Investigation of the Lipid Binding Properties of the Marburg Virus Matrix Protein VP40.

PubMed

Wijesinghe, Kaveesha J; Stahelin, Robert V

2015-12-30

Marburg virus (MARV), which belongs to the virus family Filoviridae, causes hemorrhagic fever in humans and nonhuman primates that is often fatal. MARV is a lipid-enveloped virus that during the replication process extracts its lipid coat from the plasma membrane of the host cell it infects. MARV carries seven genes, one of which encodes its matrix protein VP40 (mVP40), which regulates the assembly and budding of the virions. Currently, little information is available on mVP40 lipid binding properties. Here, we have investigated the in vitro and cellular mechanisms by which mVP40 associates with lipid membranes. mVP40 associates with anionic membranes in a nonspecific manner that is dependent upon the anionic charge density of the membrane. These results are consistent with recent structural determination of mVP40, which elucidated an mVP40 dimer with a flat and extensive cationic lipid binding interface. Marburg virus (MARV) is a lipid-enveloped filamentous virus from the family Filoviridae. MARV was discovered in 1967, and yet little is known about how its seven genes are used to assemble and form a new viral particle in the host cell it infects. The MARV matrix protein VP40 (mVP40) underlies the inner leaflet of the virus and regulates budding from the host cell plasma membrane. In vitro and cellular assays in this study investigated the mechanism by which mVP40 associates with lipids. The results demonstrate that mVP40 interactions with lipid vesicles or the inner leaflet of the plasma membrane are electrostatic but nonspecific in nature and are dependent on the anionic charge density of the membrane surface. Small molecules that can disrupt lipid trafficking or reduce the anionic charge of the plasma membrane interface may be useful in inhibiting assembly and budding of MARV. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

14-3-3ε Boosts Bleomycin-induced DNA Damage Response by Inhibiting the Drug-Resistant Activity of MVP

PubMed Central

Tang, Siwei; Bai, Chen; Yang, Pengyuan; Chen, Xian

2013-01-01

Major vault protein (MVP) is the predominant constituent of the vault particle, the largest known ribonuclear protein complex. Although emerging evidences have been establishing the links between MVP (vault) and multidrug resistance (MDR), little is known regarding exactly how the MDR activity of MVP is modulated during cellular response to drug-induced DNA damage (DDR). Bleomycin (BLM), an anti-cancer drug, induces DNA double-stranded breaks (DSBs) and consequently triggers the cellular DDR. Due to its physiological implications in hepatocellular carcinoma (HCC) and cell fate decision, 14-3-3ε was chosen as the pathway-specific bait protein to identify the critical target(s) responsible for HCC MDR. By using LC-MS/MS-based proteomic approach, MVP was first identified in the BLM-induced 14-3-3ε interactome formed in HCC cells. Biological characterization revealed that MVP possesses specific activity to promote the resistance to the BLM-induced DDR. On the other hand, 14-3-3ε enhances BLM-induced DDR by interacting with MVP. Mechanistic investigation further revealed that 14-3-3ε, in a phosphorylation-dependent manner, binds to the phosphorylated sites at both Thr52 and Ser864 of the monomer of MVP. Consequently, the phosphorylation-dependent binding between 14-3-3ε and MVP inhibits the drug-resistant activity of MVP for an enhanced DDR to BLM treatment. Our findings provide an insight into the mechanism underlying how the BLM-induced interaction between 14-3-3ε and MVP modulates MDR, implicating novel strategy to overcome the chemotherapeutic resistance through interfering specific protein-protein interactions. PMID:23590642

[Arrhythmias and heart blocks in flying personnel with mitral valve prolapses].

PubMed

Zakharov, V P; Karlov, V N; Bondareva, S V; Vlasov, V D

1999-01-01

Investigated were 76 pilots with ECG-verified mitral valve prolapses (MVP) of the 1st and 2nd degree (w/o profound regurgitation). There were various heart blocks and ECG repolarization changes in 35 cases. Comparison of results of the cardiovascular functional investigations of flyers with MVP displayed non-specific cardiac rhythm and conductance disturbances that were registered more often during ECG-monitoring or test loading. According to the data of this study, bicycle and treadmill ergometry revealed "pseudoischemic" shifts in ECG. Literary indications of a significant loss in human endurance of physical loads due to MVP combined with the strain-induced arrhythmia received the experimental confirmation. Probably, arrhythmias in flyers with diagnosed MVP are predominantly associated with electric instability of the myocardium against the autonomous dysfunction with prevailing adrenergic effects.

Adult women with mitral valve prolapse are more flexible

PubMed Central

Araujo, C; Chaves, C

2005-01-01

Background: Mitral valve prolapse (MVP) is common in women. Other clinical features such as flexibility and hyperlaxity are often associated with MVP, as there is a common biochemical and histological basis for collagen tissue characteristics, range of joint motion, and mitral leaflet excursion. Objective: To confirm whether adult women with MVP are more flexible and hypermobile than those without. Methods: Data from 125 women (mean age 50 years), 31 of them with MVP, were retrospectively analysed with regard to clinical and kinanthropometric aspects. Passive joint motion was evaluated in 20 body movements using Flexitest and three laxity tests. Flexitest individual movements (0 to 4) and overall Flexindex scores were obtained in all subjects by the same investigator. Results: Women with MVP were lighter, less endomorphic and mesomorphic, and more linear. The Flexindex was significantly higher in the women with MVP, both absolute (48 (1.6) v 41 (1.3); p<0.01) and centile for age (67 v 42; p<0.01) values. In 13 out of 20 movements, the Flexitest scores were significantly higher for the women with MVP. Signs of hyperlaxity were about five times more common in these women: 74% v 16% (p<0.01). Scores of 0 and 1 in elbow extension, absence of hyperlaxity, and a Flexindex centile below 65 were almost never found in women with MVP. Conclusion: Flexitest, alone or combined with hyperlaxity tests, may be useful in the assessment of adult women with MVP. PMID:16183767

Multiscale virtual particle based elastic network model (MVP-ENM) for normal mode analysis of large-sized biomolecules.

PubMed

Xia, Kelin

2017-12-20

In this paper, a multiscale virtual particle based elastic network model (MVP-ENM) is proposed for the normal mode analysis of large-sized biomolecules. The multiscale virtual particle (MVP) model is proposed for the discretization of biomolecular density data. With this model, large-sized biomolecular structures can be coarse-grained into virtual particles such that a balance between model accuracy and computational cost can be achieved. An elastic network is constructed by assuming "connections" between virtual particles. The connection is described by a special harmonic potential function, which considers the influence from both the mass distributions and distance relations of the virtual particles. Two independent models, i.e., the multiscale virtual particle based Gaussian network model (MVP-GNM) and the multiscale virtual particle based anisotropic network model (MVP-ANM), are proposed. It has been found that in the Debye-Waller factor (B-factor) prediction, the results from our MVP-GNM with a high resolution are as good as the ones from GNM. Even with low resolutions, our MVP-GNM can still capture the global behavior of the B-factor very well with mismatches predominantly from the regions with large B-factor values. Further, it has been demonstrated that the low-frequency eigenmodes from our MVP-ANM are highly consistent with the ones from ANM even with very low resolutions and a coarse grid. Finally, the great advantage of MVP-ANM model for large-sized biomolecules has been demonstrated by using two poliovirus virus structures. The paper ends with a conclusion.

mvp - an open-source preprocessor for cleaning duplicate records and missing values in mass spectrometry data.

PubMed

Lee, Geunho; Lee, Hyun Beom; Jung, Byung Hwa; Nam, Hojung

2017-07-01

Mass spectrometry (MS) data are used to analyze biological phenomena based on chemical species. However, these data often contain unexpected duplicate records and missing values due to technical or biological factors. These 'dirty data' problems increase the difficulty of performing MS analyses because they lead to performance degradation when statistical or machine-learning tests are applied to the data. Thus, we have developed missing values preprocessor (mvp), an open-source software for preprocessing data that might include duplicate records and missing values. mvp uses the property of MS data in which identical chemical species present the same or similar values for key identifiers, such as the mass-to-charge ratio and intensity signal, and forms cliques via graph theory to process dirty data. We evaluated the validity of the mvp process via quantitative and qualitative analyses and compared the results from a statistical test that analyzed the original and mvp-applied data. This analysis showed that using mvp reduces problems associated with duplicate records and missing values. We also examined the effects of using unprocessed data in statistical tests and examined the improved statistical test results obtained with data preprocessed using mvp.

Cospectral budget of turbulence explains the bulk properties of smooth pipe flow.

PubMed

Katul, Gabriel G; Manes, Costantino

2014-12-01

Connections between the wall-normal turbulent velocity spectrum E(ww)(k) at wave number k and the mean velocity profile (MVP) are explored in pressure-driven flows confined within smooth walls at moderate to high bulk Reynolds numbers (Re). These connections are derived via a cospectral budget for the longitudinal (u') and wall-normal (w') velocity fluctuations, which include a production term due to mean shear interacting with E(ww)(k), viscous effects, and a decorrelation between u' and w' by pressure-strain effects [=π(k)]. The π(k) is modeled using a conventional Rotta-like return-to-isotropy closure but adjusted to include the effects of isotropization of the production term. The resulting cospectral budget yields a generalization of a previously proposed "spectral link" between the MVP and the spectrum of turbulence. The proposed cospectral budget is also shown to reproduce the measured MVP across the pipe with changing Re including the MVP shapes in the buffer and wake regions. Because of the links between E(ww)(k) and the MVP, the effects of intermittency corrections to inertial subrange scales and the so-called spectral bottleneck reported as k approaches viscous dissipation eddy sizes (η) on the MVP shapes are investigated and shown to be of minor importance. Inclusion of a local Reynolds number correction to a parameter associated with the spectral exponential cutoff as kη→1 appears to be more significant to the MVP shape in the buffer region. While the bulk shape of the MVP is reasonably reproduced in all regions of the pipe, the solution to the cospectral budget systematically underestimates the negative curvature of the MVP within the buffer layer.

Mitral valve prolapse associated with celiac artery stenosis: a new ultrasonographic syndrome?

PubMed Central

Arcari, Luciano

2004-01-01

Background Celiac artery stenosis (CAS) may be caused by atherosclerotic degeneration or compression exerted by the arched ligament of the diaphragm. Mitral valve prolapse (MVP) is the most common valvular disorder. There are no reports on an association between CAS and MVP. Methods 1560 (41%) out of 3780 consecutive patients undergoing echocardiographic assessment of MVP, had Doppler sonography of the celiac tract to detect CAS. Results CAS was found in 57 (3.7%) subjects (23 males and 34 females) none of whom complained of symptoms related to visceral ischemia. MVP was observed in 47 (82.4%) subjects with and 118 (7.9%) without CAS (p < 0.001). The agreement between MVP and CAS was 39% (95% CI 32–49%). PSV (Peak Systolic Velocity) was the only predictor of CAS in MPV patients (OR 0.24, 95% CI 0.08–0.69) as selected in a multivariate logistic model. Conclusion CAS and MVP seem to be significantly associated in patients undergoing consecutive ultrasonographic screening. PMID:15588321

Reliability assessment of MVP-BURN and JENDL-4.0 related to nuclear transmutation of light platinum group elements

NASA Astrophysics Data System (ADS)

Terashima, Atsunori; Nilsson, Mikael; Ozawa, Masaki; Chiba, Satoshi

2017-09-01

The Aprés ORIENT research program, as a concept of advanced nuclear fuel cycle, was initiated in FY2011 aiming at creating stable, highly-valuable elements by nuclear transmutation from ↓ssion products. In order to simulate creation of such elements by (n, γ) reaction succeeded by β- decay in reactors, a continuous-energy Monte Carlo burnup calculation code MVP-BURN was employed. Then, it is one of the most important tasks to con↓rm the reliability of MVP-BURN code and evaluated neutron cross section library. In this study, both an experiment of neutron activation analysis in TRIGA Mark I reactor at University of California, Irvine and the corresponding burnup calculation using MVP-BURN code were performed for validation of the simulation on transmutation of light platinum group elements. Especially, some neutron capture reactions such as 102Ru(n, γ)103Ru, 104Ru(n, γ)105Ru, and 108Pd(n, γ)109Pd were dealt with in this study. From a comparison between the calculation (C) and the experiment (E) about 102Ru(n, γ)103Ru, the deviation (C/E-1) was signi↓cantly large. Then, it is strongly suspected that not MVP-BURN code but the neutron capture cross section of 102Ru belonging to JENDL-4.0 used in this simulation have made the big di↑erence as (C/E-1) >20%.

