerate salinity; ZHA1 was weakly expressed in immature leaves, which are protected from seawater by tightly enveloping sheaths and are sensitive to salinity. In mature leaves, in situ hybridization revealed that ZHA1 was expressed specifically in epidermal cells, the plasma membranes of which were highly invaginated and morphologically similar to those of typical transfer cells. Therefore, the differentiation of the transfer cell-like structures, accompanied by the high-level expression of ZHA1, in the epidermal cells of mature leaves in particular may be important for the excretion of salt by these cells. PMID:8587992
Kolek, Jan; Sedlár, Karel; Provazník, Ivo; Patáková, Petra
2014-03-20
We present a draft genome sequence of Clostridium pasteurianum NRRL B-598. This strain ferments saccharides by two-stage acetone-butanol (AB) fermentation, is oxygen tolerant, and has high hydrogen yields.
Cloning and functional characterization of SAD genes in potato.
Li, Fei; Bian, Chun Song; Xu, Jian Fei; Pang, Wan Fu; Liu, Jie; Duan, Shao Guang; Lei, Zun-Guo; Jiwan, Palta; Jin, Li-Ping
2015-01-01
Stearoyl-acyl carrier protein desaturase (SAD), locating in the plastid stroma, is an important fatty acid biosynthetic enzyme in higher plants. SAD catalyzes desaturation of stearoyl-ACP to oleyl-ACP and plays a key role in determining the homeostasis between saturated fatty acids and unsaturated fatty acids, which is an important player in cold acclimation in plants. Here, four new full-length cDNA of SADs (ScoSAD, SaSAD, ScaSAD and StSAD) were cloned from four Solanum species, Solanum commersonii, S. acaule, S. cardiophyllum and S. tuberosum, respectively. The ORF of the four SADs were 1182 bp in length, encoding 393 amino acids. A sequence alignment indicated 13 amino acids varied among the SADs of three wild species. Further analysis showed that the freezing tolerance and cold acclimation capacity of S. commersonii are similar to S. acaule and their SAD amino acid sequences were identical but differed from that of S. cardiophyllum, which is sensitive to freezing. Furthermore, the sequence alignments between StSAD and ScoSAD indicated that only 7 different amino acids at residues were found in SAD of S. tuberosum (Zhongshu8) against the protein sequence of ScoSAD. A phylogenetic analysis showed the three wild potato species had the closest genetic relationship with the SAD of S. lycopersicum and Nicotiana tomentosiformis but not S. tuberosum. The SAD gene from S. commersonii (ScoSAD) was cloned into multiple sites of the pBI121 plant binary vector and transformed into the cultivated potato variety Zhongshu 8. A freeze tolerance analysis showed overexpression of the ScoSAD gene in transgenic plants significantly enhanced freeze tolerance in cv. Zhongshu 8 and increased their linoleic acid content, suggesting that linoleic acid likely plays a key role in improving freeze tolerance in potato plants. This study provided some new insights into how SAD regulates in the freezing tolerance and cold acclimation in potato.
Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.
Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold
2017-02-13
Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in hypoxia tolerance evolution of Gymnotiform electric fishes.
Ingram, Emily R; Robertson, Iain K; Ogden, Kathryn J; Dennis, Amanda E; Campbell, Joanne E; Corbould, Anne M
2017-06-01
Gestational diabetes mellitus (GDM) is associated with life-long increased risk of type 2 diabetes: affected women are advised to undergo oral glucose tolerance testing (OGTT) at 6-12 weeks postpartum, then glucose screening every 1-3 years. We investigated whether in women with GDM, antenatal clinical factors predicted postpartum abnormal glucose tolerance and compliance with screening. In women with GDM delivering 2007 to mid-2009 in a single hospital, antenatal/obstetric data and glucose tests at 6-12 weeks postpartum and during 5.5 years post-pregnancy were retrospectively collected. Predictors of return for testing and abnormal glucose tolerance were identified using multivariate analysis. Of 165 women, 117 (70.9%) returned for 6-12 week postpartum OGTT: 23 (19.6%) were abnormal. Smoking and parity, independent of socioeconomic status, were associated with non-return for testing. Fasting glucose ≥5.4 mmol/L on pregnancy OGTT predicted both non-return for testing and abnormal OGTT. During 5.5 years post-pregnancy, 148 (89.7%) women accessed glucose screening: nine (6.1%) developed diabetes, 33 (22.3%) had impaired fasting glucose / impaired glucose tolerance. Predictors of abnormal glucose tolerance were fasting glucose ≥5.4 mmol/L and 2-h glucose ≥9.3 mmol/L on pregnancy OGTT (~2.5-fold increased risk), and polycystic ovary syndrome (~3.4 fold increased risk). Risk score calculation, based on combined antenatal factors, did not improve predictions. Antenatal clinical factors were modestly predictive of return for testing and abnormal glucose tolerance post-pregnancy in women with GDM. Risk score calculations were ineffective in predicting outcomes: risk scores developed in other populations require validation. Ongoing glucose screening is indicated for all women with GDM. © 2016 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.
Bhardwaj, Jyoti; Mahajan, Monika; Yadav, Sudesh Kumar
2013-08-01
DNA methylation is known as an epigenetic modification that affects gene expression in plants. Variation in CpG methylation behavior was studied in two natural horse gram (Macrotyloma uniflorum [Lam.] Verdc.) genotypes, HPKC2 (drought-sensitive) and HPK4 (drought-tolerant). The methylation pattern in both genotypes was studied through methylation-sensitive amplified polymorphism. The results revealed that methylation was higher in HPKC2 (10.1%) than in HPK4 (8.6%). Sequencing demonstrated sequence homology with the DRE binding factor (cbf1), the POZ/BTB protein, and the Ty1-copia retrotransposon among some of the polymorphic fragments showing alteration in methylation behavior. Differences in DNA methylation patterns could explain the differential drought tolerance and the epigenetic signature of these two horse gram genotypes.
Rahman, Hifzur; Jagadeeshselvam, N; Valarmathi, R; Sachin, B; Sasikala, R; Senthil, N; Sudhakar, D; Robin, S; Muthurajan, Raveendran
2014-07-01
Finger millet (Eleusine coracana L.) is a hardy cereal known for its superior level of tolerance against drought, salinity, diseases and its nutritional properties. In this study, attempts were made to unravel the physiological and molecular basis of salinity tolerance in two contrasting finger millet genotypes viz., CO 12 and Trichy 1. Physiological studies revealed that the tolerant genotype Trichy 1 had lower Na(+) to K(+) ratio in leaves and shoots, higher growth rate (osmotic tolerance) and ability to accumulate higher amount of total soluble sugar in leaves under salinity stress. We sequenced the salinity responsive leaf transcriptome of contrasting finger millet genotypes using IonProton platform and generated 27.91 million reads. Mapping and annotation of finger millet transcripts against rice gene models led to the identification of salinity responsive genes and genotype specific responses. Several functional groups of genes like transporters, transcription factors, genes involved in cell signaling, osmotic homeostasis and biosynthesis of compatible solutes were found to be highly up-regulated in the tolerant Trichy 1. Salinity stress inhibited photosynthetic capacity and photosynthesis related genes in the susceptible genotype CO 12. Several genes involved in cell growth and differentiation were found to be up-regulated in both the genotypes but more specifically in tolerant genotype. Genes involved in flavonoid biosynthesis were found to be down-regulated specifically in the salinity tolerant Trichy 1. This study provides a genome-wide transcriptional analysis of two finger millet genotypes differing in their level of salinity tolerance during a gradually progressing salinity stress under greenhouse conditions.
Exploring new alleles for frost tolerance in winter rye.
Erath, Wiltrud; Bauer, Eva; Fowler, D Brian; Gordillo, Andres; Korzun, Viktor; Ponomareva, Mira; Schmidt, Malthe; Schmiedchen, Brigitta; Wilde, Peer; Schön, Chris-Carolin
2017-10-01
Rye genetic resources provide a valuable source of new alleles for the improvement of frost tolerance in rye breeding programs. Frost tolerance is a must-have trait for winter cereal production in northern and continental cropping areas. Genetic resources should harbor promising alleles for the improvement of frost tolerance of winter rye elite lines. For frost tolerance breeding, the identification of quantitative trait loci (QTL) and the choice of optimum genome-based selection methods are essential. We identified genomic regions involved in frost tolerance of winter rye by QTL mapping in a biparental population derived from a highly frost tolerant selection from the Canadian cultivar Puma and the European elite line Lo157. Lines per se and their testcrosses were phenotyped in a controlled freeze test and in multi-location field trials in Russia and Canada. Three QTL on chromosomes 4R, 5R, and 7R were consistently detected across environments. The QTL on 5R is congruent with the genomic region harboring the Frost resistance locus 2 (Fr-2) in Triticeae. The Puma allele at the Fr-R2 locus was found to significantly increase frost tolerance. A comparison of predictive ability obtained from the QTL-based model with different whole-genome prediction models revealed that besides a few large, also small QTL effects contribute to the genomic variance of frost tolerance in rye. Genomic prediction models assigning a high weight to the Fr-R2 locus allow increasing the selection intensity for frost tolerance by genome-based pre-selection of promising candidates.
SLLE for predicting membrane protein types.
Wang, Meng; Yang, Jie; Xu, Zhi-Jie; Chou, Kuo-Chen
2005-01-07
Introduction of the concept of pseudo amino acid composition (PROTEINS: Structure, Function, and Genetics 43 (2001) 246; Erratum: ibid. 44 (2001) 60) has made it possible to incorporate a considerable amount of sequence-order effects by representing a protein sample in terms of a set of discrete numbers, and hence can significantly enhance the prediction quality of membrane protein type. As a continuous effort along such a line, the Supervised Locally Linear Embedding (SLLE) technique for nonlinear dimensionality reduction is introduced (Science 22 (2000) 2323). The advantage of using SLLE is that it can reduce the operational space by extracting the essential features from the high-dimensional pseudo amino acid composition space, and that the cluster-tolerant capacity can be increased accordingly. As a consequence by combining these two approaches, high success rates have been observed during the tests of self-consistency, jackknife and independent data set, respectively, by using the simplest nearest neighbour classifier. The current approach represents a new strategy to deal with the problems of protein attribute prediction, and hence may become a useful vehicle in the area of bioinformatics and proteomics.
Kutz, Amanda; Marshall, Erin; Bernstein, Amit; Zvolensky, Michael J
2010-01-01
The current study investigated anxiety sensitivity, distress tolerance (Simons & Gaher, 2005), and discomfort intolerance (Schmidt, Richey, Cromer, & Buckner, 2007) in relation to panic-relevant responding (i.e., panic attack symptoms and panic-relevant cognitions) to a 10% carbon dioxide enriched air challenge. Participants were 216 adults (52.6% female; M(age)=22.4, SD=9.0). A series of hierarchical multiple regressions was conducted with covariates of negative affectivity and past year panic attack history in step one of the model, and anxiety sensitivity, discomfort intolerance, and distress tolerance entered simultaneously into step two. Results indicated that anxiety sensitivity, but not distress tolerance or discomfort intolerance, was significantly incrementally predictive of physical panic attack symptoms and cognitive panic attack symptoms. Additionally, anxiety sensitivity was significantly predictive of variance in panic attack status during the challenge. These findings emphasize the important, unique role of anxiety sensitivity in predicting risk for panic psychopathology, even when considered in the context of other theoretically relevant emotion vulnerability variables.
Pandey, Garima; Yadav, Chandra Bhan; Sahu, Pranav Pankaj; Muthamilarasan, Mehanathan; Prasad, Manoj
2017-05-01
Genome-wide methylation analysis of foxtail millet cultivars contrastingly differing in salinity tolerance revealed DNA demethylation events occurring in tolerant cultivar under salinity stress, eventually modulating the expression of stress-responsive genes. Reduced productivity and significant yield loss are the adverse effects of environmental conditions on physiological and biochemical pathways in crop plants. In this context, understanding the epigenetic machinery underlying the tolerance traits in a naturally stress tolerant crop is imperative. Foxtail millet (Setaria italica) is known for its better tolerance to abiotic stresses compared to other cereal crops. In the present study, methylation-sensitive amplified polymorphism (MSAP) technique was used to quantify the salt-induced methylation changes in two foxtail millet cultivars contrastingly differing in their tolerance levels to salt stress. The study highlighted that the DNA methylation level was significantly reduced in tolerant cultivar compared to sensitive cultivar. A total of 86 polymorphic MSAP fragments were identified, sequenced and functionally annotated. These fragments showed sequence similarity to several genes including ABC transporter, WRKY transcription factor, serine threonine-protein phosphatase, disease resistance, oxidoreductases, cell wall-related enzymes and retrotransposon and transposase like proteins, suggesting salt stress-induced methylation in these genes. Among these, four genes were chosen for expression profiling which showed differential expression pattern between both cultivars of foxtail millet. Altogether, the study infers that salinity stress induces genome-wide DNA demethylation, which in turn, modulates expression of corresponding genes.
Single-molecule sequencing of the desiccation-tolerant grass Oropetium thomaeum.
VanBuren, Robert; Bryant, Doug; Edger, Patrick P; Tang, Haibao; Burgess, Diane; Challabathula, Dinakar; Spittle, Kristi; Hall, Richard; Gu, Jenny; Lyons, Eric; Freeling, Michael; Bartels, Dorothea; Ten Hallers, Boudewijn; Hastie, Alex; Michael, Todd P; Mockler, Todd C
2015-11-26
Plant genomes, and eukaryotic genomes in general, are typically repetitive, polyploid and heterozygous, which complicates genome assembly. The short read lengths of early Sanger and current next-generation sequencing platforms hinder assembly through complex repeat regions, and many draft and reference genomes are fragmented, lacking skewed GC and repetitive intergenic sequences, which are gaining importance due to projects like the Encyclopedia of DNA Elements (ENCODE). Here we report the whole-genome sequencing and assembly of the desiccation-tolerant grass Oropetium thomaeum. Using only single-molecule real-time sequencing, which generates long (>16 kilobases) reads with random errors, we assembled 99% (244 megabases) of the Oropetium genome into 625 contigs with an N50 length of 2.4 megabases. Oropetium is an example of a 'near-complete' draft genome which includes gapless coverage over gene space as well as intergenic sequences such as centromeres, telomeres, transposable elements and rRNA clusters that are typically unassembled in draft genomes. Oropetium has 28,466 protein-coding genes and 43% repeat sequences, yet with 30% more compact euchromatic regions it is the smallest known grass genome. The Oropetium genome demonstrates the utility of single-molecule real-time sequencing for assembling high-quality plant and other eukaryotic genomes, and serves as a valuable resource for the plant comparative genomics community.
Dissecting the genetic architecture of frost tolerance in Central European winter wheat.
Zhao, Yusheng; Gowda, Manje; Würschum, Tobias; Longin, C Friedrich H; Korzun, Viktor; Kollers, Sonja; Schachschneider, Ralf; Zeng, Jian; Fernando, Rohan; Dubcovsky, Jorge; Reif, Jochen C
2013-11-01
Abiotic stress tolerance in plants is pivotal to increase yield stability, but its genetic basis is still poorly understood. To gain insight into the genetic architecture of frost tolerance, this work evaluated a large mapping population of 1739 wheat (Triticum aestivum L.) lines and hybrids adapted to Central Europe in field trials in Germany and fingerprinted the lines with a 9000 single-nucleotide polymorphism array. Additive effects prevailed over dominance effects. A two-dimensional genome scan revealed the presence of epistatic effects. Genome-wide association mapping in combination with a robust cross-validation strategy identified one frost tolerance locus with a major effect located on chromosome 5B. This locus was not in linkage disequilibrium with the known frost loci Fr-B1 and Fr-B2. The use of the detected diagnostic markers on chromosome 5B, however, does not allow prediction of frost tolerance with high accuracy. Application of genome-wide selection approaches that take into account also loci with small effect sizes considerably improved prediction of the genetic variation of frost tolerance in wheat. The developed prediction model is valuable for improving frost tolerance because this trait displays a wide variation in occurrence across years and is therefore a difficult target for conventional phenotypic selection.
Wang, Hongwei; Xin, Haibo; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko; Qin, Feng
2013-01-01
The worldwide production of maize (Zea mays L.) is frequently impacted by water scarcity and as a result, increased drought tolerance is a priority target in maize breeding programs. While DREB transcription factors have been demonstrated to play a central role in desiccation tolerance, whether or not natural sequence variations in these genes are associated with the phenotypic variability of this trait is largely unknown. In the present study, eighteen ZmDREB genes present in the maize B73 genome were cloned and systematically analyzed to determine their phylogenetic relationship, synteny with rice, maize and sorghum genomes; pattern of drought-responsive gene expression, and protein transactivation activity. Importantly, the association between the nucleic acid variation of each ZmDREB gene with drought tolerance was evaluated using a diverse population of maize consisting of 368 varieties from tropical and temperate regions. A significant association between the genetic variation of ZmDREB2.7 and drought tolerance at seedling stage was identified. Further analysis found that the DNA polymorphisms in the promoter region of ZmDREB2.7, but not the protein coding region itself, was associated with different levels of drought tolerance among maize varieties, likely due to distinct patterns of gene expression in response to drought stress. In vitro, protein-DNA binding assay demonstrated that ZmDREB2.7 protein could specifically interact with the target DNA sequences. The transgenic Arabidopsis overexpressing ZmDREB2.7 displayed enhanced tolerance to drought stress. Moreover, a favorable allele of ZmDREB2.7, identified in the drought-tolerant maize varieties, was effective in imparting plant tolerance to drought stress. Based upon these findings, we conclude that natural variation in the promoter of ZmDREB2.7 contributes to maize drought tolerance, and that the gene and its favorable allele may be an important genetic resource for the genetic improvement of drought tolerance in maize. PMID:24086146
Tolerance Signatures in Transplant Recipients
Newell, Kenneth A.; Turka, Laurence A.
2015-01-01
Purpose of review The intent of this review is to describe biomarkers that predict or identify individuals who exhibit tolerance to a transplanted organ. The identification of tolerance biomarkers would spare some individuals the toxicity of immunosuppressive agents, enhance the safety of studies to induce tolerance, and provide insights into mechanisms of tolerance that may aid in designing new regimens. Recent findings Studies of tolerant kidney transplant recipients have revealed an association with B cells. More recent studies have suggested that these B cells may be less mature than from those in nontolerant recipients, and specially suited to suppress alloimmune responses. Biomarkers in tolerant liver transplant patients appear to be distinct from those associated renal tolerance. Most reports have identified an association with NK and/or γδ T cells rather than B cells. Recent data indicate biomarkers associated with iron homeostasis within the transplanted liver more accurately predict the tolerant state than do biomarkers expressed in the blood, suggesting that the renal allograft itself, which is infrequently sampled, would be informative. Summary Given the encouraging progress in identifying tolerance biomarkers, it will be important to validate these markers in larger studies of transplant recipients undergoing prospective minimization or withdrawal of immunosuppression. PMID:26107969
Development of DArT-based PCR markers for selecting drought-tolerant spring barley.
Fiust, Anna; Rapacz, Marcin; Wójcik-Jagła, Magdalena; Tyrka, Mirosław
2015-08-01
The tolerance of spring barley (Hordeum vulgare L.) cultivars to spring drought is an important agronomic trait affecting crop yield and quality in Poland. Therefore, breeders require new molecular markers to select plants with lower spring drought susceptibility. With the advent of genomic selection technology, simple molecular tools may still be applicable to screen material for markers of the most important traits and in-depth genome scanning. In previous studies, diversity arrays technology (DArT)-based genetic maps were constructed for F2 populations of Polish fodder and malt barley elite breeding lines, and 15 and 18 quantitative trait loci (QTLs) related to spring drought tolerance were identified, respectively. In this paper, we show the results of a conversion of 30 DArT markers corresponding to 11 QTLs into simple sequence repeat (SSR) and sequence tagged site (STS) markers. Twenty-two polymorphic markers were obtained, including 13 DArT-based SSRs. Additionally, 31 SSR markers, located in close proximity to the DArT markers, were selected from the GrainGenes database and tested. Further analyses of 24 advanced breeding lines with different drought tolerances confirmed that five out of the 30 converted markers, as well as three out of the 31 additional SSR markers, were effective in marker-assisted selection for drought tolerance. The possible function of clones related to these markers in drought tolerance is discussed.
NASA Astrophysics Data System (ADS)
Rath, Kristin; Fierer, Noah; Rousk, Johannes
2017-04-01
Our knowledge of the dynamics structuring microbial communities and the consequences this has for soil functions is rudimentary. In particular, predictions of the response of microbial communities to environmental change and the implications for associated ecosystem processes remain elusive. Understanding how environmental factors structure microbial communities and regulate the functions they perform is key to a mechanistic understanding of how biogeochemical cycles respond to environmental change. Soil salinization is an agricultural problem in many parts of the world. The activity of soil microorganisms is reduced in saline soils compared to non-saline soil. However, soil salinity often co-varies with other factors, making it difficult to assign responses of microbial communities to direct effects of salinity. A trait-based approach allows us to connect the environmental factor salinity with the responses of microbial community composition and functioning. Salinity along a salinity gradient serves as a filter for the community trait distribution of salt tolerance, selecting for higher salt tolerance at more saline sites. This trait-environment relationship can be used to predict responses of microbial communities to environmental change. Our aims were to (i) use salinity along natural salinity gradients as an environmental filter, and (ii) link the resulting filtered trait-distributions of the communities (the trait being salt tolerance) to the community composition. Soil samples were obtained from two replicated salinity gradients along an Australian salt lake, spanning a wide range of soil salinities (0.1 dS m-1 to >50 dS m-1). In one of the two gradients salinity was correlated with pH. Community trait distributions for salt tolerance were assessed by establishing dose-dependences for extracted bacterial communities using growth rate assays. In addition, functional parameters were measured along the salt gradients. Community composition of sites was compared through 16S rRNA gene amplicon sequencing. Microbial community composition changed greatly along the salinity gradients. Using the salt-tolerance assessments to estimate bacterial trait-distributions we could determine substantial differences in tolerance to salt revealing a strong causal connection between environment and trait distributions. By constraining the community composition with salinity tolerance in ordinations, we could assign which community differences were directly due to a shift in community trait distributions. These analyses revealed that a substantial part (up to 30%) of the community composition differences were directly driven by environmental salt concentrations.. Even though communities in saline soils had trait-distributions aligned to their environment, their performance (respiration, growth rates) was lower than those in non-saline soils and remained low even after input of organic material. Using a trait-based approach we could connect filtered trait distributions along environmental gradients, to the composition of the microbial community. We show that soil salinity played an important role in shaping microbial community composition by selecting for communities with higher salt tolerance. The shift toward bacterial communities with trait distributions matched to salt environments probably compensated for much of the potential loss of function induced by salinity, resulting in a degree of apparent functional redundancy for decomposition. However, more tolerant communities still showed reduced functioning, suggesting a trade-off between salt tolerance and performance.
Codon-Anticodon Recognition in the Bacillus subtilis glyQS T Box Riboswitch
Caserta, Enrico; Liu, Liang-Chun; Grundy, Frank J.; Henkin, Tina M.
2015-01-01
Many amino acid-related genes in Gram-positive bacteria are regulated by the T box riboswitch. The leader RNA of genes in the T box family controls the expression of downstream genes by monitoring the aminoacylation status of the cognate tRNA. Previous studies identified a three-nucleotide codon, termed the “Specifier Sequence,” in the riboswitch that corresponds to the amino acid identity of the downstream genes. Pairing of the Specifier Sequence with the anticodon of the cognate tRNA is the primary determinant of specific tRNA recognition. This interaction mimics codon-anticodon pairing in translation but occurs in the absence of the ribosome. The goal of the current study was to determine the effect of a full range of mismatches for comparison with codon recognition in translation. Mutations were individually introduced into the Specifier Sequence of the glyQS leader RNA and tRNAGly anticodon to test the effect of all possible pairing combinations on tRNA binding affinity and antitermination efficiency. The functional role of the conserved purine 3′ of the Specifier Sequence was also verifiedin this study. We found that substitutions at the Specifier Sequence resulted in reduced binding, the magnitude of which correlates well with the predicted stability of the RNA-RNA pairing. However, the tolerance for specific mismatches in antitermination was generally different from that during decoding, which reveals a unique tRNA recognition pattern in the T box antitermination system. PMID:26229106
Mondal, Tapan Kumar; Ganie, Showkat Ahmad; Debnath, Ananda Bhusan
2015-01-01
Oryza coarctata, a halophyte and wild relative of rice, is grown normally in saline water. MicroRNAs (miRNAs) are non-coding RNAs that play pivotal roles in every domain of life including stress response. There are very few reports on the discovery of salt-responsive miRNAs from halophytes. In this study, two small RNA libraries, one each from the control and salt-treated (450 mM NaCl for 24 h) leaves of O. coarctata were sequenced, which yielded 338 known and 95 novel miRNAs. Additionally, we used publicly available transcriptomics data of O. coarctata which led to the discovery of additional 48 conserved miRNAs along with their pre-miRNA sequences through in silico analysis. In total, 36 known and 7 novel miRNAs were up-regulated whereas, 12 known and 7 novel miRNAs were down-regulated under salinity stress. Further, 233 and 154 target genes were predicted for 48 known and 14 novel differentially regulated miRNAs respectively. These targets with the help of gene ontology analysis were found to be involved in several important biological processes that could be involved in salinity tolerance. Relative expression trends of majority of the miRNAs as detected by real time-PCR as well as predicted by Illumina sequencing were found to be coherent. Additionally, expression of most of the target genes was negatively correlated with their corresponding miRNAs. Thus, the present study provides an account of miRNA-target networking that is involved in salinity adaption of O. coarctata.
USDA-ARS?s Scientific Manuscript database
The woody resurrection plant Myrothamnus flabellifolia has remarkable tolerance to desiccation. Pyro-sequencing technology permitted us to analyze the transcriptome of M. flabellifolia during both dehydration and rehydration. We identified a total of 8287 and 8542 differentially transcribed genes du...
USDA-ARS?s Scientific Manuscript database
Broccoli is a cool weather vegetable crop with a vernalization requirement to initiate and maintain floral development. Breeding for heat tolerance in broccoli has the potential to both expand viable production areas and extend the growing season. A doubled haploid (DH) population of broccoli (Bras...
NASA Astrophysics Data System (ADS)
Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng
2015-12-01
Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.
Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng
2015-12-22
Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.
Li, Ming; Wang, Rui; Xiang, Hua
2014-01-01
The prokaryotic immune system CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated genes) adapts to foreign invaders by acquiring their short deoxyribonucleic acid (DNA) fragments as spacers, which guide subsequent interference to foreign nucleic acids based on sequence matching. The adaptation mechanism avoiding acquiring ‘self’ DNA fragments is poorly understood. In Haloarcula hispanica, we previously showed that CRISPR adaptation requires being primed by a pre-existing spacer partially matching the invader DNA. Here, we further demonstrate that flanking a fully-matched target sequence, a functional PAM (protospacer adjacent motif) is still required to prime adaptation. Interestingly, interference utilizes only four PAM sequences, whereas adaptation-priming tolerates as many as 23 PAM sequences. This relaxed PAM selectivity explains how adaptation-priming maximizes its tolerance of PAM mutations (that escape interference) while avoiding mis-targeting the spacer DNA within CRISPR locus. We propose that the primed adaptation, which hitches and cooperates with the interference pathway, distinguishes target from non-target by CRISPR ribonucleic acid guidance and PAM recognition. PMID:24803673
Mondy, Cédric P; Muñoz, Isabel; Dolédec, Sylvain
2016-12-01
Multiple stressors constitute a serious threat to aquatic ecosystems, particularly in the Mediterranean region where water scarcity is likely to interact with other anthropogenic stressors. Biological traits potentially allow the unravelling of the effects of multiple stressors. However, thus far, trait-based approaches have failed to fully deliver on their promise and still lack strong predictive power when multiple stressors are present. We aimed to quantify specific community tolerances against six anthropogenic stressors and investigate the responses of the underlying macroinvertebrate biological traits and their combinations. We built and calibrated boosted regression tree models to predict community tolerances using multiple biological traits with a priori hypotheses regarding their individual responses to specific stressors. We analysed the combinations of traits underlying community tolerance and the effect of trait association on this tolerance. Our results validated the following three hypotheses: (i) the community tolerance models efficiently and robustly related trait combinations to stressor intensities and, to a lesser extent, to stressors related to the presence of dams and insecticides; (ii) the effects of traits on community tolerance not only depended on trait identity but also on the trait associations emerging at the community level from the co-occurrence of different traits in species; and (iii) the community tolerances and the underlying trait combinations were specific to the different stressors. This study takes a further step towards predictive tools in community ecology that consider combinations and associations of traits as the basis of stressor tolerance. Additionally, the community tolerance concept has potential application to help stream managers in the decision process regarding management options. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Liu, Wuxing; Wang, Qingling; Hou, Jinyu; Tu, Chen; Luo, Yongming; Christie, Peter
2016-05-01
This research undertook the systematic analysis of the Klebsiella sp. D5A genome and identification of genes that contribute to plant growth-promoting (PGP) traits, especially genes related to salt tolerance and wide pH adaptability. The genome sequence of isolate D5A was obtained using an Illumina HiSeq 2000 sequencing system with average coverages of 174.7× and 200.1× using the paired-end and mate-pair sequencing, respectively. Predicted and annotated gene sequences were analyzed for similarity with the Kyoto Encyclopedia of Genes and Genomes (KEGG) enzyme database followed by assignment of each gene into the KEGG pathway charts. The results show that the Klebsiella sp. D5A genome has a total of 5,540,009 bp with 57.15% G + C content. PGP conferring genes such as indole-3-acetic acid (IAA) biosynthesis, phosphate solubilization, siderophore production, acetoin and 2,3-butanediol synthesis, and N2 fixation were determined. Moreover, genes putatively responsible for resistance to high salinity including glycine-betaine synthesis, trehalose synthesis and a number of osmoregulation receptors and transport systems were also observed in the D5A genome together with numerous genes that contribute to pH homeostasis. These genes reveal the genetic adaptation of D5A to versatile environmental conditions and the effectiveness of the isolate to serve as a plant growth stimulator.
Ntougias, Spyridon; Lapidus, Alla; Copeland, Alex; ...
2015-08-13
Members of the genus Halotalea (family Halomonadaceae) are of high significance since they can tolerate the greatest glucose and maltose concentrations ever reported for known bacteria and are involved in the degradation of industrial effluents. Here, the characteristics and the permanent-draft genome sequence and annotation of Halotalea alkalilenta AW-7T are described. The microorganism was sequenced as a part of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project at the DOE Joint Genome Institute, and it is the only strain within the genus Halotalea having its genome sequenced. The genome is 4,467,826 bp longmore » and consists of 40 scaffolds with 64.62 % average GC content. A total of 4,104 genes were predicted, comprising of 4,028 protein-coding and 76 RNA genes. Most protein-coding genes (87.79 %) were assigned to a putative function. Halotalea alkalilenta AW-7T encodes the catechol and protocatechuate degradation to β-ketoadipate via the β-ketoadipate and protocatechuate ortho-cleavage degradation pathway, and it possesses the genetic ability to detoxify fluoroacetate, cyanate and acrylonitrile. Lastly, an emended description of the genus Halotalea Ntougias et al. 2007 is also provided in order to describe the delayed fermentation ability of the type strain.« less
Pais, Thiago M.; Foulquié-Moreno, María R.; Hubmann, Georg; Duitama, Jorge; Swinnen, Steve; Goovaerts, Annelies; Yang, Yudi; Dumortier, Françoise; Thevelein, Johan M.
2013-01-01
The yeast Saccharomyces cerevisiae is able to accumulate ≥17% ethanol (v/v) by fermentation in the absence of cell proliferation. The genetic basis of this unique capacity is unknown. Up to now, all research has focused on tolerance of yeast cell proliferation to high ethanol levels. Comparison of maximal ethanol accumulation capacity and ethanol tolerance of cell proliferation in 68 yeast strains showed a poor correlation, but higher ethanol tolerance of cell proliferation clearly increased the likelihood of superior maximal ethanol accumulation capacity. We have applied pooled-segregant whole-genome sequence analysis to identify the polygenic basis of these two complex traits using segregants from a cross of a haploid derivative of the sake strain CBS1585 and the lab strain BY. From a total of 301 segregants, 22 superior segregants accumulating ≥17% ethanol in small-scale fermentations and 32 superior segregants growing in the presence of 18% ethanol, were separately pooled and sequenced. Plotting SNP variant frequency against chromosomal position revealed eleven and eight Quantitative Trait Loci (QTLs) for the two traits, respectively, and showed that the genetic basis of the two traits is partially different. Fine-mapping and Reciprocal Hemizygosity Analysis identified ADE1, URA3, and KIN3, encoding a protein kinase involved in DNA damage repair, as specific causative genes for maximal ethanol accumulation capacity. These genes, as well as the previously identified MKT1 gene, were not linked in this genetic background to tolerance of cell proliferation to high ethanol levels. The superior KIN3 allele contained two SNPs, which are absent in all yeast strains sequenced up to now. This work provides the first insight in the genetic basis of maximal ethanol accumulation capacity in yeast and reveals for the first time the importance of DNA damage repair in yeast ethanol tolerance. PMID:23754966
Ali, Bina; Green, Kerry M; Daughters, Stacey B; Lejuez, C W
2017-10-01
Our understanding of the conditions that influence substance abuse treatment retention in urban African American substance users is limited. This study examined the interacting effect of circumstances, motivation, and readiness (CMR) with distress tolerance to predict substance abuse treatment retention in a sample of urban African American treatment-seeking substance users. Data were collected from 81 African American substance users entering residential substance abuse treatment facility in an urban setting. Participants completed self-reported measures on CMR and distress tolerance. In addition, participants were assessed on psychiatric comorbidities, substance use severity, number of previous treatments, and demographic characteristics. Data on substance abuse treatment retention were obtained using administrative records of the treatment center. Logistic regression analysis found that the interaction of CMR and distress tolerance was significant in predicting substance abuse treatment retention. Higher score on CMR was significantly associated with increased likelihood of treatment retention in substance users with higher distress tolerance, but not in substance users with lower distress tolerance. Findings of the study indicate that at higher level of distress tolerance, favorable external circumstances, higher internal motivation, and greater readiness to treatment are important indicators of substance abuse treatment retention. The study highlights the need for assessing CMR and distress tolerance levels among substance users entering treatment, and providing targeted interventions to increase substance abuse treatment retention and subsequent recovery from substance abuse among urban African American substance users. Copyright © 2017 Elsevier Ltd. All rights reserved.
Pseudomonas fluorescens-like bacteria from the stomach: a microbiological and molecular study.
Patel, Saurabh Kumar; Pratap, Chandra Bhan; Verma, Ajay Kumar; Jain, Ashok Kumar; Dixit, Vinod Kumar; Nath, Gopal
2013-02-21
To characterize oxidase- and urease-producing bacterial isolates, grown aerobically, that originated from antral biopsies of patients suffering from acid peptic diseases. A total of 258 antral biopsy specimens were subjected to isolation of bacteria followed by tests for oxidase and urease production, acid tolerance and aerobic growth. The selected isolates were further characterized by molecular techniques viz. amplifications for 16S rRNA using universal eubacterial and HSP60 gene specific primers. The amplicons were subjected to restriction analysis and partial sequencing. A phylogenetic tree was generated using unweighted pair group method with arithmetic mean (UPGMA) from evolutionary distance computed with bootstrap test of phylogeny. Assessment of acidity tolerance of bacteria isolated from antrum was performed using hydrochloric acid from 10(-7) mol/L to 10(-1) mol/L. Of the 258 antral biopsy specimens collected from patients, 179 (69.4%) were positive for urease production by rapid urease test and 31% (80/258) yielded typical Helicobacter pylori (H. pylori) after 5-7 d of incubation under a microaerophilic environment. A total of 240 (93%) antral biopsies yielded homogeneous semi-translucent and small colonies after overnight incubation. The partial 16S rRNA sequences revealed that the isolates had 99% similarity with Pseudomonas species. A phylogenetic tree on the basis of 16S rRNA sequences denoted that JQ927226 and JQ927227 were likely to be related to Pseudomonas fluorescens (P. fluorescens). On the basis of HSP60 sequences applied to the UPGMA phylogenetic tree, it was observed that isolated strains in an aerobic environment were likely to be P. fluorescens, and HSP60 sequences had more discriminatory potential rather than 16S rRNA sequences. Interestingly, this bacterium was acid tolerant for hours at low pH. Further, a total of 250 (96.9%) genomic DNA samples of 258 biopsy specimens and DNA from 240 bacterial isolates were positive for the 613 bp amplicons by targeting P. fluorescens-specific conserved putative outer membrane protein gene sequences. This study indicates that bacterial isolates from antral biopsies grown aerobically were P. fluorescens, and thus acid-tolerant bacteria other than H. pylori can also colonize the stomach and may be implicated in pathogenesis/protection.
Li, Min; Li, Yujuan; Wang, Ying; Ma, Xiangjian; Zhang, Yuan; Tan, Feng; Wu, Rongling
2016-01-01
As a salt-tolerant arbor tree species, Salix matsudana plays an important role in afforestation and greening in the coastal areas of China. To select superior Salix varieties that adapt to wide saline areas, it is of paramount importance to understand and identify the mechanisms of salt-tolerance at the level of the whole genome. Here, we describe a high-density genetic linkage map of S. matsudana that represents a good coverage of the Salix genome. An intraspecific F1 hybrid population was established by crossing the salt-sensitive “Yanjiang” variety as the female parent with the salt-tolerant “9901” variety as the male parent. This population, along with its parents, was genotyped by specific length amplified fragment sequencing (SLAF-seq), leading to 277,333 high-quality SLAF markers. By marker analysis, we found that both the parents and offspring were tetraploid. The mean sequencing depth was 53.20-fold for “Yanjiang”, 47.41-fold for “9901”, and 11.02-fold for the offspring. Of the SLAF markers detected, 42,321 are polymorphic with sufficient quality for map construction. The final genetic map was constructed using 6,737 SLAF markers, covering 38 linkage groups (LGs). The genetic map spanned 5,497.45 cM in length, with an average distance of 0.82 cM. As a first high-density genetic map of S. matsudana constructed from salt tolerance-varying varieties, this study will provide a foundation for mapping quantitative trait loci that modulate salt tolerance and resistance in Salix and provide important references for molecular breeding of this important forest tree. PMID:27327501
Shen, Chun-Ying; Xu, Guang-Hui; Chen, Shi-Xuan; Song, Li-Zhen; Li, Mei-Jing; Wang, Li-Li; Zhu, Yan; Lv, Wei-Tao; Gong, Zhi-Zhong; Liu, Chun-Ming; Deng, Xin
2014-01-01
Functional genomic elements, including transposable elements, small RNAs and non-coding RNAs, are involved in regulation of gene expression in response to plant stress. To identify genomic elements that regulate dehydration and alkaline tolerance in Boea hygrometrica, a resurrection plant that inhabits drought and alkaline Karst areas, a genomic DNA library from B. hygrometrica was constructed and subsequently transformed into Arabidopsis using binary bacterial artificial chromosome (BIBAC) vectors. Transgenic lines were screened under osmotic and alkaline conditions, leading to the identification of Clone L1-4 that conferred osmotic and alkaline tolerance. Sequence analyses revealed that L1-4 contained a 49-kb retroelement fragment from B. hygrometrica, of which only a truncated sequence was present in L1-4 transgenic Arabidopsis plants. Additional subcloning revealed that activity resided in a 2-kb sequence, designated Osmotic and Alkaline Resistance 1 (OAR1). In addition, transgenic Arabidopsis lines carrying an OAR1-homologue also showed similar stress tolerance phenotypes. Physiological and molecular analyses demonstrated that OAR1-transgenic plants exhibited improved photochemical efficiency and membrane integrity and biomarker gene expression under both osmotic and alkaline stresses. Short transcripts that originated from OAR1 were increased under stress conditions in both B. hygrometrica and Arabidopsis carrying OAR1. The relative copy number of OAR1 was stable in transgenic Arabidopsis under stress but increased in B. hygrometrica. Taken together, our results indicated a potential role of OAR1 element in plant tolerance to osmotic and alkaline stresses, and verified the feasibility of the BIBAC transformation technique to identify functional genomic elements from physiological model species. PMID:24851859
NASA Technical Reports Server (NTRS)
Smith, T. B., Jr.; Lala, J. H.
1983-01-01
The basic organization of the fault tolerant multiprocessor, (FTMP) is that of a general purpose homogeneous multiprocessor. Three processors operate on a shared system (memory and I/O) bus. Replication and tight synchronization of all elements and hardware voting is employed to detect and correct any single fault. Reconfiguration is then employed to repair a fault. Multiple faults may be tolerated as a sequence of single faults with repair between fault occurrences.
Identification and comparative analysis of drought-associated microRNAs in two cowpea genotypes.
Barrera-Figueroa, Blanca E; Gao, Lei; Diop, Ndeye N; Wu, Zhigang; Ehlers, Jeffrey D; Roberts, Philip A; Close, Timothy J; Zhu, Jian-Kang; Liu, Renyi
2011-09-17
Cowpea (Vigna unguiculata) is an important crop in arid and semi-arid regions and is a good model for studying drought tolerance. MicroRNAs (miRNAs) are known to play critical roles in plant stress responses, but drought-associated miRNAs have not been identified in cowpea. In addition, it is not understood how miRNAs might contribute to different capacities of drought tolerance in different cowpea genotypes. We generated deep sequencing small RNA reads from two cowpea genotypes (CB46, drought-sensitive, and IT93K503-1, drought-tolerant) that grew under well-watered and drought stress conditions. We mapped small RNA reads to cowpea genomic sequences and identified 157 miRNA genes that belong to 89 families. Among 44 drought-associated miRNAs, 30 were upregulated in drought condition and 14 were downregulated. Although miRNA expression was in general consistent in two genotypes, we found that nine miRNAs were predominantly or exclusively expressed in one of the two genotypes and that 11 miRNAs were drought-regulated in only one genotype, but not the other. These results suggest that miRNAs may play important roles in drought tolerance in cowpea and may be a key factor in determining the level of drought tolerance in different cowpea genotypes.
Transcriptional Response to Lactic Acid Stress in the Hybrid Yeast Zygosaccharomyces parabailii
2017-01-01
ABSTRACT Lactic acid has a wide range of applications starting from its undissociated form, and its production using cell factories requires stress-tolerant microbial hosts. The interspecies hybrid yeast Zygosaccharomyces parabailii has great potential to be exploited as a novel host for lactic acid production, due to high organic acid tolerance at low pH and a fermentative metabolism with a high growth rate. Here we used mRNA sequencing (RNA-seq) to analyze Z. parabailii's transcriptional response to lactic acid added exogenously, and we explore the biological mechanisms involved in tolerance. Z. parabailii contains two homeologous copies of most genes. Under lactic acid stress, the two genes in each homeolog pair tend to diverge in expression to a significantly greater extent than under control conditions, indicating that stress tolerance is facilitated by interactions between the two gene sets in the hybrid. Lactic acid induces downregulation of genes related to cell wall and plasma membrane functions, possibly altering the rate of diffusion of lactic acid into cells. Genes related to iron transport and redox processes were upregulated, suggesting an important role for respiratory functions and oxidative stress defense. We found differences in the expression profiles of genes putatively regulated by Haa1 and Aft1/Aft2, previously described as lactic acid responsive in Saccharomyces cerevisiae. Furthermore, formate dehydrogenase (FDH) genes form a lactic acid-responsive gene family that has been specifically amplified in Z. parabailii in comparison to other closely related species. Our study provides a useful starting point for the engineering of Z. parabailii as a host for lactic acid production. IMPORTANCE Hybrid yeasts are important in biotechnology because of their tolerance to harsh industrial conditions. The molecular mechanisms of tolerance can be studied by analyzing differential gene expression under conditions of interest and relating gene expression patterns to protein functions. However, hybrid organisms present a challenge to the standard use of mRNA sequencing (RNA-seq) to study transcriptional responses to stress, because their genomes contain two similar copies of almost every gene. Here we used stringent mapping methods and a high-quality genome sequence to study the transcriptional response to lactic acid stress in Zygosaccharomyces parabailii ATCC 60483, a natural interspecies hybrid yeast that contains two complete subgenomes that are approximately 7% divergent in sequence. Beyond the insights we gained into lactic acid tolerance in this study, the methods we developed will be broadly applicable to other yeast hybrid strains. PMID:29269498
Transcriptional Response to Lactic Acid Stress in the Hybrid Yeast Zygosaccharomyces parabailii.
Ortiz-Merino, Raúl A; Kuanyshev, Nurzhan; Byrne, Kevin P; Varela, Javier A; Morrissey, John P; Porro, Danilo; Wolfe, Kenneth H; Branduardi, Paola
2018-03-01
Lactic acid has a wide range of applications starting from its undissociated form, and its production using cell factories requires stress-tolerant microbial hosts. The interspecies hybrid yeast Zygosaccharomyces parabailii has great potential to be exploited as a novel host for lactic acid production, due to high organic acid tolerance at low pH and a fermentative metabolism with a high growth rate. Here we used mRNA sequencing (RNA-seq) to analyze Z. parabailii 's transcriptional response to lactic acid added exogenously, and we explore the biological mechanisms involved in tolerance. Z. parabailii contains two homeologous copies of most genes. Under lactic acid stress, the two genes in each homeolog pair tend to diverge in expression to a significantly greater extent than under control conditions, indicating that stress tolerance is facilitated by interactions between the two gene sets in the hybrid. Lactic acid induces downregulation of genes related to cell wall and plasma membrane functions, possibly altering the rate of diffusion of lactic acid into cells. Genes related to iron transport and redox processes were upregulated, suggesting an important role for respiratory functions and oxidative stress defense. We found differences in the expression profiles of genes putatively regulated by Haa1 and Aft1/Aft2, previously described as lactic acid responsive in Saccharomyces cerevisiae Furthermore, formate dehydrogenase ( FDH ) genes form a lactic acid-responsive gene family that has been specifically amplified in Z. parabailii in comparison to other closely related species. Our study provides a useful starting point for the engineering of Z. parabailii as a host for lactic acid production. IMPORTANCE Hybrid yeasts are important in biotechnology because of their tolerance to harsh industrial conditions. The molecular mechanisms of tolerance can be studied by analyzing differential gene expression under conditions of interest and relating gene expression patterns to protein functions. However, hybrid organisms present a challenge to the standard use of mRNA sequencing (RNA-seq) to study transcriptional responses to stress, because their genomes contain two similar copies of almost every gene. Here we used stringent mapping methods and a high-quality genome sequence to study the transcriptional response to lactic acid stress in Zygosaccharomyces parabailii ATCC 60483, a natural interspecies hybrid yeast that contains two complete subgenomes that are approximately 7% divergent in sequence. Beyond the insights we gained into lactic acid tolerance in this study, the methods we developed will be broadly applicable to other yeast hybrid strains. Copyright © 2018 Ortiz-Merino et al.
Challenges Facing Crop Production And (Some) Potential Solutions
NASA Astrophysics Data System (ADS)
Schnable, P. S.
2017-12-01
To overcome some of the myriad challenges facing sustainable crop production we are seeking to develop statistical models that will predict crop performance in diverse agronomic environments. Crop phenotypes such as yield and drought tolerance are controlled by genotype, environment (considered broadly) and their interaction (GxE). As a consequence of the next generation sequencing revolution genotyping data are now available for a wide diversity of accessions in each of the major crops. The necessary volumes of phenotypic data, however, remain limiting and our understanding of molecular basis of GxE is minimal. To address this limitation, we are collaborating with engineers to construct new sensors and robots to automatically collect large volumes of phenotypic data. Two types of high-throughput, high-resolution, field-based phenotyping systems and new sensors will be described. Some of these technologies will be introduced within the context of the Genomes to Fields Initiative. Progress towards developing predictive models will be briefly summarized. An administrative structure that fosters transdisciplinary collaborations will be briefly described.
Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee
2016-01-01
We explore a model for ‘quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10–11 bp insertions or deletions (INDELs) and sensitive to 5–6 bp INDELs. We test this prediction on 61 σ54-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat. PMID:26832446
Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee
2016-02-02
We explore a model for 'quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10-11 bp insertions or deletions (INDELs) and sensitive to 5-6 bp INDELs. We test this prediction on 61 σ(54)-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat.
[Analysis of structural characteristics of alpha-tubulins in plants with enhanced cold tolerance].
Nyporko, A Iu; Demchuk, O N; Blium, Ia B
2003-01-01
The uniqueness of the point substitutions in the sequences of two alpha-tubulin isotypes from psychrophilic alga Chloromonas that can determine the increased cold tolerance of this alga was analyzed. The comparison of all known amino acid sequences of plant alpha-tubulins enabled to ascertain that only M268-->V replacement is unique and may have a significant influence on spatial structure of plant alpha-tubulins. Modeling of molecular surfaces of alpha-tubulins from Chloromonas, Chalmydomonas reinhardtii and goose grass Eleusine indica showed that insertion of the amino acid replacement M268-->V into the sequence of goose grace tubulin led to the likening of this protein surface to the surface of native alpha-tubulin from Chloromonas. Alteration of local hydrophobic properties of alpha-tubulin molecular surface in interdimeric contact zone as a result of the mentioned replacement was shown that may play important role in increasing the level of cold resistance of microtubules. The crucial role of amino acid residue in 268 position for forming the interdimeric contact surface of alpha-tubulin molecule was revealed. The assumption is made about the importance of replacements at this position for plant tolerance to abiotic factors of different nature (cold, herbicides).