Conceptual Designing of a Reduced Moderation Pressurized Water Reactor by Use of MVP and MVP-BURN

NASA Astrophysics Data System (ADS)

Kugo, T.

A conceptual design of a seed-blanket assembly PWR core with a complicated geometry and a strong heterogeneity has been carried forward by use of the continuous-energy Monte Carlo method. Through parametric survey calculations by repeated use of MVP and a lattice burn-up calculation by MVP-BURN, a seed-blanket assembly configuration suitable for a concept of RMWR has been established, by evaluating precisely reactivity, a conversion ratio and a coolant void reactivity coefficient in a realistic computation time on a super computer.

Aversive Learning and Appetitive Motivation Toggle Feed-Forward Inhibition in the Drosophila Mushroom Body.

PubMed

Perisse, Emmanuel; Owald, David; Barnstedt, Oliver; Talbot, Clifford B; Huetteroth, Wolf; Waddell, Scott

2016-06-01

In Drosophila, negatively reinforcing dopaminergic neurons also provide the inhibitory control of satiety over appetitive memory expression. Here we show that aversive learning causes a persistent depression of the conditioned odor drive to two downstream feed-forward inhibitory GABAergic interneurons of the mushroom body, called MVP2, or mushroom body output neuron (MBON)-γ1pedc>α/β. However, MVP2 neuron output is only essential for expression of short-term aversive memory. Stimulating MVP2 neurons preferentially inhibits the odor-evoked activity of avoidance-directing MBONs and odor-driven avoidance behavior, whereas their inhibition enhances odor avoidance. In contrast, odor-evoked activity of MVP2 neurons is elevated in hungry flies, and their feed-forward inhibition is required for expression of appetitive memory at all times. Moreover, imposing MVP2 activity promotes inappropriate appetitive memory expression in food-satiated flies. Aversive learning and appetitive motivation therefore toggle alternate modes of a common feed-forward inhibitory MVP2 pathway to promote conditioned odor avoidance or approach. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

LuxO controls extracellular protease, haemolytic activities and siderophore production in fish pathogen Vibrio alginolyticus.

PubMed

Wang, Q; Liu, Q; Ma, Y; Rui, H; Zhang, Y

2007-11-01

To characterize the luxO gene in fish pathogen Vibrio alginolyticus MVP01 and investigate its roles in regulation of extracellular products (ECP) and siderophore production. The luxO gene was cloned from V. alginolyticus MVP01. Genetic analysis revealed that it encoded a protein with high similarity to other LuxO homologues. The luxO in-frame deletion mutant and rpoN null mutant were constructed with suicide plasmids. We demonstrated that sole deletion in LuxO increased the secretion of extracellular protease and haemolytic products, but decreased siderophore production for V. alginolyticus MVP01. Mutants with null rpoN displayed significantly enhanced protease level and siderophore production while notable reduction in haemolytic activities of ECP. Vibrio alginolyticus harbours functional luxO gene that regulates the secretion of extracellular protease and haemolytic materials as well as siderophore production in either sigma(54) dependent or independent manners. The current study demonstrated that V. alginolyticus MVP01 produces extracellular protease and haemolytic activity material as well as siderophore, which may be characteristics of the virulence of the strain. Revelations that secretion of these products is under the regulation of LuxO and sigma(54) as well as the potential quorum sensing systems in V. alginolyticus MVP01 will expedite the understanding of vibriosis pathogenesis.

Is mitral valve repair superior to replacement for chronic ischemic mitral regurgitation with left ventricular dysfunction?

PubMed Central

2010-01-01

Background This study was undertaken to compare mitral valve repair and replacement as treatments for ischemic mitral regurgitation (IMR) with left ventricular dysfunction (LVD). Specifically, we sought to determine whether the choice of mitral valve procedure affected survival, and discover which patients were predicted to benefit from mitral valve repair and which from replacement. Methods A total of 218 consecutive patients underwent either mitral valve repair (MVP, n = 112) or mitral valve replacement (MVR, n = 106). We retrospectively reviewed the clinical material, operation methods, echocardiography check during operation and follow-up. Patients details and follow-up outcomes were compared using multivariate and Kaplan-Meier analyses. Results No statistical difference was found between the two groups in term of intraoperative data. Early mortality was 3.2% (MVP 2.7% and MVR 3.8%). At discharge, Left ventricular end-systolic and end-diastolic diameter and left ventricular ejection fraction (LVEF) were improved more in the MVP group than MVR group (P < 0.05), however, in follow-up no statistically significant difference was observed between the MVR and MVP group (P > 0.05). Follow-up mitral regurgitation grade was significantly improved in the MVR group compared with the MVP group (P < 0.05). The Kaplan-Meier survival estimates at 1, 3, and 5 years were simlar between MVP and MVR group. Logistic regression revealed poor survival was associated with old age(#75), preoperative renal insufficiency and low left ventricular ejection fraction (< 30%). Conclusion Mitral valve repair is the procedure of choice in the majority of patients having surgery for severe ischemic mitral regurgitation with left ventricular dysfunction. Early results of MVP treatment seem to be satisfactory, but several lines of data indicate that mitral valve repair provided less long-term benefit than mitral valve replacement in the LVD patients. PMID:21059216

Mitomycin C plus vindesine plus etoposide (MEV) versus mitomycin C plus vindesine plus cisplatin (MVP) in stage IV non-small-cell lung cancer: A phase III multicentre randomised trial. The "Gruppo Oncologico Centro-Sud-Isole' (G.O.C.S.I.).

PubMed

Gridelli, C; Perrone, F; Palmeri, S; D'Aprile, M; Cognetti, F; Rossi, A; Gebbia, V; Pepe, R; Veltri, E; Airoma, G; Russo, A; Incoronato, P; Scinto, A F; Palazzolo, G; Natali, M; Leonardi, V; Gallo, C; De Placido, S; Bianco, A R

1996-10-01

To compare mitomycin C plus vindesine plus etoposide (MEV) vs. mitomycin C plus vindesine plus cisplatin (MVP) in the treatment of stage IV non-small-cell lung cancer. 204 patients were entered in a phase III multicentre randomised trial from June 1990 to December 1994 and stratified according to the ECOG performance status (0-1 vs. 2). MVP was given in the following dosages: mitomycin C 8 mg/m2+vindesine 3 mg/m2+cisplatin 100 mg/m2 i.v. day 1 and vindesine 3 mg/m2 i.v. day 8 with cycles repeated every 4 weeks. MEV was given in the following dosages: mitomycin C 8 mg/m2+vindesine 3 mg/ m2 i.v. day 1 and etoposide 100 mg/m2 i.v. days 1 to 3 with cycles repeated every 3 weeks. For both treatments a maximum of 6 cycles was planned. Response and toxicity were evaluated according to WHO. Subjective responses were assessed by numerical scales. Analyses were made on the basis of intent to treat. The objective response rate was 21.4% (1 CR + 21 PR among 103 patients) in the MEV and 28.7% (1 CR + 28 PR among 101 patients) in the MVP arm (P = 0.48). Symptoms were similar in the two arms. 196 patients progressed and 182 died. The median times to progression were 10 weeks (95% CI 9-12) and 12 weeks (95% CI 10-15) and median survivals were 29 weeks (95% CI 25-36) and 28 weeks (95% CI 25-35) in the MEV and MVP arms, respectively. The relative risks of progressing and of dying were 0.89 (95% CL 0.66-1.20) and 0.96 (95% CL 0.71-1.30), respectively, for patients receiving MVP as compared with those receiving MEV at multivariate analysis adjusted by sex, age, histologic type, number of metastatic sites, performance status at entry, and centre. In the present study, no significant differences were observed in response rate, survival or palliation of symptoms between the MEV and MVP regimens, while toxicity was significantly more frequent and severe with MVP. Thus, MEV should be considered a reasonable alternative to the MVP regimen in the treatment of stage IV NSCLC.

Identification and analysis of proton-translocating pyrophosphatases in the methanogenic archaeon Methansarcina mazei.

PubMed

Bäumer, Sebastian; Lentes, Sabine; Gottschalk, Gerhard; Deppenmeier, Uwe

2002-03-01

Analysis of genome sequence data from the methanogenic archaeon Methanosarcina mazei Gö1 revealed the existence of two open reading frames encoding proton-translocating pyrophosphatases (PPases). These open reading frames are linked by a 750-bp intergenic region containing TC-rich stretches and are transcribed in opposite directions. The corresponding polypeptides are referred to as Mvp1 and Mvp2 and consist of 671 and 676 amino acids, respectively. Both enzymes represent extremely hydrophobic, integral membrane proteins with 15 predicted transmembrane segments and an overall amino acid sequence similarity of 50.1%. Multiple sequence alignments revealed that Mvp1 is closely related to eukaryotic PPases, whereas Mvp2 shows highest homologies to bacterial PPases. Northern blot experiments with RNA from methanol-grown cells harvested in the mid-log growth phase indicated that only Mvp2 was produced under these conditions. Analysis of washed membranes showed that Mvp2 had a specific activity of 0.34 U mg (protein)(-1). Proton translocation experiments with inverted membrane vesicles prepared from methanol-grown cells showed that hydrolysis of 1 mol of pyrophosphate was coupled to the translocation of about 1 mol of protons across the cytoplasmic membrane. Appropriate conditions for mvp1 expression could not be determined yet. The pyrophosphatases of M. mazei Gö1 represent the first examples of this enzyme class in methanogenic archaea and may be part of their energy-conserving system.

MVP and College Success for First-Year Students

ERIC Educational Resources Information Center

Becker, Karen A.

2017-01-01

This chapter describes a Reading and Study Skills program and course that are offered to first-year students who are underprepared or reluctant and who may be at risk for failure in other courses as well as at risk for long-term retention and graduation. The course is discussed with respect to its parallels to the MVP model, and initial evidence…

[Prospective randomized study of HMVP, MVP, and HVP regimens in treatment of advanced non-small cell lung cancer].

PubMed

Gao, Jian-Fei; Li, Chang-Sheng; Zhang, Bi-Cheng; Du, Guang-Zu; Zhang, Xin-Hua; Wang, Jun; Zhu, Yu-Ze; Ou, Wu-Ling; Yang, Bo

2004-04-01

Non-small cell lung cancer (NSCLC) is hyposensitive to the normal first and second-line chemotherapy regimens. Camptothecin derivative is becoming a hot point in the treatment of advanced NSCLC. The objective of this article was to evaluate the response, toxicity, and survival time of HMVP, MVP, and HVP regimens (detail in below) in the treatment of advanced NSCLC. A total of 134 cases with advanced NSCLC was randomized into three groups: HMVP group [46 patients, hydroxycamptothecin (HCPT) 12 mg/m(2) from d1 to d5, mitomycin C (MMC) 6 mg/m(2) d1, vindesine (VDS) 2.5-3 mg/m(2) d1 and d8, cisplatin (DDP) 50 mg/m(2) d2 and d3], MVP group (44 patients, MMC, VDS and DDP were the same as HMVP group) and HVP group (44 patients, HCPT, VDS, DDP were the same as HMVP group). The response rates were 39.54% (17/43), 35.57% (15/42), and 26.19% (11/42) in HMVP, MVP, and HVP groups, respectively; no significant difference was detected among the three groups (P >0.05). No significant difference was detected in the median time of remission, median survival time, and 1-, 2-year survival rates among the three groups. Moreover, no significant difference was detected in grade III-IV leukopenia, grade III-IV thrombocytopenia, grade III-IV nausea and vomiting and grade III-IV constipation among the three groups. The response rate of MVP regimen is slightly lower than that of HMVP regimen, but HMVP regimen do not show obvious superiority. It may increase toxicities such as leukopenia, nausea/vomiting, and constipation. The response rate of HVP regimen is slightly lower than that of MVP regimen.

jsc2018m000314_Spinning_Science_Multi-use_Variable-g_Platform_Arrives_at_the_Space_Station-MP4

NASA Image and Video Library

2018-05-09

Spinning Science: Multi-use Variable-g Platform Arrives at the Space Station --- The Multi-use Variable-gravity Platform (MVP) Validation mission will install and test the MVP, a new hardware platform developed and owned by Techshot Inc., on the International Space Station (ISS). Though the MVP is designed for research with many different kinds of organisms and cell types, this validation mission will focus on Drosophila melanogaster, more commonly known as the fruit fly. This platform will be especially important for fruit fly research, as it will allow researchers to study larger sample sizes of Drosophila melanogaster than in other previous hardware utilizing centrifuges and it will be able to support fly colonies for multiple generations.

Identification and analysis of proton-translocating pyrophosphatases in the methanogenic archaeon Methanosarcina mazei

PubMed Central

Bäumer, Sebastian; Lentes, Sabine; Gottschalk, Gerhard; Deppenmeier, Uwe

2002-01-01

Analysis of genome sequence data from the methanogenic archaeon Methanosarcina mazei Gö1 revealed the existence of two open reading frames encoding proton-translocating pyrophosphatases (PPases). These open reading frames are linked by a 750-bp intergenic region containing TC-rich stretches and are transcribed in opposite directions. The corresponding polypeptides are referred to as Mvp1 and Mvp2 and consist of 671 and 676 amino acids, respectively. Both enzymes represent extremely hydrophobic, integral membrane proteins with 15 predicted transmembrane segments and an overall amino acid sequence similarity of 50.1%. Multiple sequence alignments revealed that Mvp1 is closely related to eukaryotic PPases, whereas Mvp2 shows highest homologies to bacterial PPases. Northern blot experiments with RNA from methanol-grown cells harvested in the mid-log growth phase indicated that only Mvp2 was produced under these conditions. Analysis of washed membranes showed that Mvp2 had a specific activity of 0.34 U mg (protein)–1. Proton translocation experiments with inverted membrane vesicles prepared from methanol-grown cells showed that hydrolysis of 1 mol of pyrophosphate was coupled to the translocation of about 1 mol of protons across the cytoplasmic membrane. Appropriate conditions for mvp1 expression could not be determined yet. The pyrophosphatases of M. mazei Gö1 represent the first examples of this enzyme class in methanogenic archaea and may be part of their energy-conserving system. Abbreviations: DCCD, N,N′-dicyclohexylcarbodiimide; PPase, inorganic pyrophosphatase; PPi, inorganic pyrophosphate; Δp, proton motive force. PMID:15803653

Atrial antitachycardia pacing and managed ventricular pacing in bradycardia patients with paroxysmal or persistent atrial tachyarrhythmias: the MINERVA randomized multicentre international trial.

PubMed

Boriani, Giuseppe; Tukkie, Raymond; Manolis, Antonis S; Mont, Lluis; Pürerfellner, Helmut; Santini, Massimo; Inama, Giuseppe; Serra, Paolo; de Sousa, João; Botto, Giovanni Luca; Mangoni, Lorenza; Grammatico, Andrea; Padeletti, Luigi

2014-09-14

Atrial fibrillation (AF) is a common comorbidity in bradycardia patients. Advanced pacemakers feature atrial preventive pacing and atrial antitachycardia pacing (DDDRP) and managed ventricular pacing (MVP), which minimizes unnecessary right ventricular pacing. We evaluated whether DDDRP and MVP might reduce mortality, morbidity, or progression to permanent AF when compared with standard dual-chamber pacing (Control DDDR). In a randomized, parallel, single-blind, multi-centre trial we enrolled 1300 patients with bradycardia and previous atrial tachyarrhythmias, in whom a DDDRP pacemaker had recently been implanted. History of permanent AF and third-degree atrioventricular block were exclusion criteria. After a 1-month run-in period, 1166 eligible patients, aged 74 ± 9 years, 50% females, were randomized to Control DDDR, DDDRP + MVP, or MVP. Analysis was intention-to-treat. The primary outcome, i.e. the 2-year incidence of a combined endpoint composed of death, cardiovascular hospitalizations, or permanent AF, occurred in 102/385 (26.5%) Control DDDR patients, in 76/383 (19.8%) DDDRP + MVP patients [hazard ratio (HR) = 0.74, 95% confidence interval 0.55-0.99, P = 0.04 vs. Control DDDR] and in 85/398 (21.4%) MVP patients (HR = 0.89, 95% confidence interval 0.77-1.03, P = 0.125 vs. Control DDDR). When compared with Control DDDR, DDDRP + MVP reduced the risk for AF longer than 1 day (HR = 0.66, 95% CI 0.52-0.85, P < 0.001), AF longer than 7 days (HR = 0.52, 95% CI 0.36-0.73, P < 0.001), and permanent AF (HR = 0.39, 95% CI 0.21-0.75, P = 0.004). In patients with bradycardia and atrial tachyarrhythmias, DDDRP + MVP is superior to standard dual-chamber pacing. The primary endpoint was significantly lowered through the reduction of the progression of atrial tachyarrhythmias to permanent AF. NCT00262119. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Cardiology.

A Phase III randomized controlled trial comparing the efficacy, safety and tolerability of oral dydrogesterone versus micronized vaginal progesterone for luteal support in in vitro fertilization

PubMed Central

Tournaye, Herman; Sukhikh, Gennady T.; Griesinger, Georg

2017-01-01

Abstract STUDY QUESTION Is oral dydrogesterone 30 mg daily (10 mg three times daily [TID]) non-inferior to micronized vaginal progesterone (MVP) 600 mg daily (200 mg TID) for luteal support in in vitro fertilization (IVF), assessed by the presence of fetal heartbeats determined by transvaginal ultrasound at 12 weeks of gestation? SUMMARY ANSWER Non-inferiority of oral dydrogesterone versus MVP was demonstrated at 12 weeks of gestation, with a difference in pregnancy rate and an associated confidence interval (CI) that were both within the non-inferiority margin. WHAT IS KNOWN ALREADY MVP is routinely used in most clinics for luteal support in IVF, but it is associated with side effects, such as vaginal irritation and discharge, as well as poor patient acceptance. Dydrogesterone may be an alternative treatment due to its patient-friendly oral administration. STUDY DESIGN, SIZE, DURATION Lotus I was an international Phase III randomized controlled trial, performed across 38 sites, from August 2013 to March 2016. Subjects were premenopausal women (>18 to <42 years of age; body mass index (BMI) ≥18 to ≤30 kg/m2) with a documented history of infertility who were planning to undergo IVF. A centralized electronic system was used for randomization, and the study investigators, sponsor's study team, and subjects remained blinded throughout the study. PARTICIPANTS/MATERIALS, SETTING, METHODS In total, 1031 subjects were randomized to receive either oral dydrogesterone (n = 520) or MVP (n = 511). Luteal support was started on the day of oocyte retrieval and continued until 12 weeks of gestation (Week 10), if a positive pregnancy test was obtained at 2 weeks after embryo transfer. MAIN RESULTS AND THE ROLE OF CHANCE In the full analysis set (FAS), 497 and 477 subjects in the oral dydrogesterone and MVP groups, respectively, had an embryo transfer. Non-inferiority of oral dydrogesterone was demonstrated, with pregnancy rates at 12 weeks of gestation of 37.6% and 33.1% in the oral dydrogesterone and MVP treatment groups, respectively (difference 4.7%; 95% CI: −1.2–10.6%). Live birth rates of 34.6% (172 mothers with 213 newborns) and 29.8% (142 mothers with 158 newborns) were obtained in the dydrogesterone and MVP groups, respectively (difference 4.9%; 95% CI: −0.8–10.7%). Oral dydrogesterone was well tolerated and had a similar safety profile to MVP. LIMITATIONS, REASONS FOR CAUTION The analysis of the results was powered to consider the clinical pregnancy rate, but the live birth rate may be of greater clinical interest. Conclusions relating to the differences between treatments in live birth rate, observed in this study, should therefore be made with caution. WIDER IMPLICATIONS OF THE FINDINGS Oral dydrogesterone may replace MVP as the standard of care for luteal phase support in IVF, owing to the oral route being more patient-friendly than intravaginal administration, as well as it being a well tolerated and efficacious treatment. STUDY FUNDING/COMPETING INTEREST(S) Sponsored and supported by Abbott Established Pharmaceuticals Division. H.T.’s institution has received grants from Merck, MSD, Goodlife, Cook, Roche, Besins, Ferring and Mithra (now Allergan) and H.T. has received consultancy fees from Finox, Ferring, Abbott, ObsEva and Ovascience. G.S. has nothing to disclose. E.K. is an employee of Abbott GmbH. G.G. has received investigator fees from Abbott during the conduct of the study; outside of this submitted work, G.G. has received personal fees and non-financial support from MSD, Ferring, Merck-Serono, Finox, TEVA, Glycotope, as well as personal fees from VitroLife, NMC Healthcare LLC, ReprodWissen LLC and ZIVA LLC. TRIAL REGISTRATION NUMBER NCT01850030 (clinicaltrials.gov). TRIAL REGISTRATION DATE 19 April 2013. DATE OF FIRST PATIENT'S ENROLLMENT 23 August 2013. PMID:28333318

Usefulness of Mitral Valve Prosthetic or Bioprosthetic Time Velocity Index Ratio to Detect Prosthetic or Bioprosthetic Mitral Valve Dysfunction.

PubMed

Luis, Sushil Allen; Blauwet, Lori A; Samardhi, Himabindu; West, Cathy; Mehta, Ramila A; Luis, Chris R; Scalia, Gregory M; Miller, Fletcher A; Burstow, Darryl J

2017-10-15

This study aimed to investigate the utility of transthoracic echocardiographic (TTE) Doppler-derived parameters in detection of mitral prosthetic dysfunction and to define optimal cut-off values for identification of such dysfunction by valve type. In total, 971 TTE studies (647 mechanical prostheses; 324 bioprostheses) were compared with transesophageal echocardiography for evaluation of mitral prosthesis function. Among all prostheses, mitral valve prosthesis (MVP) ratio (ratio of time velocity integral of MVP to that of left ventricular outflow tract; odds ratio [OR] 10.34, 95% confidence interval [95% CI] 6.43 to 16.61, p<0.001), E velocity (OR 3.23, 95% CI 1.61 to 6.47, p<0.001), and mean gradient (OR 1.13, 95% CI 1.02 to 1.25, p=0.02) provided good discrimination of clinically normal and clinically abnormal prostheses. Optimal cut-off values by receiver operating characteristic analysis for differentiating clinically normal and abnormal prostheses varied by prosthesis type. Combining MVP ratio and E velocity improved specificity (92%) and positive predictive value (65%) compared with either parameter alone, with minimal decline in negative predictive value (92%). Pressure halftime (OR 0.99, 95% CI 0.98 to 1.00, p=0.04) did not differentiate between clinically normal and clinically abnormal prostheses but was useful in discriminating obstructed from normal and regurgitant prostheses. In conclusion, cut-off values for TTE-derived Doppler parameters of MVP function were specific to prosthesis type and carried high sensitivity and specificity for identifying prosthetic valve dysfunction. MVP ratio was the best predictor of prosthetic dysfunction and, combined with E velocity, provided a useful parameter for determining likelihood of dysfunction and need for further assessment. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.