2013-01-01
Background Modern banana cultivars are primarily interspecific triploid hybrids of two species, Musa acuminata and Musa balbisiana, which respectively contribute the A- and B-genomes. The M. balbisiana genome has been associated with improved vigour and tolerance to biotic and abiotic stresses and is thus a target for Musa breeding programs. However, while a reference M. acuminata genome has recently been released (Nature 488:213–217, 2012), little sequence data is available for the corresponding B-genome. To address these problems we carried out Next Generation gDNA sequencing of the wild diploid M. balbisiana variety ‘Pisang Klutuk Wulung’ (PKW). Our strategy was to align PKW gDNA reads against the published A-genome and to extract the mapped consensus sequences for subsequent rounds of evaluation and gene annotation. Results The resulting B-genome is 79% the size of the A-genome, and contains 36,638 predicted functional gene sequences which is nearly identical to the 36,542 of the A-genome. There is substantial sequence divergence from the A-genome at a frequency of 1 homozygous SNP per 23.1 bp, and a high degree of heterozygosity corresponding to one heterozygous SNP per 55.9 bp. Using expressed small RNA data, a similar number of microRNA sequences were predicted in both A- and B-genomes, but additional novel miRNAs were detected, including some that are unique to each genome. The usefulness of this B-genome sequence was evaluated by mapping RNA-seq data from a set of triploid AAA and AAB hybrids simultaneously to both genomes. Results for the plantains demonstrated the expected 2:1 distribution of reads across the A- and B-genomes, but for the AAA genomes, results show they contain regions of significant homology to the B-genome supporting proposals that there has been a history of interspecific recombination between homeologous A and B chromosomes in Musa hybrids. Conclusions We have generated and annotated a draft reference Musa B-genome and demonstrate that this can be used for molecular genetic mapping of gene transcripts and small RNA expression data from several allopolyploid banana cultivars. This draft therefore represents a valuable resource to support the study of metabolism in inter- and intraspecific triploid Musa hybrids and to help direct breeding programs. PMID:24094114
Taravat, Elham; Zebarjadi, Alireza; Kahrizi, Danial; Yari, Kheirollah
2015-05-01
Among the essential amino acids, phenylalanine, tryptophan, and tyrosine are aromatic amino acids which are synthesized by the shikimate pathway in plants and bacteria. Herbicide glyphosate can inhibit the biosynthesis of these amino acids. So, identification of the gene tolerant to glyphosate is very important. It has been shown that the common reed or Phragmites australis Cav. (Poaceae) is relatively tolerant to glyphosate. The aim of the current research is identification, cloning, sequencing, and registering of partial aro A gene of the common reed P. australis. The partial aro A gene of common reed (P. australis) was cloned in Escherichia coli and the amino acid sequence was identified/determined for the first time. This is the first report for isolation, cloning, and sequencing of a part of aro A gene from the common reed. A 670 bp fragment including two introns (86 bp and 289 bp) was obtained. The open reading frame (ORF) region in part of gene was encoded for 98 amino acids. Alignment showed high similarity among this region with Zea mays (L.) (Poaceae) (94.6%), Eleusine indica L. Gaertn (Poaceae) (94.2%), and Zoysia japonica Steud. (Poaceae) (94.2%). The alignment of amino acid sequence of the investigated part of the gene showed a homology with aro A from several other plants. This conserved region forms the enzyme active site. The alignment results of nucleotide and amino acid residues with related sequences showed that there are some differences among them. The relative glyphosate tolerance in the common reed may be related to these differences.
Single-molecule sequencing of the desiccation-tolerant grass Oropetium thomaeum
DOE Office of Scientific and Technical Information (OSTI.GOV)
VanBuren, Robert; Bryant, Doug; Edger, Patrick P.
Plant genomes, and eukaryotic genomes in general, are typically repetitive, polyploid and heterozygous, which complicates genome assembly1. The short read lengths of early Sanger and current next-generation sequencing platforms hinder assembly through complex repeat regions, and many draft and reference genomes are fragmented, lacking skewed GC and repetitive intergenic sequences, which are gaining importance due to projects like the Encyclopedia of DNA Elements (ENCODE). Here we report the whole-genome sequencing and assembly of the desiccation-tolerant grass Oropetium thomaeum. Using only single-molecule real-time sequencing, which generates long (>16 kilobases) reads with random errors, we assembled 99% (244 megabases) of the Oropetiummore » genome into 625 contigs with an N50 length of 2.4 megabases. Oropetium is an example of a ‘near-complete’ draft genome which includes gapless coverage over gene space as well as intergenic sequences such as centromeres, telomeres, transposable elements and rRNA clusters that are typically unassembled in draft genomes. Oropetium has 28,466 protein-coding genes and 43% repeat sequences, yet with 30% more compact euchromatic regions it is the smallest known grass genome. As a result, the Oropetium genome demonstrates the utility of single-molecule real-time sequencing for assembling high-quality plant and other eukaryotic genomes, and serves as a valuable resource for the plant comparative genomics community.« less
Single-molecule sequencing of the desiccation-tolerant grass Oropetium thomaeum
VanBuren, Robert; Bryant, Doug; Edger, Patrick P.; ...
2015-11-11
Plant genomes, and eukaryotic genomes in general, are typically repetitive, polyploid and heterozygous, which complicates genome assembly1. The short read lengths of early Sanger and current next-generation sequencing platforms hinder assembly through complex repeat regions, and many draft and reference genomes are fragmented, lacking skewed GC and repetitive intergenic sequences, which are gaining importance due to projects like the Encyclopedia of DNA Elements (ENCODE). Here we report the whole-genome sequencing and assembly of the desiccation-tolerant grass Oropetium thomaeum. Using only single-molecule real-time sequencing, which generates long (>16 kilobases) reads with random errors, we assembled 99% (244 megabases) of the Oropetiummore » genome into 625 contigs with an N50 length of 2.4 megabases. Oropetium is an example of a ‘near-complete’ draft genome which includes gapless coverage over gene space as well as intergenic sequences such as centromeres, telomeres, transposable elements and rRNA clusters that are typically unassembled in draft genomes. Oropetium has 28,466 protein-coding genes and 43% repeat sequences, yet with 30% more compact euchromatic regions it is the smallest known grass genome. As a result, the Oropetium genome demonstrates the utility of single-molecule real-time sequencing for assembling high-quality plant and other eukaryotic genomes, and serves as a valuable resource for the plant comparative genomics community.« less
Scafaro, Andrew P; Gallé, Alexander; Van Rie, Jeroen; Carmo-Silva, Elizabete; Salvucci, Michael E; Atwell, Brian J
2016-08-01
The mechanistic basis of tolerance to heat stress was investigated in Oryza sativa and two wild rice species, Oryza meridionalis and Oryza australiensis. The wild relatives are endemic to the hot, arid Australian savannah. Leaf elongation rates and gas exchange were measured during short periods of supra-optimal heat, revealing species differences. The Rubisco activase (RCA) gene from each species was sequenced. Using expressed recombinant RCA and leaf-extracted RCA, the kinetic properties of the two isoforms were studied under high temperatures. Leaf elongation was undiminished at 45°C in O. australiensis. The net photosynthetic rate was almost 50% slower in O. sativa at 45°C than at 28°C, while in O. australiensis it was unaffected. Oryza meridionalis exhibited intermediate heat tolerance. Based on previous reports that RCA is heat-labile, the Rubisco activation state was measured. It correlated positively with leaf elongation rates across all three species and four periods of exposure to 45°C. Sequence analysis revealed numerous polymorphisms in the RCA amino acid sequence from O. australiensis. The O. australiensis RCA enzyme was thermally stable up to 42°C, contrasting with RCA from O. sativa, which was inhibited at 36°C. We attribute heat tolerance in the wild species to thermal stability of RCA, enabling Rubisco to remain active. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
ERIC Educational Resources Information Center
Mavor, David Carl
2017-01-01
Ubiquitin is essential for eukaryotic life and varies in only 3 amino acid positions between yeast and humans. However, recent deep sequencing studies indicate that ubiquitin is highly tolerant to single mutations. We hypothesized that this tolerance would be reduced by chemically induced physiologic perturbations. To test this hypothesis, a class…
NASA Astrophysics Data System (ADS)
Marhadi, Kun Saptohartyadi
Structural optimization for damage tolerance under various unforeseen damage scenarios is computationally challenging. It couples non-linear progressive failure analysis with sampling-based stochastic analysis of random damage. The goal of this research was to understand the relationship between alternate load paths available in a structure and its damage tolerance, and to use this information to develop computationally efficient methods for designing damage tolerant structures. Progressive failure of a redundant truss structure subjected to small random variability was investigated to identify features that correlate with robustness and predictability of the structure's progressive failure. The identified features were used to develop numerical surrogate measures that permit computationally efficient deterministic optimization to achieve robustness and predictability of progressive failure. Analysis of damage tolerance on designs with robust progressive failure indicated that robustness and predictability of progressive failure do not guarantee damage tolerance. Damage tolerance requires a structure to redistribute its load to alternate load paths. In order to investigate the load distribution characteristics that lead to damage tolerance in structures, designs with varying degrees of damage tolerance were generated using brute force stochastic optimization. A method based on principal component analysis was used to describe load distributions (alternate load paths) in the structures. Results indicate that a structure that can develop alternate paths is not necessarily damage tolerant. The alternate load paths must have a required minimum load capability. Robustness analysis of damage tolerant optimum designs indicates that designs are tailored to specified damage. A design Optimized under one damage specification can be sensitive to other damages not considered. Effectiveness of existing load path definitions and characterizations were investigated for continuum structures. A load path definition using a relative compliance change measure (U* field) was demonstrated to be the most useful measure of load path. This measure provides quantitative information on load path trajectories and qualitative information on the effectiveness of the load path. The use of the U* description of load paths in optimizing structures for effective load paths was investigated.
Tramontano, A; Bianchi, E; Venturini, S; Martin, F; Pessi, A; Sollazzo, M
1994-03-01
Conformationally constraining selectable peptides onto a suitable scaffold that enables their conformation to be predicted or readily determined by experimental techniques would considerably boost the drug discovery process by reducing the gap between the discovery of a peptide lead and the design of a peptidomimetic with a more desirable pharmacological profile. With this in mind, we designed the minibody, a 61-residue beta-protein aimed at retaining some desirable features of immunoglobulin variable domains, such as tolerance to sequence variability in selected regions of the protein and predictability of the main chain conformation of the same regions, based on the 'canonical structures' model. To test the ability of the minibody scaffold to support functional sites we also designed a metal binding version of the protein by suitably choosing the sequences of its loops. The minibody was produced both by chemical synthesis and expression in E. coli and characterized by size exclusion chromatography, UV CD (circular dichroism) spectroscopy and metal binding activity. All our data supported the model, but a more detailed structural characterization of the molecule was impaired by its low solubility. We were able to overcome this problem both by further mutagenesis of the framework and by addition of a solubilizing motif. The minibody is being used to select constrained human IL-6 peptidic ligands from a library displayed on the surface of the f1 bacteriophage.
Noctor, Eoin; Crowe, Catherine; Carmody, Louise A; Saunders, Jean A; Kirwan, Breda; O'Dea, Angela; Gillespie, Paddy; Glynn, Liam G; McGuire, Brian E; O'Neill, Ciarán; O'Shea, P M; Dunne, F P
2016-10-01
An increase in gestational diabetes mellitus (GDM) prevalence has been demonstrated across many countries with adoption of the International Association of the Diabetes and Pregnancy Study Groups (IADPSG) diagnostic criteria. Here, we determine the cumulative incidence of abnormal glucose tolerance among women with previous GDM, and identify clinical risk factors predicting this. Two hundred and seventy women with previous IADPSG-defined GDM were prospectively followed up for 5years (mean 2.6) post-index pregnancy, and compared with 388 women with normal glucose tolerance (NGT) in pregnancy. Cumulative incidence of abnormal glucose tolerance (using American Diabetes Association criteria for impaired fasting glucose, impaired glucose tolerance and diabetes) was determined using the Kaplan-Meier method of survival analysis. Cox regression models were constructed to test for factors predicting abnormal glucose tolerance. Twenty-six percent of women with previous GDM had abnormal glucose tolerance vs 4% with NGT, with the log-rank test demonstrating significantly different survival curves (P<0.001). Women meeting IADPSG, but not the World Health Organization (WHO) 1999 criteria, had a lower cumulative incidence than women meeting both sets of criteria, both in the early post-partum period (4.2% vs 21.7%, P<0.001) and at longer-term follow-up (13.7% vs 32.6%, P<0.001). Predictive factors were glucose levels on the pregnancy oral glucose tolerance test, family history of diabetes, gestational week at testing, and BMI at follow-up. The proportion of women developing abnormal glucose tolerance remains high among those with IADPSG-defined GDM. This demonstrates the need for continued close follow-up, although the optimal frequency and method needs further study. © 2016 European Society of Endocrinology.
Phenylalanine tolerance can already reliably be assessed at the age of 2 years in patients with PKU.
van Spronsen, F J; van Rijn, M; Dorgelo, B; Hoeksma, M; Bosch, A M; Mulder, M F; de Klerk, J B C; de Koning, T; Rubio-Gozalbo, M Estela; de Vries, M; Verkerk, P H
2009-02-01
The clinical severity of phenylalanine hydroxylase deficiency is usually defined by either pre-treatment phenylalanine (Phe) concentration or Phe tolerance at 5 years of age. So far, little is known about the course of Phe tolerance or the ability of both pre-treatment Phe and Phe tolerance at early age to predict Phe tolerance at later age. This study was conducted to investigate the course of the individual Phe tolerance and to assess the predictive value of both the pre-treatment Phe concentration and Phe tolerance at 1 and 6 months and 1, 2, 3 and 5 years for Phe tolerance at 10 years of age. Data on blood Phe concentration, prescribed Phe intake and weight of 213 early and continuously treated Dutch PKU patients up to 10 years of age were collected. Data acquired under good metabolic control were used in the study. Tolerance was expressed in mg/day and mg/kg per day. Data at 1 and 6 months and at 1, 2, 3 and 5 years of 61, 58, 59, 57, 56 and 59 patients were included for comparison with the Phe tolerance at 10 years. Phe tolerances (mg/kg per day) at 2, 3 and 5 years showed a clear correlation with the tolerance at 10 years of age (r = 0.608, r = 0.725 and r = 0.661). Results for tolerance expressed as mg/day were comparable. Pre-treatment Phe concentrations did not correlate significantly with the tolerance. Pre-treatment Phe is unreliable but Phe tolerance is a reliable predictor of the tolerance at 10 years of age, starting at 2 years of age.
Koštál, Vladimír; Tollarová-Borovanská, Michaela
2009-01-01
Background The Pyrrhocoris apterus (Insecta: Heteroptera) adults attain high levels of cold tolerance during their overwintering diapause. Non-diapause reproducing adults, however, lack the capacity to express a whole array of cold-tolerance adaptations and show relatively low survival when exposed to sub-zero temperatures. We assessed the competence of non-diapause males of P. apterus for responding to heat- and cold-stresses by up-regulation of 70 kDa heat shock proteins (Hsps) and the role of Hsps during repair of heat- and cold-induced injury. Principal Findings The fragments of P. apterus homologues of Hsp70 inducible (PaHsp70) and cognate forms (PaHsc70) were cloned and sequenced. The abundance of mRNA transcripts for the inducible form (qPCR) and corresponding protein (Western blotting) were significantly up-regulated in response to high and low temperature stimuli. In the cognate form, mRNA was slightly up-regulated in response to both stressors but very low or no up-regulation of protein was apparent after heat- or cold-stress, respectively. Injection of 695 bp-long Pahsp70 dsRNA (RNAi) caused drastic suppression of the heat- and cold-stress-induced Pahsp70 mRNA response and the up-regulation of corresponding protein was practically eliminated. Our RNAi predictably prevented recovery from heat shock and, in addition, negatively influenced repair of chilling injuries caused by cold stress. Cold tolerance increased when the insects were first exposed to a mild heat shock, in order to trigger the up-regulation of PaHsp70, and subsequently exposed to cold stress. Conclusion Our results suggest that accumulation of PaHsp70 belongs to a complex cold tolerance adaptation in the insect Pyrrhocoris apterus. PMID:19229329
Henderson, Sam W.; Wege, Stefanie; Qiu, Jiaen; Blackmore, Deidre H.; Walker, Amanda R.; Tyerman, Stephen D.; Walker, Rob R.; Gilliham, Matthew
2015-01-01
Plant cation-chloride cotransporters (CCCs) have been implicated in conferring salt tolerance. They are predicted to improve shoot salt exclusion by directly catalyzing the retrieval of sodium (Na+) and chloride (Cl−) ions from the root xylem. We investigated whether grapevine (Vitis vinifera [Vvi]) CCC has a role in salt tolerance by cloning and functionally characterizing the gene from the cultivar Cabernet Sauvignon. Amino acid sequence analysis revealed that VviCCC shares a high degree of similarity with other plant CCCs. A VviCCC-yellow fluorescent protein translational fusion protein localized to the Golgi and the trans-Golgi network and not the plasma membrane when expressed transiently in tobacco (Nicotiana benthamiana) leaves and Arabidopsis (Arabidopsis thaliana) mesophyll protoplasts. AtCCC-green fluorescent protein from Arabidopsis also localized to the Golgi and the trans-Golgi network. In Xenopus laevis oocytes, VviCCC targeted to the plasma membrane, where it catalyzed bumetanide-sensitive 36Cl–, 22Na+, and 86Rb+ uptake, suggesting that VviCCC (like AtCCC) belongs to the Na+-K+-2Cl– cotransporter class of CCCs. Expression of VviCCC in an Arabidopsis ccc knockout mutant abolished the mutant’s stunted growth phenotypes and reduced shoot Cl– and Na+ content to wild-type levels after growing plants in 50 mm NaCl. In grapevine roots, VviCCC transcript abundance was not regulated by Cl– treatment and was present at similar levels in both the root stele and cortex of three Vitis spp. genotypes that exhibit differential shoot salt exclusion. Our findings indicate that CCC function is conserved between grapevine and Arabidopsis, but neither protein is likely to directly mediate ion transfer with the xylem or have a direct role in salt tolerance. PMID:26378102
Improved Modeling of Side-Chain–Base Interactions and Plasticity in Protein–DNA Interface Design
Thyme, Summer B.; Baker, David; Bradley, Philip
2012-01-01
Combinatorial sequence optimization for protein design requires libraries of discrete side-chain conformations. The discreteness of these libraries is problematic, particularly for long, polar side chains, since favorable interactions can be missed. Previously, an approach to loop remodeling where protein backbone movement is directed by side-chain rotamers predicted to form interactions previously observed in native complexes (termed “motifs”) was described. Here, we show how such motif libraries can be incorporated into combinatorial sequence optimization protocols and improve native complex recapitulation. Guided by the motif rotamer searches, we made improvements to the underlying energy function, increasing recapitulation of native interactions. To further test the methods, we carried out a comprehensive experimental scan of amino acid preferences in the I-AniI protein–DNA interface and found that many positions tolerated multiple amino acids. This sequence plasticity is not observed in the computational results because of the fixed-backbone approximation of the model. We improved modeling of this diversity by introducing DNA flexibility and reducing the convergence of the simulated annealing algorithm that drives the design process. In addition to serving as a benchmark, this extensive experimental data set provides insight into the types of interactions essential to maintain the function of this potential gene therapy reagent. PMID:22426128
Improved modeling of side-chain--base interactions and plasticity in protein--DNA interface design.
Thyme, Summer B; Baker, David; Bradley, Philip
2012-06-08
Combinatorial sequence optimization for protein design requires libraries of discrete side-chain conformations. The discreteness of these libraries is problematic, particularly for long, polar side chains, since favorable interactions can be missed. Previously, an approach to loop remodeling where protein backbone movement is directed by side-chain rotamers predicted to form interactions previously observed in native complexes (termed "motifs") was described. Here, we show how such motif libraries can be incorporated into combinatorial sequence optimization protocols and improve native complex recapitulation. Guided by the motif rotamer searches, we made improvements to the underlying energy function, increasing recapitulation of native interactions. To further test the methods, we carried out a comprehensive experimental scan of amino acid preferences in the I-AniI protein-DNA interface and found that many positions tolerated multiple amino acids. This sequence plasticity is not observed in the computational results because of the fixed-backbone approximation of the model. We improved modeling of this diversity by introducing DNA flexibility and reducing the convergence of the simulated annealing algorithm that drives the design process. In addition to serving as a benchmark, this extensive experimental data set provides insight into the types of interactions essential to maintain the function of this potential gene therapy reagent. Published by Elsevier Ltd.
[Human venous hemodynamics in microgravity and prediction of orthostatic tolerance in flight].
Kotovskaya, A R; Fomina, G A
2013-01-01
The paper presents the results of investigating the lower limbs venous status in cosmonauts (n = 13) with the use of occlusion plethysmography in 6-month missions to the Russian segment of the International space station (ISS). An interrelation of shifts in venous capacitance, compliance and filling with orthostatic tolerance (OT) in the lower body negative pressure test (LBNP) was stated. OT predictability by the leg vein status in the course of space flight was demonstrated. The objective changes of veins predictive of OT reduction were identified. There are 3 levels of changes in venous capacitance, compliance and filling that prognosticate respective reductions in LBNP tolerance and were attested in 91% of the in-flight LBNP testing.
Rasal, Kiran D; Shah, Tejas M; Vaidya, Megha; Jakhesara, Subhash J; Joshi, Chaitanya G
2015-06-01
The recent advances in high throughput sequencing technology accelerate possible ways for the study of genome wide variation in several organisms and associated consequences. In the present study, mutations in TGFBR3 showing significant association with FCR trait in chicken during exome sequencing were further analyzed. Out of four SNPs, one nsSNP p.Val451Leu was found in the coding region of TGFBR3. In silico tools such as SnpSift and PANTHER predicted it as deleterious (0.04) and to be tolerated, respectively, while I-Mutant revealed that protein stability decreased. The TGFBR3 I-TASSER model has a C-score of 0.85, which was validated using PROCHECK. Based on MD simulation, mutant protein structure deviated from native with RMSD 0.08 Å due to change in the H-bonding distances of mutant residue. The docking of TGFBR3 with interacting TGFBR2 inferred that mutant required more global energy. Therefore, the present study will provide useful information about functional SNPs that have an impact on FCR traits.
Global Identification of MicroRNAs and Their Targets in Barley under Salinity Stress
Cui, Licao; Feng, Kewei; Liu, Fuyan; Du, Xianghong; Tong, Wei; Nie, Xiaojun; Ji, Wanquan; Weining, Song
2015-01-01
Salinity is a major limiting factor for agricultural production worldwide. A better understanding of the mechanisms of salinity stress response will aid efforts to improve plant salt tolerance. In this study, a combination of small RNA and mRNA degradome sequencing was used to identify salinity responsive-miRNAs and their targets in barley. A total of 152 miRNAs belonging to 126 families were identified, of which 44 were found to be salinity responsive with 30 up-regulated and 25 down-regulated respectively. The majority of the salinity-responsive miRNAs were up-regulated at the 8h time point, while down-regulated at the 3h and 27h time points. The targets of these miRNAs were further detected by degradome sequencing coupled with bioinformatics prediction. Finally, qRT-PCR was used to validate the identified miRNA and their targets. Our study systematically investigated the expression profile of miRNA and their targets in barley during salinity stress phase, which can contribute to understanding how miRNAs respond to salinity stress in barley and other cereal crops. PMID:26372557
Cuff, Derek J; O'Brien, Kathleen C; Pupello, Derek R; Santoni, Brandon G
2016-07-01
To evaluate multiple preoperative and operative factors that may be predictive of and correlate with acute postoperative pain levels after arthroscopic rotator cuff repair. One hundred eighty-one patients underwent arthroscopic rotator cuff surgery along with subacromial decompression and met the inclusion criteria for this study. Postoperative visual analog scale (VAS) scores were obtained on postoperative days 1, 7, and 90. Multivariate linear regression analysis was used to correlate postoperative VAS scores with multiple independent factors, including preoperative subjective pain tolerance, preoperative VAS score, preoperative narcotic use, sex, smoking status, number of suture anchors used, tear size, single- or double-row repair, and patient age. Preoperative subjective pain tolerance, notably those patients rating themselves as having an extremely high pain tolerance, was the most significant predictor of high VAS pain scores on both postoperative day 1 (P = .0001) and postoperative day 7 (P < .0001). Preoperative narcotic use was also significantly predictive (P = .010) of high pain scores on postoperative day 1 and day 7 (P = .019), along with nonsmokers (P = .008) and younger patients (P = .006) being predictive on day 7. There were no patient factors that were predictive of VAS scores 3 months postoperatively (P = .567). Preoperative subjective pain tolerance, notably those patients rating themselves as having an extremely high pain tolerance, was the strongest factor predicting high acute pain levels after arthroscopic rotator cuff surgery. Preoperative narcotic use, smokers, and younger patients were also predictive of higher pain levels during the first postoperative week. Level IV, prognostic case series. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.
Yaish, Mahmoud W; Sunkar, Ramanjulu; Zheng, Yun; Ji, Bo; Al-Yahyai, Rashid; Farooq, Sardar A
2015-01-01
Although date palm is relatively salt-tolerant, little is known about the underlying molecular mechanisms that contribute to its salt tolerance. Only recently, investigators have uncovered microRNA-mediated post-transcriptional gene regulation, which is critical for typical plant development and adaptation to stress conditions such as salinity. To identify conserved and novel miRNAs in date palm and to characterize miRNAs that could play a role in salt tolerance, we have generated sRNA libraries from the leaves and roots of NaCl-treated and untreated seedlings of date palm. Deep sequencing of these four sRNA libraries yielded approximately 251 million reads. The bioinformatics analysis has identified 153 homologs of conserved miRNAs, 89 miRNA variants, and 180 putative novel miRNAs in date palm. Expression profiles under salinity revealed differential regulation of some miRNAs in date palm. In leaves, 54 of the identified miRNAs were significantly affected and the majority (70%) of them were upregulated, whereas in roots, 25 of the identified miRNAs were significantly affected and 76% of them were upregulated by the salinity stress. The salt-responsiveness of some of these miRNAs was further validated using semi-quantitative PCR (qPCR). Some of the predicted targets for the identified miRNA include genes with known functions in plant salt tolerance, such as potassium channel AKT2-like proteins, vacuolar protein sorting-associated protein, calcium-dependent and mitogen-activated proteins. As one of the first cultivated trees in the world that can tolerate a wide range of abiotic stresses, date palm contains a large population of conserved and non-conserved miRNAs that function at the post-transcriptional level. This study provided insights into miRNA-mediated gene expression that are important for adaptation to salinity in date palms.
Nagarajan, N; Gunasekaran, P; Rajendran, P
2015-04-01
Electroplating industries in Madurai city produce approximately 49,000 L of wastewater and 1200 L of sludge every day revealing 687-5569 ppm of nickel (Ni) with other contaminants. Seventeen Ni-tolerant bacterial strains were isolated from nutrient-enriched effluents. Among them one hyper Ni accumulating strain was scored and identified as Bacillus cereus VP17 on the basis of morphology, biochemical tests, 16S rDNA gene sequencing, and phylogenetic analysis. Equilibrium data of Ni(II) ions using the bacterium as sorbent at isothermal conditions (37 °C) and pH 6 were best adjusted by Langmuir (R(2) = 0.6268) and Freundlich models (R(2) = 0.9505). Experimental validation reveals Ni sorption takes place on a heterogeneous surface of the biosorbent, and predicted metal sorption capacity is 434 ppm. The pseudo-second-order kinetic model fitted the biosorption kinetic data better than the pseudo-first-order kinetic model (R(2) = 0.9963 and 0.3625). Scanning electron microscopy, energy dispersive X-ray, and Fourier transform infrared spectroscopy studies of the bacterial strain with and without Ni(II) ion reveals the biosorption mechanism. The results conclude possibilities of using B. cereus VP17 for Ni bioremediation.
Genome-Wide Analyses of the Soybean F-Box Gene Family in Response to Salt Stress
Jia, Qi; Xiao, Zhi-Xia; Wong, Fuk-Ling; Sun, Song; Liang, Kang-Jing; Lam, Hon-Ming
2017-01-01
The F-box family is one of the largest gene families in plants that regulate diverse life processes, including salt responses. However, the knowledge of the soybean F-box genes and their roles in salt tolerance remains limited. Here, we conducted a genome-wide survey of the soybean F-box family, and their expression analysis in response to salinity via in silico analysis of online RNA-sequencing (RNA-seq) data and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) to predict their potential functions. A total of 725 potential F-box proteins encoded by 509 genes were identified and classified into 9 subfamilies. The gene structures, conserved domains and chromosomal distributions were characterized. There are 76 pairs of duplicate genes identified, including genome-wide segmental and tandem duplication events, which lead to the expansion of the number of F-box genes. The in silico expression analysis showed that these genes would be involved in diverse developmental functions and play an important role in salt response. Our qRT-PCR analysis confirmed 12 salt-responding F-box genes. Overall, our results provide useful information on soybean F-box genes, especially their potential roles in salt tolerance. PMID:28417911
Genome-Wide Analyses of the Soybean F-Box Gene Family in Response to Salt Stress.
Jia, Qi; Xiao, Zhi-Xia; Wong, Fuk-Ling; Sun, Song; Liang, Kang-Jing; Lam, Hon-Ming
2017-04-12
The F-box family is one of the largest gene families in plants that regulate diverse life processes, including salt responses. However, the knowledge of the soybean F-box genes and their roles in salt tolerance remains limited. Here, we conducted a genome-wide survey of the soybean F-box family, and their expression analysis in response to salinity via in silico analysis of online RNA-sequencing (RNA-seq) data and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) to predict their potential functions. A total of 725 potential F-box proteins encoded by 509 genes were identified and classified into 9 subfamilies. The gene structures, conserved domains and chromosomal distributions were characterized. There are 76 pairs of duplicate genes identified, including genome-wide segmental and tandem duplication events, which lead to the expansion of the number of F-box genes. The in silico expression analysis showed that these genes would be involved in diverse developmental functions and play an important role in salt response. Our qRT-PCR analysis confirmed 12 salt-responding F-box genes. Overall, our results provide useful information on soybean F-box genes, especially their potential roles in salt tolerance.
Candidate Genes Expressed in Tolerant Common Wheat With Resistant to English Grain Aphid.
Luo, Kun; Zhang, Gaisheng; Wang, Chunping; Ouellet, Thérèse; Wu, Jingjing; Zhu, Qidi; Zhao, Huiyan
2014-10-01
The English grain aphid, Sitobion avenae (F.) (Hemiptera: Aphididae), is a common worldwide pest of wheat (Triticum aestivum L.). The use of improved resistant cultivars by the farmers is the most effective and environmentally friendly method to control this aphid in the field. The winter wheat genotypes 98-10-35 and Amigo are resistant to S. avenae. To identify genes responsible for resistance to S. avenae in these genotypes, differential-display reverse transcription-polymerase chain reaction was used to identify the corresponding differentially expressed sequences in current study. Two backcross progenies were obtained by crossing the two resistant genotypes with the susceptible genotype 1376. Six potential expected-differential bands were sequenced. Lengths of the expressed sequence tags ranged from 128 to 532 bp. Although these expressed sequences were likely associated with S. avenae resistance, there was one expressed sequence tag located on 7DL chromosome, and its potential function may associate with the ability to maintain photosynthesis in wheat. That serves as an active way for tolerant common wheat with resistant to S. avenae. Cloning the full length of these sequences would help us thoroughly understand the mechanism of wheat resistance to S. avenae and be valuable for breeding cultivars with S. avenae resistance. © 2014 Entomological Society of America.
Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng
2015-01-01
Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589
Predicting residue-wise contact orders in proteins by support vector regression.
Song, Jiangning; Burrage, Kevin
2006-10-03
The residue-wise contact order (RWCO) describes the sequence separations between the residues of interest and its contacting residues in a protein sequence. It is a new kind of one-dimensional protein structure that represents the extent of long-range contacts and is considered as a generalization of contact order. Together with secondary structure, accessible surface area, the B factor, and contact number, RWCO provides comprehensive and indispensable important information to reconstructing the protein three-dimensional structure from a set of one-dimensional structural properties. Accurately predicting RWCO values could have many important applications in protein three-dimensional structure prediction and protein folding rate prediction, and give deep insights into protein sequence-structure relationships. We developed a novel approach to predict residue-wise contact order values in proteins based on support vector regression (SVR), starting from primary amino acid sequences. We explored seven different sequence encoding schemes to examine their effects on the prediction performance, including local sequence in the form of PSI-BLAST profiles, local sequence plus amino acid composition, local sequence plus molecular weight, local sequence plus secondary structure predicted by PSIPRED, local sequence plus molecular weight and amino acid composition, local sequence plus molecular weight and predicted secondary structure, and local sequence plus molecular weight, amino acid composition and predicted secondary structure. When using local sequences with multiple sequence alignments in the form of PSI-BLAST profiles, we could predict the RWCO distribution with a Pearson correlation coefficient (CC) between the predicted and observed RWCO values of 0.55, and root mean square error (RMSE) of 0.82, based on a well-defined dataset with 680 protein sequences. Moreover, by incorporating global features such as molecular weight and amino acid composition we could further improve the prediction performance with the CC to 0.57 and an RMSE of 0.79. In addition, combining the predicted secondary structure by PSIPRED was found to significantly improve the prediction performance and could yield the best prediction accuracy with a CC of 0.60 and RMSE of 0.78, which provided at least comparable performance compared with the other existing methods. The SVR method shows a prediction performance competitive with or at least comparable to the previously developed linear regression-based methods for predicting RWCO values. In contrast to support vector classification (SVC), SVR is very good at estimating the raw value profiles of the samples. The successful application of the SVR approach in this study reinforces the fact that support vector regression is a powerful tool in extracting the protein sequence-structure relationship and in estimating the protein structural profiles from amino acid sequences.
Tranchida-Lombardo, Valentina; Aiese Cigliano, Riccardo; Anzar, Irantzu; Landi, Simone; Palombieri, Samuela; Colantuono, Chiara; Bostan, Hamed; Termolino, Pasquale; Aversano, Riccardo; Batelli, Giorgia; Cammareri, Maria; Carputo, Domenico; Chiusano, Maria Luisa; Conicella, Clara; Consiglio, Federica; D'Agostino, Nunzio; De Palma, Monica; Di Matteo, Antonio; Grandillo, Silvana; Sanseverino, Walter; Tucci, Marina; Grillo, Stefania
2017-11-14
Tomato is a high value crop and the primary model for fleshy fruit development and ripening. Breeding priorities include increased fruit quality, shelf life and tolerance to stresses. To contribute towards this goal, we re-sequenced the genomes of Corbarino (COR) and Lucariello (LUC) landraces, which both possess the traits of plant adaptation to water deficit, prolonged fruit shelf-life and good fruit quality. Through the newly developed pipeline Reconstructor, we generated the genome sequences of COR and LUC using datasets of 65.8 M and 56.4 M of 30-150 bp paired-end reads, respectively. New contigs including reads that could not be mapped to the tomato reference genome were assembled, and a total of 43, 054 and 44, 579 gene loci were annotated in COR and LUC. Both genomes showed novel regions with similarity to Solanum pimpinellifolium and Solanum pennellii. In addition to small deletions and insertions, 2, 000 and 1, 700 single nucleotide polymorphisms (SNPs) could exert potentially disruptive effects on 1, 371 and 1, 201 genes in COR and LUC, respectively. A detailed survey of the SNPs occurring in fruit quality, shelf life and stress tolerance related-genes identified several candidates of potential relevance. Variations in ethylene response components may concur in determining peculiar phenotypes of COR and LUC. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Wang, Fan; Zhao, Hongwei; Xiang, Haiying; Wu, Lijun; Men, Xiao; Qi, Chang; Chen, Guoqiang; Zhang, Haibo; Wang, Yi; Xian, Mo
2018-06-05
Microbes on aging flue-cured tobaccos (ATFs) improve the aroma and other qualities desirable in products. Understanding the relevant organisms would picture microbial community diversity, metabolic potential, and their applications. However, limited efforts have been made on characterizing the microbial quality and functional profiling. Herein, we present our investigation of the bacterial diversity and predicted potential genetic capability of the bacteria from two AFTs using 16S rRNA gene sequences and phylogenetic investigation of communities by reconstruction of unobserved states (PICRUSt) software. The results show that dominant bacteria from AFT surfaces were classified into 48 genera, 36 families, and 7 phyla. In addition, Bacillus spp. was found prevalent on both ATFs. Furthermore, PICRUSt predictions of bacterial community functions revealed many attractive metabolic capacities in the AFT microbiota, including several involved in the biosynthesis of flavors and fragrances and the degradation of harmful compounds, such as nicotine and nitrite. These results provide insights into the importance of AFT bacteria in determining product qualities and indicate specific microbial species with predicted enzymatic capabilities for the production of high-efficiency flavors, the degradation of undesirable compounds, and the provision of nicotine and nitrite tolerance which suggest fruitful areas of investigation into the manipulation of AFT microbiota for AFT and other product improvements.
SnAP reagents for the one-step synthesis of medium-ring saturated N-heterocycles from aldehydes
NASA Astrophysics Data System (ADS)
Vo, Cam-Van T.; Luescher, Michael U.; Bode, Jeffrey W.
2014-04-01
Interest in saturated N-heterocycles as scaffolds for the synthesis of bioactive molecules is increasing. Reliable and predictable synthetic methods for the preparation of these compounds, especially medium-sized rings, are limited. We describe the development of SnAP (Sn amino protocol) reagents for the transformation of aldehydes into seven-, eight- and nine-membered saturated N-heterocycles. This process occurs under mild, room-temperature conditions and offers exceptional substrate scope and functional-group tolerance. Air- and moisture-stable SnAP reagents are prepared on a multigram scale from inexpensive starting materials by simple reaction sequences. These new reagents and processes allow widely available aryl, heteroaryl and aliphatic aldehydes to be converted into diverse N-heterocycles, including diazepanes, oxazepanes, diazocanes, oxazocanes and hexahydrobenzoxazonines, by a single synthetic operation.
Chlumský, J; Filipova, P; Terl, M
2006-01-01
Most patients with chronic obstructive pulmonary disease (COPD) have impaired respiratory muscle function. Maximal oesophageal pressure correlates closely with exercise tolerance and seems to predict the distance walked during the 6-min walk test. This study assessed the non-invasive parameters of respiratory muscle function in 41 patients with COPD to investigate their relationship to pulmonary function tests and exercise tolerance. The COPD patients, who demonstrated the full range of airway obstruction severity, had a mean forced expiratory volume in 1 s of 42.5% predicted (range, 20 - 79% predicted). Both the maximal inspiratory muscle strength and non-invasive tension-time index were significantly correlated with the degree of lung hyperinflation, as expressed by the ratio of residual volume to total lung capacity, and the distance walked in 6 min. We conclude that respiratory muscle function was influenced mainly by lung hyperinflation and that it had an important effect on exercise tolerance in COPD patients.
Transcriptome analysis of hexaploid hulless oat in response to salinity stress
Wu, Bin; Hu, Yani; Huo, Pengjie; Zhang, Qian; Chen, Xin; Zhang, Zongwen
2017-01-01
Background Oat is a cereal crop of global importance used for food, feed, and forage. Understanding salinity stress tolerance mechanisms in plants is an important step towards generating crop varieties that can cope with environmental stresses. To date, little is known about the salt tolerance of oat at the molecular level. To better understand the molecular mechanisms underlying salt tolerance in oat, we investigated the transcriptomes of control and salt-treated oat using RNA-Seq. Results Using Illumina HiSeq 4000 platform, we generated 72,291,032 and 356,891,432 reads from non-stressed control and salt-stressed oat, respectively. Assembly of 64 Gb raw sequence data yielded 128,414 putative unique transcripts with an average length of 1,189 bp. Analysis of the assembled unigenes from the salt stressed and control libraries indicated that about 65,000 unigenes were differentially expressed at different stages. Functional annotation showed that ABC transporters, plant hormone signal transduction, plant-pathogen interactions, starch and sucrose metabolism, arginine and proline metabolism, and other secondary metabolite pathways were enriched under salt stress. Based on the RPKM values of assembled unigenes, 24 differentially expressed genes under salt stress were selected for quantitative RT-PCR validation, which successfully confirmed the results of RNA-Seq. Furthermore, we identified 18,039 simple sequence repeats, which may help further elucidate salt tolerance mechanisms in oat. Conclusions Our global survey of transcriptome profiles of oat plants in response to salt stress provides useful insights into the molecular mechanisms underlying salt tolerance in this crop. These findings also represent a rich resource for further analysis of salt tolerance and for breeding oat with improved salt tolerance through the use of salt-related genes. PMID:28192458
Wang, Rong-Kai; Zhang, Rui-Fen; Hao, Yu-Jin
2013-01-01
The MYB proteins comprise one of the largest families of transcription factors (TFs) in plants. Although several MYB genes have been characterized to play roles in secondary metabolism, the MYB family has not yet been identified in apple. In this study, 229 apple MYB genes were identified through a genome-wide analysis and divided into 45 subgroups. A computational analysis was conducted using the apple genomic database to yield a complete overview of the MYB family, including the intron-exon organizations, the sequence features of the MYB DNA-binding domains, the carboxy-terminal motifs, and the chromosomal locations. Subsequently, the expression of 18 MYB genes, including 12 were chosen from stress-related subgroups, while another 6 ones from other subgroups, in response to various abiotic stresses was examined. It was found that several of these MYB genes, particularly MdoMYB121, were induced by multiple stresses. The MdoMYB121 was then further functionally characterized. Its predicted protein was found to be localized in the nucleus. A transgenic analysis indicated that the overexpression of the MdoMYB121 gene remarkably enhanced the tolerance to high salinity, drought, and cold stresses in transgenic tomato and apple plants. Our results indicate that the MYB genes are highly conserved in plant species and that MdoMYB121 can be used as a target gene in genetic engineering approaches to improve the tolerance of plants to multiple abiotic stresses. PMID:23950843
Applications of a damage tolerance analysis methodology in aircraft design and production
NASA Technical Reports Server (NTRS)
Woodward, M. R.; Owens, S. D.; Law, G. E.; Mignery, L. A.
1992-01-01
Objectives of customer mandated aircraft structural integrity initiatives in design are to guide material selection, to incorporate fracture resistant concepts in the design, to utilize damage tolerance based allowables and planned inspection procedures necessary to enhance the safety and reliability of manned flight vehicles. However, validated fracture analysis tools for composite structures are needed to accomplish these objectives in a timely and economical manner. This paper briefly describes the development, validation, and application of a damage tolerance methodology for composite airframe structures. A closed-form analysis code, entitled SUBLAM was developed to predict the critical biaxial strain state necessary to cause sublaminate buckling-induced delamination extension in an impact damaged composite laminate. An embedded elliptical delamination separating a thin sublaminate from a thick parent laminate is modelled. Predicted failure strains were correlated against a variety of experimental data that included results from compression after impact coupon and element tests. An integrated analysis package was developed to predict damage tolerance based margin-of-safety (MS) using NASTRAN generated loads and element information. Damage tolerance aspects of new concepts are quickly and cost-effectively determined without the need for excessive testing.
Song, Lili; Jiang, Lin; Chen, Yue; Shu, Yongjun; Bai, Yan; Guo, Changhong
2016-09-01
Medicago sativa L. (alfalfa) 'Zhaodong' is an important forage legume that can safely survive in northern China where winter temperatures reach as low as -30 °C. Survival of alfalfa following freezing stress depends on the amount and revival ability of crown buds. In order to investigate the molecular mechanisms of frost tolerance in alfalfa, we used transcriptome sequencing technology and bioinformatics strategies to analyze crown buds of field-grown alfalfa during winter. We statistically identified a total of 5605 differentially expressed genes (DEGs) involved in freezing stress including 1900 upregulated and 3705 downregulated DEGs. We validated 36 candidate DEGs using qPCR to confirm the accuracy of the RNA-seq data. Unlike other recent studies, this study employed alfalfa plants grown in the natural environment. Our results indicate that not only the CBF orthologs but also membrane proteins, hormone signal transduction pathways, and ubiquitin-mediated proteolysis pathways indicate the presence of a special freezing adaptation mechanism in alfalfa. The antioxidant defense system may rapidly confer freezing tolerance to alfalfa. Importantly, biosynthesis of secondary metabolites and phenylalanine metabolism, which is of potential importance in coordinating freezing tolerance with growth and development, were downregulated in subzero temperatures. The adaptive mechanism for frost tolerance is a complex multigenic process that is not well understood. This systematic analysis provided an in-depth view of stress tolerance mechanisms in alfalfa.
Wang, Xi; Cai, Hua; Li, Yong; Zhu, Yanming; Ji, Wei; Bai, Xi; Zhu, Dan; Sun, Xiaoli
2015-01-01
Plasma membrane intrinsic proteins (PIPs) belong to the aquaporin family and facilitate water movement across plasma membranes. Existing data indicate that PIP genes are associated with the abilities of plants to tolerate certain stress conditions. A review of our Glycine soja expressed sequence tag (EST) dataset revealed that abiotic stress stimulated expression of a PIP, herein designated as GsPIP2;1 (GenBank_Accn: FJ825766). To understand the roles of this PIP in stress tolerance, we generated a coding sequence for GsPIP2;1 by in silico elongation and cloned the cDNA by 5'-RACE. Semiquantitative RT-PCR showed that GsPIP2;1 expression was stimulated in G. soja leaves by cold, salt, or dehydration stress, whereas the same stresses suppressed GsPIP2;1 expression in the roots. Transgenic Arabidopsis thaliana plants overexpressing GsPIP2;1 grew normally under unstressed and cold conditions, but exhibited depressed tolerance to salt and dehydration stresses. Moreover, greater changes in water potential were detected in the transgenic A. thaliana shoots, implying that GsPIP2;1 may negatively impact stress tolerance by regulating water potential. These results, deviating from those obtained in previous reports, provide new insights into the relationship between PIPs and abiotic stress tolerance in plants.
Guo, B Z; Xu, G; Cao, Y G; Holbrook, C C; Lynch, R E
2006-02-01
Preharvest aflatoxin contamination has been identified by the peanut industry as a serious issue in food safety and human health because of the carcinogenic toxicity. Drought stress is the most important environmental factor exacerbating Aspergillus infection and aflatoxin contamination in peanut. The development of drought-tolerant peanut cultivars could reduce aflatoxin contamination and would represent a major advance in the peanut industry. In this study, we identified a novel PLD gene in peanut (Arachis hypogaea), encoding a putative phospholipase D (PLD, EC 3.1.4.4). The completed cDNA sequence was obtained by using the consensus-degenerated hybrid oligonucleotide primer strategy. The deduced amino acid sequence shows high identity with known PLDs, and has similar conserved domains. The PLD gene expression under drought stress has been studied using four peanut lines: Tifton 8 and A13 (both drought tolerant) and Georgia Green (moderate) and PI 196754 (drought sensitive). Northern analysis showed that PLD gene expression was induced faster by drought stress in the drought-sensitive lines than the drought tolerance lines. Southern analysis showed that cultivated peanut has multiple copies (3 to 5 copies) of the PLD gene. These results suggest that peanut PLD may be involved in drought sensitivity and tolerance responses. Peanut PLD gene expression may be useful as a tool in germplasm screening for drought tolerance.
Lau, Cathrine; Toft, Ulla; Tetens, Inge; Carstensen, Bendix; Jørgensen, Torben; Pedersen, Oluf; Borch-Johnsen, Knut
2009-03-01
We examined whether the adherence to major dietary patterns at baseline of 5824 nondiabetic Danes (30-60 y) enrolled in the nonpharmacological Inter99 intervention predicted changes in fasting plasma glucose (FPG) and postchallenge 2-h plasma glucose (2h-PG) concentrations during a 5 y period and whether a potential association was dependent on baseline glucose tolerance status. Through principal component analysis, a score for a traditional dietary pattern (characterized by higher intakes of high-fat sandwich spreads, red meat, potatoes, butter and lard, low-fat fish, sandwich meat, and sauces) and a score for a modern dietary pattern (characterized by higher intakes of vegetables, fruit, vegetable oil/vinegar dressing, poultry, pasta, rice, and cereals) were estimated for each person at baseline. Random effect models adjusting for relevant confounders were used to estimate changes in repetitive measures of FPG and 2h-PG. A higher modern score (of 1 SD) predicted an annual decrease in 2h-PG of 0.015 mmol/L (P < 0.01) regardless of glucose tolerance status. For individuals with isolated impaired glucose tolerance, a higher traditional score (of 1 SD) predicted an annual increase in 2h-PG of 0.083 mmol/L (P < 0.0001). In conclusion, glucose tolerance status did not, in general, affect the predictive effect of the dietary patterns. The study suggests that the risk of worsening 2h-PG concentrations may be smaller for individuals with a high modern dietary pattern score characterized by high intakes of vegetables, fruit, vegetable oil/vinegar dressing, poultry, pasta, rice, and cereals.
Chang, Yun-Juan; Peacock, Aaron D.; Long, Philip E.; Stephen, John R.; McKinley, James P.; Macnaughton, Sarah J.; Hussain, A. K. M. Anwar; Saxton, Arnold M.; White, David C.
2001-01-01
Microbially mediated reduction and immobilization of U(VI) to U(IV) plays a role in both natural attenuation and accelerated bioremediation of uranium-contaminated sites. To realize bioremediation potential and accurately predict natural attenuation, it is important to first understand the microbial diversity of such sites. In this paper, the distribution of sulfate-reducing bacteria (SRB) in contaminated groundwater associated with a uranium mill tailings disposal site at Shiprock, N.Mex., was investigated. Two culture-independent analyses were employed: sequencing of clone libraries of PCR-amplified dissimilatory sulfite reductase (DSR) gene fragments and phospholipid fatty acid (PLFA) biomarker analysis. A remarkable diversity among the DSR sequences was revealed, including sequences from δ-Proteobacteria, gram-positive organisms, and the Nitrospira division. PLFA analysis detected at least 52 different mid-chain-branched saturate PLFA and included a high proportion of 10me16:0. Desulfotomaculum and Desulfotomaculum-like sequences were the most dominant DSR genes detected. Those belonging to SRB within δ-Proteobacteria were mainly recovered from low-uranium (≤302 ppb) samples. One Desulfotomaculum-like sequence cluster overwhelmingly dominated high-U (>1,500 ppb) sites. Logistic regression showed a significant influence of uranium concentration over the dominance of this cluster of sequences (P = 0.0001). This strong association indicates that Desulfotomaculum has remarkable tolerance and adaptation to high levels of uranium and suggests the organism's possible involvement in natural attenuation of uranium. The in situ activity level of Desulfotomaculum in uranium-contaminated environments and its comparison to the activities of other SRB and other functional groups should be an important area for future research. PMID:11425735
2012-01-01
Background Mutans streptococci are a group of gram-positive bacteria including the primary cariogenic dental pathogen Streptococcus mutans and closely related species. Two component systems (TCSs) composed of a signal sensing histidine kinase (HK) and a response regulator (RR) play key roles in pathogenicity, but have not been comparatively studied for these oral bacterial pathogens. Results HKs and RRs of 8 newly sequenced mutans streptococci strains, including S. sobrinus DSM20742, S. ratti DSM20564 and six S. mutans strains, were identified and compared to the TCSs of S. mutans UA159 and NN2025, two previously genome sequenced S. mutans strains. Ortholog analysis revealed 18 TCS clusters (HK-RR pairs), 2 orphan HKs and 2 orphan RRs, of which 8 TCS clusters were common to all 10 strains, 6 were absent in one or more strains, and the other 4 were exclusive to individual strains. Further classification of the predicted HKs and RRs revealed interesting aspects of their putative functions. While TCS complements were comparable within the six S. mutans strains, S. sobrinus DSM20742 lacked TCSs possibly involved in acid tolerance and fructan catabolism, and S. ratti DSM20564 possessed 3 unique TCSs but lacked the quorum-sensing related TCS (ComDE). Selected computational predictions were verified by PCR experiments. Conclusions Differences in the TCS repertoires of mutans streptococci strains, especially those of S. sobrinus and S. ratti in comparison to S. mutans, imply differences in their response mechanisms for survival in the dynamic oral environment. This genomic level study of TCSs should help in understanding the pathogenicity of these mutans streptococci strains. PMID:22475007
Gschloessl, B; Dorkeld, F; Berges, H; Beydon, G; Bouchez, O; Branco, M; Bretaudeau, A; Burban, C; Dubois, E; Gauthier, P; Lhuillier, E; Nichols, J; Nidelet, S; Rocha, S; Sauné, L; Streiff, R; Gautier, M; Kerdelhué, C
2018-05-01
The pine processionary moth Thaumetopoea pityocampa (Lepidoptera: Notodontidae) is the main pine defoliator in the Mediterranean region. Its urticating larvae cause severe human and animal health concerns in the invaded areas. This species shows a high phenotypic variability for various traits, such as phenology, fecundity and tolerance to extreme temperatures. This study presents the construction and analysis of extensive genomic and transcriptomic resources, which are an obligate prerequisite to understand their underlying genetic architecture. Using a well-studied population from Portugal with peculiar phenological characteristics, the karyotype was first determined and a first draft genome of 537 Mb total length was assembled into 68,292 scaffolds (N50 = 164 kb). From this genome assembly, 29,415 coding genes were predicted. To circumvent some limitations for fine-scale physical mapping of genomic regions of interest, a 3X coverage BAC library was also developed. In particular, 11 BACs from this library were individually sequenced to assess the assembly quality. Additionally, de novo transcriptomic resources were generated from various developmental stages sequenced with HiSeq and MiSeq Illumina technologies. The reads were de novo assembled into 62,376 and 63,175 transcripts, respectively. Then, a robust subset of the genome-predicted coding genes, the de novo transcriptome assemblies and previously published 454/Sanger data were clustered to obtain a high-quality and comprehensive reference transcriptome consisting of 29,701 bona fide unigenes. These sequences covered 99% of the cegma and 88% of the busco highly conserved eukaryotic genes and 84% of the busco arthropod gene set. Moreover, 90% of these transcripts could be localized on the draft genome. The described information is available via a genome annotation portal (http://bipaa.genouest.org/sp/thaumetopoea_pityocampa/). © 2018 John Wiley & Sons Ltd.