First results from the Mojave Volatiles Prospector (MVP) Field Campaign, a Lunar Polar Rover Mission Analog

NASA Astrophysics Data System (ADS)

Heldmann, J. L.; Colaprete, A.; Cook, A.; Deans, M. C.; Elphic, R. C.; Lim, D. S. S.; Skok, J. R.

2014-12-01

The Mojave Volatiles Prospector (MVP) project is a science-driven field program with the goal to produce critical knowledge for conducting robotic exploration of the Moon. MVP will feed science, payload, and operational lessons learned to the development of a real-time, short-duration lunar polar volatiles prospecting mission. MVP achieves these goals through a simulated lunar rover mission to investigate the composition and distribution of surface and subsurface volatiles in a natural and a priori unknown environment within the Mojave Desert, improving our understanding of how to find, characterize, and access volatiles on the Moon. The MVP field site is the Mojave Desert, selected for its low, naturally occurring water abundance. The Mojave typically has on the order of 2-6% water, making it a suitable lunar analog for this field test. MVP uses the Near Infrared and Visible Spectrometer Subsystem (NIRVSS), Neutron Spectrometer Subsystem (NSS), and a downward facing GroundCam camera on the KREX-2 rover to investigate the relationship between the distribution of volatiles and soil crust variation. Through this investigation, we mature robotic in situ instruments and concepts of instrument operations, improve ground software tools for real time science, and carry out publishable research on the water cycle and its connection to geomorphology and mineralogy in desert environments. A lunar polar rover mission is unlike prior space missions and requires a new concept of operations. The rover must navigate 3-5 km of terrain and examine multiple sites in in just ~6 days. Operational decisions must be made in real time, requiring constant situational awareness, data analysis and rapid turnaround decision support tools. This presentation will focus on the first science results and operational architecture findings from the MVP field deployment relevant to a lunar polar rover mission.

Effects of enhanced pacing modalities on health care resource utilization and costs in bradycardia patients: An analysis of the randomized MINERVA trial.

PubMed

Boriani, Giuseppe; Manolis, Antonis S; Tukkie, Raymond; Mont, Lluis; Pürerfellner, Helmut; Santini, Massimo; Inama, Giuseppe; Serra, Paolo; Gulizia, Michele; Samoilenko, Igor Vasilyevich; Wolff, Claudia; Holbrook, Reece; Gavazza, Federica; Padeletti, Luigi

2015-06-01

Many patients who suffer from bradycardia and need cardiac pacing also have atrial fibrillation (AF). New pacemaker algorithms, such as atrial preventive pacing and atrial antitachycardia pacing (DDDRP) and managed ventricular pacing (MVP), have been specifically designed to reduce AF occurrence and duration and to minimize the detrimental effects of right ventricular pacing. The randomized MINimizE Right Ventricular pacing to prevent Atrial fibrillation and heart failure trial established that DDDRP + MVP pacing modality reduced permanent AF in bradycardia patients as compared with standard dual-chamber pacing (DDDR). The aim of this study was to estimate the cost savings due to lower AF-related health care utilization events based on health care costs from the United States and the European Union. Dual-chamber pacemaker patients with a history of paroxysmal or persistent AF were randomly assigned to receive DDDR (n = 385) or the advanced features (DDDRP + MVP; n = 383). We used published health care costs from the United States and the European Union (Italy, Spain, and the United Kingdom) to estimate the costs associated with AF-related hospitalizations and emergency visits. The rate of AF-related hospitalizations was significantly lower in the DDDRP + MVP group than in the conventional pacemaker group (DDDR group; 42% reduction; incidence rate ratio 0.58). Similarly, a significant reduction of 68% was observed for AF-related emergency department visits (incidence rate ratio 0.32; P < .001). As a consequence, DDDRP + MVP could potentially reduce health care costs by 40%-44%. Over a ten-year period, the cost savings per 100 patients ranged from $35,702 in the United Kingdom to $121,831 in the United States. New pacing algorithms such as DDDRP + MVP used in the MINimizE Right Ventricular pacing to prevent Atrial fibrillation and heart failure trial successfully reduced AF-related health care utilization, resulting in significant cost savings to payers. Copyright © 2015 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

A Phase III randomized controlled trial comparing the efficacy, safety and tolerability of oral dydrogesterone versus micronized vaginal progesterone for luteal support in in vitro fertilization.

PubMed

Tournaye, Herman; Sukhikh, Gennady T; Kahler, Elke; Griesinger, Georg

2017-05-01

Is oral dydrogesterone 30 mg daily (10 mg three times daily [TID]) non-inferior to micronized vaginal progesterone (MVP) 600 mg daily (200 mg TID) for luteal support in in vitro fertilization (IVF), assessed by the presence of fetal heartbeats determined by transvaginal ultrasound at 12 weeks of gestation? Non-inferiority of oral dydrogesterone versus MVP was demonstrated at 12 weeks of gestation, with a difference in pregnancy rate and an associated confidence interval (CI) that were both within the non-inferiority margin. MVP is routinely used in most clinics for luteal support in IVF, but it is associated with side effects, such as vaginal irritation and discharge, as well as poor patient acceptance. Dydrogesterone may be an alternative treatment due to its patient-friendly oral administration. Lotus I was an international Phase III randomized controlled trial, performed across 38 sites, from August 2013 to March 2016. Subjects were premenopausal women (>18 to <42 years of age; body mass index (BMI) ≥18 to ≤30 kg/m2) with a documented history of infertility who were planning to undergo IVF. A centralized electronic system was used for randomization, and the study investigators, sponsor's study team, and subjects remained blinded throughout the study. In total, 1031 subjects were randomized to receive either oral dydrogesterone (n = 520) or MVP (n = 511). Luteal support was started on the day of oocyte retrieval and continued until 12 weeks of gestation (Week 10), if a positive pregnancy test was obtained at 2 weeks after embryo transfer. In the full analysis set (FAS), 497 and 477 subjects in the oral dydrogesterone and MVP groups, respectively, had an embryo transfer. Non-inferiority of oral dydrogesterone was demonstrated, with pregnancy rates at 12 weeks of gestation of 37.6% and 33.1% in the oral dydrogesterone and MVP treatment groups, respectively (difference 4.7%; 95% CI: -1.2-10.6%). Live birth rates of 34.6% (172 mothers with 213 newborns) and 29.8% (142 mothers with 158 newborns) were obtained in the dydrogesterone and MVP groups, respectively (difference 4.9%; 95% CI: -0.8-10.7%). Oral dydrogesterone was well tolerated and had a similar safety profile to MVP. The analysis of the results was powered to consider the clinical pregnancy rate, but the live birth rate may be of greater clinical interest. Conclusions relating to the differences between treatments in live birth rate, observed in this study, should therefore be made with caution. Oral dydrogesterone may replace MVP as the standard of care for luteal phase support in IVF, owing to the oral route being more patient-friendly than intravaginal administration, as well as it being a well tolerated and efficacious treatment. Sponsored and supported by Abbott Established Pharmaceuticals Division. H.T.'s institution has received grants from Merck, MSD, Goodlife, Cook, Roche, Besins, Ferring and Mithra (now Allergan) and H.T. has received consultancy fees from Finox, Ferring, Abbott, ObsEva and Ovascience. G.S. has nothing to disclose. E.K. is an employee of Abbott GmbH. G.G. has received investigator fees from Abbott during the conduct of the study; outside of this submitted work, G.G. has received personal fees and non-financial support from MSD, Ferring, Merck-Serono, Finox, TEVA, Glycotope, as well as personal fees from VitroLife, NMC Healthcare LLC, ReprodWissen LLC and ZIVA LLC. NCT01850030 (clinicaltrials.gov). 19 April 2013. 23 August 2013. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

Prognostic significance of miR-23b in combination with P-gp, MRP and LRP/MVP expression in non-small cell lung cancer.

PubMed

Janikova, M; Zizkova, V; Skarda, J; Kharaishvili, G; Radova, L; Kolar, Z

2016-01-01

Recently, miR-23b has emerged as a promising new cancer biomarker but its role in lung cancer has not been established yet. Patients still do not respond well to available treatments, probably due to expression of multidrug resistance (MDR) proteins, such as P-gp, MRP and LRP/MVP. The aim of this study was to determine the role of miR-23b in non-small cell lung cancer (NSCLC) and its relationship to the patient outcome together with MDR transporter proteins. We immunohistochemically evaluated expression of P-gp, MRP and LRP/MVP and quantified the relative levels of miR-23b in 62 NSCLC patients´ samples. The prognostic significance of miR-23b and MDR proteins was tested by Kaplan-Meier and Cox-regression analysis. Our results showed that miR-23b is mostly downregulated in NSCLC samples (57/62) and that its upregulation in tumors is connected with longer progression-free survival (PFS; P = 0.065) and overall survival (OS; P = 0.048). The Cox proportional hazard model revealed that the risk of death or relapse in NSCLC patients with miR-23b downregulation increases together with LRP/MVP expression and both risks decrease with miR-23b upregulation (HRPFS = 4.342, PPFS = 0.022; HROS = 4.408, POS = 0.015). Our findings indicate that miR-23b, especially in combination with LRP/MVP expression, might serve as a suitable prognostic biomarker for NSCLC patients.

Classification of microvascular patterns via cluster analysis reveals their prognostic significance in glioblastoma.

PubMed

Chen, Long; Lin, Zhi-Xiong; Lin, Guo-Shi; Zhou, Chang-Fu; Chen, Yu-Peng; Wang, Xing-Fu; Zheng, Zong-Qing

2015-01-01

There are limited researches focusing on microvascular patterns (MVPs) in human glioblastoma and their prognostic impact. We evaluated MVPs of 78 glioblastomas by CD34/periodic acid-Schiff dual staining and by cluster analysis of the percentage of microvascular area for distinct microvascular formations. The distribution of 5 types of basic microvascular formations, that is, microvascular sprouting (MS), vascular cluster (VC), vascular garland (VG), glomeruloid vascular proliferation (GVP), and vasculogenic mimicry (VM), was variable. Accordingly, cluster analysis classified MVPs into 2 types: type I MVP displayed prominent MSs and VCs, whereas type II MVP had numerous VGs, GVPs, and VMs. By analyzing the proportion of microvascular area for each type of formation, we determined that glioblastomas with few MSs and VCs had many GVPs and VMs, and vice versa. VG seemed to be a transitional type of formation. In case of type I MVP, expression of Ki-67 and p53 but not MGMT was significantly higher as compared with those of type II MVP (P < .05). Survival analysis showed that the type of MVPs presented as an independent prognostic factor of progression-free survival (PFS) and overall survival (OS) (both P < .001). Type II MVP had a more negative influence on PFS and OS than did type I MVP. We conclude that the heterogeneous MVPs in glioblastoma can be categorized properly by certain histopathologic and statistical analyses and may influence clinical outcome. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

An association between migraines and heart anomalies-true or false? A heart ultrasound study using cTTE in migraine patients and control participants.

PubMed

Domitrz, Izabela; Styczynski, Grzegorz; Wilczko, Justyna; Marczewska, Malgorzata M; Domitrz, Wojciech; Kaminska, Anna

2014-12-01

A migraine is a common neurological disorder that often coexists with other illnesses including heart abnormalities, such as patent foramen ovale (PFO), atrial septal aneurysm (ASA), and mitral valve prolapse (MVP). The aim of our study was to evaluate the occurrence of some heart abnormalities in migraine patients by routine and contrast transthoracic echocardiography. We assessed the occurrence of PFO, ASA, and MVP in 96 patients with migraine without aura (87 females), in 62 patients with migraine with aura (41 females) and in 53 healthy persons (40 females). In comparison with our control group, only the prevalence of PFO was statistically higher in patients with migraine (P = 0.03) and especially with aura (P = 0.01). We did not find any statistically significant differences between the occurrence of ASA or MVP in migraine and control groups. The results of our study raise the question of the heart's role in the mechanism of migraine attacks. If the occurrence of migraine with aura had been related to some heart abnormalities, the pathophysiology of migraine attacks may have some connection to some heart dysfunction. Resolving the association between migraine and comorbid cardiac conditions might shed light on the underlying mechanisms of migraines and even result in a different treatment strategy. However, we do not find any clear connection between PFP, ASA, and MVP, and migraine occurrence. Wiley Periodicals, Inc.