USDA-ARS?s Scientific Manuscript database
Objective: The reinforcing (motivating) value of exercise/physical activity (RRVex) predicts usual exercise behavior and meeting of physical activity guidelines. Recent cross-sectional evidence suggests, for the first time, that greater tolerance for the discomfort experienced during exercise is ass...
Wang, Ying; Guo, Shirong; Wang, Lei; Wang, Liwei; He, Xueying; Shu, Sheng; Sun, Jin; Lu, Na
2018-04-24
High-temperature stress inhibited the growth of cucumber seedlings. Foliar spraying of 1.0 mmol·L - 1 exogenous spermidine (Spd) to the sensitive cucumber cultivar 'Jinchun No. 2' grown at high-temperature (42 °C/32 °C) in an artificial climate box improved the high-temperature tolerance. Although there have been many reports on the response of microRNAs (miRNAs) to high-temperature stress, the mechanism by which exogenous Spd may mitigate the damage of high-temperature stress through miRNA-mediated regulation has not been studied. To elucidate the regulation of miRNAs in response to exogenous Spd-mediated improvement of high-temperature tolerance, four small RNA libraries were constructed from cucumber leaves and sequenced: untreated-control (CW), Spd-treated (CS), high-temperature stress (HW), and Spd-treated and high-temperature stress (HS). As a result, 107 known miRNAs and 79 novel miRNAs were identified. Eight common differentially expressed miRNAs (miR156d-3p, miR170-5p, miR2275-5p, miR394a, miR479b, miR5077, miR5222 and miR6475) were observed in CS/CW, HW/CW, HS/CW and HS/HW comparison pairs, which were the first set of miRNAs that responded to not only high-temperature stress but also exogenous Spd in cucumber seedlings. Five of the eight miRNAs were predicted to target 107 potential genes. Gene function and pathway analyses highlighted the integral role that these miRNAs and target genes probably play in the improvement of the high-temperature tolerance of cucumber seedlings through exogenous Spd application. Our study identified the first set of miRNAs associated with the exogenous Spd-mediated improvement of high-temperature tolerance in cucumber seedlings. The results could help to promote further studies on the complex molecular mechanisms underlying high-temperature tolerance in cucumber and provide a theoretical basis for the high-quality and efficient cultivation of cucumber with high-temperature resistance.
Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj
2011-06-01
The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable marker-aided breeding of foxtail millet for dehydration tolerance.
Round-off errors in cutting plane algorithms based on the revised simplex procedure
NASA Technical Reports Server (NTRS)
Moore, J. E.
1973-01-01
This report statistically analyzes computational round-off errors associated with the cutting plane approach to solving linear integer programming problems. Cutting plane methods require that the inverse of a sequence of matrices be computed. The problem basically reduces to one of minimizing round-off errors in the sequence of inverses. Two procedures for minimizing this problem are presented, and their influence on error accumulation is statistically analyzed. One procedure employs a very small tolerance factor to round computed values to zero. The other procedure is a numerical analysis technique for reinverting or improving the approximate inverse of a matrix. The results indicated that round-off accumulation can be effectively minimized by employing a tolerance factor which reflects the number of significant digits carried for each calculation and by applying the reinversion procedure once to each computed inverse. If 18 significant digits plus an exponent are carried for each variable during computations, then a tolerance value of 0.1 x 10 to the minus 12th power is reasonable.
Genetic characterization of strains of Saccharomyces uvarum from New Zealand wineries.
Zhang, Hanyao; Richards, Keith D; Wilson, Sandra; Lee, Soon A; Sheehan, Hester; Roncoroni, Miguel; Gardner, Richard C
2015-04-01
We present a genetic characterization of 65 isolates of Saccharomyces uvarum isolated from wineries in New Zealand, along with the complete nucleotide sequence of a single sulfite-tolerant isolate. The genome of the New Zealand isolate averaged 99.85% nucleotide identity to CBS7001, the previously sequenced strain of S. uvarum. However, three genomic segments (37-87 kb) showed 10% nucleotide divergence from CBS7001 but 99% identity to Saccharomyces eubayanus. We conclude that these three segments appear to have been introgressed from that species. The nucleotide sequence of the internal transcribed spacer (ITS) region from other New Zealand isolates were also very similar to that of CBS7001, and hybrids showed complete genetic compatibility for some strains, with tetrads giving four viable progeny that showed 2:2 segregations of marker genes. Some strains showed high tolerance to sulfite, with genetic analysis indicating linkage of this trait to the transcription factor FZF1, but not to SSU1, the sulfite efflux pump that it regulates in order to confer sulfite tolerance in Saccharomyces cerevisiae. The fermentation characteristics of selected strains of S. uvarum showed exceptionally good cold fermentation characteristics, superior to the best commercially available strains of S. cerevisiae. Copyright © 2014 Elsevier Ltd. All rights reserved.
Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods
Thompson, David N [Idaho Falls, ID; Thompson, Vicki S [Idaho Falls, ID; Schaller, Kastli D [Ammon, ID; Apel, William A [Jackson, WY; Lacey, Jeffrey A [Idaho Falls, ID; Reed, David W [Idaho Falls, ID
2011-04-12
Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.
Tong, Jun; Dong, Yanfang; Xu, Dongyun; Mao, Jing; Zhou, Yuan
2017-01-01
Rhododendron spp. is an important ornamental species that is widely cultivated for landscape worldwide. Heat stress is a major obstacle for its cultivation in south China. Previous studies on rhododendron principally focused on its physiological and biochemical processes, which are involved in a series of stress tolerance. However, molecular or genetic properties of rhododendron’s response to heat stress are still poorly understood. The phenotype and chlorophyll fluorescence kinetics parameters of four rhododendron cultivars were compared under normal or heat stress conditions, and a cultivar with highest heat tolerance, “Yanzhimi” (R. obtusum) was selected for transcriptome sequencing. A total of 325,429,240 high quality reads were obtained and assembled into 395,561 transcripts and 92,463 unigenes. Functional annotation showed that 38,724 unigenes had sequence similarity to known genes in at least one of the proteins or nucleotide databases used in this study. These 38,724 unigenes were categorized into 51 functional groups based on Gene Ontology classification and were blasted to 24 known cluster of orthologous groups. A total of 973 identified unigenes belonged to 57 transcription factor families, including the stress-related HSF, DREB, ZNF, and NAC genes. Photosynthesis was significantly enriched in the Kyoto Encyclopedia of Genes and Genomes pathway, and the changed expression pattern was illustrated. The key pathways and signaling components that contribute to heat tolerance in rhododendron were revealed. These results provide a potentially valuable resource that can be used for heat-tolerance breeding. PMID:29059200
SEAN: SNP prediction and display program utilizing EST sequence clusters.
Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek
2006-02-15
SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.
Ricciardi, Annamaria; Parente, Eugenio; Guidone, Angela; Ianniello, Rocco Gerardo; Zotta, Teresa; Abu Sayem, S M; Varcamonti, Mario
2012-07-02
Lactobacillus plantarum, Lactobacillus pentosus and Lactobacillus paraplantarum are three closely related species which are widespread in food and non-food environments, and are important as starter bacteria or probiotics. In order to evaluate the phenotypic diversity of stress tolerance in the L. plantarum group and the ability to mount an adaptive heat shock response, the survival of exponential and stationary phase and of heat adapted exponential phase cells of six L. plantarum subsp. plantarum, one L. plantarum subsp. argentoratensis, one L. pentosus and two L. paraplantarum strains selected in a previous work upon exposure to oxidative, heat, detergent, starvation and acid stresses was compared to that of the L. plantarum WCFS1 strain. Furthermore, to evaluate the genotypic diversity in stress response genes, ten genes (encoding for chaperones DnaK, GroES and GroEL, regulators CtsR, HrcA and CcpA, ATPases/proteases ClpL, ClpP, ClpX and protease FtsH) were amplified using primers derived from the WCFS1 genome sequence and submitted to restriction with one or two endonucleases. The results were compared by univariate and multivariate statistical methods. In addition, the amplicons for hrcA and ctsR were sequenced and compared by multiple sequence alignment and polymorphism analysis. Although there was evidence of a generalized stress response in the stationary phase, with increase of oxidative, heat, and, to a lesser extent, starvation stress tolerance, and for adaptive heat stress response, with increased tolerance to heat, acid and detergent, different growth phases and adaptation patterns were found. Principal component analysis showed that while heat, acid and detergent stresses respond similarly to growth phase and adaptation, tolerance to oxidative and starvation stresses implies completely unrelated mechanisms. A dendrogram obtained using the data from multilocus restriction typing (MLRT) of stress response genes clearly separated two groups of L. plantarum strains from the other species but there was no correlation between genotypic grouping and grouping obtained on the basis of the stress response pattern, nor with the phylograms obtained from hrcA and ctsR sequences. Differences in sequence in L. plantarum strains were mostly due to single nucleotide polymorphisms with a high frequency of synonymous nucleotide changes and, while hrcA was characterized by an excess of low frequency polymorphism, very low diversity was found in ctsR sequences. Sequence alignment of hrcA allowed a correct discrimination of the strains at the species level, thus confirming the relevance of stress response genes for taxonomy. Copyright © 2012 Elsevier B.V. All rights reserved.
Tolerance assays: measuring the unknown.
Newell, Kenneth A; Larsen, Christian P
2006-06-15
Distinguishing transplant recipients who will benefit from a reduction in, or even the withdrawal of, immunosuppression from those who require intensive, lifelong immunosuppression will be dependent on developing strategies for immune monitoring. Currently, no assays have been shown to accurately predict the development or presence of donor-specific tolerance in humans after transplantation. In this overview we describe and discuss those assays that we believe may be useful for identifying tolerant transplant recipients. Validation of "tolerance" assays will be critical for the safe development of tolerance regimens in humans.
Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke
2008-05-01
Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods.
Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke
2008-01-01
Background Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. Results SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. Conclusion The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods. PMID:18452616
Schiex, Thomas; Gouzy, Jérôme; Moisan, Annick; de Oliveira, Yannick
2003-07-01
We describe FrameD, a program that predicts coding regions in prokaryotic and matured eukaryotic sequences. Initially targeted at gene prediction in bacterial GC rich genomes, the gene model used in FrameD also allows to predict genes in the presence of frameshifts and partially undetermined sequences which makes it also very suitable for gene prediction and frameshift correction in unfinished sequences such as EST and EST cluster sequences. Like recent eukaryotic gene prediction programs, FrameD also includes the ability to take into account protein similarity information both in its prediction and its graphical output. Its performances are evaluated on different bacterial genomes. The web site (http://genopole.toulouse.inra.fr/bioinfo/FrameD/FD) allows direct prediction, sequence correction and translation and the ability to learn new models for new organisms.
Optical design and tolerancing of an ophthalmological system
NASA Astrophysics Data System (ADS)
Sieber, Ingo; Martin, Thomas; Yi, Allen; Li, Likai; Rübenach, Olaf
2014-09-01
Tolerance analysis by means of simulation is an essential step in system integration. Tolerance analysis allows for predicting the performance of a system setup of real manufactured parts and for an estimation of the yield with respect to evaluation figures, such as performance requirements, systems specification or cost demands. Currently, optical freeform optics is gaining importance in optical systems design. The performance of freeform optics often strongly depends on the manufacturing accuracy of the surfaces. For this reason, a tolerance analysis with respect to the fabrication accuracy is of crucial importance. The characterization of form tolerances caused by the manufacturing process is based on the definition of straightness, flatness, roundness, and cylindricity. In case of freeform components, however, it is often impossible to define a form deviation by means of this standard classification. Hence, prediction of the impact of manufacturing tolerances on the optical performance is not possible by means of a conventional tolerance analysis. To carry out a tolerance analysis of the optical subsystem, including freeform optics, metrology data of the fabricated surfaces have to be integrated into the optical model. The focus of this article is on design for manufacturability of freeform optics with integrated alignment structures and on tolerance analysis of the optical subsystem based on the measured surface data of manufactured optical freeform components with respect to assembly and manufacturing tolerances. This approach will be reported here using an ophthalmological system as an example.
Bednarek, Piotr T; Orłowska, Renata; Niedziela, Agnieszka
2017-04-21
We present a new methylation-sensitive amplified polymorphism (MSAP) approach for the evaluation of relative quantitative characteristics such as demethylation, de novo methylation, and preservation of methylation status of CCGG sequences, which are recognized by the isoschizomers HpaII and MspI. We applied the technique to analyze aluminum (Al)-tolerant and non-tolerant control and Al-stressed inbred triticale lines. The approach is based on detailed analysis of events affecting HpaII and MspI restriction sites in control and stressed samples, and takes advantage of molecular marker profiles generated by EcoRI/HpaII and EcoRI/MspI MSAP platforms. Five Al-tolerant and five non-tolerant triticale lines were exposed to aluminum stress using the physiologicaltest. Total genomic DNA was isolated from root tips of all tolerant and non-tolerant lines before and after Al stress following metAFLP and MSAP approaches. Based on codes reflecting events affecting cytosines within a given restriction site recognized by HpaII and MspI in control and stressed samples demethylation (DM), de novo methylation (DNM), preservation of methylated sites (MSP), and preservation of nonmethylatedsites (NMSP) were evaluated. MSAP profiles were used for Agglomerative hierarchicalclustering (AHC) based on Squared Euclidean distance and Ward's Agglomeration method whereas MSAP characteristics for ANOVA. Relative quantitative MSAP analysis revealed that both Al-tolerant and non-tolerant triticale lines subjected to Al stress underwent demethylation, with demethylation of CG predominating over CHG. The rate of de novo methylation in the CG context was ~3-fold lower than demethylation, whereas de novo methylation of CHG was observed only in Al-tolerant lines. Our relative quantitative MSAP approach, based on methylation events affecting cytosines within HpaII-MspI recognition sequences, was capable of quantifying de novo methylation, demethylation, methylation, and non-methylated status in control and stressed Al-tolerant and non-tolerant triticale inbred lines. The method could also be used to analyze methylation events affecting CG and CHG contexts, which were differentially methylated under Al stress. We cannot exclude that the methylation changes revealed among lines as well as between Al-tolerant and non-tolerant groups of lines were due to some experimental errors or that the number of lines was too small for ANOVA to prove the influence of Al stress. Nevertheless, we suspect that Al tolerance in triticale could be partly regulated by epigenetic factors acting at the level of DNA methylation. This method provides a valuable tool for studies of abiotic stresses in plants.
Impact response of graphite/epoxy fabric structures
NASA Technical Reports Server (NTRS)
Lagace, Paul A.; Kraft, Michael J.
1990-01-01
The impact damage resistance and damage tolerance of graphite/epoxy fabric plate (coupon) and cylinder structures were investigated and compared in an analytical and experimental study. Hercules A370-5H/3501-6 five-harness satin weave cloth in a quasi-isotropic (0,45)(sub s) laminate configuration was utilized. Specimens were impacted with 12.7 mm diameter steel spheres at velocities ranging from 10 m/s to 100 m/s. Damage resistance of the specimens was determined through the use of dye penetrant enhanced x-radiography, sectioning, epoxy burnoff, and visual methods. Damage tolerance of the flat plate structures was assessed in a residual tensile test while damage tolerance of the cylinder structures was assessed via pressurization tests. Impacted fabric laminates exhibited matrix crushing, fiber breakage, delamination, and fiber bundle disbonds; the latter being a unique damage mode for fabric laminates. Plate delamination and bundle disbonding was found to be more extensive around the central core area of fiber damage in the coupon specimens than in the cylinder specimens which showed a cleaner damage area due to impact. Damage resistance and damage tolerance were predicted by utilizing a five-step analysis approach previously utilized for coupon configurations. Two of the five steps were adapted to account for the effects of the structural configuration of the pressurized cylinder. The damage resistance analysis provided good correlation to the fiber damage region of both the coupon and cylinder specimens. There was little difference in the size of this region in the two specimen types. However, the analysis was not able to predict the distribution of damage through-the-thickness. This was important in assessing the damage tolerance of the cylinders. The damage tolerance analysis was able to predict the residual tensile strength of the coupons. A general methodology to predict the impact damage resistance and damage tolerance of composite structures utilizing coupon data is presented.
Identification of Rhizobium phaseoli Strains That Are Tolerant or Sensitive to Soil Acidity
Lowendorf, Henry S.; Alexander, Martin
1983-01-01
A study was conducted to determine whether the survival of Rhizobium phaseoli in acid soils could be predicted on the basis of the tolerance of the organism to acidity in culture. Of 16 strains tested, all grew in culture at pH 4.6, but only those that grew at pH 3.8 survived in soils having pH values of 4.1 to 4.6. Strains that tolerated the lowest pH values in culture were tolerant of the highest aluminum concentrations. In one acid soil, an acid-tolerant strain was unable to survive in numbers greater than 100/g, but the poor survival was not related to the level of extractable aluminum or manganese in the soil. Reproduction of an acid-tolerant strain of R. phaseoli was enhanced in the rhizosphere of Phaseolus vulgaris in both acid and limed soils, but stimulation of an acid-sensitive strain by the plant occurred only in the limed soil. These results indicate that cultural tests can be used to predict the ability of R. phaseoli to survive in acid soil. PMID:16346239
Daspute, Abhijit Arun; Kobayashi, Yuriko; Panda, Sanjib Kumar; Fakrudin, Bashasab; Kobayashi, Yasufumi; Tokizawa, Mutsutomo; Iuchi, Satoshi; Choudhary, Arbind Kumar; Yamamoto, Yoshiharu Y; Koyama, Hiroyuki
2018-01-01
Al-responsive citrate-transporting CcMATE1 function and its regulation by CcSTOP1 were analyzed using NtSTOP1 -KD tobacco- and pigeonpea hairy roots, respectively, CcSTOP1 binding sequence of CcMATE1 showed similarity with AtALMT1 promoter. The molecular mechanisms of Aluminum (Al) tolerance in pigeonpea (Cajanus cajan) were characterized to provide information for molecular breeding. Al-inducible citrate excretion was associated with the expression of MULTIDRUGS AND TOXIC COMPOUNDS EXCLUSION (CcMATE1), which encodes a citrate transporter. Ectopic expression of CcMATE1-conferred Al tolerance to hairy roots of transgenic tobacco with the STOP1 regulation system knocked down. This gain-of-function approach clearly showed CcMATE1 was involved in Al detoxification. The expression of CcMATE1 and another Al-tolerance gene, ALUMINUM SENSITIVE 3 (CcALS3), was regulated by SENSITIVE TO PROTON RHIZOTOXICITY1 (CcSTOP1) according to loss-of-function analysis of pigeonpea hairy roots in which CcSTOP1 was suppressed. An in vitro binding assay showed that the Al-responsive CcMATE1 promoter contained the GGNVS consensus bound by CcSTOP1. Mutation of GGNVS inactivated the Al-inducible expression of CcMATE1 in pigeonpea hairy roots. This indicated that CcSTOP1 binding to the promoter is critical for CcMATE1 expression. The STOP1 binding sites of both the CcMATE1 and AtALMT1 promoters contained GGNVS and a flanking 3' sequence. The GGNVS region was identical in both CcMATE1 and AtALMT1. By contrast, the 3' flanking sequence with binding affinity to STOP1 did not show similarity. Putative STOP1 binding sites with similar structures were also found in Al-inducible MATE and ALMT1 promoters in other plant species. The characterized Al-responsive CcSTOP1 and CcMATE1 genes will help in pigeonpea breeding in acid soil tolerance.
Messiaen, Marlies; Janssen, Colin Roger; De Meester, Luc; De Schamphelaere, Karel André Clara
2013-11-15
Genetic variation complicates predictions of both the initial tolerance and the long-term (micro-evolutionary) response of natural Daphnia populations to chemical stressors from results of standard single-clone laboratory ecotoxicity tests. In order to investigate possible solutions to this problem, we aimed to compare the initial sub-lethal tolerance to Cd of 10 naïve natural pond populations of Daphnia magna as well as their evolutionary potential to develop increased resistance. We did so by measuring reproductive performance of 120 clones, i.e. 12 clones hatched from the recent dormant egg bank of each of 10 populations, both in absence (Cd-free control) and presence of 4.4 μg Cd/L. We show that the initial tolerance, defined as the reproductive performance of individuals of the first generation exposed to Cd relative to that in a Cd-free control was not significantly different among the 10 studied pond populations and averaged 0.82 ± 0.04 over these populations. Moreover, these populations' initial tolerances were also not significantly different from the mean initial tolerance of 0.87 ± 0.08 at 4.0 μg Cd/L measured for a group of 7 often-used laboratory clones, collected from a range of European ecotoxicity testing laboratories. This indicates that the initial response of naïve natural pond populations to sub-lethal Cd can be relatively accurately predicted from ecotoxicity test data from only a handful of laboratory clones. We then used estimates of broad-sense heritability of Cd tolerance (H(2)) - based on the same dataset - as a proxy of these populations' capacities to evolutionarily respond to Cd in terms of the development of increased resistance, which is here defined as the increase with time of the frequency of clones with a higher Cd tolerance in the population (accompanied with an increase of mean Cd-tolerance of the population above the initial tolerance). We show that the populations' estimated H(2) values of Cd-tolerance cover almost the entire theoretically possible range, ranging from not significantly different from zero (for five populations) to between 0.48 and 0.81 (for the five other populations). This indicates that, unlike the initial tolerance to Cd, the (long-term) micro-evolutionary response to Cd may be very different among natural pond populations. Therefore, we conclude that it may be very difficult to predict the long-term response of an unstudied population to chemical stress from tolerance data on a sample of other populations. It is therefore suggested that new methods for forecasting long-term responses should be explored, such as the development of predictive models based on the combination of population-genomic and tolerance time-series data. Copyright © 2013 Elsevier B.V. All rights reserved.
GASP: Gapped Ancestral Sequence Prediction for proteins
Edwards, Richard J; Shields, Denis C
2004-01-01
Background The prediction of ancestral protein sequences from multiple sequence alignments is useful for many bioinformatics analyses. Predicting ancestral sequences is not a simple procedure and relies on accurate alignments and phylogenies. Several algorithms exist based on Maximum Parsimony or Maximum Likelihood methods but many current implementations are unable to process residues with gaps, which may represent insertion/deletion (indel) events or sequence fragments. Results Here we present a new algorithm, GASP (Gapped Ancestral Sequence Prediction), for predicting ancestral sequences from phylogenetic trees and the corresponding multiple sequence alignments. Alignments may be of any size and contain gaps. GASP first assigns the positions of gaps in the phylogeny before using a likelihood-based approach centred on amino acid substitution matrices to assign ancestral amino acids. Important outgroup information is used by first working down from the tips of the tree to the root, using descendant data only to assign probabilities, and then working back up from the root to the tips using descendant and outgroup data to make predictions. GASP was tested on a number of simulated datasets based on real phylogenies. Prediction accuracy for ungapped data was similar to three alternative algorithms tested, with GASP performing better in some cases and worse in others. Adding simple insertions and deletions to the simulated data did not have a detrimental effect on GASP accuracy. Conclusions GASP (Gapped Ancestral Sequence Prediction) will predict ancestral sequences from multiple protein alignments of any size. Although not as accurate in all cases as some of the more sophisticated maximum likelihood approaches, it can process a wide range of input phylogenies and will predict ancestral sequences for gapped and ungapped residues alike. PMID:15350199
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cairney, J.; Hays, D.; Stockand, J.D.
1991-05-01
The rangeland shrub Atriplex canescens (saltbush) is extremely drought-tolerant and is capable of growing at water potentials below {minus}40 bar. To discover the molecular basis of this tolerance, the authors have isolated a number of cDNA clones of drought-stress induced genes. Analysis of the nucleotide sequence and expression of these genes in different tissues and in response to different stresses reveals the diversity of the stress response. Members of a drought-induced, multi-gene family, have been sequenced. Although 95% homologous, non-conservative substitutions result in proteins of different tertiary structure. Additionally, the genes are expressed through a number of mature forms ofmore » mRNA which may arise by alternative RNA processing.« less
Yu, Danna; Fang, Xindong; Storey, Kenneth B; Zhang, Yongpu; Zhang, Jiayong
2016-05-01
The complete mitochondrial genomes of the yellow-bellied slider (Trachemys scripta scripta) and anoxia tolerant red-eared slider (Trachemys scripta elegans) turtles were sequenced to analyze gene arrangement. The complete mt genomes of T. s. scripta and elegans were circular molecules of 16,791 bp and 16,810 bp in length, respectively, and included an A + 1 frameshift insertion in ND3 and ND4L genes. The AT content of the overall base composition of scripta and elegans was 61.2%. Nucleotide sequence divergence of the mt-genome (p distance) between scripta and elegans was 0.4%. A detailed comparison between the mitochondrial genomes of the two subspecies is shown.
Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank
2015-01-01
Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976
Discrete sequence prediction and its applications
NASA Technical Reports Server (NTRS)
Laird, Philip
1992-01-01
Learning from experience to predict sequences of discrete symbols is a fundamental problem in machine learning with many applications. We apply sequence prediction using a simple and practical sequence-prediction algorithm, called TDAG. The TDAG algorithm is first tested by comparing its performance with some common data compression algorithms. Then it is adapted to the detailed requirements of dynamic program optimization, with excellent results.
Diversity and Evolution of Salt Tolerance in the Genus Vigna
Iseki, Kohtaro; Takahashi, Yu; Muto, Chiaki; Naito, Ken; Tomooka, Norihiko
2016-01-01
Breeding salt tolerant plants is difficult without utilizing a diversity of wild crop relatives. Since the genus Vigna (family Fabaceae) is comprised of many wild relatives adapted to various environmental conditions, we evaluated the salt tolerance of 69 accessions of this genus, including that of wild and domesticated accessions originating from Asia, Africa, Oceania, and South America. We grew plants under 50 mM and 200 mM NaCl for two weeks and then measured the biomass, relative quantum yield of photosystem II, leaf Na+ concentrations, and leaf K+ concentrations. The accessions were clustered into four groups: the most tolerant, tolerant, moderately susceptible, and susceptible. From the most tolerant group, we selected six accessions, all of which were wild accessions adapted to coastal environments, as promising sources of salt tolerance because of their consistently high relative shoot biomass and relative quantum yield. Interestingly, variations in leaf Na+ concentration were observed between the accessions in the most tolerant group, suggesting different mechanisms were responsible for their salt tolerance. Phylogenetic analysis with nuclear DNA sequences revealed that salt tolerance had evolved independently at least four times in the genus Vigna, within a relatively short period. The findings suggested that simple genetic changes in a few genes might have greatly affected salt tolerances. The elucidation of genetic mechanisms of salt tolerances in the selected accessions may contribute to improving the poor salt tolerance in legume crops. PMID:27736995
Salas-Perez, Reiofeli A.; Saski, Christopher A.; Noorai, Rooksana E.; Srivastava, Subodh K.; Lawton-Rauh, Amy L.; Nichols, Robert L.
2018-01-01
Amaranthus palmeri (Amaranthaceae) is a noxious weed in several agroecosystems and in some cases seriously threatens the sustainability of crop production in North America. Glyphosate-resistant Amaranthus species are widespread, prompting the use of alternatives to glyphosate such as glufosinate, in conjunction with glufosinate-resistant crop cultivars, to help control glyphosate-resistant weeds. An experiment was conducted to analyze the transcriptome of A. palmeri plants that survived exposure to 0.55 kg ha-1 glufosinate. Since there was no record of glufosinate use at the collection site, survival of plants within the population are likely due to genetic expression that pre-dates selection; in the formal parlance of weed science this is described as natural tolerance. Leaf tissues from glufosinate-treated and non-treated seedlings were harvested 24 h after treatment (HAT) for RNA-Seq analysis. Global gene expression was measured using Illumina DNA sequence reads from non-treated and treated surviving (presumably tolerant, T) and susceptible (S) plants. The same plants were used to determine the mechanisms conferring differential tolerance to glufosinate. The S plants accumulated twice as much ammonia as did the T plants, 24 HAT. The relative copy number of the glufosinate target gene GS2 did not differ between T and S plants, with 1 to 3 GS2 copies in both biotypes. A reference cDNA transcriptome consisting of 72,780 contigs was assembled, with 65,282 sequences putatively annotated. Sequences of GS2 from the transcriptome assembly did not have polymorphisms unique to the tolerant plants. Five hundred sixty-seven genes were differentially expressed between treated T and S plants. Of the upregulated genes in treated T plants, 210 were more highly induced than were the upregulated genes in the treated S plants. Glufosinate-tolerant plants had greater induction of ABC transporter, glutathione S-transferase (GST), NAC transcription factor, nitronate monooxygenase (NMO), chitin elicitor receptor kinase (CERK1), heat shock protein 83, ethylene transcription factor, heat stress transcription factor, NADH-ubiquinone oxidoreductase, ABA 8’-hydroxylase, and cytochrome P450 genes (CYP72A, CYP94A1). Seven candidate genes were selected for validation using quantitative real time-PCR. While GST was upregulated in treated tolerant plants in at least one population, CYP72A219 was consistently highly expressed in all treated tolerant biotypes. These genes are candidates for contributing tolerance to glufosinate. Taken together, these results show that differential induction of stress-protection genes in a population can enable some individuals to survive herbicide application. Elevated expression of detoxification-related genes can get fixed in a population with sustained selection pressure, leading to evolution of resistance. Alternatively, sustained selection pressure could select for mutation(s) in the GS2 gene with the same consequence. PMID:29672568
Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.
2011-01-01
We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875
Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A
2013-04-30
Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.
USDA-ARS?s Scientific Manuscript database
Salmonella enterica subsp. enterica bacteria are important foodborne pathogens with major economic impact. Some isolates exhibit increased heat tolerance, a concern for food safety. Analysis of a finished-quality genome sequence of an isolate commonly used in heat resistance studies, S. enterica sub...
Xiao, Jingfa; Hao, Lirui; Crowley, David E.; Zhang, Zhewen; Yu, Jun; Huang, Ning; Huo, Mingxin; Wu, Jiayan
2015-01-01
Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals. PMID:26301592
Yaish, Mahmoud W; Al-Harrasi, Ibtisam; Alansari, Aliya S; Al-Yahyai, Rashid; Glick, Bernard R
2016-09-01
Date palms are able to grow under diverse abiotic stress conditions including in saline soils, where microbial communities may be help in the plant's salinity tolerance. These communities able to produce specific growth promoting substances can enhance date palm growth in a saline environment. However, these communities are poorly defined. In the work reported here, the date palm endophytic bacterial and fungal communities were identified using the pyrosequencing method, and the microbial differential abundance in the root upon exposure to salinity stress was estimated. Approximately 150,061 reads were produced from the analysis of six ribosomal DNA libraries, which were prepared from endophytic microorganisms colonizing date palm root tissues. DNA sequence analysis of these libraries predicted the presence of a variety of bacterial and fungal endophytic species, some known and others unknown. The microbial community compositions of 30% and 8% of the bacterial and fungal species, respectively, were significantly (p ≤ 0.05) altered in response to salinity stress. Differential enrichment analysis showed that microbe diversity indicated by the Chao, Shannon and Simpson indices were slightly reduced, however, the overall microbial community structures were not significantly affected as a consequence of salinity. This may reflect a buffering effect by the host plant on the internal environments that these communities are colonizing. Some of the endophytes identified in this study were strains that were previously isolated from saline and marine environments. This suggests possible interactions with the plant that are favorable to salinity tolerance in date palm. [Int Microbiol 19(3):143-155 (2016)]. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.
Chen, Chi-Chien; Fu, Shih-Feng; Norikazu, Monma; Yang, Yau-Wen; Liu, Yu-Ju; Ikeo, Kazuho; Gojobori, Takashi; Huang, Hao-Jen
2015-12-01
MicroRNAs (miRNAs) play a vital role in growth, development, and stress response at the post-transcriptional level. Broccoli (Brassica oleracea L. var italic) is an important vegetable crop, and the yield and quality of broccoli are decreased by heat stress. The broccoli inbred lines that are capable of producing head at high temperature in summer are unique varieties in Taiwan. However, knowledge of miRNAomes during the broccoli head formation under heat stress is limited. In this study, molecular characterization of two nearly isogenic lines with contrasting head-forming capacity was investigated. Head-forming capacity was better for heat-tolerant (HT) than heat-sensitive (HS) broccoli under heat stress. By deep sequencing and computational analysis, 20 known miRNAs showed significant differential expression between HT and HS genotypes. According to the criteria for annotation of new miRNAs, 24 novel miRNA sequences with differential expression between the two genotypes were identified. To gain insight into functional significance, 213 unique potential targets of these 44 differentially expressed miRNAs were predicted. These targets were implicated in shoot apical development, phase change, response to temperature stimulus, hormone and energy metabolism. The head-forming capacity of the unique HT line was related to autonomous regulation of Bo-FT genes and less expression level of heat shock protein genes as compared to HS. For the genotypic comparison, a set of miRNAs and their targets had consistent expression patterns in various HT genotypes. This large-scale characterization of broccoli miRNAs and their potential targets is to unravel the regulatory roles of miRNAs underlying heat-tolerant head-forming capacity.
Fault trees and sequence dependencies
NASA Technical Reports Server (NTRS)
Dugan, Joanne Bechta; Boyd, Mark A.; Bavuso, Salvatore J.
1990-01-01
One of the frequently cited shortcomings of fault-tree models, their inability to model so-called sequence dependencies, is discussed. Several sources of such sequence dependencies are discussed, and new fault-tree gates to capture this behavior are defined. These complex behaviors can be included in present fault-tree models because they utilize a Markov solution. The utility of the new gates is demonstrated by presenting several models of the fault-tolerant parallel processor, which include both hot and cold spares.
Cenci, Albero; Guignon, Valentin; Roux, Nicolas; Rouard, Mathieu
2014-05-01
Identifying the molecular mechanisms underlying tolerance to abiotic stresses is important in crop breeding. A comprehensive understanding of the gene families associated with drought tolerance is therefore highly relevant. NAC transcription factors form a large plant-specific gene family involved in the regulation of tissue development and responses to biotic and abiotic stresses. The main goal of this study was to set up a framework of orthologous groups determined by an expert sequence comparison of NAC genes from both monocots and dicots. In order to clarify the orthologous relationships among NAC genes of different species, we performed an in-depth comparative study of four divergent taxa, in dicots and monocots, whose genomes have already been completely sequenced: Arabidopsis thaliana, Vitis vinifera, Musa acuminata and Oryza sativa. Due to independent evolution, NAC copy number is highly variable in these plant genomes. Based on an expert NAC sequence comparison, we propose forty orthologous groups of NAC sequences that were probably derived from an ancestor gene present in the most recent common ancestor of dicots and monocots. These orthologous groups provide a curated resource for large-scale protein sequence annotation of NAC transcription factors. The established orthology relationships also provide a useful reference for NAC function studies in newly sequenced genomes such as M. acuminata and other plant species.
Mission Management Computer and Sequencing Hardware for RLV-TD HEX-01 Mission
NASA Astrophysics Data System (ADS)
Gupta, Sukrat; Raj, Remya; Mathew, Asha Mary; Koshy, Anna Priya; Paramasivam, R.; Mookiah, T.
2017-12-01
Reusable Launch Vehicle-Technology Demonstrator Hypersonic Experiment (RLV-TD HEX-01) mission posed some unique challenges in the design and development of avionics hardware. This work presents the details of mission critical avionics hardware mainly Mission Management Computer (MMC) and sequencing hardware. The Navigation, Guidance and Control (NGC) chain for RLV-TD is dual redundant with cross-strapped Remote Terminals (RTs) interfaced through MIL-STD-1553B bus. MMC is Bus Controller on the 1553 bus, which does the function of GPS aided navigation, guidance, digital autopilot and sequencing for the RLV-TD launch vehicle in different periodicities (10, 20, 500 ms). Digital autopilot execution in MMC with a periodicity of 10 ms (in ascent phase) is introduced for the first time and successfully demonstrated in the flight. MMC is built around Intel i960 processor and has inbuilt fault tolerance features like ECC for memories. Fault Detection and Isolation schemes are implemented to isolate the failed MMC. The sequencing hardware comprises Stage Processing System (SPS) and Command Execution Module (CEM). SPS is `RT' on the 1553 bus which receives the sequencing and control related commands from MMCs and posts to downstream modules after proper error handling for final execution. SPS is designed as a high reliability system by incorporating various fault tolerance and fault detection features. CEM is a relay based module for sequence command execution.
Hittalmani, Shailaja; Mahesh, H B; Shirke, Meghana Deepak; Biradar, Hanamareddy; Uday, Govindareddy; Aruna, Y R; Lohithaswa, H C; Mohanrao, A
2017-06-15
Finger millet (Eleusine coracana (L.) Gaertn.) is an important staple food crop widely grown in Africa and South Asia. Among the millets, finger millet has high amount of calcium, methionine, tryptophan, fiber, and sulphur containing amino acids. In addition, it has C4 photosynthetic carbon assimilation mechanism, which helps to utilize water and nitrogen efficiently under hot and arid conditions without severely affecting yield. Therefore, development and utilization of genomic resources for genetic improvement of this crop is immensely useful. Experimental results from whole genome sequencing and assembling process of ML-365 finger millet cultivar yielded 1196 Mb covering approximately 82% of total estimated genome size. Genome analysis showed the presence of 85,243 genes and one half of the genome is repetitive in nature. The finger millet genome was found to have higher colinearity with foxtail millet and rice as compared to other Poaceae species. Mining of simple sequence repeats (SSRs) yielded abundance of SSRs within the finger millet genome. Functional annotation and mining of transcription factors revealed finger millet genome harbors large number of drought tolerance related genes. Transcriptome analysis of low moisture stress and non-stress samples revealed the identification of several drought-induced candidate genes, which could be used in drought tolerance breeding. This genome sequencing effort will strengthen plant breeders for allele discovery, genetic mapping, and identification of candidate genes for agronomically important traits. Availability of genomic resources of finger millet will enhance the novel breeding possibilities to address potential challenges of finger millet improvement.
An Architectural Concept for Intrusion Tolerance in Air Traffic Networks
NASA Technical Reports Server (NTRS)
Maddalon, Jeffrey M.; Miner, Paul S.
2003-01-01
The goal of an intrusion tolerant network is to continue to provide predictable and reliable communication in the presence of a limited num ber of compromised network components. The behavior of a compromised network component ranges from a node that no longer responds to a nod e that is under the control of a malicious entity that is actively tr ying to cause other nodes to fail. Most current data communication ne tworks do not include support for tolerating unconstrained misbehavio r of components in the network. However, the fault tolerance communit y has developed protocols that provide both predictable and reliable communication in the presence of the worst possible behavior of a limited number of nodes in the system. One may view a malicious entity in a communication network as a node that has failed and is behaving in an arbitrary manner. NASA/Langley Research Center has developed one such fault-tolerant computing platform called SPIDER (Scalable Proces sor-Independent Design for Electromagnetic Resilience). The protocols and interconnection mechanisms of SPIDER may be adapted to large-sca le, distributed communication networks such as would be required for future Air Traffic Management systems. The predictability and reliabi lity guarantees provided by the SPIDER protocols have been formally v erified. This analysis can be readily adapted to similar network stru ctures.
Mumford, Elizabeth A; Taylor, Bruce G; Giordano, Peggy C
2017-02-01
Research has pointed to the salience of friendships in predicting abuse in adolescent dating relationships. The current study investigates the perpetration of physical and sexual dating abuse as predicted by individual conditional tolerance for dating abuse within the context of friendship behaviors and group characteristics. Using two waves of the National Survey of Teen Relationships and Intimate Violence (STRiV; N = 511 daters aged 12-18 years), we investigated the effects of baseline individual tolerance for hitting dating partners and friendship factors on perpetration of physical and sexual adolescent dating abuse (ADA) approximately 1 year later. Conditional tolerance for hitting boyfriends was associated with ADA perpetration in the absence of friendship characteristics. Daters who reported recent discussion of a problem with friends and female daters who named all-girl friendship groups were more likely to report ADA perpetration. Close friendships are an avenue for preventing ADA perpetration. Furthermore, ADA perpetration may be reduced by targeting conditional tolerance for violence particularly against male partners within female friendship groups.
Heteroassociative storage of hippocampal pattern sequences in the CA3 subregion
Recio, Renan S.; Reyes, Marcelo B.
2018-01-01
Background Recent research suggests that the CA3 subregion of the hippocampus has properties of both autoassociative network, due to its ability to complete partial cues, tolerate noise, and store associations between memories, and heteroassociative one, due to its ability to store and retrieve sequences of patterns. Although there are several computational models of the CA3 as an autoassociative network, more detailed evaluations of its heteroassociative properties are missing. Methods We developed a model of the CA3 subregion containing 10,000 integrate-and-fire neurons with both recurrent excitatory and inhibitory connections, and which exhibits coupled oscillations in the gamma and theta ranges. We stored thousands of pattern sequences using a heteroassociative learning rule with competitive synaptic scaling. Results We showed that a purely heteroassociative network model can (i) retrieve pattern sequences from partial cues with external noise and incomplete connectivity, (ii) achieve homeostasis regarding the number of connections per neuron when many patterns are stored when using synaptic scaling, (iii) continuously update the set of retrievable patterns, guaranteeing that the last stored patterns can be retrieved and older ones can be forgotten. Discussion Heteroassociative networks with synaptic scaling rules seem sufficient to achieve many desirable features regarding connectivity homeostasis, pattern sequence retrieval, noise tolerance and updating of the set of retrievable patterns. PMID:29312826
Gould, Billie; McCouch, Susan; Geber, Monica
2015-01-01
Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE) provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE), cell wall modification (OsSTAR1), and internal Al detoxification (OsNRAT1) in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE. PMID:26148203
Gould, Billie; McCouch, Susan; Geber, Monica
2015-01-01
Studies of adaptation in the wild grass Anthoxanthum odoratum at the Park Grass Experiment (PGE) provided one of the earliest examples of rapid evolution in plants. Anthoxanthum has become locally adapted to differences in soil Al toxicity, which have developed there due to soil acidification from long-term experimental fertilizer treatments. In this study, we used transcriptome sequencing to identify Al stress responsive genes in Anthoxanhum and identify candidates among them for further molecular study of rapid Al tolerance evolution at the PGE. We examined the Al content of Anthoxanthum tissues and conducted RNA-sequencing of root tips, the primary site of Al induced damage. We found that despite its high tolerance Anthoxanthum is not an Al accumulating species. Genes similar to those involved in organic acid exudation (TaALMT1, ZmMATE), cell wall modification (OsSTAR1), and internal Al detoxification (OsNRAT1) in cultivated grasses were responsive to Al exposure. Expression of a large suite of novel loci was also triggered by early exposure to Al stress in roots. Three-hundred forty five transcripts were significantly more up- or down-regulated in tolerant vs. sensitive Anthoxanthum genotypes, providing important targets for future study of rapid evolution at the PGE.
Guan, Zhiyong; Feng, Yitong; Song, Aiping; Shi, Xiaomeng; Mao, Yachao; Chen, Sumei; Jiang, Jiafu; Ding, Lian; Chen, Fadi
2017-01-01
Chrysanthemum crassum is a decaploid species of Chrysanthemum with high stress tolerance that allows survival under salinity stress while maintaining a relatively ideal growth rate. We previously recorded morphological changes after salt treatment, such as the expansion of leaf cells. To explore the underlying salinity tolerance mechanisms, we used an Illumina platform and obtained three sequencing libraries from samples collected after 0 h, 12 h and 24 h of salt treatment. Following de novo assembly, 154,944 transcripts were generated, and 97,833 (63.14%) transcripts were annotated, including 55 Gene Ontology (GO) terms and 128 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The expression profile of C. crassum was globally altered after salt treatment. We selected functional genes and pathways that may contribute to salinity tolerance and identified some factors involved in the salinity tolerance strategies of C. crassum, such as signal transduction, transcription factors and plant hormone regulation, enhancement of energy metabolism, functional proteins and osmolyte synthesis, reactive oxygen species (ROS) scavenging, photosystem protection and recovery, and cell wall protein modifications. Forty-six genes were selected for quantitative real-time polymerase chain reaction detection, and their expression patterns were shown to be consistent with the changes in their transcript abundance determined by RNA sequencing. PMID:28437448
A realistic appraisal of methods to enhance desiccation tolerance of entomopathogenic nematodes.
Perry, Roland N; Ehlers, Ralf-Udo; Glazer, Itamar
2012-06-01
Understanding the desiccation survival attributes of infective juveniles of entomopathogenic nematodes (EPN) of the genera Steinernema and Heterorhabditis, is central to evaluating the reality of enhancing the shelf-life and field persistence of commercial formulations. Early work on the structural and physiological aspects of desiccation survival focused on the role of the molted cuticle in controlling the rate of water loss and the importance of energy reserves, particularly neutral lipids. The accumulation of trehalose was also found to enhance desiccation survival. Isolation of natural populations that can survive harsh environments, such as deserts, indicated that some populations have enhanced abilities to survive desiccation. However, survival abilities of EPN are limited compared with those of some species of plant-parasitic nematodes inhabiting aerial parts of plants. Research on EPN stress tolerance has expanded on two main lines: i) to select strains of species, currently in use commercially, which have increased tolerance to environmental extremes; and ii) to utilize molecular information, including expressed sequence tags and genome sequence data, to determine the underlying genetic factors that control longevity and stress tolerance of EPN. However, given the inherent limitations of EPN survival ability, it is likely that improved formulation will be the major factor to enhance EPN longevity and, perhaps, increase the range of applications.
Mapping of HKT1;5 Gene in Barley Using GWAS Approach and Its Implication in Salt Tolerance Mechanism
Hazzouri, Khaled M.; Khraiwesh, Basel; Amiri, Khaled M. A.; Pauli, Duke; Blake, Tom; Shahid, Mohammad; Mullath, Sangeeta K.; Nelson, David; Mansour, Alain L.; Salehi-Ashtiani, Kourosh; Purugganan, Michael; Masmoudi, Khaled
2018-01-01
Sodium (Na+) accumulation in the cytosol will result in ion homeostasis imbalance and toxicity of transpiring leaves. Studies of salinity tolerance in the diploid wheat ancestor Triticum monococcum showed that HKT1;5-like gene was a major gene in the QTL for salt tolerance, named Nax2. In the present study, we were interested in investigating the molecular mechanisms underpinning the role of the HKT1;5 gene in salt tolerance in barley (Hordeum vulgare). A USDA mini-core collection of 2,671 barley lines, part of a field trial was screened for salinity tolerance, and a Genome Wide Association Study (GWAS) was performed. Our results showed important SNPs that are correlated with salt tolerance that mapped to a region where HKT1;5 ion transporter located on chromosome four. Furthermore, sodium (Na+) and potassium (K+) content analysis revealed that tolerant lines accumulate more sodium in roots and leaf sheaths, than in the sensitive ones. In contrast, sodium concentration was reduced in leaf blades of the tolerant lines under salt stress. In the absence of NaCl, the concentration of Na+ and K+ were the same in the roots, leaf sheaths and leaf blades between the tolerant and the sensitive lines. In order to study the molecular mechanism behind that, alleles of the HKT1;5 gene from five tolerant and five sensitive barley lines were cloned and sequenced. Sequence analysis did not show the presence of any polymorphism that distinguishes between the tolerant and sensitive alleles. Our real-time RT-PCR experiments, showed that the expression of HKT1;5 gene in roots of the tolerant line was significantly induced after challenging the plants with salt stress. In contrast, in leaf sheaths the expression was decreased after salt treatment. In sensitive lines, there was no difference in the expression of HKT1;5 gene in leaf sheath under control and saline conditions, while a slight increase in the expression was observed in roots after salt treatment. These results provide stronger evidence that HKT1;5 gene in barley play a key role in withdrawing Na+ from the xylem and therefore reducing its transport to leaves. Given all that, these data support the hypothesis that HKT1;5 gene is responsible for Na+ unloading to the xylem and controlling its distribution in the shoots, which provide new insight into the understanding of this QTL for salinity tolerance in barley. PMID:29515598
Hazzouri, Khaled M; Khraiwesh, Basel; Amiri, Khaled M A; Pauli, Duke; Blake, Tom; Shahid, Mohammad; Mullath, Sangeeta K; Nelson, David; Mansour, Alain L; Salehi-Ashtiani, Kourosh; Purugganan, Michael; Masmoudi, Khaled
2018-01-01
Sodium (Na + ) accumulation in the cytosol will result in ion homeostasis imbalance and toxicity of transpiring leaves. Studies of salinity tolerance in the diploid wheat ancestor Triticum monococcum showed that HKT1;5 -like gene was a major gene in the QTL for salt tolerance, named Nax2 . In the present study, we were interested in investigating the molecular mechanisms underpinning the role of the HKT1;5 gene in salt tolerance in barley ( Hordeum vulgare ). A USDA mini-core collection of 2,671 barley lines, part of a field trial was screened for salinity tolerance, and a Genome Wide Association Study (GWAS) was performed. Our results showed important SNPs that are correlated with salt tolerance that mapped to a region where HKT1;5 ion transporter located on chromosome four. Furthermore, sodium (Na + ) and potassium (K + ) content analysis revealed that tolerant lines accumulate more sodium in roots and leaf sheaths, than in the sensitive ones. In contrast, sodium concentration was reduced in leaf blades of the tolerant lines under salt stress. In the absence of NaCl, the concentration of Na + and K + were the same in the roots, leaf sheaths and leaf blades between the tolerant and the sensitive lines. In order to study the molecular mechanism behind that, alleles of the HKT1;5 gene from five tolerant and five sensitive barley lines were cloned and sequenced. Sequence analysis did not show the presence of any polymorphism that distinguishes between the tolerant and sensitive alleles. Our real-time RT-PCR experiments, showed that the expression of HKT1;5 gene in roots of the tolerant line was significantly induced after challenging the plants with salt stress. In contrast, in leaf sheaths the expression was decreased after salt treatment. In sensitive lines, there was no difference in the expression of HKT1;5 gene in leaf sheath under control and saline conditions, while a slight increase in the expression was observed in roots after salt treatment. These results provide stronger evidence that HKT1;5 gene in barley play a key role in withdrawing Na + from the xylem and therefore reducing its transport to leaves. Given all that, these data support the hypothesis that HKT1;5 gene is responsible for Na + unloading to the xylem and controlling its distribution in the shoots, which provide new insight into the understanding of this QTL for salinity tolerance in barley.