Programmable architecture for pixel level processing tasks in lightweight strapdown IR seekers

NASA Astrophysics Data System (ADS)

Coates, James L.

1993-06-01

Typical processing tasks associated with missile IR seeker applications are described, and a straw man suite of algorithms is presented. A fully programmable multiprocessor architecture is realized on a multimedia video processor (MVP) developed by Texas Instruments. The MVP combines the elements of RISC, floating point, advanced DSPs, graphics processors, display and acquisition control, RAM, and external memory. Front end pixel level tasks typical of missile interceptor applications, operating on 256 x 256 sensor imagery, can be processed at frame rates exceeding 100 Hz in a single MVP chip.

A GaAs vector processor based on parallel RISC microprocessors

NASA Astrophysics Data System (ADS)

Misko, Tim A.; Rasset, Terry L.

A vector processor architecture based on the development of a 32-bit microprocessor using gallium arsenide (GaAs) technology has been developed. The McDonnell Douglas vector processor (MVP) will be fabricated completely from GaAs digital integrated circuits. The MVP architecture includes a vector memory of 1 megabyte, a parallel bus architecture with eight processing elements connected in parallel, and a control processor. The processing elements consist of a reduced instruction set CPU (RISC) with four floating-point coprocessor units and necessary memory interface functions. This architecture has been simulated for several benchmark programs including complex fast Fourier transform (FFT), complex inner product, trigonometric functions, and sort-merge routine. The results of this study indicate that the MVP can process a 1024-point complex FFT at a speed of 112 microsec (389 megaflops) while consuming approximately 618 W of power in a volume of approximately 0.1 ft-cubed.

MVP-CA Methodology for the Expert System Advocate's Advisor (ESAA)

DOT National Transportation Integrated Search

1997-11-01

The Multi-Viewpoint Clustering Analysis (MVP-CA) tool is a semi-automated tool to provide a valuable aid for comprehension, verification, validation, maintenance, integration, and evolution of complex knowledge-based software systems. In this report,...

Theoretical and numerical difficulties in 3-D vector potential methods in finite element magnetostatic computations

NASA Technical Reports Server (NTRS)

Demerdash, N. A.; Wang, R.

1990-01-01

This paper describes the results of application of three well known 3D magnetic vector potential (MVP) based finite element formulations for computation of magnetostatic fields in electrical devices. The three methods were identically applied to three practical examples, the first of which contains only one medium (free space), while the second and third examples contained a mix of free space and iron. The first of these methods is based on the unconstrained curl-curl of the MVP, while the second and third methods are predicated upon constraining the divergence of the MVP 10 zero (Coulomb's Gauge). It was found that the two latter methods cease to give useful and meaningful results when the global solution region contains a mix of media of high and low permeabilities. Furthermore, it was found that their results do not achieve the intended zero constraint on the divergence of the MVP.

Mitral valve disease in patients with Marfan syndrome undergoing aortic root replacement.

PubMed

Kunkala, Meghana R; Schaff, Hartzell V; Li, Zhuo; Volguina, Irina; Dietz, Harry C; LeMaire, Scott A; Coselli, Joseph S; Connolly, Heidi

2013-09-10

Cardiac manifestations of Marfan syndrome include aortic root dilation and mitral valve prolapse (MVP). Only scant data exist describing MVP in patients with Marfan syndrome undergoing aortic root replacement. We retrospectively analyzed data from 166 MFS patients with MVP who were enrolled in a prospective multicenter registry of patients who underwent aortic root aneurysm repair. Of these 166 patients, 9% had mitral regurgitation (MR) grade >2, and 10% had MR grade 2. The severity of MVP and MR was evaluated by echocardiography preoperatively and ≤ 3 years postoperatively. Forty-one patients (25%) underwent composite graft aortic valve replacement, and 125 patients (75%) underwent aortic valve-sparing procedures; both groups had similar prevalences of MR grade >2 (P=0.7). Thirty-three patients (20%) underwent concomitant mitral valve (MV) intervention (repair, n=29; replacement, n=4), including all 15 patients with MR grade >2. Only 1 patient required MV reintervention during follow-up (mean clinical follow-up, 31 ± 10 months). Echocardiography performed 21 ± 13 months postoperatively revealed MR >2 in only 3 patients (2%). One early death and 2 late deaths occurred. Although the majority of patients with Marfan syndrome who undergo elective aortic root replacement have MVP, only 20% have concomitant MV procedures. These concomitant procedures do not seem to increase operative risk. In patients with MR grade ≤ 2 who do not undergo a concomitant MV procedure, the short-term incidence of progressive MR is low; however, more follow-up is needed to determine whether patients with MVP and MR grade ≤ 2 would benefit from prophylactic MV intervention.

Population viability analysis for endangered Roanoke logperch

USGS Publications Warehouse

Roberts, James H.; Angermeier, Paul; Anderson, Gregory B.

2016-01-01

A common strategy for recovering endangered species is ensuring that populations exceed the minimum viable population size (MVP), a demographic benchmark that theoretically ensures low long-term extinction risk. One method of establishing MVP is population viability analysis, a modeling technique that simulates population trajectories and forecasts extinction risk based on a series of biological, environmental, and management assumptions. Such models also help identify key uncertainties that have a large influence on extinction risk. We used stochastic count-based simulation models to explore extinction risk, MVP, and the possible benefits of alternative management strategies in populations of Roanoke logperch Percina rex, an endangered stream fish. Estimates of extinction risk were sensitive to the assumed population growth rate and model type, carrying capacity, and catastrophe regime (frequency and severity of anthropogenic fish kills), whereas demographic augmentation did little to reduce extinction risk. Under density-dependent growth, the estimated MVP for Roanoke logperch ranged from 200 to 4200 individuals, depending on the assumed severity of catastrophes. Thus, depending on the MVP threshold, anywhere from two to all five of the logperch populations we assessed were projected to be viable. Despite this uncertainty, these results help identify populations with the greatest relative extinction risk, as well as management strategies that might reduce this risk the most, such as increasing carrying capacity and reducing fish kills. Better estimates of population growth parameters and catastrophe regimes would facilitate the refinement of MVP and extinction-risk estimates, and they should be a high priority for future research on Roanoke logperch and other imperiled stream-fish species.

Bubble accumulation and its role in the evolution of magma reservoirs in the upper crust.

PubMed

Parmigiani, A; Faroughi, S; Huber, C; Bachmann, O; Su, Y

2016-04-28

Volcanic eruptions transfer huge amounts of gas to the atmosphere. In particular, the sulfur released during large silicic explosive eruptions can induce global cooling. A fundamental goal in volcanology, therefore, is to assess the potential for eruption of the large volumes of crystal-poor, silicic magma that are stored at shallow depths in the crust, and to obtain theoretical bounds for the amount of volatiles that can be released during these eruptions. It is puzzling that highly evolved, crystal-poor silicic magmas are more likely to generate volcanic rocks than plutonic rocks. This observation suggests that such magmas are more prone to erupting than are their crystal-rich counterparts. Moreover, well studied examples of largely crystal-poor eruptions (for example, Katmai, Taupo and Minoan) often exhibit a release of sulfur that is 10 to 20 times higher than the amount of sulfur estimated to be stored in the melt. Here we argue that these two observations rest on how the magmatic volatile phase (MVP) behaves as it rises buoyantly in zoned magma reservoirs. By investigating the fluid dynamics that controls the transport of the MVP in crystal-rich and crystal-poor magmas, we show how the interplay between capillary stresses and the viscosity contrast between the MVP and the host melt results in a counterintuitive dynamics, whereby the MVP tends to migrate efficiently in crystal-rich parts of a magma reservoir and accumulate in crystal-poor regions. The accumulation of low-density bubbles of MVP in crystal-poor magmas has implications for the eruptive potential of such magmas, and is the likely source of the excess sulfur released during explosive eruptions.

Sites of Successful Ventricular Fibrillation Ablation in Bileaflet Mitral Valve Prolapse Syndrome.

PubMed

Syed, Faisal F; Ackerman, Michael J; McLeod, Christopher J; Kapa, Suraj; Mulpuru, Siva K; Sriram, Chenni S; Cannon, Bryan C; Asirvatham, Samuel J; Noseworthy, Peter A

2016-05-01

Although the vast majority of mitral valve prolapse (MVP) is benign, a small subset of patients, predominantly women, with bileaflet prolapse, complex ventricular ectopy (VE), and abnormal T waves comprise the recently described bileaflet MVP syndrome. We compared findings on electrophysiological study in bileaflet MVP syndrome patients with and without cardiac arrest to identify factors that may predispose to malignant ventricular arrhythmia. Fourteen consecutive bileaflet MVP syndrome patients (n=13 women; median [limits], age at index ablation, 33.8 [21.0-58.7] years; ejection fraction, 60% [45%-67%]; all ≤ moderate mitral regurgitation; n=6 with previous cardiac arrest and implantable cardioverter defibrillator shocks for ventricular fibrillation; and n=8 without implantable cardioverter defibrillator although with symptomatic complex VE) were included. The 2 groups had similar baseline echocardiographic and electrocardiographic characteristics. All patients had at least 1 left ventricular papillary or fascicular VE focus. Purkinje origin VE was identified as the ventricular fibrillation trigger in 6 of 6 cardiac arrest patients (4 from papillary muscle) and Purkinje origin of dominant VE was seen in 5 of 8 (3 from papillary muscle) nonarrest patients. Acute success was seen in 17 of 19 procedures, and a ventricular fibrillation storm occurred within 24 hours of ablation in a single patient. Repeat ablation for recurrent symptomatic arrhythmia was performed in 6 patients. At 478 (39-2099) days of follow-up, 2 cardiac arrest patients received appropriate shocks. Symptoms from VE were reduced in 12 of 14. Bileaflet MVP syndrome is characterized by fascicular and papillary muscle VE that triggers ventricular fibrillation. Ablation of clinically dominant VE foci improves symptoms and reduces appropriate implantable cardioverter defibrillator shocks. © 2016 American Heart Association, Inc.

Atrial function as a guide to timing of intervention in mitral valve prolapse with mitral regurgitation.