Superactive amidated COOH-terminal glucagon analogues with no methionine or tryptophan.
Murphy, W A; Coy, D H; Lance, V A
1986-01-01
The functions of the Trp-25 and Met-27 residues and the free carboxy terminus of glucagon have been debated for many years. Despite some semi-synthetic data to the contrary, comparison of the glucagon sequence with the other 5 members of this family of peptides, all of them amides and particularly growth hormone-releasing factor(1-29) amide and its recently described analogues, suggests that alterations to these positions should be quite well tolerated in terms of biological activity. To test this prediction, [Phe-25,Leu-27]-glucagon amide was synthesized in high yield and was found to actually have superior glycogenolytic activity (196%) to glucagon in the rat. Replacement of Gly-4 by D-Phe, which has been shown to give much enhanced glycogenolytic activity than glucagon itself, also increased the activity of [D-Phe-4,Phe-25,Leu-27]-glucagon amide (518%). The L-Phe-4-analogue, [Phe-4,25,Leu-27]-glucagon amide, in contrast, was 20 times less active (30%), strongly suggesting the presence of a beta-bend in this N-terminal region of glucagon. This was supported by Chou-Fasman structural predictions which indicate extensive folding in the 1-15 region. Indeed, additional conformational restriction by substitution of D-Ser in position 2 of glucagon also increased activity to 226%. [D-Gln-3]-glucagon was slightly less active (74%) than glucagon. Chou-Fasman calculations on glucagon were compared to similar treatments of the VIP, secretin, PHI, and GRF(1-29) sequences.
Zhang, Ning; Yang, Jiangwei; Wang, Zemin; Wen, Yikai; Wang, Jie; He, Wenhui; Liu, Bailin; Si, Huaijun; Wang, Di
2014-01-01
MicroRNAs (miRNAs) are a group of small, non-coding RNAs that play important roles in plant growth, development and stress response. There have been an increasing number of investigations aimed at discovering miRNAs and analyzing their functions in model plants (such as Arabidopsis thaliana and rice). In this research, we constructed small RNA libraries from both polyethylene glycol (PEG 6,000) treated and control potato samples, and a large number of known and novel miRNAs were identified. Differential expression analysis showed that 100 of the known miRNAs were down-regulated and 99 were up-regulated as a result of PEG stress, while 119 of the novel miRNAs were up-regulated and 151 were down-regulated. Based on target prediction, annotation and expression analysis of the miRNAs and their putative target genes, 4 miRNAs were identified as regulating drought-related genes (miR811, miR814, miR835, miR4398). Their target genes were MYB transcription factor (CV431094), hydroxyproline-rich glycoprotein (TC225721), quaporin (TC223412) and WRKY transcription factor (TC199112), respectively. Relative expression trends of those miRNAs were the same as that predicted by Solexa sequencing and they showed a negative correlation with the expression of the target genes. The results provide molecular evidence for the possible involvement of miRNAs in the process of drought response and/or tolerance in the potato plant.
Bacq, Yannick; le Besco, Matthieu; Lecuyer, Anne-Isabelle; Gendrot, Chantal; Potin, Jérôme; Andres, Christian R; Aubourg, Alexandre
2017-01-01
Ursodeoxycholic acid (UDCA) therapy is commonly used in intrahepatic cholestasis of pregnancy (ICP). To evaluate the efficacy and tolerance of UDCA in real-world conditions and to search for factors predictive of response to treatment. This observational study included 98 consecutive patients suffering from pruritus during pregnancy associated with increased ALT levels or total bile acid (TBA) concentrations, without other causes of cholestasis. The entire ABCB4 gene coding sequence was analyzed by DNA sequencing. UDCA was prescribed until delivery in all patients (mean dose 14.0mg/kg/day; mean duration 30.4 days). Pruritus improved in 75/98 (76.5%) patients, and totally disappeared before delivery in 25/98 (25.5%). After 2-3 weeks of treatment, ALT levels decreased by more than 50% of base line in 67/86 (77.9%) patients and normalized in 34/86 (39.5%), and TBA concentrations decreased in 28/81 (34.6%). Only one patient stopped the treatment before delivery. On multivariate analysis, ALT >175IU/l before treatment was associated with improvement of pruritus (OR 2.97, 95% CI 1.12-7.89, P=0.029) and with decreased ALT (OR 18.61, 95% CI 3.94-87.99, P=0.0002). ABCB4 gene mutation was not associated with response to treatment. This study supports the use of UDCA as first line therapy in ICP. Copyright © 2016 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.
Savary, Brett J; Vasu, Prasanna; Cameron, Randall G; McCollum, T Gregory; Nuñez, Alberto
2013-12-26
Despite the longstanding importance of the thermally tolerant pectin methylesterase (TT-PME) activity in citrus juice processing and product quality, the unequivocal identification of the protein and its corresponding gene has remained elusive. TT-PME was purified from sweet orange [ Citrus sinensis (L.) Osbeck] finisher pulp (8.0 mg/1.3 kg tissue) with an improved purification scheme that provided 20-fold increased enzyme yield over previous results. Structural characterization of electrophoretically pure TT-PME by MALDI-TOF MS determined molecular masses of approximately 47900 and 53000 Da for two principal glycoisoforms. De novo sequences generated from tryptic peptides by MALDI-TOF/TOF MS matched multiple anonymous Citrus EST cDNA accessions. The complete tt-pme cDNA (1710 base pair) was cloned from a fruit mRNA library using RT- and RLM-RACE PCR. Citrus TT-PME is a novel isoform that showed higher sequence identity with the multiply glycosylated kiwifruit PME than to previously described Citrus thermally labile PME isoforms.
Denny, M W; Dowd, W W
2012-03-15
As the air temperature of the Earth rises, ecological relationships within a community might shift, in part due to differences in the thermal physiology of species. Prediction of these shifts - an urgent task for ecologists - will be complicated if thermal tolerance itself can rapidly evolve. Here, we employ a mechanistic approach to predict the potential for rapid evolution of thermal tolerance in the intertidal limpet Lottia gigantea. Using biophysical principles to predict body temperature as a function of the state of the environment, and an environmental bootstrap procedure to predict how the environment fluctuates through time, we create hypothetical time-series of limpet body temperatures, which are in turn used as a test platform for a mechanistic evolutionary model of thermal tolerance. Our simulations suggest that environmentally driven stochastic variation of L. gigantea body temperature results in rapid evolution of a substantial 'safety margin': the average lethal limit is 5-7°C above the average annual maximum temperature. This predicted safety margin approximately matches that found in nature, and once established is sufficient, in our simulations, to allow some limpet populations to survive a drastic, century-long increase in air temperature. By contrast, in the absence of environmental stochasticity, the safety margin is dramatically reduced. We suggest that the risk of exceeding the safety margin, rather than the absolute value of the safety margin, plays an underappreciated role in the evolution of thermal tolerance. Our predictions are based on a simple, hypothetical, allelic model that connects genetics to thermal physiology. To move beyond this simple model - and thereby potentially to predict differential evolution among populations and among species - will require significant advances in our ability to translate the details of thermal histories into physiological and population-genetic consequences.
Epigenomics and bolting tolerance in sugar beet genotypes.
Hébrard, Claire; Peterson, Daniel G; Willems, Glenda; Delaunay, Alain; Jesson, Béline; Lefèbvre, Marc; Barnes, Steve; Maury, Stéphane
2016-01-01
In sugar beet (Beta vulgaris altissima), bolting tolerance is an essential agronomic trait reflecting the bolting response of genotypes after vernalization. Genes involved in induction of sugar beet bolting have now been identified, and evidence suggests that epigenetic factors are involved in their control. Indeed, the time course and amplitude of DNA methylation variations in the shoot apical meristem have been shown to be critical in inducing sugar beet bolting, and a few functional targets of DNA methylation during vernalization have been identified. However, molecular mechanisms controlling bolting tolerance levels among genotypes are still poorly understood. Here, gene expression and DNA methylation profiles were compared in shoot apical meristems of three bolting-resistant and three bolting-sensitive genotypes after vernalization. Using Cot fractionation followed by 454 sequencing of the isolated low-copy DNA, 6231 contigs were obtained that were used along with public sugar beet DNA sequences to design custom Agilent microarrays for expression (56k) and methylation (244k) analyses. A total of 169 differentially expressed genes and 111 differentially methylated regions were identified between resistant and sensitive vernalized genotypes. Fourteen sequences were both differentially expressed and differentially methylated, with a negative correlation between their methylation and expression levels. Genes involved in cold perception, phytohormone signalling, and flowering induction were over-represented and collectively represent an integrative gene network from environmental perception to bolting induction. Altogether, the data suggest that the genotype-dependent control of DNA methylation and expression of an integrative gene network participate in bolting tolerance in sugar beet, opening up perspectives for crop improvement. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Muchero, Wellington; Ehlers, Jeffrey D; Roberts, Philip A
2010-02-01
Quantitative trait loci (QTL) studies provide insight into the complexity of drought tolerance mechanisms. Molecular markers used in these studies also allow for marker-assisted selection (MAS) in breeding programs, enabling transfer of genetic factors between breeding lines without complete knowledge of their exact nature. However, potential for recombination between markers and target genes limit the utility of MAS-based strategies. Candidate gene mapping offers an alternative solution to identify trait determinants underlying QTL of interest. Here, we used restriction site polymorphisms to investigate co-location of candidate genes with QTL for seedling drought stress-induced premature senescence identified previously in cowpea. Genomic DNA isolated from 113 F(2:8) RILs of drought-tolerant IT93K503-1 and drought susceptible CB46 genotypes was digested with combinations of EcoR1 and HpaII, Mse1, or Msp1 restriction enzymes and amplified with primers designed from 13 drought-responsive cDNAs. JoinMap 3.0 and MapQTL 4.0 software were used to incorporate polymorphic markers onto the AFLP map and to analyze their association with the drought response QTL. Seven markers co-located with peaks of previously identified QTL. Isolation, sequencing, and blast analysis of these markers confirmed their significant homology with drought or other abiotic stress-induced expressed sequence tags (EST) from cowpea and other plant systems. Further, homology with coding sequences for a multidrug resistance protein 3 and a photosystem I assembly protein ycf3 was revealed in two of these candidates. These results provide a platform for the identification and characterization of genetic trait determinants underlying seedling drought tolerance in cowpea.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qin, Yuxiang, E-mail: yuxiangqin@126.com; Tian, Yanchen; Han, Lu
Highlights: •A class II WRKY transcription factor, TaWRKY79 was isolated and characterized. •TaWRKY79 was induced by NaCl or abscisic acid. •843 bp regulatory segment was sufficient to respond to ABA or NaCl treatment. •TaWRKY79 enhanced salinity and ionic tolerance while reduced sensitivity to ABA. •TaWRKY79 increased salinity and ionic tolerance in an ABA-dependent pathway. -- Abstract: The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusionmore » between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway.« less
Guo, Hailin; Ding, Wanwen; Chen, Jingbo; Chen, Xuan; Zheng, Yiqi; Wang, Zhiyong; Liu, Jianxiu
2014-01-01
Zoysiagrass (Zoysia Willd.) is an important warm season turfgrass that is grown in many parts of the world. Salt tolerance is an important trait in zoysiagrass breeding programs. In this study, a genetic linkage map was constructed using sequence-related amplified polymorphism markers and random amplified polymorphic DNA markers based on an F1 population comprising 120 progeny derived from a cross between Zoysia japonica Z105 (salt-tolerant accession) and Z061 (salt-sensitive accession). The linkage map covered 1211 cM with an average marker distance of 5.0 cM and contained 24 linkage groups with 242 marker loci (217 sequence-related amplified polymorphism markers and 25 random amplified polymorphic DNA markers). Quantitative trait loci affecting the salt tolerance of zoysiagrass were identified using the constructed genetic linkage map. Two significant quantitative trait loci (qLF-1 and qLF-2) for leaf firing percentage were detected; qLF-1 at 36.3 cM on linkage group LG4 with a logarithm of odds value of 3.27, which explained 13.1% of the total variation of leaf firing and qLF-2 at 42.3 cM on LG5 with a logarithm of odds value of 2.88, which explained 29.7% of the total variation of leaf firing. A significant quantitative trait locus (qSCW-1) for reduced percentage of dry shoot clipping weight was detected at 44.1 cM on LG5 with a logarithm of odds value of 4.0, which explained 65.6% of the total variation. This study provides important information for further functional analysis of salt-tolerance genes in zoysiagrass. Molecular markers linked with quantitative trait loci for salt tolerance will be useful in zoysiagrass breeding programs using marker-assisted selection.
Transcriptome responses in alfalfa associated with tolerance to intensive animal grazing
Wang, Junjie; Zhao, Yan; Ray, Ian; Song, Mingzhou
2016-01-01
Tolerance of alfalfa (Medicago sativa L.) to animal grazing varies widely within the species. However, the molecular mechanisms influencing the grazing tolerant phenotype remain uncharacterized. The objective of this study was to identify genes and pathways that control grazing response in alfalfa. We analyzed whole-plant de novo transcriptomes from grazing tolerant and intolerant populations of M. sativa ssp. falcata subjected to grazing by sheep. Among the Gene Ontology terms which were identified as grazing responsive in the tolerant plants and differentially enriched between the tolerant and intolerant populations (both grazed), most were associated with the ribosome and translation-related activities, cell wall processes, and response to oxygen levels. Twenty-one grazing responsive pathways were identified that also exhibited differential expression between the tolerant and intolerant populations. These pathways were associated with secondary metabolite production, primary carbohydrate metabolic pathways, shikimate derivative dependent pathways, ribosomal subunit composition, hormone signaling, wound response, cell wall formation, and anti-oxidant defense. Sequence polymorphisms were detected among several differentially expressed homologous transcripts between the tolerant and intolerant populations. These differentially responsive genes and pathways constitute potential response mechanisms for grazing tolerance in alfalfa. They also provide potential targets for molecular breeding efforts to develop grazing-tolerant cultivars of alfalfa. PMID:26763747
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pace, Sara; Ceballos, Shannon J.; Harrold, Duff
Our aims were to identify thermophilic microbial communities that degrade green waste in the presence of the ionic liquids (IL) tetrabutylphosphonium chloride and tributylethylphosphonium diethylphosphate and examine preservation methods for IL-tolerant communities. High-solids incubations with stepwise increases in IL concentration were conducted to enrich for thermophilic IL-tolerant communities that decomposed green waste. 16S rRNA sequencing of enriched communities revealed microorganisms capable of tolerating high levels of IL. Furthermore, cryogenic preservation of enriched communities reduced the IL tolerance of the community and decreased the relative abundance of IL-tolerant organisms. The use of cryoprotectants did not have an effect on microbial activitymore » on green waste of the stored community. A successful approach was developed to enrich communities that decompose green waste in thermophilic high-solids environments in the presence of IL. Alternative community storage and revival methods are necessary for maintenance and recovery of IL-tolerant communities. The enriched communities provide a targeted source of enzymes for the bioconversion of IL-pretreated green waste for conversion to biofuels.« less
Kamphuis, Lars G; Hane, James K; Nelson, Matthew N; Gao, Lingling; Atkins, Craig A; Singh, Karam B
2015-01-01
Narrow-leafed lupin (NLL; Lupinus angustifolius L.) is an important grain legume crop that is valuable for sustainable farming and is becoming recognized as a human health food. NLL breeding is directed at improving grain production, disease resistance, drought tolerance and health benefits. However, genetic and genomic studies have been hindered by a lack of extensive genomic resources for the species. Here, the generation, de novo assembly and annotation of transcriptome datasets derived from five different NLL tissue types of the reference accession cv. Tanjil are described. The Tanjil transcriptome was compared to transcriptomes of an early domesticated cv. Unicrop, a wild accession P27255, as well as accession 83A:476, together being the founding parents of two recombinant inbred line (RIL) populations. In silico predictions for transcriptome-derived gene-based length and SNP polymorphic markers were conducted and corroborated using a survey assembly sequence for NLL cv. Tanjil. This yielded extensive indel and SNP polymorphic markers for the two RIL populations. A total of 335 transcriptome-derived markers and 66 BAC-end sequence-derived markers were evaluated, and 275 polymorphic markers were selected to genotype the reference NLL 83A:476 × P27255 RIL population. This significantly improved the completeness, marker density and quality of the reference NLL genetic map. PMID:25060816
Lingner, Thomas; Kataya, Amr R. A.; Reumann, Sigrun
2012-01-01
We recently developed the first algorithms specifically for plants to predict proteins carrying peroxisome targeting signals type 1 (PTS1) from genome sequences.1 As validated experimentally, the prediction methods are able to correctly predict unknown peroxisomal Arabidopsis proteins and to infer novel PTS1 tripeptides. The high prediction performance is primarily determined by the large number and sequence diversity of the underlying positive example sequences, which mainly derived from EST databases. However, a few constructs remained cytosolic in experimental validation studies, indicating sequencing errors in some ESTs. To identify erroneous sequences, we validated subcellular targeting of additional positive example sequences in the present study. Moreover, we analyzed the distribution of prediction scores separately for each orthologous group of PTS1 proteins, which generally resembled normal distributions with group-specific mean values. The cytosolic sequences commonly represented outliers of low prediction scores and were located at the very tail of a fitted normal distribution. Three statistical methods for identifying outliers were compared in terms of sensitivity and specificity.” Their combined application allows elimination of erroneous ESTs from positive example data sets. This new post-validation method will further improve the prediction accuracy of both PTS1 and PTS2 protein prediction models for plants, fungi, and mammals. PMID:22415050
Lingner, Thomas; Kataya, Amr R A; Reumann, Sigrun
2012-02-01
We recently developed the first algorithms specifically for plants to predict proteins carrying peroxisome targeting signals type 1 (PTS1) from genome sequences. As validated experimentally, the prediction methods are able to correctly predict unknown peroxisomal Arabidopsis proteins and to infer novel PTS1 tripeptides. The high prediction performance is primarily determined by the large number and sequence diversity of the underlying positive example sequences, which mainly derived from EST databases. However, a few constructs remained cytosolic in experimental validation studies, indicating sequencing errors in some ESTs. To identify erroneous sequences, we validated subcellular targeting of additional positive example sequences in the present study. Moreover, we analyzed the distribution of prediction scores separately for each orthologous group of PTS1 proteins, which generally resembled normal distributions with group-specific mean values. The cytosolic sequences commonly represented outliers of low prediction scores and were located at the very tail of a fitted normal distribution. Three statistical methods for identifying outliers were compared in terms of sensitivity and specificity." Their combined application allows elimination of erroneous ESTs from positive example data sets. This new post-validation method will further improve the prediction accuracy of both PTS1 and PTS2 protein prediction models for plants, fungi, and mammals.
Dubé, Marie-Pier; Castonguay, Yves; Cloutier, Jean; Michaud, Josée; Bertrand, Annick
2013-03-01
Dehydrin defines a complex family of intrinsically disordered proteins with potential adaptive value with regard to freeze-induced cell dehydration. Search within an expressed sequence tags library from cDNAs of cold-acclimated crowns of alfalfa (Medicago sativa spp. sativa L.) identified transcripts putatively encoding K(3)-type dehydrins. Analysis of full-length coding sequences unveiled two highly homologous sequence variants, K(3)-A and K(3)-B. An increase in the frequency of genotypes yielding positive genomic amplification of the K(3)-dehydrin variants in response to selection for superior tolerance to freezing and the induction of their expression at low temperature strongly support a link with cold adaptation. The presence of multiple allelic forms within single genotypes and independent segregation indicate that the two K(3) dehydrin variants are encoded by distinct genes located at unlinked loci. The co-inheritance of the K(3)-A dehydrin with a Y(2)K(4) dehydrin restriction fragment length polymorphism with a demonstrated impact on freezing tolerance suggests the presence of a genome domain where these functionally related genes are located. These results provide additional evidence that dehydrin play important roles with regard to tolerance to subfreezing temperatures. They also underscore the value of recurrent selection to help identify variants within a large multigene family in allopolyploid species like alfalfa.
Systems biology approach in plant abiotic stresses.
Mohanta, Tapan Kumar; Bashir, Tufail; Hashem, Abeer; Abd Allah, Elsayed Fathi
2017-12-01
Plant abiotic stresses are the major constraint on plant growth and development, causing enormous crop losses across the world. Plants have unique features to defend themselves against these challenging adverse stress conditions. They modulate their phenotypes upon changes in physiological, biochemical, molecular and genetic information, thus making them tolerant against abiotic stresses. It is of paramount importance to determine the stress-tolerant traits of a diverse range of genotypes of plant species and integrate those traits for crop improvement. Stress-tolerant traits can be identified by conducting genome-wide analysis of stress-tolerant genotypes through the highly advanced structural and functional genomics approach. Specifically, whole-genome sequencing, development of molecular markers, genome-wide association studies and comparative analysis of interaction networks between tolerant and susceptible crop varieties grown under stress conditions can greatly facilitate discovery of novel agronomic traits that protect plants against abiotic stresses. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Tolerance of a high-protein baked-egg product in egg-allergic children.
Saifi, Maryam; Swamy, Nithya; Crain, Maria; Brown, L Steven; Bird, John Andrew
2016-05-01
Egg allergy is one of the most common immunoglobulin E (IgE)-mediated food allergies. Extensively heating egg has been found to decrease its allergenicity and 64% to 84% of children allergic to egg have been found to tolerate baked-egg products. Because there is no reliable method for predicting baked-egg tolerance, oral food challenges remain the gold standard. Prior studies have reported on baked-egg challenges using up to 2.2 g of egg white (EW) protein. To establish whether children with egg allergy would pass a baked-egg challenge to a larger amount of egg protein and the potential criteria for predicting the likelihood of baked-egg tolerance. A chart review was conducted of all patients 6 months to 18 years of age with egg allergy who underwent oral baked-egg challenges at Children's Medical Center Dallas over a 2-year period. Challenges were conducted in the clinic with a 3.8-g baked-egg product. Fifty-nine of 94 patients (63%) tolerated the 3.8-g baked-egg product. The presence of asthma (P < .01), EW skin prick test (SPT; P < .01) reactive wheal, and EW-specific IgE level (P = .02) correlated with baked-egg reactivity, whereas ovomucoid-specific IgE level did not. The positive predictive value approached 66% at an EW SPT reactive wheal of 10 mm and 60% for an EW-specific IgE level of 8 kUA/L. Most subjects with egg allergy tolerated baked egg. This study is the first to use 3.8 g of EW protein for the challenges. The EW SPT wheal diameter and EW-specific IgE levels were the best predictors of baked-egg tolerance. Copyright © 2016 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Useful halophilic, thermostable and ionic liquids tolerant cellulases
Zhang, Tao; Datta, Supratim; Simmons, Blake A.; Rubin, Edward M.
2016-06-28
The present invention provides for an isolated or recombinant polypeptide comprising an amino acid sequence having at least 70% identity with the amino acid sequence of a Halorhabdus utahensis cellulase, such as Hu-CBH1, wherein said amino acid sequence has a halophilic thermostable and/or thermophilic cellobiohydrolase (CBH) activity. In some embodiments, the polypeptide has a CBH activity that is resistant to up to about 20% of ionic liquids. The present invention also provides for compositions comprising and methods using the isolated or recombinant polypeptide.
Pace, Sara; Ceballos, Shannon J.; Harrold, Duff; ...
2016-04-22
Our aims were to identify thermophilic microbial communities that degrade green waste in the presence of the ionic liquids (IL) tetrabutylphosphonium chloride and tributylethylphosphonium diethylphosphate and examine preservation methods for IL-tolerant communities. High-solids incubations with stepwise increases in IL concentration were conducted to enrich for thermophilic IL-tolerant communities that decomposed green waste. 16S rRNA sequencing of enriched communities revealed microorganisms capable of tolerating high levels of IL. Furthermore, cryogenic preservation of enriched communities reduced the IL tolerance of the community and decreased the relative abundance of IL-tolerant organisms. The use of cryoprotectants did not have an effect on microbial activitymore » on green waste of the stored community. A successful approach was developed to enrich communities that decompose green waste in thermophilic high-solids environments in the presence of IL. Alternative community storage and revival methods are necessary for maintenance and recovery of IL-tolerant communities. The enriched communities provide a targeted source of enzymes for the bioconversion of IL-pretreated green waste for conversion to biofuels.« less
Chen, Jeng-Chang; Chang, Ming-Ling; Huang, Shiu-Feng; Chang, Pei-Yeh; Muench, Marcus O; Fu, Ren-Huei; Ou, Liang-Shiou; Kuo, Ming-Ling
2008-01-01
It was reported that the dose of self-antigens can determine the consequence of deletional tolerance and donor T cells are critical for tolerance induction in mixed chimeras. This study aimed at assessing the effect of cell doses and marrow T cells on engraftment and tolerance induction after prenatal bone marrow transplantation. Intraperitoneal cell transplantation was performed in FVB/N (H-2K(q)) mice at gestational day 14 with escalating doses of adult C57BL/6 (H-2K(b)) marrows. Peripheral chimerism was examined postnatally by flow cytometry and tolerance was tested by skin transplantation. Transplantation of light-density marrow cells showed a dose response. High-level chimerism emerged with a threshold dose of 5.0 x 10(6) and host leukocytes could be nearly replaced at a dose of 7.5-10.0 x 10(6). High-dose transplants conferred a steady long-lasting donor-specific tolerance but were accompanied by >50% incidence of graft-versus-host disease. Depletion of marrow T cells lessened graft-versus-host disease to the detriment of engraftment. With low-level chimerism, tolerance was a graded phenomenon dependent upon the level of chimerism. Durable chimerism within 6 months required a threshold of > or = 2% chimerism at 1 month of age and predicted a 50% chance of long-term tolerance, whereas transient chimerism (<2%) only caused hyporesponsiveness to the donor. Tolerance induction did not succeed without peripheral chimerism even if a large amount of injected donor cells persisted in the peritoneum. Neither did an increase in cell doses or donor T-cell contents benefit skin graft survivals unless it had substantially improved peripheral chimerism. Thus, peripheral chimerism level can be a simple and straightforward test to predict the degree of prenatal immune tolerance.
Short-Read Sequencing for Genomic Analysis of the Brown Rot Fungus Fibroporia radiculosa
J. D. Tang; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; S. C. Burgess; S. V. Diehl
2012-01-01
The feasibility of short-read sequencing for genomic analysis was demonstrated for Fibroporia radiculosa, a copper-tolerant fungus that causes brown rot decay of wood. The effect of read quality on genomic assembly was assessed by filtering Illumina GAIIx reads from a single run of a paired-end library (75-nucleotide read length and 300-bp fragment...
Khmelenina, Valentina N.; Beck, David A. C.; Munk, Christine; Davenport, Karen; Daligault, Hajnalka; Erkkila, Tracy; Goodwin, Lynne; Gu, Wei; Lo, Chien-Chi; Scholz, Matthew; Teshima, Hazuki; Xu, Yan; Chain, Patrick; Bringel, Francoise; Vuilleumier, Stéphane; DiSpirito, Alan; Dunfield, Peter; Jetten, Mike S. M.; Klotz, Martin G.; Knief, Claudia; Murrell, J. Colin; Op den Camp, Huub J. M.; Sakai, Yasuyoshi; Semrau, Jeremy; Svenning, Mette; Stein, Lisa Y.; Trotsenko, Yuri A.
2013-01-01
Robust growth of the gammaproteobacterium Methylomicrobium buryatense strain 5G on methane makes it an attractive system for CH4-based biocatalysis. Here we present a draft genome sequence of the strain that will provide a valuable framework for metabolic engineering of the core pathways for the production of valuable chemicals from methane. PMID:23814105
Kajiwara, Yasuhiro; Mori, Kazuki; Tashiro, Kosuke; Higuchi, Yujiro; Takegawa, Kaoru; Takashita, Hideharu
2018-04-05
Here, we report the draft genome sequence of Saccharomyces cerevisiae strain BAW-6, which is used for the production of barley shochu, a traditional Japanese spirit. This genomic information can be used to elucidate the genetic basis underlying the high alcohol production capacity and citric acid tolerance of shochu yeast. Copyright © 2018 Kajiwara et al.
Genomic Sequence of Saccharomyces cerevisiae BAW-6, a Yeast Strain Optimal for Brewing Barley Shochu
Mori, Kazuki; Tashiro, Kosuke; Higuchi, Yujiro; Takashita, Hideharu
2018-01-01
ABSTRACT Here, we report the draft genome sequence of Saccharomyces cerevisiae strain BAW-6, which is used for the production of barley shochu, a traditional Japanese spirit. This genomic information can be used to elucidate the genetic basis underlying the high alcohol production capacity and citric acid tolerance of shochu yeast. PMID:29622617
Sun, Zhizeng; Mehta, Shrenik C; Adamski, Carolyn J; Gibbs, Richard A; Palzkill, Timothy
2016-09-12
CphA is a Zn(2+)-dependent metallo-β-lactamase that efficiently hydrolyzes only carbapenem antibiotics. To understand the sequence requirements for CphA function, single codon random mutant libraries were constructed for residues in and near the active site and mutants were selected for E. coli growth on increasing concentrations of imipenem, a carbapenem antibiotic. At high concentrations of imipenem that select for phenotypically wild-type mutants, the active-site residues exhibit stringent sequence requirements in that nearly all residues in positions that contact zinc, the substrate, or the catalytic water do not tolerate amino acid substitutions. In addition, at high imipenem concentrations a number of residues that do not directly contact zinc or substrate are also essential and do not tolerate substitutions. Biochemical analysis confirmed that amino acid substitutions at essential positions decreased the stability or catalytic activity of the CphA enzyme. Therefore, the CphA active - site is fragile to substitutions, suggesting active-site residues are optimized for imipenem hydrolysis. These results also suggest that resistance to inhibitors targeted to the CphA active site would be slow to develop because of the strong sequence constraints on function.
Zhang, Jun-Feng; Xu, Yong-Qing; Dong, Jia-Min; Peng, Li-Na; Feng, Xu; Wang, Xu; Li, Fei; Miao, Yu; Yao, Shu-Kuan; Zhao, Qiao-Qin; Feng, Shan-Shan; Hu, Bao-Zhong
2018-01-01
Plant expansins are proteins involved in cell wall loosening, plant growth, and development, as well as in response to plant diseases and other stresses. In this study, we identified 128 expansin coding sequences from the wheat (Triticum aestivum) genome. These sequences belong to 45 homoeologous copies of TaEXPs, including 26 TaEXPAs, 15 TaEXPBs and four TaEXLAs. No TaEXLB was identified. Gene expression and sub-expression profiles revealed that most of the TaEXPs were expressed either only in root tissues or in multiple organs. Real-time qPCR analysis showed that many TaEXPs were differentially expressed in four different tissues of the two wheat cultivars—the cold-sensitive ‘Chinese Spring (CS)’ and the cold-tolerant ‘Dongnongdongmai 1 (D1)’ cultivars. Our results suggest that the differential expression of TaEXPs could be related to low-temperature tolerance or sensitivity of different wheat cultivars. Our study expands our knowledge on wheat expansins and sheds new light on the functions of expansins in plant development and stress response. PMID:29596529
Zhao, Xue Qiang; Aizawa, Tomoko; Schneider, Jessica; Wang, Chao; Shen, Ren Fang; Sunairi, Michio
2013-01-01
The complete mitochondrial genome of Rhodotorula taiwanensis RS1, an aluminum-tolerant Basidiomycota fungus, was determined and compared with the known mitochondrial genomes of 12 Basidiomycota species. The mitochondrial genome of R. taiwanensis RS1 is a circular DNA molecule of 40,392 bp and encodes the typical 15 mitochondrial proteins, 23 tRNAs, and small and large rRNAs as well as 10 intronic open reading frames. These genes are apparently transcribed in two directions and do not show syntenies in gene order with other investigated Basidiomycota species. The average G+C content (41%) of the mitochondrial genome of R. taiwanensis RS1 is the highest among the Basidiomycota species. Two introns were detected in the sequence of the atp9 gene of R. taiwanensis RS1, but not in that of other Basidiomycota species. Rhodotorula taiwanensis is the first species of the genus Rhodotorula whose full mitochondrial genome has been sequenced; and the data presented here supply valuable information for understanding the evolution of fungal mitochondrial genomes and researching the mechanism of aluminum tolerance in microorganisms. PMID:23427135
Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex; ...
2017-09-21
Dethiobacter alkaliphilus strain AHT1 T is an anaerobic, sulfidogenic, moderately salt-tolerant alkaliphilic chemolithotroph isolated from hypersaline soda lake sediments in northeastern Mongolia. It is thus a Gram-positive bacterium with low GC content, within the phylum Firmicutes. We report its draft genome sequence, which consists of 34 contigs with a total sequence length of 3.12 Mbp. D. alkaliphilus strain AHT1 T was sequenced by the Joint Genome Institute (JGI) as part of the Community Science Program due to its relevance to bioremediation and biotechnological applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex
Dethiobacter alkaliphilus strain AHT1 T is an anaerobic, sulfidogenic, moderately salt-tolerant alkaliphilic chemolithotroph isolated from hypersaline soda lake sediments in northeastern Mongolia. It is thus a Gram-positive bacterium with low GC content, within the phylum Firmicutes. We report its draft genome sequence, which consists of 34 contigs with a total sequence length of 3.12 Mbp. D. alkaliphilus strain AHT1 T was sequenced by the Joint Genome Institute (JGI) as part of the Community Science Program due to its relevance to bioremediation and biotechnological applications.
Complete genome sequence of Thioalkalivibrio sp. K90mix
Muyzer, Gerard; Sorokin, Dimitry Y.; Mavromatis, Konstantinos; Lapidus, Alla; Foster, Brian; Sun, Hui; Ivanova, Natalia; Pati, Amrita; D'haeseleer, Patrik; Woyke, Tanja; Kyrpides, Nikos C.
2011-01-01
Thioalkalivibrio sp. K90mix is an obligately chemolithoautotrophic, natronophilic sulfur-oxidizing bacterium (SOxB) belonging to the family Ectothiorhodospiraceae within the Gammaproteobacteria. The strain was isolated from a mixture of sediment samples obtained from different soda lakes located in the Kulunda Steppe (Altai, Russia) based on its extreme potassium carbonate tolerance as an enrichment method. Here we report the complete genome sequence of strain K90mix and its annotation. The genome was sequenced within the Joint Genome Institute Community Sequencing Program, because of its relevance to the sustainable removal of sulfide from wastewater and gas streams. PMID:22675584
Secondary Structure Predictions for Long RNA Sequences Based on Inversion Excursions and MapReduce.
Yehdego, Daniel T; Zhang, Boyu; Kodimala, Vikram K R; Johnson, Kyle L; Taufer, Michela; Leung, Ming-Ying
2013-05-01
Secondary structures of ribonucleic acid (RNA) molecules play important roles in many biological processes including gene expression and regulation. Experimental observations and computing limitations suggest that we can approach the secondary structure prediction problem for long RNA sequences by segmenting them into shorter chunks, predicting the secondary structures of each chunk individually using existing prediction programs, and then assembling the results to give the structure of the original sequence. The selection of cutting points is a crucial component of the segmenting step. Noting that stem-loops and pseudoknots always contain an inversion, i.e., a stretch of nucleotides followed closely by its inverse complementary sequence, we developed two cutting methods for segmenting long RNA sequences based on inversion excursions: the centered and optimized method. Each step of searching for inversions, chunking, and predictions can be performed in parallel. In this paper we use a MapReduce framework, i.e., Hadoop, to extensively explore meaningful inversion stem lengths and gap sizes for the segmentation and identify correlations between chunking methods and prediction accuracy. We show that for a set of long RNA sequences in the RFAM database, whose secondary structures are known to contain pseudoknots, our approach predicts secondary structures more accurately than methods that do not segment the sequence, when the latter predictions are possible computationally. We also show that, as sequences exceed certain lengths, some programs cannot computationally predict pseudoknots while our chunking methods can. Overall, our predicted structures still retain the accuracy level of the original prediction programs when compared with known experimental secondary structure.
Thermodynamic characterization of tandem mismatches found in naturally occurring RNA
Christiansen, Martha E.; Znosko, Brent M.
2009-01-01
Although all sequence symmetric tandem mismatches and some sequence asymmetric tandem mismatches have been thermodynamically characterized and a model has been proposed to predict the stability of previously unmeasured sequence asymmetric tandem mismatches [Christiansen,M.E. and Znosko,B.M. (2008) Biochemistry, 47, 4329–4336], experimental thermodynamic data for frequently occurring tandem mismatches is lacking. Since experimental data is preferred over a predictive model, the thermodynamic parameters for 25 frequently occurring tandem mismatches were determined. These new experimental values, on average, are 1.0 kcal/mol different from the values predicted for these mismatches using the previous model. The data for the sequence asymmetric tandem mismatches reported here were then combined with the data for 72 sequence asymmetric tandem mismatches that were published previously, and the parameters used to predict the thermodynamics of previously unmeasured sequence asymmetric tandem mismatches were updated. The average absolute difference between the measured values and the values predicted using these updated parameters is 0.5 kcal/mol. This updated model improves the prediction for tandem mismatches that were predicted rather poorly by the previous model. This new experimental data and updated predictive model allow for more accurate calculations of the free energy of RNA duplexes containing tandem mismatches, and, furthermore, should allow for improved prediction of secondary structure from sequence. PMID:19509311
Predicting DNA hybridization kinetics from sequence
NASA Astrophysics Data System (ADS)
Zhang, Jinny X.; Fang, John Z.; Duan, Wei; Wu, Lucia R.; Zhang, Angela W.; Dalchau, Neil; Yordanov, Boyan; Petersen, Rasmus; Phillips, Andrew; Zhang, David Yu
2018-01-01
Hybridization is a key molecular process in biology and biotechnology, but so far there is no predictive model for accurately determining hybridization rate constants based on sequence information. Here, we report a weighted neighbour voting (WNV) prediction algorithm, in which the hybridization rate constant of an unknown sequence is predicted based on similarity reactions with known rate constants. To construct this algorithm we first performed 210 fluorescence kinetics experiments to observe the hybridization kinetics of 100 different DNA target and probe pairs (36 nt sub-sequences of the CYCS and VEGF genes) at temperatures ranging from 28 to 55 °C. Automated feature selection and weighting optimization resulted in a final six-feature WNV model, which can predict hybridization rate constants of new sequences to within a factor of 3 with ∼91% accuracy, based on leave-one-out cross-validation. Accurate prediction of hybridization kinetics allows the design of efficient probe sequences for genomics research.
Huang, Xianzhong; Yang, Lifei; Jin, Yuhuan; Lin, Jun; Liu, Fang
2017-01-01
Arabidopsis pumila is an ephemeral plant, and a close relative of the model plant Arabidopsis thaliana , but it possesses higher photosynthetic efficiency, higher propagation rate, and higher salinity tolerance compared to those A. thaliana , thus providing a candidate plant system for gene mining for environmental adaption and salt tolerance. However, A. pumila is an under-explored resource for understanding the genetic mechanisms underlying abiotic stress adaptation. To improve our understanding of the molecular and genetic mechanisms of salt stress adaptation, more than 19,900 clones randomly selected from a cDNA library constructed previously from leaf tissue exposed to high-salinity shock were sequenced. A total of 16,014 high-quality expressed sequence tags (ESTs) were generated, which have been deposited in the dbEST GenBank under accession numbers JZ932319 to JZ948332. Clustering and assembly of these ESTs resulted in the identification of 8,835 unique sequences, consisting of 2,469 contigs and 6,366 singletons. The blastx results revealed 8,011 unigenes with significant similarity to known genes, while only 425 unigenes remained uncharacterized. Functional classification demonstrated an abundance of unigenes involved in binding, catalytic, structural or transporter activities, and in pathways of energy, carbohydrate, amino acid, or lipid metabolism. At least seven main classes of genes were related to salt-tolerance among the 8,835 unigenes. Many previously reported salt tolerance genes were also manifested in this library, for example VP1, H + -ATPase, NHX1, SOS2, SOS3, NAC, MYB, ERF, LEA, P5CS1 . In addition, 251 transcription factors were identified from the library, classified into 42 families. Lastly, changes in expression of the 12 most abundant unigenes, 12 transcription factor genes, and 19 stress-related genes in the first 24 h of exposure to high-salinity stress conditions were monitored by qRT-PCR. The large-scale EST library obtained in this study provides first-hand information on gene sequences expressed in young leaves of A. pumila exposed to salt shock. The rapid discovery of known or unknown genes related to salinity stress response in A. pumila will facilitate the understanding of complex adaptive mechanisms for ephemerals.
Halimaa, Pauliina; Lin, Ya-Fen; Ahonen, Viivi H; Blande, Daniel; Clemens, Stephan; Gyenesei, Attila; Häikiö, Elina; Kärenlampi, Sirpa O; Laiho, Asta; Aarts, Mark G M; Pursiheimo, Juha-Pekka; Schat, Henk; Schmidt, Holger; Tuomainen, Marjo H; Tervahauta, Arja I
2014-03-18
Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically well-characterized N. caerulescens accessions, i.e., Ganges, La Calamine, and Monte Prinzera. Genes with possible contribution to zinc, cadmium, and nickel hyperaccumulation and hypertolerance were predicted. The most significant differences between the accessions were related to metal ion (di-, trivalent inorganic cation) transmembrane transporter activity, iron and calcium ion binding, (inorganic) anion transmembrane transporter activity, and antioxidant activity. Analysis of correlation between the expression profile of each gene and the metal-related characteristics of the accessions disclosed both previously characterized (HMA4, HMA3) and new candidate genes (e.g., for nickel IRT1, ZIP10, and PDF2.3) as possible contributors to the hyperaccumulation/tolerance phenotype. A number of unknown Noccaea-specific transcripts also showed correlation with Zn(2+), Cd(2+), or Ni(2+) hyperaccumulation/tolerance. This study shows that N. caerulescens populations have evolved great diversity in the expression of metal-related genes, facilitating adaptation to various metalliferous soils. The information will be helpful in the development of improved plants for metal phytoremediation.
John, Ulrik P; Polotnianka, Renatam M; Sivakumaran, Kailayapillai A; Chew, Orinda; Mackin, Leanne; Kuiper, Micheal J; Talbot, Jonathan P; Nugent, Gregory D; Mautord, Julie; Schrauf, Gustavo E; Spangenberg, German C
2009-04-01
Antarctic hair grass (Deschampsia antarctica E. Desv.), the only grass indigenous to Antarctica, has well-developed freezing tolerance, strongly induced by cold acclimation. Here, we show that in response to low temperatures, D. antarctica expresses potent recrystallization inhibition (RI) activity that, inhibits the growth of small ice crystals into potentially damaging large ones, is proteinaceous and localized to the apoplasm. A gene family from D. antarctica encoding putative homologs of an ice recrystallization inhibition protein (IRIP) has been isolated and characterized. IRIPs are apoplastically targeted proteins with two potential ice-binding motifs: 1-9 leucine-rich repeats (LRRs) and c. 16 'IRIP' repeats. IRIP genes appear to be confined to the grass subfamily Pooideae and their products, exhibit sequence similarity to phytosulphokine receptors and are predicted to adopt conformations with two ice-binding surfaces. D. antarctica IRIP (DaIRIP) transcript levels are greatly enhanced in leaf tissue following cold acclimation. Transgenic Arabidopsis thaliana expressing a DaIRIP has novel RI activity, and purified DaIRIP, when added back to extracts of leaves from non-acclimated D. antarctica, can reconstitute the activity found in acclimated plants. We propose that IRIP-mediated RI activity may contribute to the cryotolerance of D. antarctica, and thus to its unique ability to have colonized Antarctica.
Murik, Omer; Oren, Nadav; Shotland, Yoram; Raanan, Hagai; Treves, Haim; Kedem, Isaac; Keren, Nir; Hagemann, Martin; Pade, Nadin; Kaplan, Aaron
2017-02-01
Filamentous cyanobacteria are the main founders and primary producers in biological desert soil crusts (BSCs) and are likely equipped to cope with one of the harshest environmental conditions on earth including daily hydration/dehydration cycles, high irradiance and extreme temperatures. Here, we resolved and report on the genome sequence of Leptolyngbya ohadii, an important constituent of the BSC. Comparative genomics identified a set of genes present in desiccation-tolerant but not in dehydration-sensitive cyanobacteria. RT qPCR analyses showed that the transcript abundance of many of them is upregulated during desiccation in L. ohadii. In addition, we identified genes where the orthologs detected in desiccation-tolerant cyanobacteria differs substantially from that found in desiccation-sensitive cells. We present two examples, treS and fbpA (encoding trehalose synthase and fructose 1,6-bisphosphate aldolase respectively) where, in addition to the orthologs present in the desiccation-sensitive strains, the resistant cyanobacteria also possess genes with different predicted structures. We show that in both cases the two orthologs are transcribed during controlled dehydration of L. ohadii and discuss the genetic basis for the acclimation of cyanobacteria to the desiccation conditions in desert BSC. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Genome‐wide identification of tolerance mechanisms toward p‐coumaric acid in Pseudomonas putida
Calero, Patricia; Jensen, Sheila I.; Bojanovič, Klara; Lennen, Rebecca M.; Koza, Anna
2017-01-01
Abstract The soil bacterium Pseudomonas putida KT2440 has gained increasing biotechnological interest due to its ability to tolerate different types of stress. Here, the tolerance of P. putida KT2440 toward eleven toxic chemical compounds was investigated. P. putida was found to be significantly more tolerant toward three of the eleven compounds when compared to Escherichia coli. Increased tolerance was for example found toward p‐coumaric acid, an interesting precursor for polymerization with a significant industrial relevance. The tolerance mechanism was therefore investigated using the genome‐wide approach, Tn‐seq. Libraries containing a large number of miniTn5‐Km transposon insertion mutants were grown in the presence and absence of p‐coumaric acid, and the enrichment or depletion of mutants was quantified by high‐throughput sequencing. Several genes, including the ABC transporter Ttg2ABC and the cytochrome c maturation system (ccm), were identified to play an important role in the tolerance toward p‐coumaric acid of this bacterium. Most of the identified genes were involved in membrane stability, suggesting that tolerance toward p‐coumaric acid is related to transport and membrane integrity. PMID:29131301
Genomic prediction using imputed whole-genome sequence data in Holstein Friesian cattle.
van Binsbergen, Rianne; Calus, Mario P L; Bink, Marco C A M; van Eeuwijk, Fred A; Schrooten, Chris; Veerkamp, Roel F
2015-09-17
In contrast to currently used single nucleotide polymorphism (SNP) panels, the use of whole-genome sequence data is expected to enable the direct estimation of the effects of causal mutations on a given trait. This could lead to higher reliabilities of genomic predictions compared to those based on SNP genotypes. Also, at each generation of selection, recombination events between a SNP and a mutation can cause decay in reliability of genomic predictions based on markers rather than on the causal variants. Our objective was to investigate the use of imputed whole-genome sequence genotypes versus high-density SNP genotypes on (the persistency of) the reliability of genomic predictions using real cattle data. Highly accurate phenotypes based on daughter performance and Illumina BovineHD Beadchip genotypes were available for 5503 Holstein Friesian bulls. The BovineHD genotypes (631,428 SNPs) of each bull were used to impute whole-genome sequence genotypes (12,590,056 SNPs) using the Beagle software. Imputation was done using a multi-breed reference panel of 429 sequenced individuals. Genomic estimated breeding values for three traits were predicted using a Bayesian stochastic search variable selection (BSSVS) model and a genome-enabled best linear unbiased prediction model (GBLUP). Reliabilities of predictions were based on 2087 validation bulls, while the other 3416 bulls were used for training. Prediction reliabilities ranged from 0.37 to 0.52. BSSVS performed better than GBLUP in all cases. Reliabilities of genomic predictions were slightly lower with imputed sequence data than with BovineHD chip data. Also, the reliabilities tended to be lower for both sequence data and BovineHD chip data when relationships between training animals were low. No increase in persistency of prediction reliability using imputed sequence data was observed. Compared to BovineHD genotype data, using imputed sequence data for genomic prediction produced no advantage. To investigate the putative advantage of genomic prediction using (imputed) sequence data, a training set with a larger number of individuals that are distantly related to each other and genomic prediction models that incorporate biological information on the SNPs or that apply stricter SNP pre-selection should be considered.
Fatigue crack growth and life prediction under mixed-mode loading
NASA Astrophysics Data System (ADS)
Sajith, S.; Murthy, K. S. R. K.; Robi, P. S.
2018-04-01
Fatigue crack growth life as a function of crack length is essential for the prevention of catastrophic failures from damage tolerance perspective. In damage tolerance design approach, principles of fracture mechanics are usually applied to predict the fatigue life of structural components. Numerical prediction of crack growth versus number of cycles is essential in damage tolerance design. For cracks under mixed mode I/II loading, modified Paris law (d/a d N =C (ΔKe q ) m ) along with different equivalent stress intensity factor (ΔKeq) model is used for fatigue crack growth rate prediction. There are a large number of ΔKeq models available for the mixed mode I/II loading, the selection of proper ΔKeq model has significant impact on fatigue life prediction. In the present investigation, the performance of ΔKeq models in fatigue life prediction is compared with respect to the experimental findings as there are no guidelines/suggestions available on the selection of these models for accurate and/or conservative predictions of fatigue life. Within the limitations of availability of experimental data and currently available numerical simulation techniques, the results of present study attempt to outline models that would provide accurate and conservative life predictions. Such a study aid the numerical analysts or engineers in the proper selection of the model for numerical simulation of the fatigue life. Moreover, the present investigation also suggests a procedure to enhance the accuracy of life prediction using Paris law.