PubMed

Ring, Liam; Rana, Bushra S; Wells, Francis C; Kydd, Anna C; Dutka, David P

2014-03-01

The purpose of this study was to determine the clinical utility of left atrial (LA) functional indexes in patients with mitral valve prolapse (MVP) and mitral regurgitation (MR). Timing of surgery for MVP remains challenging. We hypothesized that assessment of LA function may provide diagnostic utility in these patients. We studied 192 consecutive patients in sinus rhythm with MVP, classified into 3 groups: moderate or less MR (MOD group, n = 54); severe MR without surgical indication (SEV group, n = 52); and severe MR with ≥1 surgical indication (SURG group, n = 86). Comparison was made with 50 control patients. Using 2D speckle imaging, average peak contractile, conduit, and reservoir atrial strain was recorded. Using Simpson's method we recorded maximal left atrial volume (LAVmax) and minimal left atrial volume (LAVmin), from which the total left atrial emptying fraction (TLAEF) was derived: (LAVmax-LAVmin)/LAVmax × 100%. TLAEF was similar in the MOD and control groups (61% vs. 57%; p = NS), was reduced in the SEV group (55%; p < 0.001 vs. control group), and markedly lower in the SURG group (40%; p < 0.001 vs. other groups). Reservoir strain demonstrated a similar pattern. Contractile strain was similarly reduced in the MOD and SEV groups (MOD 15%; SEV 14%; p = NS; both p < 0.05 vs. control group 20%) and further reduced in the SURG group (8%; p < 0.001 vs. other groups). By multivariate analysis, TLAEF (odds ratio [OR]: 0.78; p < 0.001), reservoir strain (OR: 0.91; p = 0.028), and contractile strain (OR: 0.86; p = 0.021) were independent predictors of severe MR requiring surgery. Using receiver-operating characteristic analysis, TLAEF <50% demonstrated 91% sensitivity and 92% specificity for predicting MVP with surgical indication (area under the curve: 0.96; p < 0.001). We report the changes in left atrial function in humans with MVP and the relationship of LA dysfunction to clinical indications for mitral valve surgery. We propose that the findings support the utility of quantitative assessment of atrial function by echocardiography as an additional tool to guide the optimum timing of surgery for MVP. Copyright © 2014 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Infective Endocarditis in Patients With Bicuspid Aortic Valve or Mitral Valve Prolapse.

PubMed

Zegri-Reiriz, Isabel; de Alarcón, Arístides; Muñoz, Patricia; Martínez Sellés, Manuel; González-Ramallo, Victor; Miro, Jose M; Falces, Carles; Gonzalez Rico, Claudia; Kortajarena Urkola, Xabier; Lepe, José Antonio; Rodriguez Alvarez, Regino; Reguera Iglesias, Jose Maria; Navas, Enrique; Dominguez, Fernando; Garcia-Pavia, Pablo

2018-06-19

There is little information concerning infective endocarditis (IE) in patients with bicuspid aortic valve (BAV) or mitral valve prolapse (MVP). Currently, IE antibiotic prophylaxis (IEAP) is not recommended for these conditions. This study sought to describe the clinical and microbiological features of IE in patients with BAV and MVP and compare them with those of IE patients with and without IEAP indication, to determine the potential benefit of IEAP in these conditions. This analysis involved 3,208 consecutive IE patients prospectively included in the GAMES (Grupo de Apoyo al Manejo de la Endocarditis infecciosa en España) registry at 31 Spanish hospitals. Patients were classified as high-risk IE with IEAP indication (high-risk group; n = 1,226), low- and moderate-risk IE without IEAP indication (low/moderate-risk group; n = 1,839), and IE with BAV (n = 54) or MVP (n = 89). BAV and MVP patients had a higher incidence of viridans group streptococci IE than did high-risk group and low/moderate-risk group patients (35.2% and 39.3% vs. 12.1% and 15.0%, respectively; all p < 0.01). A similar pattern was seen for IE from suspected odontologic origin (14.8% and 18.0% vs. 5.8% and 6.0%; all p < 0.01). BAV and MVP patients had more intracardiac complications than did low/moderate-risk group (50% and 47.2% vs. 30.6%, both p < 0.01) patients and were similar to high-risk group patients. IE in patients with BAV and MVP have higher rates of viridans group streptococci IE and IE from suspected odontologic origin than in other IE patients, with a clinical profile similar to that of high-risk IE patients. Our findings suggest that BAV and MVP should be classified as high-risk IE conditions and the case for IEAP should be reconsidered. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Feasibility and performance of novel software to quantify metabolically active volumes and 3D partial volume corrected SUV and metabolic volumetric products of spinal bone marrow metastases on 18F-FDG-PET/CT.

PubMed

Torigian, Drew A; Lopez, Rosa Fernandez; Alapati, Sridevi; Bodapati, Geetha; Hofheinz, Frank; van den Hoff, Joerg; Saboury, Babak; Alavi, Abass

2011-01-01

Our aim was to assess feasibility and performance of novel semi-automated image analysis software called ROVER to quantify metabolically active volume (MAV), maximum standardized uptake value-maximum (SUV(max)), 3D partial volume corrected mean SUV (cSUV(mean)), and 3D partial volume corrected mean MVP (cMVP(mean)) of spinal bone marrow metastases on fluorine-18 fluorodeoxyglucose-positron emission tomography/computerized tomography ((18)F-FDG-PET/CT). We retrospectively studied 16 subjects with 31 spinal metastases on FDG-PET/CT and MRI. Manual and ROVER determinations of lesional MAV and SUV(max), and repeated ROVER measurements of MAV, SUV(max), cSUV(mean) and cMVP(mean) were made. Bland-Altman and correlation analyses were performed to assess reproducibility and agreement. Our results showed that analyses of repeated ROVER measurements revealed MAV mean difference (D)=-0.03±0.53cc (95% CI(-0.22, 0.16)), lower limit of agreement (LLOA)=-1.07cc, and upper limit of agreement (ULOA)=1.01cc; SUV(max) D=0.00±0.00 with LOAs=0.00; cSUV(mean) D=-0.01±0.39 (95% CI(-0.15, 0.13)), LLOA=-0.76, and ULOA=0.75; cMVP(mean) D=-0.52±4.78cc (95% CI(-2.23, 1.23)), LLOA=-9.89cc, and ULOA=8.86cc. Comparisons between ROVER and manual measurements revealed volume D= -0.39±1.37cc (95% CI (-0.89, 0.11)), LLOA=-3.08cc, and ULOA=2.30cc; SUV(max) D=0.00±0.00 with LOAs=0.00. Mean percent increase in lesional SUV(mean) and MVP(mean) following partial volume correction using ROVER was 84.25±36.00% and 84.45±35.94% , respectively. In conclusion, it is feasible to estimate MAV, SUV(max), cSUV(mean), and cMVP(mean) of spinal bone marrow metastases from (18)F-FDG-PET/CT quickly and easily with good reproducibility via ROVER software. Partial volume correction is imperative, as uncorrected SUV(mean) and MVP(mean) are significantly underestimated, even for large lesions. This novel approach has great potential for practical, accurate, and precise combined structural-functional PET quantification of disease before and after therapeutic intervention.

From Keller's MVP Model to Faculty Development Practice

ERIC Educational Resources Information Center

Svinicki, Marilla D.

2017-01-01

As faculty and faculty developers, we sometimes forget that the principles of learning and motivation that we apply to students also apply to us. This chapter illustrates how the MVP model can be used to create effective faculty development activities.

The MVP Model as an Organizing Framework for Neuroscience Findings Related to Learning

ERIC Educational Resources Information Center

Zakrajsek, Todd M.

2017-01-01

This chapter describes the ways in which the MVP model relates to recent research on neuroscience and learning, and demonstrates how those relationships may be used to better understand physiological impacts on motivation, and to facilitate improved learning.

Plasma membrane association facilitates conformational changes in the Marburg virus protein VP40 dimer.

PubMed

Bhattarai, Nisha; Gc, Jeevan B; Gerstman, Bernard S; Stahelin, Robert V; Chapagain, Prem P

2017-04-26

Filovirus infections cause hemorrhagic fever in humans and non-human primates that often results in high fatality rates. The Marburg virus is a lipid-enveloped virus from the Filoviridae family and is closely related to the Ebola virus. The viral matrix layer underneath the lipid envelope is formed by the matrix protein VP40 (VP40), which is also involved in other functions during the viral life-cycle. As in the Ebola virus VP40 (eVP40), the recently determined X-ray crystal structure of the Marburg virus VP40 (mVP40) features loops containing cationic residues that form a lipid binding basic patch. However, the mVP40 basic patch is significantly flatter with a more extended surface than in eVP40, suggesting the possibility of differences in the plasma membrane interactions and phospholipid specificity between the VP40 dimers. In this paper, we report on molecular dynamics simulations that investigate the roles of various residues and lipid types in PM association as well as the conformational changes of the mVP40 dimer facilitated by membrane association. We compared the structural changes of the mVP40 dimer with the mVP40 dimer in both lipid free and membrane associated conditions. Despite the significant structural differences in the crystal structure, the Marburg VP40 dimer is found to adopt a configuration very similar to the Ebola VP40 dimer after associating with the membrane. This conformational rearrangement upon lipid binding allows Marburg VP40 to localize and stabilize at the membrane surface in a manner similar to the Ebola VP40 dimer. Consideration of the structural information in its lipid-interacting condition may be important in targeting mVP40 for novel drugs to inhibit viral budding from the plasma membrane.

Towards an Intelligent Planning Knowledge Base Development Environment

NASA Technical Reports Server (NTRS)

Chien, S.

1994-01-01

ract describes work in developing knowledge base editing and debugging tools for the Multimission VICAR Planner (MVP) system. MVP uses artificial intelligence planning techniques to automatically construct executable complex image processing procedures (using models of the smaller constituent image processing requests made to the JPL Multimission Image Processing Laboratory.

A new irradiation method with a neutron filter for silicon neutron transmutation doping at the Japan research reactor no. 3 (JRR-3).

PubMed

Komeda, Masao; Kawasaki, Kozo; Obara, Toru

2013-04-01

We studied a new silicon irradiation holder with a neutron filter designed to make the vertical neutron flux profile uniform. Since an irradiation holder has to be made of a low activation material, we applied aluminum blended with B4C as the holder material. Irradiation methods to achieve uniform flux with a filter are discussed using Monte-Carlo calculation code MVP. Validation of the use of the MVP code for the holder's analyses is also discussed via characteristic experiments. Copyright © 2013 Elsevier Ltd. All rights reserved.

Assessing Motivation to Improve Learning: Practical Applications of Keller's MVP Model and ARCS-V Design Process

ERIC Educational Resources Information Center

Angelo, Thomas A.

2017-01-01

This chapter applies John Keller's MVP model and, specifically, adapts the ARCS-V components of that model--defined and described in Chapter 1 of this issue of "New Directions for Teaching and Learning"--as a frame for exploring practical, research-based assessment, and feedback strategies and tools teachers can use to help students…

Analytical model of tilted driver–pickup coils for eddy current nondestructive evaluation

NASA Astrophysics Data System (ADS)

Cao, Bing-Hua; Li, Chao; Fan, Meng-Bao; Ye, Bo; Tian, Gui-Yun

2018-03-01

A driver-pickup probe possesses better sensitivity and flexibility due to individual optimization of a coil. It is frequently observed in an eddy current (EC) array probe. In this work, a tilted non-coaxial driver-pickup probe above a multilayered conducting plate is analytically modeled with spatial transformation for eddy current nondestructive evaluation. Basically, the core of the formulation is to obtain the projection of magnetic vector potential (MVP) from the driver coil onto the vector along the tilted pickup coil, which is divided into two key steps. The first step is to make a projection of MVP along the pickup coil onto a horizontal plane, and the second one is to build the relationship between the projected MVP and the MVP along the driver coil. Afterwards, an analytical model for the case of a layered plate is established with the reflection and transmission theory of electromagnetic fields. The calculated values from the resulting model indicate good agreement with those from the finite element model (FEM) and experiments, which validates the developed analytical model. Project supported by the National Natural Science Foundation of China (Grant Nos. 61701500, 51677187, and 51465024).

Automated synthesis of image processing procedures using AI planning techniques

NASA Technical Reports Server (NTRS)

Chien, Steve; Mortensen, Helen

1994-01-01

This paper describes the Multimission VICAR (Video Image Communication and Retrieval) Planner (MVP) (Chien 1994) system, which uses artificial intelligence planning techniques (Iwasaki & Friedland, 1985, Pemberthy & Weld, 1992, Stefik, 1981) to automatically construct executable complex image processing procedures (using models of the smaller constituent image processing subprograms) in response to image processing requests made to the JPL Multimission Image Processing Laboratory (MIPL). The MVP system allows the user to specify the image processing requirements in terms of the various types of correction required. Given this information, MVP derives unspecified required processing steps and determines appropriate image processing programs and parameters to achieve the specified image processing goals. This information is output as an executable image processing program which can then be executed to fill the processing request.

Impact of a multidisciplinary vulvodynia program on sexual functioning and dyspareunia.

PubMed

Brotto, Lori A; Yong, Paul; Smith, Kelly B; Sadownik, Leslie A

2015-01-01

For many years, multidisciplinary approaches, which integrate psychological, physical, and medical treatments, have been shown to be effective for the treatment of chronic pain. To date, there has been anecdotal support, but little empirical data, to justify the application of this multidisciplinary approach toward the treatment of chronic sexual pain secondary to provoked vestibulodynia (PVD). This study aimed to evaluate a 10-week hospital-based treatment (multidisciplinary vulvodynia program [MVP]) integrating psychological skills training, pelvic floor physiotherapy, and medical management on the primary outcomes of dyspareunia and sexual functioning, including distress. A total of 132 women with a diagnosis of PVD provided baseline data and agreed to participate in the MVP. Of this group, n = 116 (mean age 28.4 years, standard deviation 7.1) provided complete data at the post-MVP assessment, and 84 women had complete data through to the 3- to 4-month follow-up period. There were high levels of avoidance of intimacy (38.1%) and activities that elicited sexual arousal (40.7%), with many women (50.4%) choosing to focus on their partner's sexual arousal and satisfaction at baseline. With treatment, over half the sample (53.8%) reported significant improvements in dyspareunia. Following the MVP, there were strong significant effects for the reduction in dyspareunia (P = 0.001) and sex-related distress (P < 0.001), and improvements in sexual arousal (P < 0.001) and overall sexual functioning (P = 0.001). More modest but still statistically significant were improvements in sexual desire, lubrication, orgasmic function, and sexual satisfaction. All improvements were retained at 2- to 3-month follow-up. This study provides strong support for the efficacy of a multidisciplinary approach (psychological, pelvic floor physiotherapy, and medical management) for improving dyspareunia and all domains of sexual functioning among women with PVD. The study also highlights the benefits of incorporating sexual health education into general pain management strategies for this population. © 2014 International Society for Sexual Medicine.

Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes.

PubMed

Statello, Luisa; Maugeri, Marco; Garre, Elena; Nawaz, Muhammad; Wahlgren, Jessica; Papadimitriou, Alexandros; Lundqvist, Christina; Lindfors, Lennart; Collén, Anna; Sunnerhagen, Per; Ragusa, Marco; Purrello, Michele; Di Pietro, Cinzia; Tigue, Natalie; Valadi, Hadi

2018-01-01

The RNA that is packaged into exosomes is termed as exosomal-shuttle RNA (esRNA); however, the players, which take this subset of RNA (esRNA) into exosomes, remain largely unknown. We hypothesized that RNA binding proteins (RBPs) could serve as key players in this mechanism, by making complexes with RNAs and transporting them into exosomes during the biosynthesis of exosomes. Here, we demonstrate the presence of 30 RBPs in exosomes that were shown to form RNA-RBP complexes with both cellular RNA and exosomal-RNA species. To assess the involvement of these RBPs in RNA-transfer into exosomes, the gene transcripts encoding six of the proteins identified in exosomes (HSP90AB1, XPO5, hnRNPH1, hnRNPM, hnRNPA2B1, and MVP) were silenced by siRNA and subsequent effect on esRNA was assessed. A significant reduction of total esRNA was observed by post-transcriptional silencing of MVP, compared to other RBPs. Furthermore, to confirm the binding of MVP with esRNA, a biotinylated-MVP was transiently expressed in HEK293F cells. Higher levels of esRNA were recovered from MVP that was eluted from exosomes of transfected cells, as compared to those of non-transfected cells. Our data indicate that these RBPs could end up in exosomes together with RNA molecules in the form of RNA-ribonucleoprotein complexes, which could be important for the transport of RNAs into exosomes and the maintenance of RNAs inside exosomes. This type of maintenance may favor the shuttling of RNAs from exosomes to recipient cells in the form of stable complexes.

Simulations of Liners and Test Objects for a New Atlas Advanced Radiography Source

DOE Office of Scientific and Technical Information (OSTI.GOV)

D. V. Morgan; S. Iversen; R. A. Hilko

2002-06-01

The Advanced Radiographic Source (ARS) will improve the data significantly due to its smaller source width. Because of the enhanced ARS output, larger source-to-object distances are a reality. The harder ARS source will allow radiography of thick high-Z targets. The five different spectral simulations resulted in similar imaging detector weighted transmission. This work used a limited set of test objects and imaging detectors. Other test objects and imaging detectors could possibly change the MVp-sensitivity result. The effect of material motion blur must be considered for the ARS due to the expected smaller X-ray source size. This study supports the originalmore » 1.5-MVp value.« less

The importance of using open source technologies and common standards for interoperability within eHealth: Perspectives from the Millennium Villages Project

PubMed Central

Borland, Rob; Barasa, Mourice; Iiams-Hauser, Casey; Velez, Olivia; Kaonga, Nadi Nina; Berg, Matt

2013-01-01

The purpose of this paper is to illustrate the importance of using open source technologies and common standards for interoperability when implementing eHealth systems and illustrate this through case studies, where possible. The sources used to inform this paper draw from the implementation and evaluation of the eHealth Program in the context of the Millennium Villages Project (MVP). As the eHealth Team was tasked to deploy an eHealth architecture, the Millennium Villages Global-Network (MVG-Net), across all fourteen of the MVP sites in Sub-Saharan Africa, the team recognized the need for standards and uniformity but also realized that context would be an important factor. Therefore, the team decided to utilize open source solutions. The MVP implementation of MVG-Net provides a model for those looking to implement informatics solutions across disciplines and countries. Furthermore, there are valuable lessons learned that the eHealth community can benefit from. By sharing lessons learned and developing an accessible, open-source eHealth platform, we believe that we can more efficiently and rapidly achieve the health-related and collaborative Millennium Development Goals (MDGs). PMID:22894051

Reexamining the minimum viable population concept for long-lived species.

PubMed

Shoemaker, Kevin T; Breisch, Alvin R; Jaycox, Jesse W; Gibbs, James P

2013-06-01

For decades conservation biologists have proposed general rules of thumb for minimum viable population size (MVP); typically, they range from hundreds to thousands of individuals. These rules have shifted conservation resources away from small and fragmented populations. We examined whether iteroparous, long-lived species might constitute an exception to general MVP guidelines. On the basis of results from a 10-year capture-recapture study in eastern New York (U.S.A.), we developed a comprehensive demographic model for the globally threatened bog turtle (Glyptemys muhlenbergii), which is designated as endangered by the IUCN in 2011. We assessed population viability across a wide range of initial abundances and carrying capacities. Not accounting for inbreeding, our results suggest that bog turtle colonies with as few as 15 breeding females have >90% probability of persisting for >100 years, provided vital rates and environmental variance remain at currently estimated levels. On the basis of our results, we suggest that MVP thresholds may be 1-2 orders of magnitude too high for many long-lived organisms. Consequently, protection of small and fragmented populations may constitute a viable conservation option for such species, especially in a regional or metapopulation context. © 2013 Society for Conservation Biology.

Mean-velocity profile of smooth channel flow explained by a cospectral budget model with wall-blockage

DOE PAGES

McColl, Kaighin A.; Katul, Gabriel G.; Gentine, Pierre; ...

2016-03-16

A series of recent studies has shown that a model of the turbulent vertical velocity variance spectrum (F vv) combined with a simplified cospectral budget can reproduce many macroscopic flow properties of turbulent wall-bounded flows, including various features of the mean-velocity profile (MVP), i.e., the "law of the wall". While the approach reasonably models the MVP's logarithmic layer, the buffer layer displays insufficient curvature compared to measurements. The assumptions are re-examined here using a direct numerical simulation (DNS) dataset at moderate Reynolds number that includes all the requisite spectral and co-spectral information. Starting with several hypotheses for the cause ofmore » the "missing" curvature in the buffer layer, it is shown that the curvature deficit is mainly due to mismatches between (i) the modelled and DNS-observed pressure-strain terms in the cospectral budget and (ii) the DNS-observed F vv and the idealized form used in previous models. By replacing the current parameterization for the pressure-strain term with an expansive version that directly accounts for wall-blocking effects, the modelled and DNS reported pressure-strain profiles match each other in the buffer and logarithmic layers. Forcing the new model with DNS-reported F vv rather than the idealized form previously used reproduces the missing buffer layer curvature to high fidelity thereby confirming the "spectral link" between F vv and the MVP across the full profile. A broad implication of this work is that much of the macroscopic properties of the flow (such as the MVP) may be derived from the energy distribution in turbulent eddies (i.e., F vv) representing the microstate of the flow, provided the link between them accounts for wall-blocking.« less

Diagnostic value of color flow mapping and Doppler echocardiography in the quantification of mitral regurgitation in patients with mitral valve prolapse or rheumatic heart disease.

PubMed

Pinheiro, Aurélio Carvalho; Mancuso, Frederico José Neves; Hemerly, Daniela Fernanda Alli; Kiyose, Alberto Takeshi; Campos, Orlando; de Andrade, José Lázaro; de Paola, Angelo Amato Vicenzo; de Camargo Carvalho, Antonio Carlos; Moises, Valdir Ambrosio

2007-10-01

The objective was to analyze the diagnostic value of the echocardiographic methods used for quantification of mitral regurgitation (MR) in patients with mitral valve prolapse (MVP) or rheumatic heart disease (RHD). The study included 50 patients with MR (mean age of 46.1 years; 35 women), 27 (54%) with RHD and 23 (46%) with MVP. Quantification of the mitral valve regurgitation was obtained by regurgitant orifice area (ROA) and regurgitant volume (RV) by the flow convergence region (FCR) and two-dimensional Doppler echocardiographic methods, regurgitant fraction, jet area (JA), jet area/left atrial area ratio (JA/LAA), and vena contracta (VC). Patients were clinically followed to identify cardiovascular events. Data were analyzed by Pearson, kappa, and receiver operator characteristic curve tests; significance was defined as a P value less than .05. The correlation between the two methods for ROA and RV were r = 0.79 and r = 0.80, respectively, and between these parameters and regurgitant fraction, VC, JA, and JA/LAA varied from r = 0.54 to r = 0.94 (P lt; .05); the agreement varied from kappa = 0.19 to kappa = 0.83. The highest accuracy to identify patients with clinically significant MR (events at follow-up) was 96% for ROA by FCR, 94% for VC, 86% for RV by FCR, and 86% for JA. No method showed a significant difference between MVP and RHD. The methods analyzed had significant correlation and good agreement. ROA by FCR and VC had the best performance to identify severe MR; no significant difference between MVP and RHD was observed.

Combined magnetic vector-scalar potential finite element computation of 3D magnetic field and performance of modified Lundell alternators in Space Station applications. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Wang, Ren H.

1991-01-01

A method of combined use of magnetic vector potential (MVP) based finite element (FE) formulations and magnetic scalar potential (MSP) based FE formulations for computation of three-dimensional (3D) magnetostatic fields is developed. This combined MVP-MSP 3D-FE method leads to considerable reduction by nearly a factor of 3 in the number of unknowns in comparison to the number of unknowns which must be computed in global MVP based FE solutions. This method allows one to incorporate portions of iron cores sandwiched in between coils (conductors) in current-carrying regions. Thus, it greatly simplifies the geometries of current carrying regions (in comparison with the exclusive MSP based methods) in electric machinery applications. A unique feature of this approach is that the global MSP solution is single valued in nature, that is, no branch cut is needed. This is again a superiority over the exclusive MSP based methods. A Newton-Raphson procedure with a concept of an adaptive relaxation factor was developed and successfully used in solving the 3D-FE problem with magnetic material anisotropy and nonlinearity. Accordingly, this combined MVP-MSP 3D-FE method is most suited for solution of large scale global type magnetic field computations in rotating electric machinery with very complex magnetic circuit geometries, as well as nonlinear and anisotropic material properties.