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Tomcho, Jeremy C; Tillman, Magdalena R; Znosko, Brent M
2015-09-01
Predicting the secondary structure of RNA is an intermediate in predicting RNA three-dimensional structure. Commonly, determining RNA secondary structure from sequence uses free energy minimization and nearest neighbor parameters. Current algorithms utilize a sequence-independent model to predict free energy contributions of dinucleotide bulges. To determine if a sequence-dependent model would be more accurate, short RNA duplexes containing dinucleotide bulges with different sequences and nearest neighbor combinations were optically melted to derive thermodynamic parameters. These data suggested energy contributions of dinucleotide bulges were sequence-dependent, and a sequence-dependent model was derived. This model assigns free energy penalties based on the identity of nucleotides in the bulge (3.06 kcal/mol for two purines, 2.93 kcal/mol for two pyrimidines, 2.71 kcal/mol for 5'-purine-pyrimidine-3', and 2.41 kcal/mol for 5'-pyrimidine-purine-3'). The predictive model also includes a 0.45 kcal/mol penalty for an A-U pair adjacent to the bulge and a -0.28 kcal/mol bonus for a G-U pair adjacent to the bulge. The new sequence-dependent model results in predicted values within, on average, 0.17 kcal/mol of experimental values, a significant improvement over the sequence-independent model. This model and new experimental values can be incorporated into algorithms that predict RNA stability and secondary structure from sequence.
Prediction of protein secondary structure content for the twilight zone sequences.
Homaeian, Leila; Kurgan, Lukasz A; Ruan, Jishou; Cios, Krzysztof J; Chen, Ke
2007-11-15
Secondary protein structure carries information about local structural arrangements, which include three major conformations: alpha-helices, beta-strands, and coils. Significant majority of successful methods for prediction of the secondary structure is based on multiple sequence alignment. However, multiple alignment fails to provide accurate results when a sequence comes from the twilight zone, that is, it is characterized by low (<30%) homology. To this end, we propose a novel method for prediction of secondary structure content through comprehensive sequence representation, called PSSC-core. The method uses a multiple linear regression model and introduces a comprehensive feature-based sequence representation to predict amount of helices and strands for sequences from the twilight zone. The PSSC-core method was tested and compared with two other state-of-the-art prediction methods on a set of 2187 twilight zone sequences. The results indicate that our method provides better predictions for both helix and strand content. The PSSC-core is shown to provide statistically significantly better results when compared with the competing methods, reducing the prediction error by 5-7% for helix and 7-9% for strand content predictions. The proposed feature-based sequence representation uses a comprehensive set of physicochemical properties that are custom-designed for each of the helix and strand content predictions. It includes composition and composition moment vectors, frequency of tetra-peptides associated with helical and strand conformations, various property-based groups like exchange groups, chemical groups of the side chains and hydrophobic group, auto-correlations based on hydrophobicity, side-chain masses, hydropathy, and conformational patterns for beta-sheets. The PSSC-core method provides an alternative for predicting the secondary structure content that can be used to validate and constrain results of other structure prediction methods. At the same time, it also provides useful insight into design of successful protein sequence representations that can be used in developing new methods related to prediction of different aspects of the secondary protein structure. (c) 2007 Wiley-Liss, Inc.
Effect of water availability on tolerance of leaf damage in tall morning glory, Ipomoea purpurea
NASA Astrophysics Data System (ADS)
Atala, Cristian; Gianoli, Ernesto
2009-03-01
Resource availability may limit plant tolerance of herbivory. To predict the effect of differential resource availability on plant tolerance, the limiting resource model (LRM) considers which resource limits plant fitness and which resource is mostly affected by herbivore damage. We tested the effect of experimental drought on tolerance of leaf damage in Ipomoea purpurea, which is naturally exposed to both leaf damage and summer drought. To seek mechanistic explanations, we also measured several morphological, allocation and gas exchange traits. In this case, LRM predicts that tolerance would be the same in both water treatments. Plants were assigned to a combination of two water treatments (control and low water) and two damage treatments (50% defoliation and undamaged). Plants showed tolerance of leaf damage, i.e., a similar number of fruits were produced by damaged and undamaged plants, only in control water. Whereas experimental drought affected all plant traits, leaf damage caused plants to show a greater leaf trichome density and reduced shoot biomass, but only in low water. It is suggested that the reduced fitness (number of fruits) of damaged plants in low water was mediated by the differential reduction of shoot biomass, because the number of fruits per shoot biomass was similar in damaged and undamaged plants. Alternative but less likely explanations include the opposing direction of functional responses to drought and defoliation, and resource costs of the damage-induced leaf trichome density. Our results somewhat challenge the LRM predictions, but further research including field experiments is needed to validate some of the preliminary conclusions drawn.
2012-01-01
Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence-based methods. Conclusions Appropriate homologous sequences are selected automatically and objectively by the index. Such sequence selection improved the performance of functional region prediction. As far as we know, this is the first approach in which spatial statistics have been applied to protein analyses. Such integration of structure and sequence information would be useful for other bioinformatics problems. PMID:22643026
2013-01-01
Background Soybean is an important crop that provides valuable proteins and oils for human use. Because soybean growth and development is extremely sensitive to water deficit, quality and crop yields are severely impacted by drought stress. In the face of limited water resources, drought-responsive genes are therefore of interest. Identification and analysis of dehydration- and rehydration-inducible differentially expressed genes (DEGs) would not only aid elucidation of molecular mechanisms of stress response, but also enable improvement of crop stress tolerance via gene transfer. Using Digital Gene Expression Tag profiling (DGE), a new technique based on Illumina sequencing, we analyzed expression profiles between two soybean genotypes to identify drought-responsive genes. Results Two soybean genotypes—drought-tolerant Jindou21 and drought-sensitive Zhongdou33—were subjected to dehydration and rehydration conditions. For analysis of DEGs under dehydration conditions, 20 cDNA libraries were generated from roots and leaves at two different time points under well-watered and dehydration conditions. We also generated eight libraries for analysis under rehydration conditions. Sequencing of the 28 libraries produced 25,000–33,000 unambiguous tags, which were mapped to reference sequences for annotation of expressed genes. Many genes exhibited significant expression differences among the libraries. DEGs in the drought-tolerant genotype were identified by comparison of DEGs among treatments and genotypes. In Jindou21, 518 and 614 genes were differentially expressed under dehydration in leaves and roots, respectively, with 24 identified both in leaves and roots. The main functional categories enriched in these DEGs were metabolic process, response to stresses, plant hormone signal transduction, protein processing, and plant-pathogen interaction pathway; the associated genes primarily encoded transcription factors, protein kinases, and other regulatory proteins. The seven most significantly expressed (|log2 ratio| ≥ 8) genes— Glyma15g03920, Glyma05g02470, Glyma15g15010, Glyma05g09070, Glyma06g35630, Glyma08g12590, and Glyma11g16000—are more likely to determine drought stress tolerance. The expression patterns of eight randomly-selected genes were confirmed by quantitative RT-PCR; the results of QRT-PCR analysis agreed with transcriptional profile data for 96 out of 128 (75%) data points. Conclusions Many soybean genes were differentially expressed between drought-tolerant and drought-sensitive genotypes. Based on GO functional annotation and pathway enrichment analysis, some of these genes encoded transcription factors, protein kinases, and other regulatory proteins. The seven most significant DEGs are candidates for improving soybean drought tolerance. These findings will be helpful for analysis and elucidation of molecular mechanisms of drought tolerance; they also provide a basis for cultivating new varieties of drought-tolerant soybean. PMID:24093224
Song, Jiangning; Yuan, Zheng; Tan, Hao; Huber, Thomas; Burrage, Kevin
2007-12-01
Disulfide bonds are primary covalent crosslinks between two cysteine residues in proteins that play critical roles in stabilizing the protein structures and are commonly found in extracy-toplasmatic or secreted proteins. In protein folding prediction, the localization of disulfide bonds can greatly reduce the search in conformational space. Therefore, there is a great need to develop computational methods capable of accurately predicting disulfide connectivity patterns in proteins that could have potentially important applications. We have developed a novel method to predict disulfide connectivity patterns from protein primary sequence, using a support vector regression (SVR) approach based on multiple sequence feature vectors and predicted secondary structure by the PSIPRED program. The results indicate that our method could achieve a prediction accuracy of 74.4% and 77.9%, respectively, when averaged on proteins with two to five disulfide bridges using 4-fold cross-validation, measured on the protein and cysteine pair on a well-defined non-homologous dataset. We assessed the effects of different sequence encoding schemes on the prediction performance of disulfide connectivity. It has been shown that the sequence encoding scheme based on multiple sequence feature vectors coupled with predicted secondary structure can significantly improve the prediction accuracy, thus enabling our method to outperform most of other currently available predictors. Our work provides a complementary approach to the current algorithms that should be useful in computationally assigning disulfide connectivity patterns and helps in the annotation of protein sequences generated by large-scale whole-genome projects. The prediction web server and Supplementary Material are accessible at http://foo.maths.uq.edu.au/~huber/disulfide
Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila
2010-07-16
Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A large RGA08 gene cluster identified in wild banana corresponds to a highly variable genomic region between haplotypes surrounded by conserved flanking regions. High level of sequence identity (70 to 99%) of the genic and intergenic regions suggests a recent and rapid evolution of this cluster in M. balbisiana.
Wheat EST resources for functional genomics of abiotic stress
Houde, Mario; Belcaid, Mahdi; Ouellet, François; Danyluk, Jean; Monroy, Antonio F; Dryanova, Ani; Gulick, Patrick; Bergeron, Anne; Laroche, André; Links, Matthew G; MacCarthy, Luke; Crosby, William L; Sarhan, Fathey
2006-01-01
Background Wheat is an excellent species to study freezing tolerance and other abiotic stresses. However, the sequence of the wheat genome has not been completely characterized due to its complexity and large size. To circumvent this obstacle and identify genes involved in cold acclimation and associated stresses, a large scale EST sequencing approach was undertaken by the Functional Genomics of Abiotic Stress (FGAS) project. Results We generated 73,521 quality-filtered ESTs from eleven cDNA libraries constructed from wheat plants exposed to various abiotic stresses and at different developmental stages. In addition, 196,041 ESTs for which tracefiles were available from the National Science Foundation wheat EST sequencing program and DuPont were also quality-filtered and used in the analysis. Clustering of the combined ESTs with d2_cluster and TGICL yielded a few large clusters containing several thousand ESTs that were refractory to routine clustering techniques. To resolve this problem, the sequence proximity and "bridges" were identified by an e-value distance graph to manually break clusters into smaller groups. Assembly of the resolved ESTs generated a 75,488 unique sequence set (31,580 contigs and 43,908 singletons/singlets). Digital expression analyses indicated that the FGAS dataset is enriched in stress-regulated genes compared to the other public datasets. Over 43% of the unique sequence set was annotated and classified into functional categories according to Gene Ontology. Conclusion We have annotated 29,556 different sequences, an almost 5-fold increase in annotated sequences compared to the available wheat public databases. Digital expression analysis combined with gene annotation helped in the identification of several pathways associated with abiotic stress. The genomic resources and knowledge developed by this project will contribute to a better understanding of the different mechanisms that govern stress tolerance in wheat and other cereals. PMID:16772040
76 FR 20542 - Escherichia coli
Federal Register 2010, 2011, 2012, 2013, 2014
2011-04-13
... Escherichia coli O157:H7, sequence negative for shiga toxins I and II, and grown on atoxigenic host bacteria... host bacteria. The temporary tolerance exemption expires on April 1, 2013. [[Page 20543
Mishra, Manoj K.; Chaturvedi, Pankaj; Singh, Ruchi; Singh, Gaurav; Sharma, Lokendra K.; Pandey, Vibha; Kumari, Nishi; Misra, Pratibha
2013-01-01
Background Sterol glycosyltrnasferases (SGT) are enzymes that glycosylate sterols which play important role in plant adaptation to stress and are medicinally important in plants like Withania somnifera. The present study aims to find the role of WsSGTL1 which is a sterol glycosyltransferase from W. somnifera, in plant’s adaptation to abiotic stress. Methodology The WsSGTL1 gene was transformed in Arabidopsis thaliana through Agrobacterium mediated transformation, using the binary vector pBI121, by floral dip method. The phenotypic and physiological parameters like germination, root length, shoot weight, relative electrolyte conductivity, MDA content, SOD levels, relative electrolyte leakage and chlorophyll measurements were compared between transgenic and wild type Arabidopsis plants under different abiotic stresses - salt, heat and cold. Biochemical analysis was done by HPLC-TLC and radiolabelled enzyme assay. The promoter of the WsSGTL1 gene was cloned by using Genome Walker kit (Clontech, USA) and the 3D structures were predicted by using Discovery Studio Ver. 2.5. Results The WsSGTL1 transgenic plants were confirmed to be single copy by Southern and homozygous by segregation analysis. As compared to WT, the transgenic plants showed better germination, salt tolerance, heat and cold tolerance. The level of the transgene WsSGTL1 was elevated in heat, cold and salt stress along with other marker genes such as HSP70, HSP90, RD29, SOS3 and LEA4-5. Biochemical analysis showed the formation of sterol glycosides and increase in enzyme activity. When the promoter of WsSGTL1 gene was cloned from W. somnifera and sequenced, it contained stress responsive elements. Bioinformatics analysis of the 3D structure of the WsSGTL1 protein showed functional similarity with sterol glycosyltransferase AtSGT of A. thaliana. Conclusions Transformation of WsSGTL1 gene in A. thaliana conferred abiotic stress tolerance. The promoter of the gene in W.somnifera was found to have stress responsive elements. The 3D structure showed functional similarity with sterol glycosyltransferases. PMID:23646175
Rong, Liping; Li, Qianzhong; Li, Shushun; Tang, Ling; Wen, Jing
2016-04-01
Maple (Acer palmatum) is an important species for landscape planting worldwide. Salt stress affects the normal growth of the Maple leaf directly, leading to loss of esthetic value. However, the limited availability of Maple genomic information has hindered research on the mechanisms underlying this tolerance. In this study, we performed comprehensive analyses of the salt tolerance in two genotypes of Maple using RNA-seq. Approximately 146.4 million paired-end reads, representing 181,769 unigenes, were obtained. The N50 length of the unigenes was 738 bp, and their total length over 102.66 Mb. 14,090 simple sequence repeats and over 500,000 single nucleotide polymorphisms were identified, which represent useful resources for marker development. Importantly, 181,769 genes were detected in at least one library, and 303 differentially expressed genes (DEGs) were identified between salt-sensitive and salt-tolerant genotypes. Among these DEGs, 125 were upregulated and 178 were downregulated genes. Two MYB-related proteins and one LEA protein were detected among the first 10 most downregulated genes. Moreover, a methyltransferase-related gene was detected among the first 10 most upregulated genes. The three most significantly enriched pathways were plant hormone signal transduction, arginine and proline metabolism, and photosynthesis. The transcriptome analysis provided a rich genetic resource for gene discovery related to salt tolerance in Maple, and in closely related species. The data will serve as an important public information platform to further our understanding of the molecular mechanisms involved in salt tolerance in Maple.
Singh, Jogendra; Singh, Vijayata; Sharma, P C
2018-05-01
The growth of chickpea ( Cicer arietinum L.) is extremely hampered by salt stress. Understanding of physio-biochemical and molecular attributes along with morphological traits contributing to the salinity tolerance is important for developing salt tolerant chickpea varieties. To explore these facts, two genotypes CSG8962 and HC5 with contrasting salt tolerance were evaluated in the salinity stress (Control and 120 mM NaCl) conditions. CSG8962 maintained lower Na/K ratio in root and shoot, trammeled Na translocation to the shoots from roots compared to HC5 which ascribed to better exclusion of salt from its roots and compartmentation in the shoot. In chickpea, salt stress specifically induced genes/sequences involved at several levels in the salt stress signaling pathway. Higher induction of trehalose 6 phosphate synthase and protein kinase genes pertaining to the osmotic and signaling modules, respectively, were evident in CSG8962 compared to HC5. Further transcripts of late embryogenesis abundant, non-specific lipid transfer protein, HI and 219 genes/sequences were also highly induced in CSG8962 compared to HC5 which emphasizes the better protection of cellular membranous network and membrane-bound macromolecules under salt stress. This further suppressed the stress enhanced electrolyte leakage, loss of turgidity, promoted the higher compatible solute accumulation and maintained better cellular ion homoeostasis in CSG8962 compared to HC5. Our study further adds to the importance of these genes in salt tolerance by comparing their behavior in contrasting chickpea genotypes.
Examining the specific dimensions of distress tolerance that prospectively predict perceived stress.
Bardeen, Joseph R; Fergus, Thomas A; Orcutt, Holly K
2017-04-01
We examined five dimensions of distress tolerance (i.e. uncertainty, ambiguity, frustration, negative emotion, physical discomfort) as prospective predictors of perceived stress. Undergraduate students (N = 135) completed self-report questionnaires over the course of two assessment sessions (T1 and T2). Results of a linear regression in which the five dimensions of distress tolerance and covariates (i.e. T1 perceived stress, duration between T1 and T2) served as predictor variables and T2 perceived stress served as the outcome variable showed that intolerance of uncertainty was the only dimension of distress tolerance to predict T2 perceived stress. To better understand this prospective association, we conducted a post hoc analysis simultaneously regressing two subdimensions of intolerance of uncertainty on T2 perceived stress. The subdimension representing beliefs that "uncertainty has negative behavioral and self-referent implications" significantly predicted T2 perceived stress, while the subdimension indicating that "uncertainty is unfair and spoils everything" did not. Results support a growing body of research suggesting intolerance of uncertainty as a risk factor for a wide variety of maladaptive psychological outcomes. Clinical implications will be discussed.
Prediction of pain in orthodontic patients based on preoperative pain assessment
Zheng, Baoyu; Ren, Manman; Lin, Feiou; Yao, Linjie
2016-01-01
Aim To investigate whether pretreatment assessment of experimental pain can predict the level of pain after archwire placement. Methods One hundred and twenty-one general university students seeking orthodontic treatment were enrolled in this study. A cold pressor test was performed to estimate the pain tolerance of subjects before treatment. Self-reported pain intensity was calculated using a 10 cm visual analog scale during the 7 days after treatment. The relationship between pain tolerance and orthodontic pain was analyzed using Spearman’s correlation analysis. Results The maximum mean level of pain intensity occurred at 24 hours after bonding (53.31±16.13) and fell to normal levels at day 7. Spearman’s correlation analysis found a moderate positive association between preoperative pain tolerance and self-reported pain after archwire placement (P<0.01). There was no significant difference in pain intensity between male and female patients at any time point (P>0.05). Conclusion A simple and noninvasive preoperative sensory test (the cold pressor test) was useful in predicting the risk of developing unbearable pain in patients after archwire placement. Self-reported pain after archwire placement decreased as individual pain tolerance increased. PMID:27042019
A Novel Approach to Rotorcraft Damage Tolerance
NASA Technical Reports Server (NTRS)
Forth, Scott C.; Everett, Richard A.; Newman, John A.
2002-01-01
Damage-tolerance methodology is positioned to replace safe-life methodologies for designing rotorcraft structures. The argument for implementing a damage-tolerance method comes from the fundamental fact that rotorcraft structures typically fail by fatigue cracking. Therefore, if technology permits prediction of fatigue-crack growth in structures, a damage-tolerance method should deliver the most accurate prediction of component life. Implementing damage-tolerance (DT) into high-cycle-fatigue (HCF) components will require a shift from traditional DT methods that rely on detecting an initial flaw with nondestructive inspection (NDI) methods. The rapid accumulation of cycles in a HCF component will result in a design based on a traditional DT method that is either impractical because of frequent inspections, or because the design will be too heavy to operate efficiently. Furthermore, once a HCF component develops a detectable propagating crack, the remaining fatigue life is short, sometimes less than one flight hour, which does not leave sufficient time for inspection. Therefore, designing a HCF component will require basing the life analysis on an initial flaw that is undetectable with current NDI technology.
Seal, B S; Neill, J D; Ridpath, J F
1994-07-01
Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.
Das, Priyanka; Maharana, Jitendra; Paria, Prasenjit; Mandal, Shambhu Nath; Meena, Dharmendra Kumar; Sharma, Anil Prakash; Jayarajan, Rijith; Dixit, Vishal; Verma, Ankit; Vellarikkal, Shamsudheen Karuthedath; Scaria, Vinod; Sivasubbu, Sridhar; Rao, Atmakuri Ramakrishna; Mohapatra, Trilochan
2015-01-01
Halomonas salina strain CIFRI1 is an extremely salt-stress-tolerant bacterium isolated from the salt crystals of the east coast of India. Here we report the annotated 3.45-Mb draft genome sequence of strain CIFRI1 having 86 contigs with 3,139 protein coding loci, including 62 RNA genes. PMID:25573926
Hyson, Peter; Shapiro, Joshua A; Wien, Michelle W
2015-10-08
Exiguobacterium sp. strain BMC-KP was isolated as part of a student environmental sampling project at Bryn Mawr College, PA. Sequencing of bacterial DNA assembled a 3.32-Mb draft genome. Analysis suggests the presence of genes for tolerance to cold and toxic metals, broad carbohydrate metabolism, and genes derived from phage. Copyright © 2015 Hyson et al.
2010-01-01
Background Some organisms can survive extreme desiccation by entering a state of suspended animation known as anhydrobiosis. The free-living mycophagous nematode Aphelenchus avenae can be induced to enter anhydrobiosis by pre-exposure to moderate reductions in relative humidity (RH) prior to extreme desiccation. This preconditioning phase is thought to allow modification of the transcriptome by activation of genes required for desiccation tolerance. Results To identify such genes, a panel of expressed sequence tags (ESTs) enriched for sequences upregulated in A. avenae during preconditioning was created. A subset of 30 genes with significant matches in databases, together with a number of apparently novel sequences, were chosen for further study. Several of the recognisable genes are associated with water stress, encoding, for example, two new hydrophilic proteins related to the late embryogenesis abundant (LEA) protein family. Expression studies confirmed EST panel members to be upregulated by evaporative water loss, and the majority of genes was also induced by osmotic stress and cold, but rather fewer by heat. We attempted to use RNA interference (RNAi) to demonstrate the importance of this gene set for anhydrobiosis, but found A. avenae to be recalcitrant with the techniques used. Instead, therefore, we developed a cross-species RNAi procedure using A. avenae sequences in another anhydrobiotic nematode, Panagrolaimus superbus, which is amenable to gene silencing. Of 20 A. avenae ESTs screened, a significant reduction in survival of desiccation in treated P. superbus populations was observed with two sequences, one of which was novel, while the other encoded a glutathione peroxidase. To confirm a role for glutathione peroxidases in anhydrobiosis, RNAi with cognate sequences from P. superbus was performed and was also shown to reduce desiccation tolerance in this species. Conclusions This study has identified and characterised the expression profiles of members of the anhydrobiotic gene set in A. avenae. It also demonstrates the potential of RNAi for the analysis of anhydrobiosis and provides the first genetic data to underline the importance of effective antioxidant systems in metazoan desiccation tolerance. PMID:20085654
Song, Jiangning; Burrage, Kevin; Yuan, Zheng; Huber, Thomas
2006-03-09
The majority of peptide bonds in proteins are found to occur in the trans conformation. However, for proline residues, a considerable fraction of Prolyl peptide bonds adopt the cis form. Proline cis/trans isomerization is known to play a critical role in protein folding, splicing, cell signaling and transmembrane active transport. Accurate prediction of proline cis/trans isomerization in proteins would have many important applications towards the understanding of protein structure and function. In this paper, we propose a new approach to predict the proline cis/trans isomerization in proteins using support vector machine (SVM). The preliminary results indicated that using Radial Basis Function (RBF) kernels could lead to better prediction performance than that of polynomial and linear kernel functions. We used single sequence information of different local window sizes, amino acid compositions of different local sequences, multiple sequence alignment obtained from PSI-BLAST and the secondary structure information predicted by PSIPRED. We explored these different sequence encoding schemes in order to investigate their effects on the prediction performance. The training and testing of this approach was performed on a newly enlarged dataset of 2424 non-homologous proteins determined by X-Ray diffraction method using 5-fold cross-validation. Selecting the window size 11 provided the best performance for determining the proline cis/trans isomerization based on the single amino acid sequence. It was found that using multiple sequence alignments in the form of PSI-BLAST profiles could significantly improve the prediction performance, the prediction accuracy increased from 62.8% with single sequence to 69.8% and Matthews Correlation Coefficient (MCC) improved from 0.26 with single local sequence to 0.40. Furthermore, if coupled with the predicted secondary structure information by PSIPRED, our method yielded a prediction accuracy of 71.5% and MCC of 0.43, 9% and 0.17 higher than the accuracy achieved based on the singe sequence information, respectively. A new method has been developed to predict the proline cis/trans isomerization in proteins based on support vector machine, which used the single amino acid sequence with different local window sizes, the amino acid compositions of local sequence flanking centered proline residues, the position-specific scoring matrices (PSSMs) extracted by PSI-BLAST and the predicted secondary structures generated by PSIPRED. The successful application of SVM approach in this study reinforced that SVM is a powerful tool in predicting proline cis/trans isomerization in proteins and biological sequence analysis.
McDermott, Jason E.; Bruillard, Paul; Overall, Christopher C.; ...
2015-03-09
There are many examples of groups of proteins that have similar function, but the determinants of functional specificity may be hidden by lack of sequencesimilarity, or by large groups of similar sequences with different functions. Transporters are one such protein group in that the general function, transport, can be easily inferred from the sequence, but the substrate specificity can be impossible to predict from sequence with current methods. In this paper we describe a linguistic-based approach to identify functional patterns from groups of unaligned protein sequences and its application to predict multi-drug resistance transporters (MDRs) from bacteria. We first showmore » that our method can recreate known patterns from PROSITE for several motifs from unaligned sequences. We then show that the method, MDRpred, can predict MDRs with greater accuracy and positive predictive value than a collection of currently available family-based models from the Pfam database. Finally, we apply MDRpred to a large collection of protein sequences from an environmental microbiome study to make novel predictions about drug resistance in a potential environmental reservoir.« less
2013-03-01
amounts of time and effort to implement. Future testing with commercial, fault-tolerant synthesis software, under a radiation environment, will yield ...initial viewpoint of the author is to take the flash-based FPGA route. This will yield a simple, reconfigurable circuit while providing the added...structure seen in Figure 30. Each of these full adder blocks were replaced in subsequent iterations to yield proper comparison with this baseline
Ali, Ather; Ma, Yingying; Reynolds, Jesse; Wise, John Pierce; Inzucchi, Silvio E; Katz, David L
2011-01-01
To investigate the effects of daily chromium picolinate supplementation on serum measures of glucose tolerance and insulin sensitivity in patients at high risk for type 2 diabetes mellitus. We conducted a randomized, double-blind, placebo-controlled, modified cross-over clinical trial with 6-month sequences of intervention and placebo followed by a 6-month postintervention assessment. Adult patients with impaired fasting glucose, impaired glucose tolerance, or metabolic syndrome were enrolled. Participants received 6-month sequences of chromium picolinate or placebo at 1 of 2 dosages (500 or 1000 mcg daily). Primary outcome measures were change in fasting plasma glucose, 2-hour plasma glucose during oral glucose tolerance testing, fasting and 2-hour insulin, and homeostasis model assessment of insulin resistance (HOMA-IR). Secondary outcomes included anthropometric measures, blood pressure, endothelial function, hemoglobin A1c, lipids, and urinary microalbumin. Fifty-nine participants were enrolled. No changes were seen in glucose level, insulin level, or HOMA-IR (all P>.05) after 6 months of chromium at either dosage level (500 mcg or 1000 mcg daily) when compared with placebo. None of the secondary outcomes improved with either chromium dosage compared with placebo (P>.05). Chromium supplementation does not appear to ameliorate insulin resistance or impaired glucose metabolism in patients at risk for type 2 diabetes and thus is unlikely to attenuate diabetes risk.
Harbige, James; Eichmann, Martin; Peakman, Mark
2017-11-01
The mechanism by which immune tolerance is breached in autoimmune disease is poorly understood. One possibility is that post-translational modification of self-antigens leads to peripheral recognition of neo-epitopes against which central and peripheral tolerance is inadequate. Accumulating evidence points to multiple mechanisms through which non-germline encoded sequences can give rise to these non-conventional epitopes which in turn engage the immune system as T cell targets. In particular, where these modifications alter the rules of epitope engagement with MHC molecules, such non-conventional epitopes offer a persuasive explanation for associations between specific HLA alleles and autoimmune diseases. In this review article, we discuss current understanding of mechanisms through which non-conventional epitopes may be generated, focusing on several recently described pathways that can transpose germline-encoded sequences. We contextualise these discoveries around type 1 diabetes, the prototypic organ-specific autoimmune disease in which specific HLA-DQ molecules confer high risk. Non-conventional epitopes have the potential to act as tolerance breakers or disease drivers in type 1 diabetes, prompting a timely re-evaluation of models of a etiopathogenesis. Future studies are required to elucidate the disease-relevance of a range of potential non-germline epitopes and their relationship to the natural peptide repertoire. Copyright © 2017 Elsevier Ltd. All rights reserved.
Recchia, Gustavo Henrique; Caldas, Danielle Gregorio Gomes; Beraldo, Ana Luiza Ahern; da Silva, Márcio José; Tsai, Siu Mui
2013-01-01
In Brazil, common bean (Phaseolus vulgaris L.) productivity is severely affected by drought stress due to low technology cultivation systems. Our purpose was to identify differentially expressed genes in roots of a genotype tolerant to water deficit (BAT 477) when submitted to an interruption of irrigation during its development. A SSH library was constructed taking as “driver” the genotype Carioca 80SH (susceptible to drought). After clustering and data mining, 1572 valid reads were obtained, resulting in 1120 ESTs (expressed sequence tags). We found sequences for transcription factors, carbohydrates metabolism, proline-rich proteins, aquaporins, chaperones and ubiquitins, all of them organized according to their biological processes. Our suppressive subtractive hybridization (SSH) library was validated through RT-qPCR experiment by assessing the expression patterns of 10 selected genes in both genotypes under stressed and control conditions. Finally, the expression patterns of 31 ESTs, putatively related to drought responses, were analyzed in a time-course experiment. Our results confirmed that such genes are more expressed in the tolerant genotype during stress; however, they are not exclusive, since different levels of these transcripts were also detected in the susceptible genotype. In addition, we observed a fluctuation in gene regulation over time for both the genotypes, which seem to adopt and adapt different strategies in order to develop tolerance against this stress. PMID:23538843
microRNAs Associated with Drought Response in the Bioenergy Crop Sugarcane (Saccharum spp.)
Vilela, Romel Duarte; Costa, Gustavo Gilson Lacerda; Dias, Lara Isys; Endres, Laurício; Menossi, Marcelo
2012-01-01
Sugarcane (Saccharum spp.) is one of the most important crops in the world. Drought stress is a major abiotic stress factor that significantly reduces sugarcane yields. However the gene network that mediates plant responses to water stress remains largely unknown in several crop species. Although several microRNAs that mediate post-transcriptional regulation during water stress have been described in other species, the role of the sugarcane microRNAs during drought stress has not been studied. The objective of this work was to identify sugarcane miRNAs that are differentially expressed under drought stress and to correlate this expression with the behavior of two sugarcane cultivars with different drought tolerances. The sugarcane cultivars RB867515 (higher drought tolerance) and RB855536 (lower drought tolerance) were cultivated in a greenhouse for three months and then subjected to drought for 2, 4, 6 or 8 days. By deep sequencing of small RNAs, we were able to identify 18 miRNA families. Among all of the miRNAs thus identified, seven were differentially expressed during drought. Six of these miRNAs were differentially expressed at two days of stress, and five miRNAs were differentially expressed at four days. The expression levels of five miRNAs (ssp-miR164, ssp-miR394, ssp-miR397, ssp-miR399-seq 1 and miR528) were validated by RT-qPCR (quantitative reverse transcriptase PCR). Six precursors and the targets of the differentially expressed miRNA were predicted using an in silico approach and validated by RT-qPCR; many of these targets may play important roles in drought tolerance. These findings constitute a significant increase in the number of identified miRNAs in sugarcane and contribute to the elucidation of the complex regulatory network that is activated by drought stress. PMID:23071617
Yadav, Amita; Khan, Yusuf; Prasad, Manoj
2016-03-01
A set of novel and known dehydration-responsive miRNAs have been identified in foxtail millet. These findings provide new insights into understanding the functional role of miRNAs and their respective targets in regulating plant response to dehydration stress. MicroRNAs perform significant regulatory roles in growth, development and stress response of plants. Though the miRNA-mediated gene regulatory networks under dehydration stress remain largely unexplored in plant including foxtail millet (Setaria italica), which is a natural abiotic stress tolerant crop. To find out the dehydration-responsive miRNAs at the global level, four small RNA libraries were constructed from control and dehydration stress treated seedlings of two foxtail millet cultivars showing contrasting tolerance behavior towards dehydration stress. Using Illumina sequencing technology, 55 known and 136 novel miRNAs were identified, representing 22 and 48 miRNA families, respectively. Eighteen known and 33 novel miRNAs were differentially expressed during dehydration stress. After the stress treatment, 32 dehydration-responsive miRNAs were up-regulated in tolerant cultivar and 22 miRNAs were down-regulated in sensitive cultivar, suggesting that miRNA-mediated molecular regulation might play important roles in providing contrasting characteristics to these cultivars. Predicted targets of identified miRNAs were found to encode various transcription factors and functional enzymes, indicating their involvement in broad spectrum regulatory functions and biological processes. Further, differential expression patterns of seven known miRNAs were validated by northern blot and expression of ten novel dehydration-responsive miRNAs were confirmed by SL-qRT PCR. Differential expression behavior of five miRNA-target genes was verified under dehydration stress treatment and two of them also validated by RLM RACE. Overall, the present study highlights the importance of dehydration stress-associated post-transcriptional regulation governed by miRNAs and their targets in a naturally stress-tolerant model crop.
Gene and translation initiation site prediction in metagenomic sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John
2012-01-01
Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translationmore » initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.« less
Gene Unprediction with Spurio: A tool to identify spurious protein sequences.
Höps, Wolfram; Jeffryes, Matt; Bateman, Alex
2018-01-01
We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation. Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases. We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes. Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.
Competitive ability, stress tolerance and plant interactions along stress gradients.
Qi, Man; Sun, Tao; Xue, SuFeng; Yang, Wei; Shao, DongDong; Martínez-López, Javier
2018-04-01
Exceptions to the generality of the stress-gradient hypothesis (SGH) may be reconciled by considering species-specific traits and stress tolerance strategies. Studies have tested stress tolerance and competitive ability in mediating interaction outcomes, but few have incorporated this to predict how species interactions shift between competition and facilitation along stress gradients. We used field surveys, salt tolerance and competition experiments to develop a predictive model interspecific interaction shifts across salinity stress gradients. Field survey and greenhouse tolerance tests revealed tradeoffs between stress tolerance and competitive ability. Modeling showed that along salinity gradients, (1) plant interactions shifted from competition to facilitation at high salinities within the physiological limits of salt-intolerant plants, (2) facilitation collapsed when salinity stress exceeded the physiological tolerance of salt-intolerant plants, and (3) neighbor removal experiments overestimate interspecific facilitation by including intraspecific effects. A community-level field experiment, suggested that (1) species interactions are competitive in benign and, facilitative in harsh condition, but fuzzy under medium environmental stress due to niche differences of species and weak stress amelioration, and (2) the SGH works on strong but not weak stress gradients, so SGH confusion arises when it is applied across questionable stress gradients. Our study clarifies how species interactions vary along stress gradients. Moving forward, focusing on SGH applications rather than exceptions on weak or nonexistent gradients would be most productive. © 2018 by the Ecological Society of America.
Yin, Changchuan
2015-04-01
To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.
Nguyen, Trang Quynh; Blum, Robert W
2014-12-01
Disapproval of homosexuality is the cause of tremendous suffering among sexual minorities. No research has examined determinants of Vietnamese attitudes toward homosexuality. This article examined predictors of such attitudes among Vietnamese youth. Data were from Vietnamese youth aged 15-24 years nationally surveyed in 2009 (Survey Assessment of Vietnamese Youth II). We evaluated structural equation models in which homosexuality tolerance was conceptualized to be influenced by two tiers of predictors: tier 1 (more proximal) including traditional sexual values and self-esteem and tier 2 (more distal) including demographic/contextual variables (urban residence, college education, Internet use, age, and marital status). Female (n = 3,135) and male (n = 3,072) data were analyzed separately. Sexual conservativeness predicted intolerance in both men and women; value of fidelity also predicted intolerance in women. Self-esteem was nonsignificant for women; for men, positive self-perception was nonsignificant, but negative self-perception predicted tolerance. College education, urban residence, and Internet use predicted tolerance, with gender differences. Findings about traditional sexual values, college education, urban residence, and the gender difference in whether self-esteem matters are consistent with the literature. The positive association of Internet use with tolerance was first theorized and tested in this study. The study informs discussions on practice, in terms of tailoring/targeting attitude change interventions to rural versus urban youth and male versus female youth, capitalizing on the Internet to promote respect of sexual diversity, and locating attitudes toward homosexuality within the broader approach to sexuality. Copyright © 2014 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Metabolite and transcript markers for the prediction of potato drought tolerance.
Sprenger, Heike; Erban, Alexander; Seddig, Sylvia; Rudack, Katharina; Thalhammer, Anja; Le, Mai Q; Walther, Dirk; Zuther, Ellen; Köhl, Karin I; Kopka, Joachim; Hincha, Dirk K
2018-04-01
Potato (Solanum tuberosum L.) is one of the most important food crops worldwide. Current potato varieties are highly susceptible to drought stress. In view of global climate change, selection of cultivars with improved drought tolerance and high yield potential is of paramount importance. Drought tolerance breeding of potato is currently based on direct selection according to yield and phenotypic traits and requires multiple trials under drought conditions. Marker-assisted selection (MAS) is cheaper, faster and reduces classification errors caused by noncontrolled environmental effects. We analysed 31 potato cultivars grown under optimal and reduced water supply in six independent field trials. Drought tolerance was determined as tuber starch yield. Leaf samples from young plants were screened for preselected transcript and nontargeted metabolite abundance using qRT-PCR and GC-MS profiling, respectively. Transcript marker candidates were selected from a published RNA-Seq data set. A Random Forest machine learning approach extracted metabolite and transcript markers for drought tolerance prediction with low error rates of 6% and 9%, respectively. Moreover, by combining transcript and metabolite markers, the prediction error was reduced to 4.3%. Feature selection from Random Forest models allowed model minimization, yielding a minimal combination of only 20 metabolite and transcript markers that were successfully tested for their reproducibility in 16 independent agronomic field trials. We demonstrate that a minimum combination of transcript and metabolite markers sampled at early cultivation stages predicts potato yield stability under drought largely independent of seasonal and regional agronomic conditions. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Cui, Yimin; Song, Yan; Wang, Jessie; Yu, Zhigang; Schuster, Alan; Barrett, Yu Chen; Frost, Charles
2013-01-01
Background The pharmacokinetics (PK), pharmacodynamics (PD), and safety of apixaban were assessed in healthy Chinese subjects in this randomized, placebo-controlled, double-blind, single-sequence, single- and multiple-dose study. Subjects and methods Eighteen subjects 18–45 years of age were randomly assigned (2:1 ratio) to receive apixaban or matched placebo. Subjects received a single 10 mg dose of apixaban or placebo on day 1, followed by 10 mg apixaban or placebo twice daily for 6 days (days 4–9). The PK and PD of apixaban were assessed by collecting plasma samples for 72 hours following the dose on day 1 and the morning dose on day 9, and measuring apixaban concentration and anti-Xa activity. Safety was assessed via physical examinations, vital sign measurements, electrocardiograms, and clinical laboratory evaluations. Results PK analysis showed similar characteristics of apixaban after single and multiple doses, including a median time to maximum concentration of ~3 hours, mean elimination half-life of ~11 hours, and renal clearance of ~1.2 L/hour. The accumulation index was 1.7, consistent with twice-daily dosing and the observed elimination half-life. Single-dose data predict multiple-dose PK, therefore apixaban PK are time-independent. The relationship between anti-Xa activity and plasma apixaban concentrations appears to be linear. Apixaban was safe and well tolerated, with no bleeding-related adverse events reported. Conclusion Apixaban was safe and well tolerated in healthy Chinese subjects. Apixaban PK and PD were predictable and consistent with findings from previous studies in Asian and non-Asian subjects. The administration of apixaban does not require any dose modification based on race. PMID:24353445
Wang, Hualei; Sun, Huihui; Wei, Dongzhi
2013-02-18
A nitrilase-mediated pathway has significant advantages in the production of optically pure (R)-(-)-mandelic acid. However, unwanted byproduct, low enantioselectivity, and specific activity reduce its value in practical applications. An ideal nitrilase that can efficiently hydrolyze mandelonitrile to optically pure (R)-(-)-mandelic acid without the unwanted byproduct is needed. A novel nitrilase (BCJ2315) was discovered from Burkholderia cenocepacia J2315 through phylogeny-based enzymatic substrate specificity prediction (PESSP). This nitrilase is a mandelonitrile hydrolase that could efficiently hydrolyze mandelonitrile to (R)-(-)-mandelic acid, with a high enantiomeric excess of 98.4%. No byproduct was observed in this hydrolysis process. BCJ2315 showed the highest identity of 71% compared with other nitrilases in the amino acid sequence. BCJ2315 possessed the highest activity toward mandelonitrile and took mandelonitrile as the optimal substrate based on the analysis of substrate specificity. The kinetic parameters Vmax, Km, Kcat, and Kcat/Km toward mandelonitrile were 45.4 μmol/min/mg, 0.14 mM, 15.4 s(-1), and 1.1×10(5) M(-1)s(-1), respectively. The recombinant Escherichia coli M15/BCJ2315 had a strong substrate tolerance and could completely hydrolyze mandelonitrile (100 mM) with fewer amounts of wet cells (10 mg/ml) within 1 h. PESSP is an efficient method for discovering an ideal mandelonitrile hydrolase. BCJ2315 has high affinity and catalytic efficiency toward mandelonitrile. This nitrilase has great advantages in the production of optically pure (R)-(-)-mandelic acid because of its high activity and enantioselectivity, strong substrate tolerance, and having no unwanted byproduct. Thus, BCJ2315 has great potential in the practical production of optically pure (R)-(-)-mandelic acid in the industry.
Molecular Determinants of Mutant Phenotypes, Inferred from Saturation Mutagenesis Data.
Tripathi, Arti; Gupta, Kritika; Khare, Shruti; Jain, Pankaj C; Patel, Siddharth; Kumar, Prasanth; Pulianmackal, Ajai J; Aghera, Nilesh; Varadarajan, Raghavan
2016-11-01
Understanding how mutations affect protein activity and organismal fitness is a major challenge. We used saturation mutagenesis combined with deep sequencing to determine mutational sensitivity scores for 1,664 single-site mutants of the 101 residue Escherichia coli cytotoxin, CcdB at seven different expression levels. Active-site residues could be distinguished from buried ones, based on their differential tolerance to aliphatic and charged amino acid substitutions. At nonactive-site positions, the average mutational tolerance correlated better with depth from the protein surface than with accessibility. Remarkably, similar results were observed for two other small proteins, PDZ domain (PSD95 pdz3 ) and IgG-binding domain of protein G (GB1). Mutational sensitivity data obtained with CcdB were used to derive a procedure for predicting functional effects of mutations. Results compared favorably with those of two widely used computational predictors. In vitro characterization of 80 single, nonactive-site mutants of CcdB showed that activity in vivo correlates moderately with thermal stability and solubility. The inability to refold reversibly, as well as a decreased folding rate in vitro, is associated with decreased activity in vivo. Upon probing the effect of modulating expression of various proteases and chaperones on mutant phenotypes, most deleterious mutants showed an increased in vivo activity and solubility only upon over-expression of either Trigger factor or SecB ATP-independent chaperones. Collectively, these data suggest that folding kinetics rather than protein stability is the primary determinant of activity in vivo This study enhances our understanding of how mutations affect phenotype, as well as the ability to predict fitness effects of point mutations. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
NASA Astrophysics Data System (ADS)
Mittal, Shikha; Mallikarjuna, Mallana Gowdra; Rao, Atmakuri R.; Jain, Prashant A.; Dash, Prasanta K.; Thirunavukkarasu, Nepolean
2017-12-01
Calcium dependent protein kinases (CDPKs) play major role in regulation of plant growth and development in response to various stresses including drought. A set of 32 CDPK genes identified in maize were further used for searching of orthologs in the model plant Arabidopsis (72) and major food crops such as rice (78) and sorghum (91). We comprehensively investigated the phylogenetic relationship, annotations, gene duplications, gene structure, divergence time, 3-D protein structures and tissue-specific drought induced expression of CDPK genes in all four species. Variation in intron frequency among these species likely contributed to the functional diversity of CDPK genes to various stress responses. Protein kinase and protein kinase C phosphorylation site domains were the most conserved motifs identified in all species. Four groups were identified from the sequence-based phylogenetic analysis, in which maize CDPKs were clustered in group III. The time of divergence (Ka/Ks) analysis revealed that the CDPKs were evolved through stabilizing selection. Expression data showed that the CDPK genes were highly expressed in leaf of maize, rice, and sorghum whereas in Arabidopsis the maximum expression was observed in root. 3-D protein structure were predicted for the nine genes (Arabidopsis: 2, maize: 2, rice: 3 and sorghum: 2) showing differential expression in at least three species. The predicted 3-D structures were further evaluated and validated by Ramachandran plot, ANOLEA, ProSA and Verify-3D. The superimposed 3-D structure of drought-related orthologous proteins retained similar folding pattern owing to their conserved nature. Functional annotation revealed the involvement of CDPK genes in various pathways such as osmotic homeostasis, cell protection and root growth. The interactions of CDPK genes in various pathways play crucial role in imparting drought tolerance through different ABA and MAPK signalling cascades. Our studies suggest that these selected candidate genes could be targeted in development of drought tolerant cultivars in maize, rice and sorghum through appropriate breeding approaches. Our comparative experiments of CDPK genes could also be extended in the drought stress breeding programmes of the related species.
Satheesh, Viswanathan; Jagannadham, P Tej Kumar; Chidambaranathan, Parameswaran; Jain, P K; Srinivasan, R
2014-12-01
The NAC (NAM, ATAF and CUC) proteins are plant-specific transcription factors implicated in development and stress responses. In the present study 88 pigeonpea NAC genes were identified from the recently published draft genome of pigeonpea by using homology based and de novo prediction programmes. These sequences were further subjected to phylogenetic, motif and promoter analyses. In motif analysis, highly conserved motifs were identified in the NAC domain and also in the C-terminal region of the NAC proteins. A phylogenetic reconstruction using pigeonpea, Arabidopsis and soybean NAC genes revealed 33 putative stress-responsive pigeonpea NAC genes. Several stress-responsive cis-elements were identified through in silico analysis of the promoters of these putative stress-responsive genes. This analysis is the first report of NAC gene family in pigeonpea and will be useful for the identification and selection of candidate genes associated with stress tolerance.
Structural modeling for multicell composite rotor blades
NASA Technical Reports Server (NTRS)
Rehfield, Lawrence W.; Atilgan, Ali R.
1987-01-01
Composite material systems are currently good candidates for aerospace structures, primarily for the design flexibility they offer, i.e., it is possible to tailor the material and manufacturing approach to the application. A working definition of elastic or structural tailoring is the use of structural concept, fiber orientation, ply stacking sequence, and a blend of materials to achieve specific performance goals. In the design process, choices of materials and dimensions are made which produce specific response characteristics, and which permit the selected goals to be achieved. Common choices for tailoring goals are preventing instabilities or vibration resonances or enhancing damage tolerance. An essential, enabling factor in the design of tailored composite structures is structural modeling that accurately, but simply, characterizes response. The objective of this paper is to present a new multicell beam model for composite rotor blades and to validate predictions based on the new model by comparison with a finite element simulation in three benchmark static load cases.
Sedlar, Karel; Kolek, Jan; Skutkova, Helena; Branska, Barbora; Provaznik, Ivo; Patakova, Petra
2015-11-20
The strain Clostridium pasteurianum NRRL B-598 is non-type, oxygen tolerant, spore-forming, mesophilic and heterofermentative strain with high hydrogen production and ability of acetone-butanol fermentation (ethanol production being negligible). Here, we present the annotated complete genome sequence of this bacterium, replacing the previous draft genome assembly. The genome consisting of a single circular 6,186,879 bp chromosome with no plasmid was determined using PacBio RSII and Roche 454 sequencing. Copyright © 2015 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Tao; Datta, Supratim; Simmons, Blake A.
The present invention provides for an isolated or recombinant polypeptide comprising an amino acid sequence having at least 70% identity with the amino acid sequence of a Halorhabdus utahensis cellulase, such as Hu-CBH1, wherein said amino acid sequence has a halophilic thermostable and/or thermophilic cellobiohydrolase (CBH) activity. In some embodiments, the polypeptide has a CBH activity that is resistant to up to about 20% of ionic liquids. The present invention also provides for compositions comprising and methods using the isolated or recombinant polypeptide.
Lyons, Pierre J; Govaere, Louise; Crapoulet, Nicolas; Storey, Kenneth B; Morin, Pier Jr
2016-12-01
Significant physiological and biochemical changes are observed in freeze-tolerant insects when confronted with cold temperatures. These insects have adapted to winter by retreating into a hypometabolic state of diapause and implementing cryoprotective mechanisms that allow them to survive whole body freezing. MicroRNAs (miRNAs), a family of short ribonucleic acids, are emerging as likely molecular players underlying the process of cold adaptation. Unfortunately, the data is sparse concerning the signature of miRNAs that are modulated following cold exposure in the freeze-tolerant goldenrod gall fly Eurosta solidaginis. Leveraging for the first time a next-generation sequencing approach, differentially expressed miRNAs were evaluated in 5°C and -15°C-exposed E. solidaginis larvae. Next-generation sequencing expression data was subsequently validated by qRT-PCR for selected miRNA targets. Results demonstrate 24 differentially expressed freeze-responsive miRNAs. Notable, miR-1-3p, a miRNA modulated at low temperature in another cold-hardy insect, and miR-14-3p, a miRNA associated with stress response in the fruit fly, were shown to be significantly up-regulated in -15°C-exposed larvae. Overall, this work identifies, for the first time in a high-throughput manner, differentially expressed miRNAs in cold-exposed E. solidaginis larvae and further clarifies an emerging signature of miRNAs modulated at low temperatures in cold-hardy insects. Copyright © 2016 Elsevier Inc. All rights reserved.
Wheat CBF gene family: identification of polymorphisms in the CBF coding sequence.
Mohseni, Sara; Che, Hua; Djillali, Zakia; Dumont, Estelle; Nankeu, Joseph; Danyluk, Jean
2012-12-01
Expression of cold-regulated genes needed for protection against freezing stress is mediated, in part, by the CBF transcription factor family. Previous studies with temperate cereals suggested that the CBF gene family in wheat was large, and that CBF genes were at the base of an important low temperature tolerance trait. Therefore, the goal of our study was to identify the CBF repertoire in the freezing-tolerant hexaploid wheat cultivar Norstar, and then to examine if the coding region of CBF genes in two spring cultivars contain polymorphisms that could affect the protein sequence and structure. Our analyses reveal that hexaploid wheat contains a complex CBF family consisting of at least 65 CBF genes of which 60 are known to be expressed in the cultivar Norstar. They represent 27 paralogous genes with 1-3 homeologous copies for the A, B, and D genomes. The cultivar Norstar contains two pseudogenes and at least 24 additional proteins having sequences and (or) structures that deviate from the consensus in the conserved AP2 DNA-binding and (or) C-terminal activation-domains. This suggests that in cultivars such as Norstar, low temperature tolerance may be increased through breeding of additional optimal alleles. The examination of the CBF repertoire present in the two spring cultivars, Chinese Spring and Manitou, reveals that they have additional polymorphisms affecting conserved positions in these domains. Understanding the effects of these polymorphisms will provide additional information for the selection of optimum CBF alleles in Triticeae breeding programs.
Khaleque, Himel N; Corbett, Melissa K; Ramsay, Joshua P; Kaksonen, Anna H; Boxall, Naomi J; Watkin, Elizabeth L J
2017-11-20
Successful process development for the bioleaching of mineral ores, particularly the refractory copper sulfide ore chalcopyrite, remains a challenge in regions where freshwater is scarce and source water contains high concentrations of chloride ion. In this study, a pure isolate of Acidihalobacter prosperus strain F5 was characterized for its ability to leach base metals from sulfide ores (pyrite, chalcopyrite and pentlandite) at increasing chloride ion concentrations. F5 successfully released base metals from ores including pyrite and pentlandite at up to 30gL -1 chloride ion and chalcopyrite up to 18gL -1 chloride ion. In order to understand the genetic mechanisms of tolerance to high acid, saline and heavy metal stress the genome of F5 was sequenced and analysed. As well as being the first strain of Ac. prosperus to be isolated from Australia it is also the first complete genome of the Ac. prosperus species to be sequenced. The F5 genome contains genes involved in the biosynthesis of compatible solutes and genes encoding monovalent cation/proton antiporters and heavy metal transporters which could explain its abilities to tolerate high salinity, acidity and heavy metal stress. Genome analysis also confirmed the presence of genes involved in copper tolerance. The study demonstrates the potential biotechnological applicability of Ac. prosperus strain F5 for saline water bioleaching of mineral ores. Copyright © 2017 Elsevier B.V. All rights reserved.
Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) Version 3.0 User Guide
User Guide to describe the complete functionality of the Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) Version 3.0 online tool. The US Environmental Protection Agency Sequence Alignment to Predict Across Species Susceptibility tool (SeqAPASS; https://seqa...
Phylogenetic and expression analysis of the NPR1-like gene family from Persea americana (Mill.).
Backer, Robert; Mahomed, Waheed; Reeksting, Bianca J; Engelbrecht, Juanita; Ibarra-Laclette, Enrique; van den Berg, Noëlani
2015-01-01
The NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 (NPR1) forms an integral part of the salicylic acid (SA) pathway in plants and is involved in cross-talk between the SA and jasmonic acid/ethylene (JA/ET) pathways. Therefore, NPR1 is essential to the effective response of plants to pathogens. Avocado (Persea americana) is a commercially important crop worldwide. Significant losses in production result from Phytophthora root rot, caused by the hemibiotroph, Phytophthora cinnamomi. This oomycete infects the feeder roots of avocado trees leading to an overall decline in health and eventual death. The interaction between avocado and P. cinnamomi is poorly understood and as such limited control strategies exist. Thus uncovering the role of NPR1 in avocado could provide novel insights into the avocado - P. cinnamomi interaction. A total of five NPR1-like sequences were identified. These sequences were annotated using FGENESH and a maximum-likelihood tree was constructed using 34 NPR1-like protein sequences from other plant species. The conserved protein domains and functional motifs of these sequences were predicted. Reverse transcription quantitative PCR was used to analyze the expression of the five NPR1-like sequences in the roots of avocado after treatment with salicylic and jasmonic acid, P. cinnamomi infection, across different tissues and in P. cinnamomi infected tolerant and susceptible rootstocks. Of the five NPR1-like sequences three have strong support for a defensive role while two are most likely involved in development. Significant differences in the expression profiles of these five NPR1-like genes were observed, assisting in functional classification. Understanding the interaction of avocado and P. cinnamomi is essential to developing new control strategies. This work enables further classification of these genes by means of functional annotation and is a crucial step in understanding the role of NPR1 during P. cinnamomi infection.
Phylogenetic and expression analysis of the NPR1-like gene family from Persea americana (Mill.)
Backer, Robert; Mahomed, Waheed; Reeksting, Bianca J.; Engelbrecht, Juanita; Ibarra-Laclette, Enrique; van den Berg, Noëlani
2015-01-01
The NONEXPRESSOR OF PATHOGENESIS-RELATED GENES1 (NPR1) forms an integral part of the salicylic acid (SA) pathway in plants and is involved in cross-talk between the SA and jasmonic acid/ethylene (JA/ET) pathways. Therefore, NPR1 is essential to the effective response of plants to pathogens. Avocado (Persea americana) is a commercially important crop worldwide. Significant losses in production result from Phytophthora root rot, caused by the hemibiotroph, Phytophthora cinnamomi. This oomycete infects the feeder roots of avocado trees leading to an overall decline in health and eventual death. The interaction between avocado and P. cinnamomi is poorly understood and as such limited control strategies exist. Thus uncovering the role of NPR1 in avocado could provide novel insights into the avocado – P. cinnamomi interaction. A total of five NPR1-like sequences were identified. These sequences were annotated using FGENESH and a maximum-likelihood tree was constructed using 34 NPR1-like protein sequences from other plant species. The conserved protein domains and functional motifs of these sequences were predicted. Reverse transcription quantitative PCR was used to analyze the expression of the five NPR1-like sequences in the roots of avocado after treatment with salicylic and jasmonic acid, P. cinnamomi infection, across different tissues and in P. cinnamomi infected tolerant and susceptible rootstocks. Of the five NPR1-like sequences three have strong support for a defensive role while two are most likely involved in development. Significant differences in the expression profiles of these five NPR1-like genes were observed, assisting in functional classification. Understanding the interaction of avocado and P. cinnamomi is essential to developing new control strategies. This work enables further classification of these genes by means of functional annotation and is a crucial step in understanding the role of NPR1 during P. cinnamomi infection. PMID:25972890
1994-01-01
Physiological tolerance to uncompensable heat stress: effects of exercise intensity, protective clothing , and climate SCOTT J. MONTAIN, MICHAEL N...effects of exercise 26), there remains little information to predict the inci- intensity, protective clothing , and climate. J. AppL PhysioL dence of...that pre- exercise intensity, protective clothing level, and climate on dict the physiological responses and work capability dur- physiological tolerance
Preiss, David; Giles, Thomas D; Thomas, Laine E; Sun, Jie-Lena; Haffner, Steven M; Holman, Rury R; Standl, Eberhard; Mazzone, Theodore; Rutten, Guy E; Tognoni, Gianni; Chiang, Fu-Tien; McMurray, John J V; Califf, Robert M
2013-09-01
Risk factors for stroke are well-established in general populations but sparsely studied in individuals with impaired glucose tolerance. We identified predictors of stroke among participants with impaired glucose tolerance in the Nateglinide and Valsartan in Impaired Glucose Tolerance Outcomes Research (NAVIGATOR) trial. Cox proportional-hazard regression models were constructed using baseline variables, including the 2 medications studied, valsartan and nateglinide. Among 9306 participants, 237 experienced a stroke over 6.4 years. Predictors of stroke included classical risk factors such as existing cerebrovascular and coronary heart disease, higher pulse pressure, higher low-density lipoprotein cholesterol, older age, and atrial fibrillation. Other factors, including previous venous thromboembolism, higher waist circumference, lower estimated glomerular filtration rate, lower heart rate, and lower body mass index, provided additional important predictive information, yielding a C-index of 0.72. Glycemic measures were not predictive of stroke. Variables associated with stroke were similar in participants with no prior history of cerebrovascular disease at baseline. The most powerful predictors of stroke in patients with impaired glucose tolerance included a combination of established risk factors and novel variables, such as previous venous thromboembolism and elevated waist circumference, allowing moderately effective identification of high-risk individuals.
Bohne, Felix; Martínez-Llordella, Marc; Lozano, Juan-José; Miquel, Rosa; Benítez, Carlos; Londoño, María-Carlota; Manzia, Tommaso-María; Angelico, Roberta; Swinkels, Dorine W.; Tjalsma, Harold; López, Marta; Abraldes, Juan G.; Bonaccorsi-Riani, Eliano; Jaeckel, Elmar; Taubert, Richard; Pirenne, Jacques; Rimola, Antoni; Tisone, Giuseppe; Sánchez-Fueyo, Alberto
2011-01-01
Following organ transplantation, lifelong immunosuppressive therapy is required to prevent the host immune system from destroying the allograft. This can cause severe side effects and increased recipient morbidity and mortality. Complete cessation of immunosuppressive drugs has been successfully accomplished in selected transplant recipients, providing proof of principle that operational allograft tolerance is attainable in clinical transplantation. The intra-graft molecular pathways associated with successful drug withdrawal, however, are not well defined. In this study, we analyzed sequential blood and liver tissue samples collected from liver transplant recipients enrolled in a prospective multicenter immunosuppressive drug withdrawal clinical trial. Before initiation of drug withdrawal, operationally tolerant and non-tolerant recipients differed in the intra-graft expression of genes involved in the regulation of iron homeostasis. Furthermore, as compared with non-tolerant recipients, operationally tolerant patients exhibited higher serum levels of hepcidin and ferritin and increased hepatocyte iron deposition. Finally, liver tissue gene expression measurements accurately predicted the outcome of immunosuppressive withdrawal in an independent set of patients. These results point to a critical role for iron metabolism in the regulation of intra-graft alloimmune responses in humans and provide a set of biomarkers to conduct drug-weaning trials in liver transplantation. PMID:22156196
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mhamdi, Ridha; Ardley, Julie; Tian, Rui
We report that Ensifer meliloti 4H41 is an aerobic, motile, Gram-negative, non-spore-forming rod that can exist as a soil saprophyte or as a legume microsymbiont of common bean (Phaseolus vulgaris). Strain 4H41 was isolated in 2002 from root nodules of P. vulgaris grown in South Tunisia from the oasis of Rjim-Maatoug. Strain 4H41 is salt- and drought-tolerant and highly effective at fixing nitrogen with P. vulgaris. Here we describe the features of E. meliloti 4H41, together with genome sequence information and its annotation. The 6,795,637 bp high-quality permanent draft genome is arranged into 47 scaffolds of 47 contigs containing 6,350more » protein-coding genes and 72 RNA-only encoding genes, and is one of the rhizobial genomes sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) project proposal.« less
Mhamdi, Ridha; Ardley, Julie; Tian, Rui; ...
2015-07-02
We report that Ensifer meliloti 4H41 is an aerobic, motile, Gram-negative, non-spore-forming rod that can exist as a soil saprophyte or as a legume microsymbiont of common bean (Phaseolus vulgaris). Strain 4H41 was isolated in 2002 from root nodules of P. vulgaris grown in South Tunisia from the oasis of Rjim-Maatoug. Strain 4H41 is salt- and drought-tolerant and highly effective at fixing nitrogen with P. vulgaris. Here we describe the features of E. meliloti 4H41, together with genome sequence information and its annotation. The 6,795,637 bp high-quality permanent draft genome is arranged into 47 scaffolds of 47 contigs containing 6,350more » protein-coding genes and 72 RNA-only encoding genes, and is one of the rhizobial genomes sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) project proposal.« less
Draft versus finished sequence data for DNA and protein diagnostic signature development
Gardner, Shea N.; Lam, Marisa W.; Smith, Jason R.; Torres, Clinton L.; Slezak, Tom R.
2005-01-01
Sequencing pathogen genomes is costly, demanding careful allocation of limited sequencing resources. We built a computational Sequencing Analysis Pipeline (SAP) to guide decisions regarding the amount of genomic sequencing necessary to develop high-quality diagnostic DNA and protein signatures. SAP uses simulations to estimate the number of target genomes and close phylogenetic relatives (near neighbors or NNs) to sequence. We use SAP to assess whether draft data are sufficient or finished sequencing is required using Marburg and variola virus sequences. Simulations indicate that intermediate to high-quality draft with error rates of 10−3–10−5 (∼8× coverage) of target organisms is suitable for DNA signature prediction. Low-quality draft with error rates of ∼1% (3× to 6× coverage) of target isolates is inadequate for DNA signature prediction, although low-quality draft of NNs is sufficient, as long as the target genomes are of high quality. For protein signature prediction, sequencing errors in target genomes substantially reduce the detection of amino acid sequence conservation, even if the draft is of high quality. In summary, high-quality draft of target and low-quality draft of NNs appears to be a cost-effective investment for DNA signature prediction, but may lead to underestimation of predicted protein signatures. PMID:16243783
Use of skin temperature to predict tolerance to thermal environments.
DOT National Transportation Integrated Search
1971-01-01
Skin temperature is a sensitive index of the effect of the thermal environment on the seminude man. Skin temperatures and tolerance times from several studies have been utilized in an attempt to establish a relationship between (1) final skin tempera...
Software fault tolerance in computer operating systems
NASA Technical Reports Server (NTRS)
Iyer, Ravishankar K.; Lee, Inhwan
1994-01-01
This chapter provides data and analysis of the dependability and fault tolerance for three operating systems: the Tandem/GUARDIAN fault-tolerant system, the VAX/VMS distributed system, and the IBM/MVS system. Based on measurements from these systems, basic software error characteristics are investigated. Fault tolerance in operating systems resulting from the use of process pairs and recovery routines is evaluated. Two levels of models are developed to analyze error and recovery processes inside an operating system and interactions among multiple instances of an operating system running in a distributed environment. The measurements show that the use of process pairs in Tandem systems, which was originally intended for tolerating hardware faults, allows the system to tolerate about 70% of defects in system software that result in processor failures. The loose coupling between processors which results in the backup execution (the processor state and the sequence of events occurring) being different from the original execution is a major reason for the measured software fault tolerance. The IBM/MVS system fault tolerance almost doubles when recovery routines are provided, in comparison to the case in which no recovery routines are available. However, even when recovery routines are provided, there is almost a 50% chance of system failure when critical system jobs are involved.
Statistical physics of interacting neural networks
NASA Astrophysics Data System (ADS)
Kinzel, Wolfgang; Metzler, Richard; Kanter, Ido
2001-12-01
Recent results on the statistical physics of time series generation and prediction are presented. A neural network is trained on quasi-periodic and chaotic sequences and overlaps to the sequence generator as well as the prediction errors are calculated numerically. For each network there exists a sequence for which it completely fails to make predictions. Two interacting networks show a transition to perfect synchronization. A pool of interacting networks shows good coordination in the minority game-a model of competition in a closed market. Finally, as a demonstration, a perceptron predicts bit sequences produced by human beings.
Liang, Yunyun; Liu, Sanyang; Zhang, Shengli
2015-01-01
Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM). Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS), segmented PsePSSM, and segmented autocovariance transformation (ACT) based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640) are adopted in this paper. Then a 700-dimensional (700D) feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA). To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.
Hashimoto, Takuma; Horikawa, Daiki D.; Saito, Yuki; Kuwahara, Hirokazu; Kozuka-Hata, Hiroko; Shin-I, Tadasu; Minakuchi, Yohei; Ohishi, Kazuko; Motoyama, Ayuko; Aizu, Tomoyuki; Enomoto, Atsushi; Kondo, Koyuki; Tanaka, Sae; Hara, Yuichiro; Koshikawa, Shigeyuki; Sagara, Hiroshi; Miura, Toru; Yokobori, Shin-ichi; Miyagawa, Kiyoshi; Suzuki, Yutaka; Kubo, Takeo; Oyama, Masaaki; Kohara, Yuji; Fujiyama, Asao; Arakawa, Kazuharu; Katayama, Toshiaki; Toyoda, Atsushi; Kunieda, Takekazu
2016-01-01
Tardigrades, also known as water bears, are small aquatic animals. Some tardigrade species tolerate almost complete dehydration and exhibit extraordinary tolerance to various physical extremes in the dehydrated state. Here we determine a high-quality genome sequence of Ramazzottius varieornatus, one of the most stress-tolerant tardigrade species. Precise gene repertoire analyses reveal the presence of a small proportion (1.2% or less) of putative foreign genes, loss of gene pathways that promote stress damage, expansion of gene families related to ameliorating damage, and evolution and high expression of novel tardigrade-unique proteins. Minor changes in the gene expression profiles during dehydration and rehydration suggest constitutive expression of tolerance-related genes. Using human cultured cells, we demonstrate that a tardigrade-unique DNA-associating protein suppresses X-ray-induced DNA damage by ∼40% and improves radiotolerance. These findings indicate the relevance of tardigrade-unique proteins to tolerability and tardigrades could be a bountiful source of new protection genes and mechanisms. PMID:27649274
Hashimoto, Takuma; Horikawa, Daiki D; Saito, Yuki; Kuwahara, Hirokazu; Kozuka-Hata, Hiroko; Shin-I, Tadasu; Minakuchi, Yohei; Ohishi, Kazuko; Motoyama, Ayuko; Aizu, Tomoyuki; Enomoto, Atsushi; Kondo, Koyuki; Tanaka, Sae; Hara, Yuichiro; Koshikawa, Shigeyuki; Sagara, Hiroshi; Miura, Toru; Yokobori, Shin-Ichi; Miyagawa, Kiyoshi; Suzuki, Yutaka; Kubo, Takeo; Oyama, Masaaki; Kohara, Yuji; Fujiyama, Asao; Arakawa, Kazuharu; Katayama, Toshiaki; Toyoda, Atsushi; Kunieda, Takekazu
2016-09-20
Tardigrades, also known as water bears, are small aquatic animals. Some tardigrade species tolerate almost complete dehydration and exhibit extraordinary tolerance to various physical extremes in the dehydrated state. Here we determine a high-quality genome sequence of Ramazzottius varieornatus, one of the most stress-tolerant tardigrade species. Precise gene repertoire analyses reveal the presence of a small proportion (1.2% or less) of putative foreign genes, loss of gene pathways that promote stress damage, expansion of gene families related to ameliorating damage, and evolution and high expression of novel tardigrade-unique proteins. Minor changes in the gene expression profiles during dehydration and rehydration suggest constitutive expression of tolerance-related genes. Using human cultured cells, we demonstrate that a tardigrade-unique DNA-associating protein suppresses X-ray-induced DNA damage by ∼40% and improves radiotolerance. These findings indicate the relevance of tardigrade-unique proteins to tolerability and tardigrades could be a bountiful source of new protection genes and mechanisms.
Evolutionary Engineering Improves Tolerance for Replacement Jet Fuels in Saccharomyces cerevisiae
Brennan, Timothy C. R.; Williams, Thomas C.; Schulz, Benjamin L.; Palfreyman, Robin W.; Nielsen, Lars K.
2015-01-01
Monoterpenes are liquid hydrocarbons with applications ranging from flavor and fragrance to replacement jet fuel. Their toxicity, however, presents a major challenge for microbial synthesis. Here we evolved limonene-tolerant Saccharomyces cerevisiae strains and sequenced six strains across the 200-generation evolutionary time course. Mutations were found in the tricalbin proteins Tcb2p and Tcb3p. Genomic reconstruction in the parent strain showed that truncation of a single protein (tTcb3p1-989), but not its complete deletion, was sufficient to recover the evolved phenotype improving limonene fitness 9-fold. tTcb3p1-989 increased tolerance toward two other monoterpenes (β-pinene and myrcene) 11- and 8-fold, respectively, and tolerance toward the biojet fuel blend AMJ-700t (10% cymene, 50% limonene, 40% farnesene) 4-fold. tTcb3p1-989 is the first example of successful engineering of phase tolerance and creates opportunities for production of the highly toxic C10 alkenes in yeast. PMID:25746998
Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa
NASA Astrophysics Data System (ADS)
Basyuni, M.; Sumardi
2017-01-01
This study descibes bioinformatics approach on the analyze of the salt tolerance genes in mangrove plant, Rhizophora stylosa on DDBJ/EMBL/GenBank as well as similarity, phylogenetic, potential peptide, and subcellular localization. The DNA sequence between salt tolerance gene from R. stylosa exhibited 42-11% between themselves The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the salt-tolerant genes in R. stylosa, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, first branch of Cu/Zn SOD and reverse transcriptase genes, the second branch consists of the majority genes and the last group was MAP3K alpha protein kinase only. The present study, therefore, suggested that salt tolerance genes form distinct clusters in the tree.
Rascovan, Nicolás; Castro, Camila; Revale, Santiago; Giaveno, M. Alejandra; Vazquez, Martín; Donati, Edgardo R.
2014-01-01
Acidianus copahuensis is a recently characterized thermoacidophilic archaeon isolated from the Copahue volcanic area in Argentina. Here, we present its draft genome sequence, in which we found genes involved in key metabolic pathways for developing under Copahue’s extreme environmental conditions, such as sulfur and iron oxidation, carbon fixation, and metal tolerance. PMID:24812211
Evolution of sparsity and modularity in a model of protein allostery
NASA Astrophysics Data System (ADS)
Hemery, Mathieu; Rivoire, Olivier
2015-04-01
The sequence of a protein is not only constrained by its physical and biochemical properties under current selection, but also by features of its past evolutionary history. Understanding the extent and the form that these evolutionary constraints may take is important to interpret the information in protein sequences. To study this problem, we introduce a simple but physical model of protein evolution where selection targets allostery, the functional coupling of distal sites on protein surfaces. This model shows how the geometrical organization of couplings between amino acids within a protein structure can depend crucially on its evolutionary history. In particular, two scenarios are found to generate a spatial concentration of functional constraints: high mutation rates and fluctuating selective pressures. This second scenario offers a plausible explanation for the high tolerance of natural proteins to mutations and for the spatial organization of their least tolerant amino acids, as revealed by sequence analysis and mutagenesis experiments. It also implies a faculty to adapt to new selective pressures that is consistent with observations. The model illustrates how several independent functional modules may emerge within the same protein structure, depending on the nature of past environmental fluctuations. Our model thus relates the evolutionary history of proteins to the geometry of their functional constraints, with implications for decoding and engineering protein sequences.
Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong
2015-01-01
Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.
Accurate Classification of RNA Structures Using Topological Fingerprints
Li, Kejie; Gribskov, Michael
2016-01-01
While RNAs are well known to possess complex structures, functionally similar RNAs often have little sequence similarity. While the exact size and spacing of base-paired regions vary, functionally similar RNAs have pronounced similarity in the arrangement, or topology, of base-paired stems. Furthermore, predicted RNA structures often lack pseudoknots (a crucial aspect of biological activity), and are only partially correct, or incomplete. A topological approach addresses all of these difficulties. In this work we describe each RNA structure as a graph that can be converted to a topological spectrum (RNA fingerprint). The set of subgraphs in an RNA structure, its RNA fingerprint, can be compared with the fingerprints of other RNA structures to identify and correctly classify functionally related RNAs. Topologically similar RNAs can be identified even when a large fraction, up to 30%, of the stems are omitted, indicating that highly accurate structures are not necessary. We investigate the performance of the RNA fingerprint approach on a set of eight highly curated RNA families, with diverse sizes and functions, containing pseudoknots, and with little sequence similarity–an especially difficult test set. In spite of the difficult test set, the RNA fingerprint approach is very successful (ROC AUC > 0.95). Due to the inclusion of pseudoknots, the RNA fingerprint approach both covers a wider range of possible structures than methods based only on secondary structure, and its tolerance for incomplete structures suggests that it can be applied even to predicted structures. Source code is freely available at https://github.rcac.purdue.edu/mgribsko/XIOS_RNA_fingerprint. PMID:27755571
Puentes, A; Johnson, M T J
2016-01-01
The evolution of plant defence in response to herbivory will depend on the fitness effects of damage, availability of genetic variation and potential ecological and genetic constraints on defence. Here, we examine the potential for evolution of tolerance to deer herbivory in Oenothera biennis while simultaneously considering resistance to natural insect herbivores. We examined (i) the effects of deer damage on fitness, (ii) the presence of genetic variation in tolerance and resistance, (iii) selection on tolerance, (iv) genetic correlations with resistance that could constrain evolution of tolerance and (v) plant traits that might predict defence. In a field experiment, we simulated deer damage occurring early and late in the season, recorded arthropod abundances, flowering phenology and measured growth rate and lifetime reproduction. Our study showed that deer herbivory has a negative effect on fitness, with effects being more pronounced for late-season damage. Selection acted to increase tolerance to deer damage, yet there was low and nonsignificant genetic variation in this trait. In contrast, there was substantial genetic variation in resistance to insect herbivores. Resistance was genetically uncorrelated with tolerance, whereas positive genetic correlations in resistance to insect herbivores suggest there exists diffuse selection on resistance traits. In addition, growth rate and flowering time did not predict variation in tolerance, but flowering phenology was genetically correlated with resistance. Our results suggest that deer damage has the potential to exert selection because browsing reduces plant fitness, but limited standing genetic variation in tolerance is expected to constrain adaptive evolution in O. biennis. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.
Peters, Rachel L.; Gurrin, Lyle C.; Dharmage, Shyamali C.; Koplin, Jennifer J.; Allen, Katrina J.
2013-01-01
IgE-mediated food allergy is a transient condition for some children, however there are few indices to predict when and in whom food allergy will resolve. Skin prick test (SPT) and serum-specific IgE levels (sIgE) are usually monitored in the management of food allergy and are used to predict the development of tolerance or persistence of food allergy. The aim of this article is to review the published literature that investigated the predictive value of SPT and sIgE in development of tolerance in children with a previous diagnosis of peanut, egg and milk allergy. A systematic search identified twenty-six studies, of which most reported SPT or sIgE thresholds which predicted persistent or resolved allergy. However, results were inconsistent between studies. Previous research was hampered by several limitations including the absence of gold standard test to diagnose food allergy or tolerance, biased samples in retrospective audits and lack of systematic protocols for triggering re-challenges. There is a need for population-based, prospective studies that use the gold standard oral food challenge (OFC) to diagnose food allergy at baseline and follow-up to develop SPT and sIgE thresholds that predict the course of food allergy. PMID:24132133
Discriminative prediction of mammalian enhancers from DNA sequence
Lee, Dongwon; Karchin, Rachel; Beer, Michael A.
2011-01-01
Accurately predicting regulatory sequences and enhancers in entire genomes is an important but difficult problem, especially in large vertebrate genomes. With the advent of ChIP-seq technology, experimental detection of genome-wide EP300/CREBBP bound regions provides a powerful platform to develop predictive tools for regulatory sequences and to study their sequence properties. Here, we develop a support vector machine (SVM) framework which can accurately identify EP300-bound enhancers using only genomic sequence and an unbiased set of general sequence features. Moreover, we find that the predictive sequence features identified by the SVM classifier reveal biologically relevant sequence elements enriched in the enhancers, but we also identify other features that are significantly depleted in enhancers. The predictive sequence features are evolutionarily conserved and spatially clustered, providing further support of their functional significance. Although our SVM is trained on experimental data, we also predict novel enhancers and show that these putative enhancers are significantly enriched in both ChIP-seq signal and DNase I hypersensitivity signal in the mouse brain and are located near relevant genes. Finally, we present results of comparisons between other EP300/CREBBP data sets using our SVM and uncover sequence elements enriched and/or depleted in the different classes of enhancers. Many of these sequence features play a role in specifying tissue-specific or developmental-stage-specific enhancer activity, but our results indicate that some features operate in a general or tissue-independent manner. In addition to providing a high confidence list of enhancer targets for subsequent experimental investigation, these results contribute to our understanding of the general sequence structure of vertebrate enhancers. PMID:21875935
Development of imidazolinone herbicide tolerant borage (Borago officinalis L.).
Song, Dongyan; Wu, Guohai; Vrinten, Patricia; Qiu, Xiao
2017-09-01
Borage (Borago officinalis) is an annual herb that produces a high level of gamma-linolenic acid (GLA) in its seed oil. Due to the recognized health benefits of GLA, borage is now commercially cultivated worldwide. However, an herbicide-tolerant variety for effective weed management has not yet been developed. Here we report the generation and characterization of ethyl methanesulfonate (EMS) induced borage mutant lines tolerant to the herbicide imidazolinone. An EMS-mutagenized borage population was generated by using a series of concentrations of EMS to treat mature borage seeds. Screening of the M2 and M3 borage plants using an herbicide treatment resulted in the identification of two imidazolinone-tolerant lines. Sequence analysis of two acetohydroxyacid synthase (AHAS) genes, AHAS1 and AHAS2, from the mutant (tolerant) and wild type (susceptible) borage plants showed that single nucleotide substitutions which resulted in amino acid changes occurred in AHAS1 and AHAS2, respectively in the two tolerant lines. A KASP marker was then developed to differentiate the homozygous susceptible, homozygous tolerant and heterozygous borage plants. An in vitro assay showed that homozygous tolerant borage carrying the AHAS1 mutation retained significantly higher AHAS activity than susceptible borage across different imazamox concentrations. A herbicide dose response test indicated that the line with the AHAS1 mutation could tolerate four times the normally used field concentration of "Solo" herbicide. Copyright © 2017. Published by Elsevier B.V.
Xiong, Hongchun; Guo, Huijun; Xie, Yongdun; Zhao, Linshu; Gu, Jiayu; Zhao, Shirong; Li, Junhui; Liu, Luxiang
2017-06-02
Salinity stress has become an increasing threat to food security worldwide and elucidation of the mechanism for salinity tolerance is of great significance. Induced mutation, especially spaceflight mutagenesis, is one important method for crop breeding. In this study, we show that a spaceflight-induced wheat mutant, named salinity tolerance 1 (st1), is a salinity-tolerant line. We report the characteristics of transcriptomic sequence variation induced by spaceflight, and show that mutations in genes associated with sodium ion transport may directly contribute to salinity tolerance in st1. Furthermore, GO and KEGG enrichment analysis of differentially expressed genes (DEGs) between salinity-treated st1 and wild type suggested that the homeostasis of oxidation-reduction process is important for salt tolerance in st1. Through KEGG pathway analysis, "Butanoate metabolism" was identified as a new pathway for salinity responses. Additionally, key genes for salinity tolerance, such as genes encoding arginine decarboxylase, polyamine oxidase, hormones-related, were not only salt-induced in st1 but also showed higher expression in salt-treated st1 compared with salt-treated WT, indicating that these genes may play important roles in salinity tolerance in st1. This study presents valuable genetic resources for studies on transcriptome variation caused by induced mutation and the identification of salt tolerance genes in crops.
Dealing with feeling: Specific emotion regulation skills predict responses to stress in psychosis.
Lincoln, Tania M; Hartmann, Maike; Köther, Ulf; Moritz, Steffen
2015-08-15
Elevated negative affect is an established link between minor stressors and psychotic symptoms. Less clear is why people with psychosis fail to regulate distressing emotions effectively. This study tests whether subjective, psychophysiological and symptomatic responses to stress can be predicted by specific emotion regulation (ER) difficulties. Participants with psychotic disorders (n=35) and healthy controls (n=28) were assessed for ER-skills at baseline. They were then exposed to a noise versus no stressor on different days, during which self-reported stress responses, state paranoia and skin conductance levels (SCL) were assessed. Participants with psychosis showed a stronger increase in self-reported stress and SCL in response to the stressor than healthy controls. Stronger increases in self-reported stress were predicted by a reduced ability to be aware of and tolerate distressing emotions, whereas increases in SCL were predicted by a reduced ability to be aware of, tolerate, accept and modify them. Although paranoid symptoms were not significantly affected by the stressors, individual variation in paranoid responses was also predicted by a reduced ability to be aware of and tolerate emotions. Differences in stress responses in the samples were no longer significant after controlling for ER skills. Thus, interventions that improve ER-skills could reduce stress-sensitivity in psychosis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Fischbach, Katharina; Kosiek, Otrud; Friebe, Björn; Wybranski, Christian; Schnackenburg, Bernhard; Schmeisser, Alexander; Smid, Jan; Ricke, Jens; Pech, Maciej
2017-01-01
Cardiac magnetic resonance imaging (cMRI) has become the non-invasive reference standard for the evaluation of cardiac function and viability. The introduction of open, high-field, 1.0T (HFO) MR scanners offers advantages for examinations of obese, claustrophobic and paediatric patients.The aim of our study was to compare standard cMRI sequences from an HFO scanner and those from a cylindrical, 1.5T MR system. Fifteen volunteers underwent cMRI both in an open HFO and in a cylindrical MR system. The protocol consisted of cine and unenhanced tissue sequences. The signal-to-noise ratio (SNR) for each sequence and blood-myocardium contrast for the cine sequences were assessed. Image quality and artefacts were rated. The location and number of non-diagnostic segments was determined. Volunteers' tolerance to examinations in both scanners was investigated. SNR was significantly lower in the HFO scanner (all p<0.001). However, the contrast of the cine sequence was significantly higher in the HFO platform compared to the 1.5T MR scanner (0.685±0.41 vs. 0.611±0.54; p<0.001). Image quality was comparable for all sequences (all p>0.05). Overall, only few non-diagnostic myocardial segments were recorded: 6/960 (0.6%) by the HFO and 17/960 (1.8%) segments by the cylindrical system. The volunteers expressed a preference for the open MR system (p<0.01). Standard cardiac MRI sequences in an HFO platform offer a high image quality that is comparable to the quality of images acquired in a cylindrical 1.5T MR scanner. An open scanner design may potentially improve tolerance of cardiac MRI and therefore allow to examine an even broader patient spectrum.
Everett, Meredith V; Seeb, James E
2014-01-01
Understanding how organisms interact with their environments is increasingly important for conservation efforts in many species, especially in light of highly anticipated climate changes. One method for understanding this relationship is to use genetic maps and QTL mapping to detect genomic regions linked to phenotypic traits of importance for adaptation. We used high-throughput genotyping by sequencing (GBS) to both detect and map thousands of SNPs in haploid Chinook salmon (Oncorhynchus tshawytscha). We next applied this map to detect QTL related to temperature tolerance and body size in families of diploid Chinook salmon. Using these techniques, we mapped 3534 SNPs in 34 linkage groups which is consistent with the haploid chromosome number for Chinook salmon. We successfully detected three QTL for temperature tolerance and one QTL for body size at the experiment-wide level, as well as additional QTL significant at the chromosome-wide level. The use of haploids coupled with GBS provides a robust pathway to rapidly develop genomic resources in nonmodel organisms; these QTL represent preliminary progress toward linking traits of conservation interest to regions in the Chinook salmon genome. PMID:24822082
Zhao, Xue Qiang; Aizawa, Tomoko; Schneider, Jessica; Wang, Chao; Shen, Ren Fang; Sunairi, Michio
2013-04-01
The complete mitochondrial genome of Rhodotorula taiwanensis RS1, an aluminum-tolerant Basidiomycota fungus, was determined and compared with the known mitochondrial genomes of 12 Basidiomycota species. The mitochondrial genome of R. taiwanensis RS1 is a circular DNA molecule of 40,392 bp and encodes the typical 15 mitochondrial proteins, 23 tRNAs, and small and large rRNAs as well as 10 intronic open reading frames. These genes are apparently transcribed in two directions and do not show syntenies in gene order with other investigated Basidiomycota species. The average G+C content (41%) of the mitochondrial genome of R. taiwanensis RS1 is the highest among the Basidiomycota species. Two introns were detected in the sequence of the atp9 gene of R. taiwanensis RS1, but not in that of other Basidiomycota species. Rhodotorula taiwanensis is the first species of the genus Rhodotorula whose full mitochondrial genome has been sequenced; and the data presented here supply valuable information for understanding the evolution of fungal mitochondrial genomes and researching the mechanism of aluminum tolerance in microorganisms. © 2013 The Authors. Published by Blackwell Publishing Ltd.
Software reliability models for fault-tolerant avionics computers and related topics
NASA Technical Reports Server (NTRS)
Miller, Douglas R.
1987-01-01
Software reliability research is briefly described. General research topics are reliability growth models, quality of software reliability prediction, the complete monotonicity property of reliability growth, conceptual modelling of software failure behavior, assurance of ultrahigh reliability, and analysis techniques for fault-tolerant systems.
Villanueva, Paola A.; Lopez, Jorge; Torres, Rodrigo; Navarro, Jorge M.; Bacigalupe, Leonardo D.
2017-01-01
Phenotypic plasticity is expected to play a major adaptive role in the response of species to ocean acidification (OA), by providing broader tolerances to changes in pCO2 conditions. However, tolerances and sensitivities to future OA may differ among populations within a species because of their particular environmental context and genetic backgrounds. Here, using the climatic variability hypothesis (CVH), we explored this conceptual framework in populations of the sea urchin Loxechinus albus across natural fluctuating pCO2/pH environments. Although elevated pCO2 affected the morphology, physiology, development and survival of sea urchin larvae, the magnitude of these effects differed among populations. These differences were consistent with the predictions of the CVH showing greater tolerance to OA in populations experiencing greater local variation in seawater pCO2/pH. Considering geographical differences in plasticity, tolerances and sensitivities to increased pCO2 will provide more accurate predictions for species responses to future OA. PMID:28179409
Gaitán-Espitia, Juan Diego; Villanueva, Paola A; Lopez, Jorge; Torres, Rodrigo; Navarro, Jorge M; Bacigalupe, Leonardo D
2017-02-01
Phenotypic plasticity is expected to play a major adaptive role in the response of species to ocean acidification (OA), by providing broader tolerances to changes in p CO 2 conditions. However, tolerances and sensitivities to future OA may differ among populations within a species because of their particular environmental context and genetic backgrounds. Here, using the climatic variability hypothesis (CVH), we explored this conceptual framework in populations of the sea urchin Loxechinus albus across natural fluctuating p CO 2 /pH environments. Although elevated p CO 2 affected the morphology, physiology, development and survival of sea urchin larvae, the magnitude of these effects differed among populations. These differences were consistent with the predictions of the CVH showing greater tolerance to OA in populations experiencing greater local variation in seawater p CO 2 /pH. Considering geographical differences in plasticity, tolerances and sensitivities to increased p CO 2 will provide more accurate predictions for species responses to future OA. © 2017 The Author(s).
Rugiu, Luca; Manninen, Iita; Rothäusler, Eva; Jormalainen, Veijo
2018-03-01
Climate change is threating species' persistence worldwide. To predict species responses to climate change we need information not just on their environmental tolerance but also on its adaptive potential. We tested how the foundation species of rocky littoral habitats, Fucus vesiculosus, responds to combined hyposalinity and warming projected to the Baltic Sea by 2070-2099. We quantified responses of replicated populations originating from the entrance, central, and marginal Baltic regions. Using replicated individuals, we tested for the presence of within-population tolerance variation. Future conditions hampered growth and survival of the central and marginal populations whereas the entrance populations fared well. Further, both the among- and within-population variation in responses to climate change indicated existence of genetic variation in tolerance. Such standing genetic variation provides the raw material necessary for adaptation to a changing environment, which may eventually ensure the persistence of the species in the inner Baltic Sea. Copyright © 2017 Elsevier Ltd. All rights reserved.
LIGHT, AUDREY; AHN, TAEHYUN
2010-01-01
Given that divorce often represents a high-stakes income gamble, we ask how individual levels of risk tolerance affect the decision to divorce. We extend the orthodox divorce model by assuming that individuals are risk averse, that marriage is risky, and that divorce is even riskier. The model predicts that conditional on the expected gains to marriage and divorce, the probability of divorce increases with relative risk tolerance because risk averse individuals require compensation for the additional risk that is inherent in divorce. To implement the model empirically, we use data for first-married women and men from the 1979 National Longitudinal Survey of Youth to estimate a probit model of divorce in which a measure of risk tolerance is among the covariates. The estimates reveal that a 1-point increase in risk tolerance raises the predicted probability of divorce by 4.3% for a representative man and by 11.4% for a representative woman. These findings are consistent with the notion that divorce entails a greater income gamble for women than for men. PMID:21308563
Light, Audrey; Ahn, Taehyun
2010-11-01
Given that divorce often represents a high-stakes income gamble, we ask how individual levels of risk tolerance affect the decision to divorce. We extend the orthodox divorce model by assuming that individuals are risk averse, that marriage is risky, and that divorce is even riskier. The model predicts that conditional on the expected gains to marriage and divorce, the probability of divorce increases with relative risk tolerance because risk averse individuals require compensation for the additional risk that is inherent in divorce. To implement the model empirically, we use data for first-married women and men from the 1979 National Longitudinal Survey of Youth to estimate a probit model of divorce in which a measure of risk tolerance is among the covariates. The estimates reveal that a 1-point increase in risk tolerance raises the predicted probability of divorce by 4.3% for a representative man and by 11.4% for a representative woman. These findings are consistent with the notion that divorce entails a greater income gamble for women than for men.
Selecting sequence variants to improve genomic predictions for dairy cattle
USDA-ARS?s Scientific Manuscript database
Millions of genetic variants have been identified by population-scale sequencing projects, but subsets are needed for routine genomic predictions or to include on genotyping arrays. Methods of selecting sequence variants were compared using both simulated sequence genotypes and actual data from run ...
Predictors of noninvasive ventilation tolerance in patients with amyotrophic lateral sclerosis.
Gruis, K L; Brown, D L; Schoennemann, A; Zebarah, V A; Feldman, E L
2005-12-01
Noninvasive ventilation (NIV) appears to improve survival and quality of life in patients with amyotrophic lateral sclerosis (ALS), but little is known about predictors of NIV tolerance. NIV use was assessed and clinical predictors of tolerance were investigated, using predictive modeling, in ALS patients diagnosed and followed in our clinic until death over a 4-year time period. Patients were prescribed NIV based on current practice parameters when respiratory symptoms were present or forced vital capacity was less than 50%. We prescribed NIV in 52% (72) of patients. For those prescribed NIV, information regarding tolerance was available for 50 patients, with 72% (36) tolerant to its use. Tolerance was six times more likely in limb-onset than bulbar-onset ALS patients, with a trend toward reduced tolerance in those with lower forced vital capacity at NIV initiation. Age, gender, and duration of disease were not predictors of NIV tolerance. We conclude that a majority of ALS patients who are prescribed NIV can successfully become tolerant to its use.
High-throughput transcriptome analysis of barley (Hordeum vulgare) exposed to excessive boron.
Tombuloglu, Guzin; Tombuloglu, Huseyin; Sakcali, M Serdal; Unver, Turgay
2015-02-15
Boron (B) is an essential micronutrient for optimum plant growth. However, above certain threshold B is toxic and causes yield loss in agricultural lands. While a number of studies were conducted to understand B tolerance mechanism, a transcriptome-wide approach for B tolerant barley is performed here for the first time. A high-throughput RNA-Seq (cDNA) sequencing technology (Illumina) was used with barley (Hordeum vulgare), yielding 208 million clean reads. In total, 256,874 unigenes were generated and assigned to known peptide databases: Gene Ontology (GO) (99,043), Swiss-Prot (38,266), Clusters of Orthologous Groups (COG) (26,250), and the Kyoto Encyclopedia of Genes and Genomes (KEGG) (36,860), as determined by BLASTx search. According to the digital gene expression (DGE) analyses, 16% and 17% of the transcripts were found to be differentially regulated in root and leaf tissues, respectively. Most of them were involved in cell wall, stress response, membrane, protein kinase and transporter mechanisms. Some of the genes detected as highly expressed in root tissue are phospholipases, predicted divalent heavy-metal cation transporters, formin-like proteins and calmodulin/Ca(2+)-binding proteins. In addition, chitin-binding lectin precursor, ubiquitin carboxyl-terminal hydrolase, and serine/threonine-protein kinase AFC2 genes were indicated to be highly regulated in leaf tissue upon excess B treatment. Some pathways, such as the Ca(2+)-calmodulin system, are activated in response to B toxicity. The differential regulation of 10 transcripts was confirmed by qRT-PCR, revealing the tissue-specific responses against B toxicity and their putative function in B-tolerance mechanisms. Copyright © 2014. Published by Elsevier B.V.
Karimi, Marzieh; Ghazanfari, Farahnaz; Fadaei, Adeleh; Ahmadi, Laleh; Shiran, Behrouz; Rabei, Mohammad; Fallahi, Hossein
2016-01-01
Spring frost is an important environmental stress that threatens the production of Prunus trees. However, little information is available regarding molecular response of these plants to the frost stress. Using high throughput sequencing, this study was conducted to identify differentially expressed miRNAs, both the conserved and the non-conserved ones, in the reproductive tissues of almond tolerant H genotype under cold stress. Analysis of 50 to 58 million raw reads led to identification of 174 unique conserved and 59 novel microRNAs (miRNAs). Differential expression pattern analysis showed that 50 miRNA families were expressed differentially in one or both of almond reproductive tissues (anther and ovary). Out of these 50 miRNA families, 12 and 15 displayed up-regulation and down-regulation, respectively. The distribution of conserved miRNA families indicated that miR482f harbor the highest number of members. Confirmation of miRNAs expression patterns by quantitative real- time PCR (qPCR) was performed in cold tolerant (H genotype) alongside a sensitive variety (Sh12 genotype). Our analysis revealed differential expression for 9 miRNAs in anther and 3 miRNAs in ovary between these two varieties. Target prediction of miRNAs followed by differential expression analysis resulted in identification of 83 target genes, mostly transcription factors. This study comprehensively catalogued expressed miRNAs under different temperatures in two reproductive tissues (anther and ovary). Results of current study and the previous RNA-seq study, which was conducted in the same tissues by our group, provide a unique opportunity to understand the molecular basis of responses of almond to cold stress. The results can also enhance the possibility for gene manipulation to develop cold tolerant plants.
Li, Haishan; Dai, Yufei; Huang, Hanlin; Li, Laiyu; Leng, Shuguang; Cheng, Juan; Niu, Yong; Duan, Huawei; Liu, Qingjun; Zhang, Xing; Huang, Xianqing; Xie, Jinxin; Feng, Zhiming; Wang, Juncai; He, Jiaxi; Zheng, Yuxin
2007-01-01
Background Trichloroethylene (TCE) is used extensively as an industrial solvent and has been recognized as one of the major environmental pollutants. To date, > 200 cases of TCE-induced hypersensitivity dermatitis among exposed workers have been reported worldwide, and TCE exposure has become one of the critical occupational health issues in Asia. Objectives The study aimed to identify genetic susceptible biomarkers associated with the TCE-induced hypersensitivity dermatitis in genes located in the human leukocyte antigen (HLA) region. Methods From 1998 to 2006, 121 cases with TCE-induced hypersensitivity dermatitis and 142 tolerant controls were recruited into the population-based case–control study. We determined HLA alleles B, DRB1, DQA1, and DQB1, by sequence-based typing. p-Values were corrected for comparisons of multiple HLA alleles. In addition, we compared and analyzed the structure character of amino acid residues of HLA molecules found in participants. Results We obtained complete genotyping data of 113 cases and 142 controls. The allele HLA-B*1301 was present in 83 (73.5%) of 113 patients compared with 13 (9.2%) of 142 tolerant workers (odds ratio = 27.5; 95% confidence interval, 13.5–55.7; corrected p = 1.48 × 10−21). In addition, the HLA-B*44 alleles were present in 6.2% (7/113) of patients, but were absent in TCE-tolerant workers. Residue 95 shared by HLA-B*1301 and HLA-B*44 molecules formed a different pocket F than other residues. Conclusions The allele HLA-B*1301 is strongly associated with TCE-induced hypersensitivity dermatitis among exposed workers and might be used as a biomarker to predict high risk individuals to TCE. PMID:18007983
Shiran, Behrouz; Rabei, Mohammad; Fallahi, Hossein
2016-01-01
Spring frost is an important environmental stress that threatens the production of Prunus trees. However, little information is available regarding molecular response of these plants to the frost stress. Using high throughput sequencing, this study was conducted to identify differentially expressed miRNAs, both the conserved and the non-conserved ones, in the reproductive tissues of almond tolerant H genotype under cold stress. Analysis of 50 to 58 million raw reads led to identification of 174 unique conserved and 59 novel microRNAs (miRNAs). Differential expression pattern analysis showed that 50 miRNA families were expressed differentially in one or both of almond reproductive tissues (anther and ovary). Out of these 50 miRNA families, 12 and 15 displayed up-regulation and down-regulation, respectively. The distribution of conserved miRNA families indicated that miR482f harbor the highest number of members. Confirmation of miRNAs expression patterns by quantitative real- time PCR (qPCR) was performed in cold tolerant (H genotype) alongside a sensitive variety (Sh12 genotype). Our analysis revealed differential expression for 9 miRNAs in anther and 3 miRNAs in ovary between these two varieties. Target prediction of miRNAs followed by differential expression analysis resulted in identification of 83 target genes, mostly transcription factors. This study comprehensively catalogued expressed miRNAs under different temperatures in two reproductive tissues (anther and ovary). Results of current study and the previous RNA-seq study, which was conducted in the same tissues by our group, provide a unique opportunity to understand the molecular basis of responses of almond to cold stress. The results can also enhance the possibility for gene manipulation to develop cold tolerant plants. PMID:27253370
NASA Astrophysics Data System (ADS)
Xia, Huanxiong; Xiang, Dong; Yang, Wang; Mou, Peng
2014-12-01
Low-temperature plasma technique is one of the critical techniques in IC manufacturing process, such as etching and thin-film deposition, and the uniformity greatly impacts the process quality, so the design for the plasma uniformity control is very important but difficult. It is hard to finely and flexibly regulate the spatial distribution of the plasma in the chamber via controlling the discharge parameters or modifying the structure in zero-dimensional space, and it just can adjust the overall level of the process factors. In the view of this problem, a segmented non-uniform dielectric module design solution is proposed for the regulation of the plasma profile in a CCP chamber. The solution achieves refined and flexible regulation of the plasma profile in the radial direction via configuring the relative permittivity and the width of each segment. In order to solve this design problem, a novel simulation-based auto-design approach is proposed, which can automatically design the positional sequence with multi independent variables to make the output target profile in the parameterized simulation model approximate the one that users preset. This approach employs an idea of quasi-closed-loop control system, and works in an iterative mode. It starts from initial values of the design variable sequences, and predicts better sequences via the feedback of the profile error between the output target profile and the expected one. It never stops until the profile error is narrowed in the preset tolerance.
MIPS: a calmodulin-binding protein of Gracilaria lemaneiformis under heat shock.
Zhang, Xuan; Zhou, Huiyue; Zang, Xiaonan; Gong, Le; Sun, Hengyi; Zhang, Xuecheng
2014-08-01
To study the Ca(2+)/Calmodulin (CaM) signal transduction pathway of Gracilaria lemaneiformis under heat stress, myo-inositol-1-phosphate synthase (MIPS), a calmodulin-binding protein, was isolated using the yeast two-hybrid system. cDNA and DNA sequences of mips were cloned from G. lemaneiformis by using 5'RACE and genome walking procedures. The MIPS DNA sequence was 2,067 nucleotides long, containing an open reading frame (ORF) of 1,623 nucleotides with no intron. The mips ORF was predicted to encode 540 amino acids, which included the conserved MIPS domain and was 61-67 % similar to that of other species. After analyzing the amino acid sequence of MIPS, the CaM-Binding Domain (CaMBD) was inferred to be at a site spanning from amino acid 212 to amino acid 236. The yeast two-hybrid results proved that MIPS can interact with CaM and that MIPS is a type of calmodulin-binding protein. Next, the expression of CaM and MIPS in wild-type G. lemaneiformis and a heat-tolerant G. lemaneiformis cultivar, "981," were analyzed using real-time PCR under a heat shock of 32 °C. The expression level displayed a cyclical upward trend. Compared with wild type, the CaM expression levels of cultivar 981 were higher, which might directly relate to its resistance to high temperatures. This paper indicates that MIPS and CaM may play important roles in the high-temperature resistance of G. lemaneiformis.
Evaluating the accuracy of SHAPE-directed RNA secondary structure predictions
Sükösd, Zsuzsanna; Swenson, M. Shel; Kjems, Jørgen; Heitsch, Christine E.
2013-01-01
Recent advances in RNA structure determination include using data from high-throughput probing experiments to improve thermodynamic prediction accuracy. We evaluate the extent and nature of improvements in data-directed predictions for a diverse set of 16S/18S ribosomal sequences using a stochastic model of experimental SHAPE data. The average accuracy for 1000 data-directed predictions always improves over the original minimum free energy (MFE) structure. However, the amount of improvement varies with the sequence, exhibiting a correlation with MFE accuracy. Further analysis of this correlation shows that accurate MFE base pairs are typically preserved in a data-directed prediction, whereas inaccurate ones are not. Thus, the positive predictive value of common base pairs is consistently higher than the directed prediction accuracy. Finally, we confirm sequence dependencies in the directability of thermodynamic predictions and investigate the potential for greater accuracy improvements in the worst performing test sequence. PMID:23325843
Rushton, Laura; Sass, Andrea; Baldwin, Adam; Dowson, Christopher G; Donoghue, Denise; Mahenthiralingam, Eshwar
2013-07-01
Bacteria from the Burkholderia cepacia complex (Bcc) are encountered as industrial contaminants, and little is known about the species involved or their mechanisms of preservative resistance. Multilocus sequence typing (MLST) revealed that multiple Bcc species may cause contamination, with B. lata (n = 17) and B. cenocepacia (n = 11) dominant within the collection examined. At the strain level, 11 of the 31 industrial sequence types identified had also been recovered from either natural environments or clinical infections. Minimal inhibitory (MIC) and minimum bactericidal (MBC) preservative concentrations varied across 83 selected Bcc strains, with industrial strains demonstrating increased tolerance for dimethylol dimethyl hydantoin (DMDMH). Benzisothiazolinone (BIT), DMDMH, methylisothiazolinone (MIT), a blend of 3:1 methylisothiazolinone-chloromethylisothiazolinone (M-CMIT), methyl paraben (MP), and phenoxyethanol (PH), were all effective anti-Bcc preservatives; benzethonium chloride (BC) and sodium benzoate (SB) were least effective. Since B. lata was the dominant industrial Bcc species, the type strain, 383(T) (LMG 22485(T)), was used to study preservative tolerance. Strain 383 developed stable preservative tolerance for M-CMIT, MIT, BIT, and BC, which resulted in preservative cross-resistance and altered antibiotic susceptibility, motility, and biofilm formation. Transcriptomic analysis of the B. lata 383 M-CMIT-adapted strain demonstrated that efflux played a key role in its M-CMIT tolerance and elevated fluoroquinolone resistance. The role of efflux was corroborated using the inhibitor l-Phe-Arg-β-napthylamide, which reduced the MICs of M-CMIT and ciprofloxacin. In summary, intrinsic preservative tolerance and stable adaptive changes, such as enhanced efflux, play a role in the ability of Bcc bacteria to cause industrial contamination.
Rushton, Laura; Sass, Andrea; Baldwin, Adam; Dowson, Christopher G.; Donoghue, Denise
2013-01-01
Bacteria from the Burkholderia cepacia complex (Bcc) are encountered as industrial contaminants, and little is known about the species involved or their mechanisms of preservative resistance. Multilocus sequence typing (MLST) revealed that multiple Bcc species may cause contamination, with B. lata (n = 17) and B. cenocepacia (n = 11) dominant within the collection examined. At the strain level, 11 of the 31 industrial sequence types identified had also been recovered from either natural environments or clinical infections. Minimal inhibitory (MIC) and minimum bactericidal (MBC) preservative concentrations varied across 83 selected Bcc strains, with industrial strains demonstrating increased tolerance for dimethylol dimethyl hydantoin (DMDMH). Benzisothiazolinone (BIT), DMDMH, methylisothiazolinone (MIT), a blend of 3:1 methylisothiazolinone-chloromethylisothiazolinone (M-CMIT), methyl paraben (MP), and phenoxyethanol (PH), were all effective anti-Bcc preservatives; benzethonium chloride (BC) and sodium benzoate (SB) were least effective. Since B. lata was the dominant industrial Bcc species, the type strain, 383T (LMG 22485T), was used to study preservative tolerance. Strain 383 developed stable preservative tolerance for M-CMIT, MIT, BIT, and BC, which resulted in preservative cross-resistance and altered antibiotic susceptibility, motility, and biofilm formation. Transcriptomic analysis of the B. lata 383 M-CMIT-adapted strain demonstrated that efflux played a key role in its M-CMIT tolerance and elevated fluoroquinolone resistance. The role of efflux was corroborated using the inhibitor l-Phe-Arg-β-napthylamide, which reduced the MICs of M-CMIT and ciprofloxacin. In summary, intrinsic preservative tolerance and stable adaptive changes, such as enhanced efflux, play a role in the ability of Bcc bacteria to cause industrial contamination. PMID:23587949
Priyanka, B; Sekhar, K; Sunita, T; Reddy, V D; Rao, Khareedu Venkateswara
2010-03-01
Pigeonpea, a major grain legume crop with remarkable drought tolerance traits, has been used for the isolation of stress-responsive genes. Herein, we report generation of ESTs, transcript profiles of selected genes and validation of candidate genes obtained from the subtracted cDNA libraries of pigeonpea plants subjected to PEG/water-deficit stress conditions. Cluster analysis of 124 selected ESTs yielded 75 high-quality ESTs. Homology searches disclosed that 55 ESTs share significant similarity with the known/putative proteins or ESTs available in the databases. These ESTs were characterized and genes relevant to the specific physiological processes were identified. Of the 75 ESTs obtained from the cDNA libraries of drought-stressed plants, 20 ESTs proved to be unique to the pigeonpea. These sequences are envisaged to serve as a potential source of stress-inducible genes of the drought stress-response transcriptome, and hence may be used for deciphering the mechanism of drought tolerance of the pigeonpea. Expression profiles of selected genes revealed increased levels of m-RNA transcripts in pigeonpea plants subjected to different abiotic stresses. Transgenic Arabidopsis lines, expressing Cajanus cajan hybrid-proline-rich protein (CcHyPRP), C. cajan cyclophilin (CcCYP) and C. cajan cold and drought regulatory (CcCDR) genes, exhibited marked tolerance, increased plant biomass and enhanced photosynthetic rates under PEG/NaCl/cold/heat stress conditions. This study represents the first report dealing with the isolation of drought-specific ESTs, transcriptome analysis and functional validation of drought-responsive genes of the pigeonpea. These genes, as such, hold promise for engineering crop plants bestowed with tolerance to major abiotic stresses.
Tambat, Subodh; Vasudevan, Madavan
2016-01-01
Although salt tolerance is a feature representative of halophytes, most studies on this topic in plants have been conducted on glycophytes. Transcriptome profiles are also available for only a limited number of halophytes. Hence, the present study was conducted to understand the molecular basis of salt tolerance through the transcriptome profiling of the halophyte Suaeda maritima, which is an emerging plant model for research on salt tolerance. Illumina sequencing revealed 72,588 clustered transcripts, including 27,434 that were annotated using BLASTX. Salt application resulted in the 2-fold or greater upregulation of 647 genes and downregulation of 735 genes. Of these, 391 proteins were homologous to proteins in the COGs (cluster of orthologous groups) database, and the majorities were grouped into the poorly characterized category. Approximately 50% of the genes assigned to MapMan pathways showed homology to S. maritima. The majority of such genes represented transcription factors. Several genes also contributed to cell wall and carbohydrate metabolism, ion relation, redox responses and G protein, phosphoinositide and hormone signaling. Real-time PCR was used to validate the results of the deep sequencing for the most of the genes. This study demonstrates the expression of protein kinase C, the target of diacylglycerol in phosphoinositide signaling, for the first time in plants. This study further reveals that the biochemical and molecular responses occurring at several levels are associated with salt tolerance in S. maritima. At the structural level, adaptations to high salinity levels include the remodeling of cell walls and the modification of membrane lipids. At the cellular level, the accumulation of glycinebetaine and the sequestration and exclusion of Na+ appear to be important. Moreover, this study also shows that the processes related to salt tolerance might be highly complex, as reflected by the salt-induced enhancement of transcription factor expression, including hormone-responsive factors, and that this process might be initially triggered by G protein and phosphoinositide signaling. PMID:27682829
2012-01-01
Background Metallothioneins (MT) are low molecular weight, cysteine rich metal binding proteins, found across genera and species, but their function(s) in abiotic stress tolerance are not well documented. Results We have characterized a rice MT gene, OsMT1e-P, isolated from a subtractive library generated from a stressed salinity tolerant rice genotype, Pokkali. Bioinformatics analysis of the rice genome sequence revealed that this gene belongs to a multigenic family, which consists of 13 genes with 15 protein products. OsMT1e-P is located on chromosome XI, away from the majority of other type I genes that are clustered on chromosome XII. Various members of this MT gene cluster showed a tight co-regulation pattern under several abiotic stresses. Sequence analysis revealed the presence of conserved cysteine residues in OsMT1e-P protein. Salinity stress was found to regulate the transcript abundance of OsMT1e-P in a developmental and organ specific manner. Using transgenic approach, we found a positive correlation between ectopic expression of OsMT1e-P and stress tolerance. Our experiments further suggest ROS scavenging to be the possible mechanism for multiple stress tolerance conferred by OsMT1e-P. Conclusion We present an overview of MTs, describing their gene structure, genome localization and expression patterns under salinity and development in rice. We have found that ectopic expression of OsMT1e-P enhances tolerance towards multiple abiotic stresses in transgenic tobacco and the resultant plants could survive and set viable seeds under saline conditions. Taken together, the experiments presented here have indicated that ectopic expression of OsMT1e-P protects against oxidative stress primarily through efficient scavenging of reactive oxygen species. PMID:22780875
Kumar, Gautam; Kushwaha, Hemant Ritturaj; Panjabi-Sabharwal, Vaishali; Kumari, Sumita; Joshi, Rohit; Karan, Ratna; Mittal, Shweta; Pareek, Sneh L Singla; Pareek, Ashwani
2012-07-10
Metallothioneins (MT) are low molecular weight, cysteine rich metal binding proteins, found across genera and species, but their function(s) in abiotic stress tolerance are not well documented. We have characterized a rice MT gene, OsMT1e-P, isolated from a subtractive library generated from a stressed salinity tolerant rice genotype, Pokkali. Bioinformatics analysis of the rice genome sequence revealed that this gene belongs to a multigenic family, which consists of 13 genes with 15 protein products. OsMT1e-P is located on chromosome XI, away from the majority of other type I genes that are clustered on chromosome XII. Various members of this MT gene cluster showed a tight co-regulation pattern under several abiotic stresses. Sequence analysis revealed the presence of conserved cysteine residues in OsMT1e-P protein. Salinity stress was found to regulate the transcript abundance of OsMT1e-P in a developmental and organ specific manner. Using transgenic approach, we found a positive correlation between ectopic expression of OsMT1e-P and stress tolerance. Our experiments further suggest ROS scavenging to be the possible mechanism for multiple stress tolerance conferred by OsMT1e-P. We present an overview of MTs, describing their gene structure, genome localization and expression patterns under salinity and development in rice. We have found that ectopic expression of OsMT1e-P enhances tolerance towards multiple abiotic stresses in transgenic tobacco and the resultant plants could survive and set viable seeds under saline conditions. Taken together, the experiments presented here have indicated that ectopic expression of OsMT1e-P protects against oxidative stress primarily through efficient scavenging of reactive oxygen species.
Optical Processing Techniques For Pseudorandom Sequence Prediction
NASA Astrophysics Data System (ADS)
Gustafson, Steven C.
1983-11-01
Pseudorandom sequences are series of apparently random numbers generated, for example, by linear or nonlinear feedback shift registers. An important application of these sequences is in spread spectrum communication systems, in which, for example, the transmitted carrier phase is digitally modulated rapidly and pseudorandomly and in which the information to be transmitted is incorporated as a slow modulation in the pseudorandom sequence. In this case the transmitted information can be extracted only by a receiver that uses for demodulation the same pseudorandom sequence used by the transmitter, and thus this type of communication system has a very high immunity to third-party interference. However, if a third party can predict in real time the probable future course of the transmitted pseudorandom sequence given past samples of this sequence, then interference immunity can be significantly reduced.. In this application effective pseudorandom sequence prediction techniques should be (1) applicable in real time to rapid (e.g., megahertz) sequence generation rates, (2) applicable to both linear and nonlinear pseudorandom sequence generation processes, and (3) applicable to error-prone past sequence samples of limited number and continuity. Certain optical processing techniques that may meet these requirements are discussed in this paper. In particular, techniques based on incoherent optical processors that perform general linear transforms or (more specifically) matrix-vector multiplications are considered. Computer simulation examples are presented which indicate that significant prediction accuracy can be obtained using these transforms for simple pseudorandom sequences. However, the useful prediction of more complex pseudorandom sequences will probably require the application of more sophisticated optical processing techniques.
Tolerance of sexual harassment: a laboratory paradigm.
Angelone, David J; Mitchell, Damon; Carola, Kara
2009-12-01
The present study attempted to develop a laboratory analogue for the study of tolerance for sexual harassment by using an online speed-dating paradigm. In that context, the relation between participants' sexual harassment attitudes, perpetrator attractiveness, perpetrator status, and perceived dating potential of the perpetrator were examined as factors influencing participants' tolerance of sexually harassing behavior. Participants were 128 female college students from a small northeastern public university. Results indicated that attractiveness, high social status, and attitudinal beliefs about sexual harassment were all predictive of tolerance for sexual harassment, providing preliminary support for the validity of this paradigm. In addition, participants' self reported likelihood to date a bogus male dating candidate was also predictive of tolerance for sexual harassment, over and above the aforementioned variables, suggesting that dating potential can play a role in perceptions of sexual harassment. Further, this experiment demonstrated that perceptions of sexual harassment can be assessed using the in vivo measurement of behavior. In addition, using an online environment not only provides a contemporary spin and adds a greater degree of external validity compared to other sexual harassment analogues, it also reduces any risk of potential physical sexual contact for participants.
Roberts, James R; Dollard, Denis
2010-12-01
The human body and the central nervous system can develop tremendous tolerance to ethanol. Mental and physical dysfunctions from ethanol, in an alcohol-tolerant individual, do not consistently correlate with ethanol levels traditionally used to define intoxication, or even lethality, in a nontolerant subject. Attempting to relate observed signs of alcohol intoxication or impairment, or to evaluate sobriety, by quantifying blood alcohol levels can be misleading, if not impossible. We report a case demonstrating the disconnect between alcohol levels and generally assigned parameters of intoxication and impairment. In this case, an alcohol-tolerant man, with a serum ethanol level of 515 mg/dl, appeared neurologically intact and cognitively normal. This individual was without objective signs of impairment or intoxication by repeated evaluations by experienced emergency physicians. In alcohol-tolerant individuals, blood alcohol levels cannot always be predicted by and do not necessarily correlate with outward appearance, overt signs of intoxication, or physical examination. This phenomenon must be acknowledged when analyzing medical decision making in the emergency department or when evaluating the ability of bartenders and party hosts to identify intoxication in dram shop cases.
Protein location prediction using atomic composition and global features of the amino acid sequence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cherian, Betsy Sheena, E-mail: betsy.skb@gmail.com; Nair, Achuthsankar S.
2010-01-22
Subcellular location of protein is constructive information in determining its function, screening for drug candidates, vaccine design, annotation of gene products and in selecting relevant proteins for further studies. Computational prediction of subcellular localization deals with predicting the location of a protein from its amino acid sequence. For a computational localization prediction method to be more accurate, it should exploit all possible relevant biological features that contribute to the subcellular localization. In this work, we extracted the biological features from the full length protein sequence to incorporate more biological information. A new biological feature, distribution of atomic composition is effectivelymore » used with, multiple physiochemical properties, amino acid composition, three part amino acid composition, and sequence similarity for predicting the subcellular location of the protein. Support Vector Machines are designed for four modules and prediction is made by a weighted voting system. Our system makes prediction with an accuracy of 100, 82.47, 88.81 for self-consistency test, jackknife test and independent data test respectively. Our results provide evidence that the prediction based on the biological features derived from the full length amino acid sequence gives better accuracy than those derived from N-terminal alone. Considering the features as a distribution within the entire sequence will bring out underlying property distribution to a greater detail to enhance the prediction accuracy.« less
Ali, Akhtar; Raddatz, Natalia; Aman, Rashid; Kim, Songmi; Park, Hyeong Cheol; Jan, Masood; Baek, Dongwon; Khan, Irfan Ullah; Oh, Dong-Ha; Lee, Sang Yeol; Bressan, Ray A; Lee, Keun Woo; Maggio, Albino; Pardo, Jose M; Bohnert, Hans J; Yun, Dae-Jin
2016-07-01
A crucial prerequisite for plant growth and survival is the maintenance of potassium uptake, especially when high sodium surrounds the root zone. The Arabidopsis HIGH-AFFINITY K(+) TRANSPORTER1 (HKT1), and its homologs in other salt-sensitive dicots, contributes to salinity tolerance by removing Na(+) from the transpiration stream. However, TsHKT1;2, one of three HKT1 copies in Thellungiella salsuginea, a halophytic Arabidopsis relative, acts as a K(+) transporter in the presence of Na(+) in yeast (Saccharomyces cerevisiae). Amino-acid sequence comparisons indicated differences between TsHKT1;2 and most other published HKT1 sequences with respect to an Asp residue (D207) in the second pore-loop domain. Two additional T salsuginea and most other HKT1 sequences contain Asn (n) in this position. Wild-type TsHKT1;2 and altered AtHKT1 (AtHKT1(N-D)) complemented K(+)-uptake deficiency of yeast cells. Mutant hkt1-1 plants complemented with both AtHKT1(N) (-) (D) and TsHKT1;2 showed higher tolerance to salt stress than lines complemented by the wild-type AtHKT1 Electrophysiological analysis in Xenopus laevis oocytes confirmed the functional properties of these transporters and the differential selectivity for Na(+) and K(+) based on the n/d variance in the pore region. This change also dictated inward-rectification for Na(+) transport. Thus, the introduction of Asp, replacing Asn, in HKT1-type transporters established altered cation selectivity and uptake dynamics. We describe one way, based on a single change in a crucial protein that enabled some crucifer species to acquire improved salt tolerance, which over evolutionary time may have resulted in further changes that ultimately facilitated colonization of saline habitats. © 2016 American Society of Plant Biologists. All Rights Reserved.
Zhang, Rong-Xiang; Qin, Li-Jun; Zhao, De-Gang
2017-07-20
Inositol is a cyclic polyol that is involved in various physiological processes, including signal transduction and stress adaptation in plants. l- myo -inositol monophosphatase (IMPase) is one of the metal-dependent phosphatase family members and catalyzes the last reaction step of biosynthesis of inositol. Although increased IMPase activity induced by abiotic stress has been reported in chickpea plants, the role and regulation of the IMP gene in rice ( Oryza sativa L.) remains poorly understood. In the present work, we obtained a full-length cDNA sequence coding IMPase in the cold tolerant rice landraces in Gaogonggui, which is named as OsIMP . Multiple alignment results have displayed that this sequence has characteristic signature motifs and conserved enzyme active sites of the phosphatase super family. Phylogenetic analysis showed that IMPase is most closely related to that of the wild rice Oryza brachyantha , while transcript analysis revealed that the expression of the OsIMP is significantly induced by cold stress and exogenous abscisic acid (ABA) treatment. Meanwhile, we cloned the 5' flanking promoter sequence of the OsIMP gene and identified several important cis -acting elements, such as LTR (low-temperature responsiveness), TCA-element (salicylic acid responsiveness), ABRE-element (abscisic acid responsiveness), GARE-motif (gibberellin responsive), MBS (MYB Binding Site) and other cis -acting elements related to defense and stress responsiveness. To further investigate the potential function of the OsIMP gene, we generated transgenic tobacco plants overexpressing the OsIMP gene and the cold tolerance test indicated that these transgenic tobacco plants exhibit improved cold tolerance. Furthermore, transgenic tobacco plants have a lower level of hydrogen peroxide (H₂O₂) and malondialdehyde (MDA), and a higher content of total chlorophyll as well as increased antioxidant enzyme activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD), when compared to wild type (WT) tobacco plants under normal and cold stress conditions.
Saravanan, Konda Mani; Dunker, A Keith; Krishnaswamy, Sankaran
2017-12-27
More than 60 prediction methods for intrinsically disordered proteins (IDPs) have been developed over the years, many of which are accessible on the World Wide Web. Nearly, all of these predictors give balanced accuracies in the ~65%-~80% range. Since predictors are not perfect, further studies are required to uncover the role of amino acid residues in native IDP as compared to predicted IDP regions. In the present work, we make use of sequences of 100% predicted IDP regions, false positive disorder predictions, and experimentally determined IDP regions to distinguish the characteristics of native versus predicted IDP regions. A higher occurrence of asparagine is observed in sequences of native IDP regions but not in sequences of false positive predictions of IDP regions. The occurrences of certain combinations of amino acids at the pentapeptide level provide a distinguishing feature in the IDPs with respect to globular proteins. The distinguishing features presented in this paper provide insights into the sequence fingerprints of amino acid residues in experimentally determined as compared to predicted IDP regions. These observations and additional work along these lines should enable the development of improvements in the accuracy of disorder prediction algorithm.
Barker, Jessica L.; Bronstein, Judith L.
2016-01-01
Exploitation in cooperative interactions both within and between species is widespread. Although it is assumed to be costly to be exploited, mechanisms to control exploitation are surprisingly rare, making the persistence of cooperation a fundamental paradox in evolutionary biology and ecology. Focusing on between-species cooperation (mutualism), we hypothesize that the temporal sequence in which exploitation occurs relative to cooperation affects its net costs and argue that this can help explain when and where control mechanisms are observed in nature. Our principal prediction is that when exploitation occurs late relative to cooperation, there should be little selection to limit its effects (analogous to “tolerated theft” in human cooperative groups). Although we focus on cases in which mutualists and exploiters are different individuals (of the same or different species), our inferences can readily be extended to cases in which individuals exhibit mixed cooperative-exploitative strategies. We demonstrate that temporal structure should be considered alongside spatial structure as an important process affecting the evolution of cooperation. We also provide testable predictions to guide future empirical research on interspecific as well as intraspecific cooperation. PMID:26841169
7 CFR 610.14 - Use of USLE, RUSLE, and WEQ.
Code of Federal Regulations, 2011 CFR
2011-01-01
..., DEPARTMENT OF AGRICULTURE CONSERVATION OPERATIONS TECHNICAL ASSISTANCE Soil Erosion Prediction Equations..., this includes the soil loss tolerance values used in those formulas for determining HEL. The soil loss tolerance value is used as one of the criteria for planning soil conservation systems. These values are...
7 CFR 610.14 - Use of USLE, RUSLE, and WEQ.
Code of Federal Regulations, 2013 CFR
2013-01-01
..., DEPARTMENT OF AGRICULTURE CONSERVATION OPERATIONS TECHNICAL ASSISTANCE Soil Erosion Prediction Equations..., this includes the soil loss tolerance values used in those formulas for determining HEL. The soil loss tolerance value is used as one of the criteria for planning soil conservation systems. These values are...
7 CFR 610.14 - Use of USLE, RUSLE, and WEQ.
Code of Federal Regulations, 2014 CFR
2014-01-01
..., DEPARTMENT OF AGRICULTURE CONSERVATION OPERATIONS TECHNICAL ASSISTANCE Soil Erosion Prediction Equations..., this includes the soil loss tolerance values used in those formulas for determining HEL. The soil loss tolerance value is used as one of the criteria for planning soil conservation systems. These values are...
7 CFR 610.14 - Use of USLE, RUSLE, and WEQ.
Code of Federal Regulations, 2012 CFR
2012-01-01
..., DEPARTMENT OF AGRICULTURE CONSERVATION OPERATIONS TECHNICAL ASSISTANCE Soil Erosion Prediction Equations..., this includes the soil loss tolerance values used in those formulas for determining HEL. The soil loss tolerance value is used as one of the criteria for planning soil conservation systems. These values are...
7 CFR 610.14 - Use of USLE, RUSLE, and WEQ.
Code of Federal Regulations, 2010 CFR
2010-01-01
..., DEPARTMENT OF AGRICULTURE CONSERVATION OPERATIONS TECHNICAL ASSISTANCE Soil Erosion Prediction Equations..., this includes the soil loss tolerance values used in those formulas for determining HEL. The soil loss tolerance value is used as one of the criteria for planning soil conservation systems. These values are...
Analysis of fault-tolerant neurocontrol architectures
NASA Technical Reports Server (NTRS)
Troudet, T.; Merrill, W.
1992-01-01
The fault-tolerance of analog parallel distributed implementations of a multivariable aircraft neurocontroller is analyzed by simulating weight and neuron failures in a simplified scheme of analog processing based on the functional architecture of the ETANN chip (Electrically Trainable Artificial Neural Network). The neural information processing is found to be only partially distributed throughout the set of weights of the neurocontroller synthesized with the backpropagation algorithm. Although the degree of distribution of the neural processing, and consequently the fault-tolerance of the neurocontroller, could be enhanced using Locally Distributed Weight and Neuron Approaches, a satisfactory level of fault-tolerance could only be obtained by retraining the degrated VLSI neurocontroller. The possibility of maintaining neurocontrol performance and stability in the presence of single weight of neuron failures was demonstrated through an automated retraining procedure of the neurocontroller based on a pre-programmed choice and sequence of the training parameters.
The response of transgenic Brassica species to salt stress: a review.
Shah, Nadil; Anwar, Sumera; Xu, Jingjing; Hou, Zhaoke; Salah, Akram; Khan, Shahbaz; Gong, Jianfang; Shang, Zhengwei; Qian, Li; Zhang, Chunyu
2018-06-01
Salt stress is considered one of the main abiotic factors to limit crop growth and productivity by affecting morpho-physiological and biochemical processes. Genetically, a number of salt tolerant Brassica varieties have been developed and introduced, but breeding of such varieties is time consuming. Therefore, current focus is on transgenic technology, which plays an important role in the development of salt tolerant varieties. Various salt tolerant genes have been characterized and incorporated into Brassica. Therefore, such genetic transformation of Brassica species is a significant step for improvement of crops, as well as conferring salt stress resistance qualities to Brassica species. Complete genome sequencing has made the task of genetically transforming Brassica species easier, by identifying desired candidate genes. The present review discusses relevant information about the principles which should be employed to develop transgenic Brassica species, and also will recommend tools for improved tolerance to salinity.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Li, Man; Ling, Cheng; Xu, Qi; Gao, Jingyang
2018-02-01
Sequence classification is crucial in predicting the function of newly discovered sequences. In recent years, the prediction of the incremental large-scale and diversity of sequences has heavily relied on the involvement of machine-learning algorithms. To improve prediction accuracy, these algorithms must confront the key challenge of extracting valuable features. In this work, we propose a feature-enhanced protein classification approach, considering the rich generation of multiple sequence alignment algorithms, N-gram probabilistic language model and the deep learning technique. The essence behind the proposed method is that if each group of sequences can be represented by one feature sequence, composed of homologous sites, there should be less loss when the sequence is rebuilt, when a more relevant sequence is added to the group. On the basis of this consideration, the prediction becomes whether a query sequence belonging to a group of sequences can be transferred to calculate the probability that the new feature sequence evolves from the original one. The proposed work focuses on the hierarchical classification of G-protein Coupled Receptors (GPCRs), which begins by extracting the feature sequences from the multiple sequence alignment results of the GPCRs sub-subfamilies. The N-gram model is then applied to construct the input vectors. Finally, these vectors are imported into a convolutional neural network to make a prediction. The experimental results elucidate that the proposed method provides significant performance improvements. The classification error rate of the proposed method is reduced by at least 4.67% (family level I) and 5.75% (family Level II), in comparison with the current state-of-the-art methods. The implementation program of the proposed work is freely available at: https://github.com/alanFchina/CNN .
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Xian-Wen, E-mail: xianwenli01@sina.com; College of Life Science, Xinyang Normal University, Xinyang 464000; Key Laboratory of Horticultural Plant Biology of the Ministry of Education, Huazhong Agricultural University, Wuhan 430070
In present research, the full-length cDNA and the genomic sequence of a novel cold-regulated gene, CsCOR1, were isolated from Camellia sinensis L. The deduced protein CsCOR1 contains a hydrophobic N-terminus as a signal peptide and a hydrophilic C-terminal domain that is rich in glycine, arginine and proline. Two internal repetitive tridecapeptide fragments (HSVTAGRGGYNRG) exist in the middle of the C-terminal domain and the two nucleotide sequences encoding them are identical. CsCOR1 was localized in the cell walls of transgenic-tobaccos via CsCOR1::GFP fusion approach. The expression of CsCOR1 in tea leaves was enhanced dramatically by both cold- and dehydration-stress. And overexpressionmore » of CsCOR1 in transgenic-tobaccos improved obviously the tolerance to salinity and dehydration.« less
Dong, Xiangrong; Wang, Yanping; Yang, Fengyuan; Zhao, Shanshan; Tian, Bing; Li, Tao
2017-01-01
Lycopene biosynthetic genes from Deinococcus radiodurans were co-expressed in Lactococcus lactis to produce lycopene and improve its tolerance to stress. Lycopene-related genes from D. radiodurans, DR1395 (crtE), DR0862 (crtB), and DR0861 (crtI), were fused in line with S hine-Dalgarno (SD) sequences and co-expressed in L. lactis. The recombinant strain produced 0.36 mg lycopene g -1 dry cell wt after 48 h fermentation. The survival rate to UV irradiation of the recombinant strain was higher than that of the non-transformed strain. The L. lactis with co-expressed genes responsible for lycopene biosynthesis from D. radiodurans produced lycopene and exhibited increased resistance to UV stress, suggesting that the recombinant strain has important application potential in food industry.
Hu, Yau-Chung; Kang, Chao-Kai; Tang, Cheng-Hao; Lee, Tsung-Han
2015-01-01
Milkfish (Chanos chanos), an important marine aquaculture species in southern Taiwan, show considerable euryhalinity but have low tolerance to sudden drops in water temperatures in winter. Here, we used high throughput next-generation sequencing (NGS) to identify molecular and biological processes involved in the responses to environmental changes. Preliminary tests revealed that seawater (SW)-acclimated milkfish tolerated lower temperatures than the fresh water (FW)-acclimated group. Although FW- and SW-acclimated milkfish have different levels of tolerance for hypothermal stress, to date, the molecular physiological basis of this difference has not been elucidated. Here, we performed a next-generation sequence analysis of mRNAs from four groups of milkfish. We obtained 29669 unigenes with an average length of approximately 1936 base pairs. Gene ontology (GO) analysis was performed after gene annotation. A large number of genes for molecular regulation were identified through a transcriptomic comparison in a KEGG analysis. Basal metabolic pathways involved in hypothermal tolerance, such as glycolysis, fatty acid metabolism, amino acid catabolism and oxidative phosphorylation, were analyzed using PathVisio and Cytoscape software. Our results indicate that in response to hypothermal stress, genes for oxidative phosphorylation, e.g., succinate dehydrogenase, were more highly up-regulated in SW than FW fish. Moreover, SW and FW milkfish used different strategies when exposed to hypothermal stress: SW milkfish up-regulated oxidative phosphorylation and catabolism genes to produce more energy budget, whereas FW milkfish down-regulated genes related to basal metabolism to reduce energy loss.
Hu, Yau-Chung; Kang, Chao-Kai; Tang, Cheng-Hao; Lee, Tsung-Han
2015-01-01
Milkfish (Chanos chanos), an important marine aquaculture species in southern Taiwan, show considerable euryhalinity but have low tolerance to sudden drops in water temperatures in winter. Here, we used high throughput next-generation sequencing (NGS) to identify molecular and biological processes involved in the responses to environmental changes. Preliminary tests revealed that seawater (SW)-acclimated milkfish tolerated lower temperatures than the fresh water (FW)-acclimated group. Although FW- and SW-acclimated milkfish have different levels of tolerance for hypothermal stress, to date, the molecular physiological basis of this difference has not been elucidated. Here, we performed a next-generation sequence analysis of mRNAs from four groups of milkfish. We obtained 29669 unigenes with an average length of approximately 1936 base pairs. Gene ontology (GO) analysis was performed after gene annotation. A large number of genes for molecular regulation were identified through a transcriptomic comparison in a KEGG analysis. Basal metabolic pathways involved in hypothermal tolerance, such as glycolysis, fatty acid metabolism, amino acid catabolism and oxidative phosphorylation, were analyzed using PathVisio and Cytoscape software. Our results indicate that in response to hypothermal stress, genes for oxidative phosphorylation, e.g., succinate dehydrogenase, were more highly up-regulated in SW than FW fish. Moreover, SW and FW milkfish used different strategies when exposed to hypothermal stress: SW milkfish up-regulated oxidative phosphorylation and catabolism genes to produce more energy budget, whereas FW milkfish down-regulated genes related to basal metabolism to reduce energy loss. PMID:26263550
Grasso, Filomena; Coppola, Mariangela; Carbone, Fabrizio; Baldoni, Luciana; Alagna, Fiammetta; Perrotta, Gaetano; Pérez-Pulido, Antonio J.; Garonna, Antonio; Facella, Paolo; Daddiego, Loretta; Lopez, Loredana; Vitiello, Alessia; Rao, Rosa
2017-01-01
The olive fruit fly Bactrocera oleae (Diptera: Tephritidae) is the most devastating pest of cultivated olive (Olea europaea L.). Intraspecific variation in plant resistance to B. oleae has been described only at phenotypic level. In this work, we used a transcriptomic approach to study the molecular response to the olive fruit fly in two olive cultivars with contrasting level of susceptibility. Using next-generation pyrosequencing, we first generated a catalogue of more than 80,000 sequences expressed in drupes from approximately 700k reads. The assembled sequences were used to develop a microarray layout with over 60,000 olive-specific probes. The differential gene expression analysis between infested (i.e. with II or III instar larvae) and control drupes indicated a significant intraspecific variation between the more tolerant and susceptible cultivar. Around 2500 genes were differentially regulated in infested drupes of the tolerant variety. The GO annotation of the differentially expressed genes implies that the inducible resistance to the olive fruit fly involves a number of biological functions, cellular processes and metabolic pathways, including those with a known role in defence, oxidative stress responses, cellular structure, hormone signalling, and primary and secondary metabolism. The difference in the induced transcriptional changes between the cultivars suggests a strong genetic role in the olive inducible defence, which can ultimately lead to the discovery of factors associated with a higher level of tolerance to B. oleae. PMID:28797083
Grasso, Filomena; Coppola, Mariangela; Carbone, Fabrizio; Baldoni, Luciana; Alagna, Fiammetta; Perrotta, Gaetano; Pérez-Pulido, Antonio J; Garonna, Antonio; Facella, Paolo; Daddiego, Loretta; Lopez, Loredana; Vitiello, Alessia; Rao, Rosa; Corrado, Giandomenico
2017-01-01
The olive fruit fly Bactrocera oleae (Diptera: Tephritidae) is the most devastating pest of cultivated olive (Olea europaea L.). Intraspecific variation in plant resistance to B. oleae has been described only at phenotypic level. In this work, we used a transcriptomic approach to study the molecular response to the olive fruit fly in two olive cultivars with contrasting level of susceptibility. Using next-generation pyrosequencing, we first generated a catalogue of more than 80,000 sequences expressed in drupes from approximately 700k reads. The assembled sequences were used to develop a microarray layout with over 60,000 olive-specific probes. The differential gene expression analysis between infested (i.e. with II or III instar larvae) and control drupes indicated a significant intraspecific variation between the more tolerant and susceptible cultivar. Around 2500 genes were differentially regulated in infested drupes of the tolerant variety. The GO annotation of the differentially expressed genes implies that the inducible resistance to the olive fruit fly involves a number of biological functions, cellular processes and metabolic pathways, including those with a known role in defence, oxidative stress responses, cellular structure, hormone signalling, and primary and secondary metabolism. The difference in the induced transcriptional changes between the cultivars suggests a strong genetic role in the olive inducible defence, which can ultimately lead to the discovery of factors associated with a higher level of tolerance to B. oleae.
Walther, Dirk; Bartha, Gábor; Morris, Macdonald
2001-01-01
A pivotal step in electrophoresis sequencing is the conversion of the raw, continuous chromatogram data into the actual sequence of discrete nucleotides, a process referred to as basecalling. We describe a novel algorithm for basecalling implemented in the program LifeTrace. Like Phred, currently the most widely used basecalling software program, LifeTrace takes processed trace data as input. It was designed to be tolerant to variable peak spacing by means of an improved peak-detection algorithm that emphasizes local chromatogram information over global properties. LifeTrace is shown to generate high-quality basecalls and reliable quality scores. It proved particularly effective when applied to MegaBACE capillary sequencing machines. In a benchmark test of 8372 dye-primer MegaBACE chromatograms, LifeTrace generated 17% fewer substitution errors, 16% fewer insertion/deletion errors, and 2.4% more aligned bases to the finished sequence than did Phred. For two sets totaling 6624 dye-terminator chromatograms, the performance improvement was 15% fewer substitution errors, 10% fewer insertion/deletion errors, and 2.1% more aligned bases. The processing time required by LifeTrace is comparable to that of Phred. The predicted quality scores were in line with observed quality scores, permitting direct use for quality clipping and in silico single nucleotide polymorphism (SNP) detection. Furthermore, we introduce a new type of quality score associated with every basecall: the gap-quality. It estimates the probability of a deletion error between the current and the following basecall. This additional quality score improves detection of single basepair deletions when used for locating potential basecalling errors during the alignment. We also describe a new protocol for benchmarking that we believe better discerns basecaller performance differences than methods previously published. PMID:11337481
Kavamura, Vanessa Nessner; Santos, Suikinai Nobre; Taketani, Rodrigo Gouvêa; Vasconcellos, Rafael Leandro Figueiredo; Melo, Itamar Soares
2017-02-02
The strain of Bacillus sp. CMAA 1363 was isolated from the Brazilian Caatinga biome and showed plant growth-promoting traits and ability to promote maize growth under drought stress. Sequencing revealed genes involved in stress response and plant growth promotion. These genomic features might aid in the protection of plants against the negative effects imposed by drought. Copyright © 2017 Kavamura et al.
Santos, Suikinai Nobre; Taketani, Rodrigo Gouvêa; Vasconcellos, Rafael Leandro Figueiredo; Melo, Itamar Soares
2017-01-01
ABSTRACT The strain of Bacillus sp. CMAA 1363 was isolated from the Brazilian Caatinga biome and showed plant growth-promoting traits and ability to promote maize growth under drought stress. Sequencing revealed genes involved in stress response and plant growth promotion. These genomic features might aid in the protection of plants against the negative effects imposed by drought. PMID:28153893
Wallace-Salinas, Valeria; Brink, Daniel P; Ahrén, Dag; Gorwa-Grauslund, Marie F
2015-07-09
Laboratory evolution is an important tool for developing robust yeast strains for bioethanol production since the biological basis behind combined tolerance requires complex alterations whose proper regulation is difficult to achieve by rational metabolic engineering. Previously, we reported on the evolved industrial Saccharomyces cerevisiae strain ISO12 that had acquired improved tolerance to grow and ferment in the presence of lignocellulose-derived inhibitors at high temperature (39 °C). In the current study, we used comparative genomics to uncover the extent of the genomic alterations that occurred during the evolution process and investigated possible associations between the mutations and the phenotypic traits in ISO12. Through whole-genome sequencing and variant calling we identified a high number of strain-unique SNPs and INDELs in both ISO12 and the parental strain Ethanol Red. The variants were predicted to have 760 non-synonymous effects in both strains combined and were significantly enriched in Gene Ontology terms related to cell periphery, membranes and cell wall. Eleven genes, including MTL1, FLO9/FLO11, and CYC3 were found to be under positive selection in ISO12. Additionally, the FLO genes exhibited changes in copy number, and the alterations to this gene family were correlated with experimental results of multicellularity and invasive growth in the adapted strain. An independent lipidomic analysis revealed further differences between the strains in the content of nine lipid species. Finally, ISO12 displayed improved viability in undiluted spruce hydrolysate that was unrelated to reduction of inhibitors and changes in cell wall integrity, as shown by HPLC and lyticase assays. Together, the results of the sequence comparison and the physiological characterisations indicate that cell-periphery proteins (e.g. extracellular sensors such as MTL1) and peripheral lipids/membranes are important evolutionary targets in the process of adaptation to the combined stresses. The capacity of ISO12 to develop complex colony formation also revealed multicellularity as a possible evolutionary strategy to improve competitiveness and tolerance to environmental stresses (also reflected by the FLO genes). Although a panel of altered genes with high relevance to the novel phenotype was detected, this study also demonstrates that the observed long-term molecular effects of thermal and inhibitor stress have polygenetic basis.
The Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to address needs for rapid, cost effective methods of species extrapolation of chemical susceptibility. Specifically, the SeqAPASS tool compares the primary sequence (Level 1), functiona...
Progressive failure methodologies for predicting residual strength and life of laminated composites
NASA Technical Reports Server (NTRS)
Harris, Charles E.; Allen, David H.; Obrien, T. Kevin
1991-01-01
Two progressive failure methodologies currently under development by the Mechanics of Materials Branch at NASA Langley Research Center are discussed. The damage tolerance/fail safety methodology developed by O'Brien is an engineering approach to ensuring adequate durability and damage tolerance by treating only delamination onset and the subsequent delamination accumulation through the laminate thickness. The continuum damage model developed by Allen and Harris employs continuum damage laws to predict laminate strength and life. The philosophy, mechanics framework, and current implementation status of each methodology are presented.
Feng, Xuping; Yu, Chenliang; Chen, Yue; Peng, Jiyun; Ye, Lanhan; Shen, Tingting; Wen, Haiyong; He, Yong
2018-01-01
The development of transgenic glyphosate-tolerant crops has revolutionized weed control in crops in many regions of the world. The early, non-destructive identification of superior plant phenotypes is an important stage in plant breeding programs. Here, glyphosate-tolerant transgenic maize and its parental wild-type control were studied at 2, 4, 6, and 8 days after glyphosate treatment. Visible and near-infrared hyperspectral imaging and chlorophyll fluorescence imaging techniques were applied to monitor the performance of plants. In our research, transgenic maize, which was highly tolerant to glyphosate, was phenotyped using these high-throughput non-destructive methods to validate low levels of shikimic acid accumulation and high photochemical efficiency of photosystem II as reflected by maximum quantum yield and non-photochemical quenching in response to glyphosate. For hyperspectral imaging analysis, the combination of spectroscopy and chemometric methods was used to predict shikimic acid concentration. Our results indicated that a partial least-squares regression model, built on optimal wavelengths, effectively predicted shikimic acid concentrations, with a coefficient of determination value of 0.79 for the calibration set, and 0.82 for the prediction set. Moreover, shikimic acid concentration estimates from hyperspectral images were visualized on the prediction maps by spectral features, which could help in developing a simple multispectral imaging instrument for non-destructive phenotyping. Specific physiological effects of glyphosate affected the photochemical processes of maize, which induced substantial changes in chlorophyll fluorescence characteristics. A new data-driven method, combining mean fluorescence parameters and featuring a screening approach, provided a satisfactory relationship between fluorescence parameters and shikimic acid content. The glyphosate-tolerant transgenic plants can be identified with the developed discrimination model established on important wavelengths or sensitive fluorescence parameters 6 days after glyphosate treatment. The overall results indicated that both hyperspectral imaging and chlorophyll fluorescence imaging techniques could provide useful tools for stress phenotyping in maize breeding programs and could enable the detection and evaluation of superior genotypes, such as glyphosate tolerance, with a non-destructive high-throughput technique. PMID:29686693
Feng, Xuping; Yu, Chenliang; Chen, Yue; Peng, Jiyun; Ye, Lanhan; Shen, Tingting; Wen, Haiyong; He, Yong
2018-01-01
The development of transgenic glyphosate-tolerant crops has revolutionized weed control in crops in many regions of the world. The early, non-destructive identification of superior plant phenotypes is an important stage in plant breeding programs. Here, glyphosate-tolerant transgenic maize and its parental wild-type control were studied at 2, 4, 6, and 8 days after glyphosate treatment. Visible and near-infrared hyperspectral imaging and chlorophyll fluorescence imaging techniques were applied to monitor the performance of plants. In our research, transgenic maize, which was highly tolerant to glyphosate, was phenotyped using these high-throughput non-destructive methods to validate low levels of shikimic acid accumulation and high photochemical efficiency of photosystem II as reflected by maximum quantum yield and non-photochemical quenching in response to glyphosate. For hyperspectral imaging analysis, the combination of spectroscopy and chemometric methods was used to predict shikimic acid concentration. Our results indicated that a partial least-squares regression model, built on optimal wavelengths, effectively predicted shikimic acid concentrations, with a coefficient of determination value of 0.79 for the calibration set, and 0.82 for the prediction set. Moreover, shikimic acid concentration estimates from hyperspectral images were visualized on the prediction maps by spectral features, which could help in developing a simple multispectral imaging instrument for non-destructive phenotyping. Specific physiological effects of glyphosate affected the photochemical processes of maize, which induced substantial changes in chlorophyll fluorescence characteristics. A new data-driven method, combining mean fluorescence parameters and featuring a screening approach, provided a satisfactory relationship between fluorescence parameters and shikimic acid content. The glyphosate-tolerant transgenic plants can be identified with the developed discrimination model established on important wavelengths or sensitive fluorescence parameters 6 days after glyphosate treatment. The overall results indicated that both hyperspectral imaging and chlorophyll fluorescence imaging techniques could provide useful tools for stress phenotyping in maize breeding programs and could enable the detection and evaluation of superior genotypes, such as glyphosate tolerance, with a non-destructive high-throughput technique.
de Oliveira Cunha, Cláudio; Goda Zuleta, Luiz Fernando; Paula de Almeida, Luiz Gonzaga; Prioli Ciapina, Luciane; Lustrino Borges, Wardsson; Pitard, Rosa Maria; Baldani, José Ivo; Straliotto, Rosangela; de Faria, Sérgio Miana; Hungria, Mariangela; Sousa Cavada, Benildo; Mercante, Fábio Martins; Ribeiro de Vasconcelos, Ana Tereza
2012-12-01
The genus Burkholderia represents a challenge to the fields of taxonomy and phylogeny and, especially, to the understanding of the contrasting roles as either opportunistic pathogens or bacteria with biotechnological potential. Few genomes of nonpathogenic strains, especially of diazotrophic symbiotic bacteria, have been sequenced to improve understanding of the genus. Here, we contribute with the complete genome sequence of Burkholderia phenoliruptrix strain BR3459a (CLA1), an effective diazotrophic symbiont of the leguminous tree Mimosa flocculosa Burkart, which is endemic to South America.
de Oliveira Cunha, Cláudio; Goda Zuleta, Luiz Fernando; Paula de Almeida, Luiz Gonzaga; Prioli Ciapina, Luciane; Lustrino Borges, Wardsson; Pitard, Rosa Maria; Baldani, José Ivo; Straliotto, Rosangela; de Faria, Sérgio Miana; Hungria, Mariangela; Sousa Cavada, Benildo; Mercante, Fábio Martins
2012-01-01
The genus Burkholderia represents a challenge to the fields of taxonomy and phylogeny and, especially, to the understanding of the contrasting roles as either opportunistic pathogens or bacteria with biotechnological potential. Few genomes of nonpathogenic strains, especially of diazotrophic symbiotic bacteria, have been sequenced to improve understanding of the genus. Here, we contribute with the complete genome sequence of Burkholderia phenoliruptrix strain BR3459a (CLA1), an effective diazotrophic symbiont of the leguminous tree Mimosa flocculosa Burkart, which is endemic to South America. PMID:23144415
Walters, Glenn D
2017-04-01
The purpose of the present study was to determine whether a child's perception of adult tolerance of violence interfaced with peer associations and violent offending. It was hypothesized that a child's perception of his or her parents' tolerance for violence would predict the peer influence effect for aggressive behavior in boys but not girls. Control variables included the parent's stated tolerance of violence, the child's personal attitude toward violence, recent parental divorce or separation, and child maltreatment within the past 12 months. Using the first three waves of the National Youth Survey (NYS), the relationships between perceived parental tolerance of violence and the peer influence and selection effects were examined. A negative binomial path analysis of the male subsample ( n = 736) revealed that perceived parental tolerance of violence predicted the peer influence effect (peer violence leading to participant violent offending) but not the peer selection effect (participant violent offending leading to peer violence) in boys. In girls ( n = 679), neither pathway was significant. The current findings indicate that in boys, perceived parental attitudes toward violence help account for the cycle of violence, perhaps by encouraging the child's association with violent peers. Programs designed to change these perceptions and the parental/community attitudes these perceptions may reflect could be an effective means of intervention for violent youth.
Bartlett, Megan K; Scoffoni, Christine; Sack, Lawren
2012-05-01
Increasing drought is one of the most critical challenges facing species and ecosystems worldwide, and improved theory and practices are needed for quantification of species tolerances. Leaf water potential at turgor loss, or wilting (π(tlp) ), is classically recognised as a major physiological determinant of plant water stress response. However, the cellular basis of π(tlp) and its importance for predicting ecological drought tolerance have been controversial. A meta-analysis of 317 species from 72 studies showed that π(tlp) was strongly correlated with water availability within and across biomes, indicating power for anticipating drought responses. We derived new equations giving both π(tlp) and relative water content at turgor loss point (RWC(tlp) ) as explicit functions of osmotic potential at full turgor (π(o) ) and bulk modulus of elasticity (ε). Sensitivity analyses and meta-analyses showed that π(o) is the major driver of π(tlp) . In contrast, ε plays no direct role in driving drought tolerance within or across species, but sclerophylly and elastic adjustments act to maintain RWC(tlp,) preventing cell dehydration, and additionally protect against nutrient, mechanical and herbivory stresses independent of drought tolerance. These findings clarify biogeographic trends and the underlying basis of drought tolerance parameters with applications in comparative assessments of species and ecosystems worldwide. © 2012 Blackwell Publishing Ltd/CNRS.
RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.
Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab
2012-01-01
RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.
AN ANALYSIS OF THE INFLUENCE OF ANNUAL THERMAL VARIABLES ON THE OCCURRENCE OF WARM WATER FISHES
A potential effect of climate change is modification of the geographic distribution of fish species. To predict this modification it is necessary to estimate temperature tolerances of fishes and then relate these tolerances to the changing environment. This technique will allow...
D.b.h./crown diameter relationships in mixed Appalachian hardwood stands
Neil I. Lamson; Neil I. Lamson
1987-01-01
Linear regression formulae for predicting crown diameter as a function of stem diameter are presented for nine species found in 50- to 80-year-old mixed hardwood stands in north-central West Virginia. Generally, crown diameter was closely related to tolerance; more tolerant species had larger crowns.
Remenova, Tatiana; Morand, Olivier; Amato, Dominick; Chadha-Boreham, Harbajan; Tsurutani, Scott; Marquardt, Thorsten
2015-06-19
Gastrointestinal (GI) disturbances such as diarrhea and flatulence are the most frequent adverse effects associated with miglustat therapy in type 1 Gaucher disease (GD1) and Niemann-Pick disease type C (NP-C), and the most common recorded reason for stopping treatment during clinical trials and in clinical practice settings. Miglustat-related GI disturbances are thought to arise from the inhibition of intestinal disaccharidases, mainly sucrase isomaltase. We report the effects of a co-administered dietary probiotic, S. boulardii, on the GI tolerability of miglustat in healthy adult subjects. In a double-blind, placebo-controlled, two-period, two-treatment cross-over trial, healthy adult male and female subjects were randomly allocated to treatment sequences, A-B and B-A (treatment A - miglustat 100 mg t.i.d. + placebo; treatment B - miglustat 100 mg t.i.d. + S. boulardii [500 mg, b.i.d.]). GI tolerability data were collected in patient diaries. The primary endpoint was the total number of 'diarrhea days' (≥3 loose stools within a 24-h period meeting Bristol Stool Scores [BSS] 6-7) based on WHO criteria. Secondary endpoints comprised numerous other diarrhea and GI tolerability indices. Twenty-one subjects received randomized therapy in each treatment sequence (total N = 42), and overall, 37 (88 %) subjects completed the study. The total number of diarrhea days was <1.5 for both treatment sequences, and approximately 60 % of subjects did not experience diarrhea during either treatment period. The mean (SD) number of diarrhea days was lower with miglustat + S. boulardii (0.8 [2.4] days) than with miglustat + placebo (1.3 [2.4] days), but the paired treatment difference was not statistically significant (-0.5 [2.4] days; p = 0.159). However, a significant treatment difference (-0.7 [1.9]; p < 0.05) was identified after post hoc exclusion of a clear outlier who had a very high number of diarrhea days (n = 13) and inconsistent GI tolerability reporting. The incidence of the GI AEs was higher with miglustat + placebo (82 %) than with miglustat + S. boulardii (73 %). There were no between-treatment differences in miglustat pharmacokinetics. Although the primary endpoint was not met, the results of the post-hoc analysis suggest that co-administration of miglustat with S. boulardii might improve GI tolerability.
The structure of a thermophilic kinase shapes fitness upon random circular permutation
Jones, Alicia M.; Mehta, Manan M.; Thomas, Emily E.; Atkinson, Joshua T.; Segall-Shapiro, Thomas H.; Liu, Shirley; Silberg, Jonathan J.
2016-01-01
Proteins can be engineered for synthetic biology through circular permutation, a sequence rearrangement where native protein termini become linked and new termini are created elsewhere through backbone fission. However, it remains challenging to anticipate a protein’s functional tolerance to circular permutation. Here, we describe new transposons for creating libraries of randomly circularly permuted proteins that minimize peptide additions at their termini, and we use transposase mutagenesis to study the tolerance of a thermophilic adenylate kinase (AK) to circular permutation. We find that libraries expressing permuted AK with either short or long peptides amended to their N-terminus yield distinct sets of active variants and present evidence that this trend arises because permuted protein expression varies across libraries. Mapping all sites that tolerate backbone cleavage onto AK structure reveals that the largest contiguous regions of sequence that lack cleavage sites are proximal to the phosphotransfer site. A comparison of our results with a range of structure-derived parameters further showed that retention of function correlates to the strongest extent with the distance to the phosphotransfer site, amino acid variability in an AK family sequence alignment, and residue-level deviations in superimposed AK structures. Our work illustrates how permuted protein libraries can be created with minimal peptide additions using transposase mutagenesis, and they reveal a challenge of maintaining consistent expression across permuted variants in a library that minimizes peptide additions. Furthermore, these findings provide a basis for interpreting responses of thermophilic phosphotransferases to circular permutation by calibrating how different structure-derived parameters relate to retention of function in a cellular selection. PMID:26976658
The Structure of a Thermophilic Kinase Shapes Fitness upon Random Circular Permutation.
Jones, Alicia M; Mehta, Manan M; Thomas, Emily E; Atkinson, Joshua T; Segall-Shapiro, Thomas H; Liu, Shirley; Silberg, Jonathan J
2016-05-20
Proteins can be engineered for synthetic biology through circular permutation, a sequence rearrangement in which native protein termini become linked and new termini are created elsewhere through backbone fission. However, it remains challenging to anticipate a protein's functional tolerance to circular permutation. Here, we describe new transposons for creating libraries of randomly circularly permuted proteins that minimize peptide additions at their termini, and we use transposase mutagenesis to study the tolerance of a thermophilic adenylate kinase (AK) to circular permutation. We find that libraries expressing permuted AKs with either short or long peptides amended to their N-terminus yield distinct sets of active variants and present evidence that this trend arises because permuted protein expression varies across libraries. Mapping all sites that tolerate backbone cleavage onto AK structure reveals that the largest contiguous regions of sequence that lack cleavage sites are proximal to the phosphotransfer site. A comparison of our results with a range of structure-derived parameters further showed that retention of function correlates to the strongest extent with the distance to the phosphotransfer site, amino acid variability in an AK family sequence alignment, and residue-level deviations in superimposed AK structures. Our work illustrates how permuted protein libraries can be created with minimal peptide additions using transposase mutagenesis, and it reveals a challenge of maintaining consistent expression across permuted variants in a library that minimizes peptide additions. Furthermore, these findings provide a basis for interpreting responses of thermophilic phosphotransferases to circular permutation by calibrating how different structure-derived parameters relate to retention of function in a cellular selection.
A state-based probabilistic model for tumor respiratory motion prediction
NASA Astrophysics Data System (ADS)
Kalet, Alan; Sandison, George; Wu, Huanmei; Schmitz, Ruth
2010-12-01
This work proposes a new probabilistic mathematical model for predicting tumor motion and position based on a finite state representation using the natural breathing states of exhale, inhale and end of exhale. Tumor motion was broken down into linear breathing states and sequences of states. Breathing state sequences and the observables representing those sequences were analyzed using a hidden Markov model (HMM) to predict the future sequences and new observables. Velocities and other parameters were clustered using a k-means clustering algorithm to associate each state with a set of observables such that a prediction of state also enables a prediction of tumor velocity. A time average model with predictions based on average past state lengths was also computed. State sequences which are known a priori to fit the data were fed into the HMM algorithm to set a theoretical limit of the predictive power of the model. The effectiveness of the presented probabilistic model has been evaluated for gated radiation therapy based on previously tracked tumor motion in four lung cancer patients. Positional prediction accuracy is compared with actual position in terms of the overall RMS errors. Various system delays, ranging from 33 to 1000 ms, were tested. Previous studies have shown duty cycles for latencies of 33 and 200 ms at around 90% and 80%, respectively, for linear, no prediction, Kalman filter and ANN methods as averaged over multiple patients. At 1000 ms, the previously reported duty cycles range from approximately 62% (ANN) down to 34% (no prediction). Average duty cycle for the HMM method was found to be 100% and 91 ± 3% for 33 and 200 ms latency and around 40% for 1000 ms latency in three out of four breathing motion traces. RMS errors were found to be lower than linear and no prediction methods at latencies of 1000 ms. The results show that for system latencies longer than 400 ms, the time average HMM prediction outperforms linear, no prediction, and the more general HMM-type predictive models. RMS errors for the time average model approach the theoretical limit of the HMM, and predicted state sequences are well correlated with sequences known to fit the data.
Mano, Y; Omori, F
2013-10-01
Nicaraguan teosinte (Zea nicaraguensis), a species found in frequently flooded areas, provides useful germplasm for breeding flooding-tolerant maize (Z. mays subsp. mays). The objective of this study was to select flooding-tolerant lines using a library of introgression lines (ILs), each containing a chromosome segment from Z. nicaraguensis in the maize inbred line Mi29. To produce the ILs, a single F1 plant derived from a cross between maize Mi29 and Z. nicaraguensis was backcrossed to Mi29 three times, self-pollinated four times and genotyped using simple sequence repeat markers. Flooding tolerance was evaluated at the seedling stage under reducing soil conditions. By backcrossing and selfing, a series of 45 ILs were developed covering nearly the entire maize genome. Five flooding-tolerant lines were identified from among the ILs by evaluating leaf injury. Among these, line IL#18, containing a Z. nicaraguensis chromosome segment on the long arm of chromosome 4, showed the greatest tolerance to flooding, suggesting the presence of a major quantitative trait locus (QTL) in that region. The presence of the QTL was verified by examining flooding tolerance in a population segregating for the candidate region of chromosome 4. There was no significant relationship between the capacity to form constitutive aerenchyma and flooding tolerance in the ILs, indicating the presence of other factors related to flooding tolerance under reducing soil conditions. A flooding-tolerant genotype, IL#18, was identified; this genotype should be useful for maize breeding. In addition, because the chromosome segments of Z. nicaraguensis in the ILs cover nearly the entire genome and Z. nicaraguensis possesses several unique traits related to flooding tolerance, the ILs should be valuable material for additional QTL detection and the development of flooding-tolerant maize lines.
Role of psl Genes in Antibiotic Tolerance of Adherent Pseudomonas aeruginosa.
Murakami, Keiji; Ono, Tsuneko; Viducic, Darija; Somiya, Yoko; Kariyama, Reiko; Hori, Kenji; Amoh, Takashi; Hirota, Katsuhiko; Kumon, Hiromi; Parsek, Matthew R; Miyake, Yoichiro
2017-07-01
Bacteria attached to a surface are generally more tolerant to antibiotics than their planktonic counterparts, even without the formation of a biofilm. The mechanism of antibiotic tolerance in biofilm communities is multifactorial, and the genetic background underlying this antibiotic tolerance has not yet been fully elucidated. Using transposon mutagenesis, we isolated a mutant with reduced tolerance to biapenem (relative to that of the wild type) from adherent cells. Sequencing analysis revealed a mutation in the pslL gene, which is part of the polysaccharide biosynthesis operon. The Pseudomonas aeruginosa PAO1Δ pslBCD mutant demonstrated a 100-fold-lower survival rate during the exposure of planktonic and biofilm cells to biapenem; a similar phenotype was observed in a mouse infection model and in clinical strains. Transcriptional analysis of adherent cells revealed increased expression of both pslA and pelA , which are directly regulated by bis-(3',5')-cyclic dimeric GMP (c-di-GMP). Inactivation of wspF resulted in significantly increased tolerance to biapenem due to increased production of c-di-GMP. The loss of pslBCD in the Δ wspF mutant background abolished the biapenem-tolerant phenotype of the Δ wspF mutant, underscoring the importance of psl in biapenem tolerance. Overexpression of PA2133, which can catalyze the degradation of c-di-GMP, led to a significant reduction in biapenem tolerance in adherent cells, indicating that c-di-GMP is essential in mediating the tolerance effect. The effect of pslBCD on antibiotic tolerance was evident, with 50- and 200-fold-lower survival in the presence of ofloxacin and tobramycin, respectively. We speculate that the psl genes, which are activated by surface adherence through elevated intracellular c-di-GMP levels, confer tolerance to antimicrobials. Copyright © 2017 American Society for Microbiology.
Osman, Toba A M; Olsthoorn, René C L; Livieratos, Ioannis C
2014-09-22
Pepino mosaic virus (PepMV) is a mechanically-transmitted positive-strand RNA potexvirus, with a 6410 nt long single-stranded (ss) RNA genome flanked by a 5'-methylguanosine cap and a 3' poly-A tail. Computer-assisted folding of the 64 nt long PepMV 3'-untranslated region (UTR) resulted in the prediction of three stem-loop structures (hp1, hp2, and hp3 in the 3'-5' direction). The importance of these structures and/or sequences for promotion of negative-strand RNA synthesis and binding to the RNA dependent RNA polymerase (RdRp) was tested in vitro using a specific RdRp assay. Hp1, which is highly variable among different PepMV isolates, appeared dispensable for negative-strand synthesis. Hp2, which is characterized by a large U-rich loop, tolerated base-pair changes in its stem as long as they maintained the stem integrity but was very sensitive to changes in the U-rich loop. Hp3, which harbours the conserved potexvirus ACUUAA hexamer motif, was essential for template activity. Template-RNA polymerase binding competition experiments showed that the ACUUAA sequence represents a high-affinity RdRp binding element. Copyright © 2014 Elsevier B.V. All rights reserved.
Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi
2010-10-01
Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria.
GeneSilico protein structure prediction meta-server.
Kurowski, Michal A; Bujnicki, Janusz M
2003-07-01
Rigorous assessments of protein structure prediction have demonstrated that fold recognition methods can identify remote similarities between proteins when standard sequence search methods fail. It has been shown that the accuracy of predictions is improved when refined multiple sequence alignments are used instead of single sequences and if different methods are combined to generate a consensus model. There are several meta-servers available that integrate protein structure predictions performed by various methods, but they do not allow for submission of user-defined multiple sequence alignments and they seldom offer confidentiality of the results. We developed a novel WWW gateway for protein structure prediction, which combines the useful features of other meta-servers available, but with much greater flexibility of the input. The user may submit an amino acid sequence or a multiple sequence alignment to a set of methods for primary, secondary and tertiary structure prediction. Fold-recognition results (target-template alignments) are converted into full-atom 3D models and the quality of these models is uniformly assessed. A consensus between different FR methods is also inferred. The results are conveniently presented on-line on a single web page over a secure, password-protected connection. The GeneSilico protein structure prediction meta-server is freely available for academic users at http://genesilico.pl/meta.
GeneSilico protein structure prediction meta-server
Kurowski, Michal A.; Bujnicki, Janusz M.
2003-01-01
Rigorous assessments of protein structure prediction have demonstrated that fold recognition methods can identify remote similarities between proteins when standard sequence search methods fail. It has been shown that the accuracy of predictions is improved when refined multiple sequence alignments are used instead of single sequences and if different methods are combined to generate a consensus model. There are several meta-servers available that integrate protein structure predictions performed by various methods, but they do not allow for submission of user-defined multiple sequence alignments and they seldom offer confidentiality of the results. We developed a novel WWW gateway for protein structure prediction, which combines the useful features of other meta-servers available, but with much greater flexibility of the input. The user may submit an amino acid sequence or a multiple sequence alignment to a set of methods for primary, secondary and tertiary structure prediction. Fold-recognition results (target-template alignments) are converted into full-atom 3D models and the quality of these models is uniformly assessed. A consensus between different FR methods is also inferred. The results are conveniently presented on-line on a single web page over a secure, password-protected connection. The GeneSilico protein structure prediction meta-server is freely available for academic users at http://genesilico.pl/meta. PMID:12824313
Vingron, Martin
2016-01-01
Non-methylated islands (NMIs) of DNA are genomic regions that are important for gene regulation and development. A recent study of genome-wide non-methylation data in vertebrates by Long et al. (eLife 2013;2:e00348) has shown that many experimentally identified non-methylated regions do not overlap with classically defined CpG islands which are computationally predicted using simple DNA sequence features. This is especially true in cold-blooded vertebrates such as Danio rerio (zebrafish). In order to investigate how predictive DNA sequence is of a region’s methylation status, we applied a supervised learning approach using a spectrum kernel support vector machine, to see if a more complex model and supervised learning can be used to improve non-methylated island prediction and to understand the sequence properties of these regions. We demonstrate that DNA sequence is highly predictive of methylation status, and that in contrast to existing CpG island prediction methods our method is able to provide more useful predictions of NMIs genome-wide in all vertebrate organisms that were studied. Our results also show that in cold-blooded vertebrates (Anolis carolinensis, Xenopus tropicalis and Danio rerio) where genome-wide classical CpG island predictions consist primarily of false positives, longer primarily AT-rich DNA sequence features are able to identify these regions much more accurately. PMID:27984582
Patankar, Himanshu V; Al-Harrasi, Ibtisam; Al-Yahyai, Rashid; Yaish, Mahmoud W
2018-06-01
Although date palm is a relatively salt-tolerant plant, the molecular basis of this tolerance is complex and poorly understood. Therefore, this study aimed to identify the genes involved in salinity tolerance using a basic yeast functional bioassay. To achieve this, a date palm cDNA library was overexpressed in Saccharomyces cerevisiae cells. The expression levels of selected genes that make yeast cells tolerant to salt were subsequently validated in the leaf and root tissues of date palm seedlings using a quantitative PCR method. About 6000 yeast transformant cells were replica printed and screened on a synthetic minimal medium containing 1.0 M of NaCl. The screening results showed the presence of 62 salt-tolerant transformant colonies. Sequence analysis of the recombinant yeast plasmids revealed the presence of a group of genes with potential salt-tolerance functions, such as aquaporins (PIP), serine/threonine protein kinases (STKs), ethylene-responsive transcription factor 1 (ERF1), and peroxidases (PRX). The expression pattern of the selected genes endorsed the hypothesis that these genes may be involved in salinity tolerance, as they showed a significant (p < 0.05) overexpression trend in both the leaf and root tissues in response to salinity. The genes identified in this project are suitable candidates for the further functional characterization of date palms.
Genomic selection for tolerance to heat stress in Australian dairy cattle.
Nguyen, Thuy T T; Bowman, Phil J; Haile-Mariam, Mekonnen; Pryce, Jennie E; Hayes, Benjamin J
2016-04-01
Temperature and humidity levels above a certain threshold decrease milk production in dairy cattle, and genetic variation is associated with the amount of lost production. To enable selection for improved heat tolerance, the aim of this study was to develop genomic estimated breeding values (GEBV) for heat tolerance in dairy cattle. Heat tolerance was defined as the rate of decline in production under heat stress. We combined herd test-day recording data from 366,835 Holstein and 76,852 Jersey cows with daily temperature and humidity measurements from weather stations closest to the tested herds for test days between 2003 and 2013. We used daily mean values of temperature-humidity index averaged for the day of test and the 4 previous days as the measure of heat stress. Tolerance to heat stress was estimated for each cow using a random regression model with a common threshold of temperature-humidity index=60 for all cows. The slope solutions for cows from this model were used to define the daughter trait deviations of their sires. Genomic best linear unbiased prediction was used to calculate GEBV for heat tolerance for milk, fat, and protein yield. Two reference populations were used, the first consisted of genotyped sires only (2,300 Holstein and 575 Jersey sires), and the other included genotyped sires and cows (2,189 Holstein and 1,188 Jersey cows). The remainder of the genotyped sires were used as a validation set. All animals had genotypes for 632,003 single nucleotide polymorphisms. When using only genotyped sires in the reference set and only the first parity data, the accuracy of GEBV for heat tolerance in relation to changes in milk, fat, and protein yield were 0.48, 0.50, and 0.49 in the Holstein validation sires and 0.44, 0.61, and 0.53 in the Jersey validation sires, respectively. Some slight improvement in the accuracy of prediction was achieved when cows were included in the reference population for Holsteins. No clear improvements in the accuracy of genomic prediction were observed when data from the second and third parities were included. Correlations of GEBV for heat tolerance with Australian Breeding Values for other traits suggested heat tolerance had a favorable genetic correlation with fertility (0.29-0.39 in Holsteins and 0.15-0.27 in Jerseys), but unfavorable correlations for some production traits. Options to improve heat tolerance with genomic selection in Australian dairy cattle are discussed. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Sex differences and plasticity in dehydration tolerance: insight from a tropical liverwort
Marks, Rose A.; Burton, James F.; McLetchie, D. Nicholas
2016-01-01
Background and Aims Adaptations allowing plants to cope with drying are particularly relevant in the light of predicted climate change. Dehydration tolerance (DhT, also dehydration-tolerant) is one such adaptation enabling tissue to survive substantial drying. A great deal of work has been conducted on highly DhT species. However, bryophytes showing less intense and variable DhT are understudied, despite the potential for these species to provide an informative link between highly tolerant and sensitive species. In this study, we tested the degree to which DhT varies across populations and the sexes of a species expected to exhibit a moderate DhT phenotype. Methods To test predicted patterns of tolerance we assessed DhT in males and females of Marchantia inflexa from two distinct habitat types that differ in water availability. Both common garden and field-collected tissue was subjected to drying assays at multiple intensities and recovery was monitored by chlorophyll florescence. Verification studies were conducted to confirm the level of dehydration, the rate of drying and the associated changes in photosynthetic physiology. Key Results We confirmed our expectation that M. inflexa is able to tolerate moderate dehydration. We also found that females exhibited higher DhT than males, but populations did not differ in DhT when cultured in a common garden. However, field-collected samples exhibited differences in DhT corresponding to environmental dryness, suggesting plasticity in DhT. Conclusions By studying a less extreme DhT phenotype we gained insight into how more sensitive (yet still tolerant) organisms cope with dehydration. Additionally, the identified sex-specific variation in DhT may explain ecological patterns such as female-biased sex ratios. Furthermore, plasticity in DhT has the potential to inform management practices aimed at increasing tolerance to drought conditions. PMID:27325895
Tuomainen, Marjo; Ahonen, Viivi; Kärenlampi, Sirpa O; Schat, Henk; Paasela, Tanja; Svanys, Algirdas; Tuohimetsä, Saara; Peräniemi, Sirpa; Tervahauta, Arja
2011-06-01
Stress tolerance is currently one of the major research topics in plant biology because of the challenges posed by changing climate and increasing demand to grow crop plants in marginal soils. Increased Zn tolerance and accumulation has been reported in tobacco expressing the glyoxalase 1-encoding gene from Brassica juncea. Previous studies in our laboratory showed some Zn tolerance-correlated differences in the levels of glyoxalase 1-like protein among accessions of Zn hyperaccumulator Thlaspi caerulescens. We have now isolated the corresponding gene (named here TcGLX1), including ca. 570 bp of core and proximal promoter region. The predicted protein contains three glyoxalase 1 motifs and several putative sites for post-translational modification. In silico analysis predicted a number of cis-acting elements related to stress. The expression of TcGLX1 was not responsive to Zn. There was no correlation between the levels of TcGLX1 expression and the degrees of Zn tolerance or accumulation among T. caerulescens accessions nor was there co-segregation of TcGLX1 expression with Zn tolerance or Zn accumulation among F3 lines derived from crosses between plants from accessions with contrasting phenotypes for these properties. No phenotype was observed in an A. thaliana T-DNA insertion line for the closest A. thaliana homolog of TcGLX1, ATGLX1. These results suggest that glyoxalase 1 or at least the particular isoform studied here is not a major determinant of Zn tolerance in the Zn hyperaccumulator plant T. caerulescens. In addition, ATGLX1 is not essential for normal Zn tolerance in the non-tolerant, non-accumulator plant A. thaliana. Possible explanations for the apparent discrepancy between this and previous studies are discussed.
Variation in cassava germplasm for tolerance to post-harvest physiological deterioration.
Venturini, M T; Santos, L R; Vildoso, C I A; Santos, V S; Oliveira, E J
2016-05-06
Tolerant varieties can effectively control post-harvest physiological deterioration (PPD) of cassava, although knowledge on the genetic variability and inheritance of this trait is needed. The objective of this study was to estimate genetic parameters and identify sources of tolerance to PPD and their stability in cassava accessions. Roots from 418 cassava accessions, grown in four independent experiments, were evaluated for PPD tolerance 0, 2, 5, and 10 days post-harvest. Data were transformed into area under the PPD-progress curve (AUP-PPD) to quantify tolerance. Genetic parameters, stability (Si), adaptability (Ai), and the joint analysis of stability and adaptability (Zi) were obtained via residual maximum likelihood (REML) and best linear unbiased prediction (BLUP) methods. Variance in the genotype (G) x environment (E) interaction and genotypic variance were important for PPD tolerance. Individual broad-sense heritability (hg(2)= 0.38 ± 0.04) and average heritability in accessions (hmg(2)= 0.52) showed high genetic control of PPD tolerance. Genotypic correlation of AUP-PPD in different experiments was of medium magnitude (ȓgA = 0.42), indicating significant G x E interaction. The predicted genotypic values o f G x E free of interaction (û + ĝi) showed high variation. Of the 30 accessions with high Zi, 19 were common to û + ĝi, Si, and Ai parameters. The genetic gain with selection of these 19 cassava accessions was -55.94, -466.86, -397.72, and -444.03% for û + ĝi, Si, Ai, and Zi, respectively, compared with the overall mean for each parameter. These results demonstrate the variability and potential of cassava germplasm to introduce PPD tolerance in commercial varieties.
Liu, X Z; Sang, M; Zhang, X A; Zhang, T K; Zhang, H Y; He, X; Li, S X; Sun, X D; Zhang, Z M
2017-05-01
Saccharomyces uvarum is a good wine yeast species that may have great potential for the future. However, sulfur tolerance of most S. uvarum strains is very poor. In addition there is still little information about the SSU1 gene of S. uvarum, which encodes a putative transporter conferring sulfite tolerance. In order to analyze the function of the SSU1 gene, two expression vectors that contained different SSU1 genes were constructed and transferred into a sulfite-tolerant S. uvarum strain, A9. Then sulfite tolerance, SO2 production, and PCR, sequencing, RT-qPCR and transcriptome analyses were used to access the function of the S. uvarum SSU1 gene. Our results illustrated that enhancing expression of the SSU1 gene can promote sulfite resistance in S. uvarum, and an insertion fragment ahead of the additional SSU1 gene, as seen in some alleles, could affect the expression of other genes and the sulfite tolerance level of S. uvarum. This is the first report on enhancing the expression of the SSU1 gene of S. uvarum. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
ComplexContact: a web server for inter-protein contact prediction using deep learning.
Zeng, Hong; Wang, Sheng; Zhou, Tianming; Zhao, Feifeng; Li, Xiufeng; Wu, Qing; Xu, Jinbo
2018-05-22
ComplexContact (http://raptorx2.uchicago.edu/ComplexContact/) is a web server for sequence-based interfacial residue-residue contact prediction of a putative protein complex. Interfacial residue-residue contacts are critical for understanding how proteins form complex and interact at residue level. When receiving a pair of protein sequences, ComplexContact first searches for their sequence homologs and builds two paired multiple sequence alignments (MSA), then it applies co-evolution analysis and a CASP-winning deep learning (DL) method to predict interfacial contacts from paired MSAs and visualizes the prediction as an image. The DL method was originally developed for intra-protein contact prediction and performed the best in CASP12. Our large-scale experimental test further shows that ComplexContact greatly outperforms pure co-evolution methods for inter-protein contact prediction, regardless of the species.
2013-01-01
Background Field pea (Pisum sativum L.) is a self-pollinating, diploid, cool-season food legume. Crop production is constrained by multiple biotic and abiotic stress factors, including salinity, that cause reduced growth and yield. Recent advances in genomics have permitted the development of low-cost high-throughput genotyping systems, allowing the construction of saturated genetic linkage maps for identification of quantitative trait loci (QTLs) associated with traits of interest. Genetic markers in close linkage with the relevant genomic regions may then be implemented in varietal improvement programs. Results In this study, single nucleotide polymorphism (SNP) markers associated with expressed sequence tags (ESTs) were developed and used to generate comprehensive linkage maps for field pea. From a set of 36,188 variant nucleotide positions detected through in silico analysis, 768 were selected for genotyping of a recombinant inbred line (RIL) population. A total of 705 SNPs (91.7%) successfully detected segregating polymorphisms. In addition to SNPs, genomic and EST-derived simple sequence repeats (SSRs) were assigned to the genetic map in order to obtain an evenly distributed genome-wide coverage. Sequences associated with the mapped molecular markers were used for comparative genomic analysis with other legume species. Higher levels of conserved synteny were observed with the genomes of Medicago truncatula Gaertn. and chickpea (Cicer arietinum L.) than with soybean (Glycine max [L.] Merr.), Lotus japonicus L. and pigeon pea (Cajanus cajan [L.] Millsp.). Parents and RIL progeny were screened at the seedling growth stage for responses to salinity stress, imposed by addition of NaCl in the watering solution at a concentration of 18 dS m-1. Salinity-induced symptoms showed normal distribution, and the severity of the symptoms increased over time. QTLs for salinity tolerance were identified on linkage groups Ps III and VII, with flanking SNP markers suitable for selection of resistant cultivars. Comparison of sequences underpinning these SNP markers to the M. truncatula genome defined genomic regions containing candidate genes associated with saline stress tolerance. Conclusion The SNP assays and associated genetic linkage maps developed in this study permitted identification of salinity tolerance QTLs and candidate genes. This constitutes an important set of tools for marker-assisted selection (MAS) programs aimed at performance enhancement of field pea cultivars. PMID:24134188
Leonforte, Antonio; Sudheesh, Shimna; Cogan, Noel O I; Salisbury, Philip A; Nicolas, Marc E; Materne, Michael; Forster, John W; Kaur, Sukhjiwan
2013-10-17
Field pea (Pisum sativum L.) is a self-pollinating, diploid, cool-season food legume. Crop production is constrained by multiple biotic and abiotic stress factors, including salinity, that cause reduced growth and yield. Recent advances in genomics have permitted the development of low-cost high-throughput genotyping systems, allowing the construction of saturated genetic linkage maps for identification of quantitative trait loci (QTLs) associated with traits of interest. Genetic markers in close linkage with the relevant genomic regions may then be implemented in varietal improvement programs. In this study, single nucleotide polymorphism (SNP) markers associated with expressed sequence tags (ESTs) were developed and used to generate comprehensive linkage maps for field pea. From a set of 36,188 variant nucleotide positions detected through in silico analysis, 768 were selected for genotyping of a recombinant inbred line (RIL) population. A total of 705 SNPs (91.7%) successfully detected segregating polymorphisms. In addition to SNPs, genomic and EST-derived simple sequence repeats (SSRs) were assigned to the genetic map in order to obtain an evenly distributed genome-wide coverage. Sequences associated with the mapped molecular markers were used for comparative genomic analysis with other legume species. Higher levels of conserved synteny were observed with the genomes of Medicago truncatula Gaertn. and chickpea (Cicer arietinum L.) than with soybean (Glycine max [L.] Merr.), Lotus japonicus L. and pigeon pea (Cajanus cajan [L.] Millsp.). Parents and RIL progeny were screened at the seedling growth stage for responses to salinity stress, imposed by addition of NaCl in the watering solution at a concentration of 18 dS m-1. Salinity-induced symptoms showed normal distribution, and the severity of the symptoms increased over time. QTLs for salinity tolerance were identified on linkage groups Ps III and VII, with flanking SNP markers suitable for selection of resistant cultivars. Comparison of sequences underpinning these SNP markers to the M. truncatula genome defined genomic regions containing candidate genes associated with saline stress tolerance. The SNP assays and associated genetic linkage maps developed in this study permitted identification of salinity tolerance QTLs and candidate genes. This constitutes an important set of tools for marker-assisted selection (MAS) programs aimed at performance enhancement of field pea cultivars.
Gupta, Alka; Gopal, Murali; Thomas, George V; Manikandan, Vinu; Gajewski, John; Thomas, George; Seshagiri, Somasekar; Schuster, Stephan C; Rajesh, Preeti; Gupta, Ravi
2014-01-01
Coconut, cocoa and arecanut are commercial plantation crops that play a vital role in the Indian economy while sustaining the livelihood of more than 10 million Indians. According to 2012 Food and Agricultural organization's report, India is the third largest producer of coconut and it dominates the production of arecanut worldwide. In this study, three Plant Growth Promoting Rhizobacteria (PGPR) from coconut (CPCRI-1), cocoa (CPCRI-2) and arecanut (CPCRI-3) characterized for the PGP activities have been sequenced. The draft genome sizes were 4.7 Mb (56% GC), 5.9 Mb (63.6% GC) and 5.1 Mb (54.8% GB) for CPCRI-1, CPCRI-2, CPCRI-3, respectively. These genomes encoded 4056 (CPCRI-1), 4637 (CPCRI-2) and 4286 (CPCRI-3) protein-coding genes. Phylogenetic analysis revealed that both CPCRI-1 and CPCRI-3 belonged to Enterobacteriaceae family, while, CPCRI-2 was a Pseudomonadaceae family member. Functional annotation of the genes predicted that all three bacteria encoded genes needed for mineral phosphate solubilization, siderophores, acetoin, butanediol, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, chitinase, phenazine, 4-hydroxybenzoate, trehalose and quorum sensing molecules supportive of the plant growth promoting traits observed in the course of their isolation and characterization. Additionally, in all the three CPCRI PGPRs, we identified genes involved in synthesis of hydrogen sulfide (H2S), which recently has been proposed to aid plant growth. The PGPRs also carried genes for central carbohydrate metabolism indicating that the bacteria can efficiently utilize the root exudates and other organic materials as energy source. Genes for production of peroxidases, catalases and superoxide dismutases that confer resistance to oxidative stresses in plants were identified. Besides these, genes for heat shock tolerance, cold shock tolerance and glycine-betaine production that enable bacteria to survive abiotic stress were also identified.
Specialization of Bacillus in the Geochemically Challenged Environment of Death Valley
NASA Astrophysics Data System (ADS)
Kopac, S.
2014-04-01
Death Valley is the hottest, driest place in North America, a desert with soils containing toxic elements such as boron and lead. While most organisms are unable to survive under these conditions, a diverse community of bacteria survives here. What has enabled bacteria to adapt and thrive in a plethora of extreme and stressful environments where other organisms are unable to grow? The unique environmental adaptations that distinguish ecologically distinct bacterial groups (ecotypes) remain a mystery, in contrast to many animal species (perhaps most notably Darwin's ecologically distinct finch species). We resolve the ecological factors associated with recently diverged ecotypes of the soil bacteria Bacillus subtilis and Bacillus licheniformis, isolated from the dry, geochemically challenging soils of Death Valley, CA. To investigate speciation associated with challenging environmental parameters, we sampled soil transects along a 400m stretch that parallels a decrease in salinity adjacent to a salt flat; transects also encompass gradients in soil B, Cu, Fe, NO3, and P, all of which were quantified in our soil samples. We demarcated strains using Ecotype Simulation, a sequence-based algorithm. Each ecotype's habitat associations were determined with respect to salinity, B, Cu, Fe, NO3, and P. In addition, our sample strains were tested for tolerance of copper, boron and salinity (all known to inhibit growth at high concentrations) by comparing their growth over a 20 hour period. Ecotypes differed in their habitat associations with salinity, boron, copper, iron, and other ecological factors; these environmental dimensions are likely causing speciation of B. subtilis-licheniformis ecotypes at our sample site. Strains also differed in tolerance of boron and copper, providing evidence that our sequence-based demarcations reflect real differences in metabolism. By better understanding the relationship between bacterial speciation and the environment, we can begin to predict the habitability of unexplored extreme and extra-Earth environments.
Davey, James A; Chica, Roberto A
2015-04-01
Computational protein design (CPD) predictions are highly dependent on the structure of the input template used. However, it is unclear how small differences in template geometry translate to large differences in stability prediction accuracy. Herein, we explored how structural changes to the input template affect the outcome of stability predictions by CPD. To do this, we prepared alternate templates by Rotamer Optimization followed by energy Minimization (ROM) and used them to recapitulate the stability of 84 protein G domain β1 mutant sequences. In the ROM process, side-chain rotamers for wild-type (WT) or mutant sequences are optimized on crystal or nuclear magnetic resonance (NMR) structures prior to template minimization, resulting in alternate structures termed ROM templates. We show that use of ROM templates prepared from sequences known to be stable results predominantly in improved prediction accuracy compared to using the minimized crystal or NMR structures. Conversely, ROM templates prepared from sequences that are less stable than the WT reduce prediction accuracy by increasing the number of false positives. These observed changes in prediction outcomes are attributed to differences in side-chain contacts made by rotamers in ROM templates. Finally, we show that ROM templates prepared from sequences that are unfolded or that adopt a nonnative fold result in the selective enrichment of sequences that are also unfolded or that adopt a nonnative fold, respectively. Our results demonstrate the existence of a rotamer bias caused by the input template that can be harnessed to skew predictions toward sequences displaying desired characteristics. © 2014 The Protein Society.
Incestuous sisters: mate preference for brothers over unrelated males in Drosophila melanogaster.
Loyau, Adeline; Cornuau, Jérémie H; Clobert, Jean; Danchin, Etienne
2012-01-01
The literature is full of examples of inbreeding avoidance, while recent mathematical models predict that inbreeding tolerance or even inbreeding preference should be expected under several realistic conditions like e.g. polygyny. We investigated male and female mate preferences with respect to relatedness in the fruit fly D. melanogaster. Experiments offered the choice between a first order relative (full-sibling or parent) and an unrelated individual with the same age and mating history. We found that females significantly preferred mating with their brothers, thus supporting inbreeding preference. Moreover, females did not avoid mating with their fathers, and males did not avoid mating with their sisters, thus supporting inbreeding tolerance. Our experiments therefore add empirical evidence for inbreeding preference, which strengthens the prediction that inbreeding tolerance and preference can evolve under specific circumstances through the positive effects on inclusive fitness.
DEMO: Sequence Alignment to Predict Across Species Susceptibility
The US Environmental Protection Agency Sequence Alignment to Predict Across Species Susceptibility tool (SeqAPASS; https://seqapass.epa.gov/seqapass/) was developed to comparatively evaluate protein sequence and structural similarity across species as a means to extrapolate toxic...
Adhikari, Badri; Hou, Jie; Cheng, Jianlin
2018-03-01
In this study, we report the evaluation of the residue-residue contacts predicted by our three different methods in the CASP12 experiment, focusing on studying the impact of multiple sequence alignment, residue coevolution, and machine learning on contact prediction. The first method (MULTICOM-NOVEL) uses only traditional features (sequence profile, secondary structure, and solvent accessibility) with deep learning to predict contacts and serves as a baseline. The second method (MULTICOM-CONSTRUCT) uses our new alignment algorithm to generate deep multiple sequence alignment to derive coevolution-based features, which are integrated by a neural network method to predict contacts. The third method (MULTICOM-CLUSTER) is a consensus combination of the predictions of the first two methods. We evaluated our methods on 94 CASP12 domains. On a subset of 38 free-modeling domains, our methods achieved an average precision of up to 41.7% for top L/5 long-range contact predictions. The comparison of the three methods shows that the quality and effective depth of multiple sequence alignments, coevolution-based features, and machine learning integration of coevolution-based features and traditional features drive the quality of predicted protein contacts. On the full CASP12 dataset, the coevolution-based features alone can improve the average precision from 28.4% to 41.6%, and the machine learning integration of all the features further raises the precision to 56.3%, when top L/5 predicted long-range contacts are evaluated. And the correlation between the precision of contact prediction and the logarithm of the number of effective sequences in alignments is 0.66. © 2017 Wiley Periodicals, Inc.
US forest response to projected climate-related stress: a tolerance perspective.
Liénard, Jean; Harrison, John; Strigul, Nikolay
2016-08-01
Although it is widely recognized that climate change will require a major spatial reorganization of forests, our ability to predict exactly how and where forest characteristics and distributions will change has been rather limited. Current efforts to predict future distribution of forested ecosystems as a function of climate include species distribution models (for fine-scale predictions) and potential vegetation climate envelope models (for coarse-grained, large-scale predictions). Here, we develop and apply an intermediate approach wherein we use stand-level tolerances of environmental stressors to understand forest distributions and vulnerabilities to anticipated climate change. In contrast to other existing models, this approach can be applied at a continental scale while maintaining a direct link to ecologically relevant, climate-related stressors. We first demonstrate that shade, drought, and waterlogging tolerances of forest stands are strongly correlated with climate and edaphic conditions in the conterminous United States. This discovery allows the development of a tolerance distribution model (TDM), a novel quantitative tool to assess landscape level impacts of climate change. We then focus on evaluating the implications of the drought TDM. Using an ensemble of 17 climate change models to drive this TDM, we estimate that 18% of US ecosystems are vulnerable to drought-related stress over the coming century. Vulnerable areas include mostly the Midwest United States and Northeast United States, as well as high-elevation areas of the Rocky Mountains. We also infer stress incurred by shifting climate should create an opening for the establishment of forest types not currently seen in the conterminous United States. © 2016 John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Cusick, K. D.; Dale, J.; Little, B.; Cockrell, A.; Biffinger, J.
2016-02-01
Alteromonas macleodii is a ubiquitous marine bacterium that clusters by molecular analyses into two ecotypes: surface and deep-water. Our group isolated a marine bacterium from copper coupons that generates nanoparticles (NPs) at elevated copper concentrations. Sequencing of the 16S rRNA gene identified it as an A. macleodii strain. In phylogenetic analyses based on the gyrB gene, it clustered with other surface isolates; however, it formed a unique cluster separate from that of other surface isolates based on rpoB gene sequences. Copper is commonly employed as an antifouling agent on the hulls of ships, and so copper tolerance and NP generation is under investigation in this strain. The overall goals of this study were: (1) to determine if copper tolerance is the result of changes at the genetic or transcriptional level and (2) to identify the genes involved in NP formation. Sub-cultures were established from the initial isolate in which copper concentrations were increased in .25 mM increments through multiple generations. These sub-cultures were assayed for NP formation in seawater medium supplemented with 3-4 mM copper. Scanning electron microscopy revealed large aggregates of NPs on the exterior surface of all sub-cultures. Additionally, a portion of the cells in all sub-cultures displayed an elongated morphology in comparison to the wild-type. No NPs were observed in wild-type controls grown without the addition of increased copper. Metagenomic sequencing of natural populations of A. macleodii revealed extreme divergence in several large genomic regions whose content includes genes coding for exopolysaccharide production and metal resistance. High-throughput sequencing is being used to determine whether copper tolerance and NP generation is the result of genetic or transcriptional changes. These results will be extended to natural communities to gain insights into the role of bacterial NPs during conditions of elevated metal concentrations in coastal systems.
Hawkins, Troy; Chitale, Meghana; Luban, Stanislav; Kihara, Daisuke
2009-02-15
Protein function prediction is a central problem in bioinformatics, increasing in importance recently due to the rapid accumulation of biological data awaiting interpretation. Sequence data represents the bulk of this new stock and is the obvious target for consideration as input, as newly sequenced organisms often lack any other type of biological characterization. We have previously introduced PFP (Protein Function Prediction) as our sequence-based predictor of Gene Ontology (GO) functional terms. PFP interprets the results of a PSI-BLAST search by extracting and scoring individual functional attributes, searching a wide range of E-value sequence matches, and utilizing conventional data mining techniques to fill in missing information. We have shown it to be effective in predicting both specific and low-resolution functional attributes when sufficient data is unavailable. Here we describe (1) significant improvements to the PFP infrastructure, including the addition of prediction significance and confidence scores, (2) a thorough benchmark of performance and comparisons to other related prediction methods, and (3) applications of PFP predictions to genome-scale data. We applied PFP predictions to uncharacterized protein sequences from 15 organisms. Among these sequences, 60-90% could be annotated with a GO molecular function term at high confidence (>or=80%). We also applied our predictions to the protein-protein interaction network of the Malaria plasmodium (Plasmodium falciparum). High confidence GO biological process predictions (>or=90%) from PFP increased the number of fully enriched interactions in this dataset from 23% of interactions to 94%. Our benchmark comparison shows significant performance improvement of PFP relative to GOtcha, InterProScan, and PSI-BLAST predictions. This is consistent with the performance of PFP as the overall best predictor in both the AFP-SIG '05 and CASP7 function (FN) assessments. PFP is available as a web service at http://dragon.bio.purdue.edu/pfp/. (c) 2008 Wiley-Liss, Inc.
Magozzi, Sarah; Calosi, Piero
2015-01-01
Predicting species vulnerability to global warming requires a comprehensive, mechanistic understanding of sublethal and lethal thermal tolerances. To date, however, most studies investigating species physiological responses to increasing temperature have focused on the underlying physiological traits of either acute or chronic tolerance in isolation. Here we propose an integrative, synthetic approach including the investigation of multiple physiological traits (metabolic performance and thermal tolerance), and their plasticity, to provide more accurate and balanced predictions on species and assemblage vulnerability to both acute and chronic effects of global warming. We applied this approach to more accurately elucidate relative species vulnerability to warming within an assemblage of six caridean prawns occurring in the same geographic, hence macroclimatic, region, but living in different thermal habitats. Prawns were exposed to four incubation temperatures (10, 15, 20 and 25 °C) for 7 days, their metabolic rates and upper thermal limits were measured, and plasticity was calculated according to the concept of Reaction Norms, as well as Q10 for metabolism. Compared to species occupying narrower/more stable thermal niches, species inhabiting broader/more variable thermal environments (including the invasive Palaemon macrodactylus) are likely to be less vulnerable to extreme acute thermal events as a result of their higher upper thermal limits. Nevertheless, they may be at greater risk from chronic exposure to warming due to the greater metabolic costs they incur. Indeed, a trade-off between acute and chronic tolerance was apparent in the assemblage investigated. However, the invasive species P. macrodactylus represents an exception to this pattern, showing elevated thermal limits and plasticity of these limits, as well as a high metabolic control. In general, integrating multiple proxies for species physiological acute and chronic responses to increasing temperature helps providing more accurate predictions on species vulnerability to warming. © 2014 John Wiley & Sons Ltd.
Genetic variation in Southern USA rice genotypes for seedling salinity tolerance
De Leon, Teresa B.; Linscombe, Steven; Gregorio, Glenn; Subudhi, Prasanta K.
2015-01-01
The success of a rice breeding program in developing salt tolerant varieties depends on genetic variation and the salt stress response of adapted and donor rice germplasm. In this study, we used a combination of morphological and physiological traits in multivariate analyses to elucidate the phenotypic and genetic variation in salinity tolerance of 30 Southern USA rice genotypes, along with 19 donor genotypes with varying degree of tolerance. Significant genotypic variation and correlations were found among the salt injury score (SIS), ion leakage, chlorophyll reduction, shoot length reduction, shoot K+ concentration, and shoot Na+/K+ ratio. Using these parameters, the combined methods of cluster analysis and discriminant analysis validated the salinity response of known genotypes and classified most of the USA varieties into sensitive groups, except for three and seven varieties placed in the tolerant and moderately tolerant groups, respectively. Discriminant function and MANOVA delineated the differences in tolerance and suggested no differences between sensitive and highly sensitive (HS) groups. DNA profiling using simple sequence repeat markers showed narrow genetic diversity among USA genotypes. However, the overall genetic clustering was mostly due to subspecies and grain type differentiation and not by varietal grouping based on salinity tolerance. Among the donor genotypes, Nona Bokra, Pokkali, and its derived breeding lines remained the donors of choice for improving salinity tolerance during the seedling stage. However, due to undesirable agronomic attributes and photosensitivity of these donors, alternative genotypes such as TCCP266, Geumgangbyeo, and R609 are recommended as useful and novel sources of salinity tolerance for USA rice breeding programs. PMID:26074937
Lim, Dong-Gyun; Park, Youn-Hee; Kim, Sung-Eun; Jeong, Seong-Hee; Kim, Song-Cheol
2013-08-01
The efficient development of tolerance-inducing therapies and safe reduction of immunosuppression should be supported by early diagnosis and prediction of tolerance in transplantation. Using mouse models of donor-specific tolerance to allogeneic skin and islet grafts we tested whether measurement of tolerance-related gene expression in their alloantigen-reactive peripheral T cell fraction efficiently reflected the tolerance status of recipients. We found that Foxp3, Nrn1, and Klrg1 were preferentially expressed in conditions of tolerance compared with rejection or unmanipulated controls if their expression is measured in CD69(+) T cells prepared from coculture of recipient peripheral T cells and donor antigen-presenting cells. The same pattern of gene expression was observed in recipients grafted with either skin or islets, recipients of different genetic origins, and even those taking immunosuppressive drugs. These findings suggest that the expression of tolerance-related genes in the alloantigen-reactive T cell fraction could be used to detect tolerance in the clinic. Copyright © 2013 Elsevier Inc. All rights reserved.
Using string alignment in a query-by-humming system for real world applications
NASA Astrophysics Data System (ADS)
Sailer, Christian
2005-09-01
Though query by humming (i.e., retrieving music or information about music by singing a characteristic melody) has been a popular research topic during the past decade, few approaches have reached a level of usefulness beyond mere scientific interest. One of the main problems is the inherent contradiction between error tolerance and dicriminative power in conventional melody matching algorithms that rely on a melody contour approach to handle intonation or transcription errors. Adopting the string matching/alignment techniques from bioinformatics to melody sequences allows to directly assess the similarity between two melodies. This method takes an MPEG-7 compliant melody sequence (i.e., a list of note intervals and length ratios) as query and evaluates the steps necessary to transform it into the reference sequence. By introducing a musically founded cost-of-replace function and an adequate post processing, this method yields a measure for melodic similarity. Thus it is possible to construct a query by humming system that can properly discriminate between thousands of melodies and still be sufficiently error tolerant to be used by untrained singers. The robustness has been verified in extensive tests and real world applications.
Bentley, Stephen D.; Corton, Craig; Brown, Susan E.; Barron, Andrew; Clark, Louise; Doggett, Jon; Harris, Barbara; Ormond, Doug; Quail, Michael A.; May, Georgiana; Francis, David; Knudson, Dennis; Parkhill, Julian; Ishimaru, Carol A.
2008-01-01
Clavibacter michiganensis subsp. sepedonicus is a plant-pathogenic bacterium and the causative agent of bacterial ring rot, a devastating agricultural disease under strict quarantine control and zero tolerance in the seed potato industry. This organism appears to be largely restricted to an endophytic lifestyle, proliferating within plant tissues and unable to persist in the absence of plant material. Analysis of the genome sequence of C. michiganensis subsp. sepedonicus and comparison with the genome sequences of related plant pathogens revealed a dramatic recent evolutionary history. The genome contains 106 insertion sequence elements, which appear to have been active in extensive rearrangement of the chromosome compared to that of Clavibacter michiganensis subsp. michiganensis. There are 110 pseudogenes with overrepresentation in functions associated with carbohydrate metabolism, transcriptional regulation, and pathogenicity. Genome comparisons also indicated that there is substantial gene content diversity within the species, probably due to differential gene acquisition and loss. These genomic features and evolutionary dating suggest that there was recent adaptation for life in a restricted niche where nutrient diversity and perhaps competition are low, correlated with a reduced ability to exploit previously occupied complex niches outside the plant. Toleration of factors such as multiplication and integration of insertion sequence elements, genome rearrangements, and functional disruption of many genes and operons seems to indicate that there has been general relaxation of selective pressure on a large proportion of the genome. PMID:18192393