Multi-satellites normalization of the FengYun-2s visible detectors by the MVP method

NASA Astrophysics Data System (ADS)

Li, Yuan; Rong, Zhi-guo; Zhang, Li-jun; Sun, Ling; Xu, Na

2013-08-01

After January 13, 2012, FY-2F had successfully launched, the total number of the in orbit operating FengYun-2 geostationary meteorological satellites reached three. For accurate and efficient application of multi-satellite observation data, the study of the multi-satellites normalization of the visible detector was urgent. The method required to be non-rely on the in orbit calibration. So as to validate the calibration results before and after the launch; calculate day updating surface bidirectional reflectance distribution function (BRDF); at the same time track the long-term decay phenomenon of the detector's linearity and responsivity. By research of the typical BRDF model, the normalization method was designed. Which could effectively solute the interference of surface directional reflectance characteristics, non-rely on visible detector in orbit calibration. That was the Median Vertical Plane (MVP) method. The MVP method was based on the symmetry of principal plane, which were the directional reflective properties of the general surface targets. Two geostationary satellites were taken as the endpoint of a segment, targets on the intersecting line of the segment's MVP and the earth surface could be used as a normalization reference target (NRT). Observation on the NRT by two satellites at the moment the sun passing through the MVP brought the same observation zenith, solar zenith, and opposite relative direction angle. At that time, the linear regression coefficients of the satellite output data were the required normalization coefficients. The normalization coefficients between FY-2D, FY-2E and FY-2F were calculated, and the self-test method of the normalized results was designed and realized. The results showed the differences of the responsivity between satellites could up to 10.1%(FY-2E to FY-2F); the differences of the output reflectance calculated by the broadcast calibration look-up table could up to 21.1%(FY-2D to FY-2F); the differences of the output reflectance from FY-2D and FY-2E calculated by the site experiment results reduced to 2.9%(13.6% when using the broadcast table). The normalized relative error was also calculated by the self-test method, which was less than 0.2%.

Provoked vestibulodynia-women's experience of participating in a multidisciplinary vulvodynia program.

PubMed

Sadownik, Leslie A; Seal, Brooke N; Brotto, Lori A

2012-04-01

Provoked Vestibulodynia (PVD) is the most common cause of pain with intercourse that affects reproductively aged women. The treatment outcome literature suggests that existing treatments, when administered individually, may have only limited benefits for improving pain, and that multidisciplinary approaches may be more effective for reducing pain and pain-associated distress. A program that offers education, group cognitive behavioral therapy, pelvic floor physiotherapy, and medical appointments was developed and implemented at our hospital site. To explore the experiences of women who participated in the Multidisciplinary Vulvodynia Program (MVP) in order to identify the perceived benefits of this program. Qualitative retrospective study. A semi-structured interview format was used to interview graduates of the MVP. Nineteen women, mean age 30.8 (20-54 years), participated in a one-on-one in-depth interview with a trained interviewer. The key question asked was "What has been the impact of the mvp on your life?" interviews were audio-recorded, transcribed, and qualitatively analyzed for major themes. Content analysis of interview transcripts. Five main themes emerged and included: increased knowledge, gained tools/skills, perceived improved mood/psychological well-being, a sense of validation and support, and an enhanced sense of empowerment. Overall, a multidisciplinary vulvodynia program was perceived as being beneficial for women with PVD. © 2012 International Society for Sexual Medicine.

ERMO3/MVP1/GOLD36 Is Involved in a Cell Type-Specific Mechanism for Maintaining ER Morphology in Arabidopsis thaliana

PubMed Central

Nakano, Ryohei Thomas; Matsushima, Ryo; Nagano, Atsushi J.; Fukao, Yoichiro; Fujiwara, Masayuki; Kondo, Maki; Nishimura, Mikio; Hara-Nishimura, Ikuko

2012-01-01

The endoplasmic reticulum (ER) has a unique, network-like morphology. The ER structures are composed of tubules, cisternae, and three-way junctions. This morphology is highly conserved among eukaryotes, but the molecular mechanism that maintains ER morphology has not yet been elucidated. In addition, certain Brassicaceae plants develop a unique ER-derived organelle called the ER body. This organelle accumulates large amounts of PYK10, a β-glucosidase, but its physiological functions are still obscure. We aimed to identify a novel factor required for maintaining the morphology of the ER, including ER bodies, and employed a forward-genetic approach using transgenic Arabidopsis thaliana (GFP-h) with fluorescently-labeled ER. We isolated and investigated a mutant (designated endoplasmic reticulum morphology3, ermo3) with huge aggregates and abnormal punctate structures of ER. ERMO3 encodes a GDSL-lipase/esterase family protein, also known as MVP1. Here, we showed that, although ERMO3/MVP1/GOLD36 was expressed ubiquitously, the morphological defects of ermo3 were specifically seen in a certain type of cells where ER bodies developed. Coimmunoprecipitation analysis combined with mass spectrometry revealed that ERMO3/MVP1/GOLD36 interacts with the PYK10 complex, a huge protein complex that is thought to be important for ER body-related defense systems. We also found that the depletion of transcription factor NAI1, a master regulator for ER body formation, suppressed the formation of ER-aggregates in ermo3 cells, suggesting that NAI1 expression plays an important role in the abnormal aggregation of ER. Our results suggest that ERMO3/MVP1/GOLD36 is required for preventing ER and other organelles from abnormal aggregation and for maintaining proper ER morphology in a coordinated manner with NAI1. PMID:23155454

Mitral valve prolapse and Marfan syndrome.

PubMed

Thacoor, Amitabh

2017-07-01

Marfan syndrome is a multisystemic genetic condition affecting connective tissue. It carries a reduced life expectancy, largely dependent on cardiovascular complications. More common cardiac manifestations such as aortic dissection and aortic valve incompetence have been widely documented in the literature. Mitral valve prolapse (MVP), however, has remained poorly documented. This article aims at exploring the existing literature on the pathophysiology and diagnosis of MVP in patients with Marfan syndrome, defining its current management and outlining the future developments surrounding it. © 2017 Wiley Periodicals, Inc.

The methodology of multi-viewpoint clustering analysis

NASA Technical Reports Server (NTRS)

Mehrotra, Mala; Wild, Chris

1993-01-01

One of the greatest challenges facing the software engineering community is the ability to produce large and complex computer systems, such as ground support systems for unmanned scientific missions, that are reliable and cost effective. In order to build and maintain these systems, it is important that the knowledge in the system be suitably abstracted, structured, and otherwise clustered in a manner which facilitates its understanding, manipulation, testing, and utilization. Development of complex mission-critical systems will require the ability to abstract overall concepts in the system at various levels of detail and to consider the system from different points of view. Multi-ViewPoint - Clustering Analysis MVP-CA methodology has been developed to provide multiple views of large, complicated systems. MVP-CA provides an ability to discover significant structures by providing an automated mechanism to structure both hierarchically (from detail to abstract) and orthogonally (from different perspectives). We propose to integrate MVP/CA into an overall software engineering life cycle to support the development and evolution of complex mission critical systems.

A Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM) for the Surface of Mars: An Instrument for the Planetary Science Community

NASA Technical Reports Server (NTRS)

Edmunson, J.; Gaskin, J. A.; Danilatos, G.; Doloboff, I. J.; Effinger, M. R.; Harvey, R. P.; Jerman, G. A.; Klein-Schoder, R.; Mackie, W.; Magera, B.;

Pulmonary Arteriovenous Malformations Embolized Using a Micro Vascular Plug System: Technical Note on a Preliminary Experience

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boatta, Emanuele, E-mail: emanuele.boatta@yahoo.it; Jahn, Christine, E-mail: christine.jahn@chru-strasbourg.fr; Canuet, Matthieu, E-mail: matthieu.canuet@chru-strasbourg.fr

AIMTo report our preliminary experience using a Micro Vascular Plug (MVP) deployed through a 2.8Fr micro-catheter for the treatment of pulmonary arteriovenous malformations (PAVMs) in a cohort of patients affected by Hereditary Haemorrhagic Telangiectasia (HHT).Materials and MethodsFour consecutive female patients (mean age 38.0 years; range 25–55 years) with PAVMs diagnosed on echocardiogram/bubble test and contrast-enhanced CT (CECT) underwent MVP embolization. One patient was symptomatic with recent transient ischaemic attack. Follow-up was undertaken at 1-month post-procedure with CECT to assess PAVMs permeability and MVP positioning and at 1-, 6-, and 12-month post-procedure, with echocardiography/bubble test and standard neurological history, to confirm absence ofmore » right-to-left shunts and recurrent symptoms.ResultsEight PAVMs were treated in 4 patients over 5 interventional sessions (mean 1.6 PAVMs per session). All PAVMs were simple, with mean feeding artery diameter of 4.25 mm. Eight 6.5 mm MVPs were deployed in total (one per lesion). Technical success was 100%. Mean procedural time and patient dose per session were 70 min (range 40–70 min) and 53418 mGy.cm{sup 2} (range 6113–101628 mGy.cm{sup 2}), respectively. No signs of reperfusion neither of MPV migration were noted at 1-month CECT follow-up. At early follow-up (mean 3.75 months; range 1–12 months), clinical success was 100% with no evidence of recurrent right-to-left shunt, and no neurological symptoms. No immediate or late complications were observed.ConclusionsMVP embolization of PAVMs appears technically feasible, safe, and effective at early follow-up. Further prospective studies are required to confirm long-term safety and efficacy of this promising technique.« less

A new definition for an old entity: improved definition of mitral valve prolapse using three-dimensional echocardiography and color-coded parametric models.

PubMed

Addetia, Karima; Mor-Avi, Victor; Weinert, Lynn; Salgo, Ivan S; Lang, Roberto M

2014-01-01

Differentiating between mitral valve (MV) prolapse (MVP) and MV billowing (MVB) on two-dimensional echocardiography is challenging. The aim of this study was to test the hypothesis that color-coded models of maximal leaflet displacement from the annular plane into the atrium derived from three-dimensional transesophageal echocardiography would allow discrimination between these lesions. Three-dimensional transesophageal echocardiographic imaging of the MV was performed in 50 patients with (n = 38) and without (n = 12) degenerative MV disease. Definitive diagnosis of MVP versus MVB was made using inspection of dynamic three-dimensional renderings and multiple two-dimensional cut planes extracted from three-dimensional data sets. This was used as a reference standard to test an alternative approach, wherein the color-coded parametric models were inspected for integrity of the coaptation line and location of the maximally displaced portion of the leaflet. Diagnostic interpretations of these models by two independent readers were compared with the reference standard. In all cases of MVP, the color-coded models depicted loss of integrity of the coaptation line and maximal leaflet displacement extending to the coaptation line. MVB was depicted by preserved leaflet apposition with maximal displacement away from the coaptation line. Interpretation of the 50 color-coded models by novice readers took 5 to 10 min and resulted in good agreement with the reference technique (κ = 0.81 and κ = 0.73 for the two readers). Three-dimensional color-coded models provide a static display of MV leaflet displacement, allowing differentiation between MVP and MVB, without the need to inspect multiple planes and while taking into account the saddle shape of the mitral annulus. Copyright © 2014 American Society of Echocardiography. Published by Mosby, Inc. All rights reserved.

Understanding the Delay in Onset of Pagets Disease of Bone

DTIC Science & Technology

2015-09-01

gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C K E E K A G S S G L MVP gene D N P G Q D R A T C K E...E K A G S S G L MVV gene agcaaaccatgcctctcagcaattggatcaactgaaggcggtgcacctcgcatccgcggt S K P C L S A I G S T E G G A P R...I R G MVP gene S K P C L S A I G S T E G G A P R I R G MVV gene

Directional plasticity rapidly improves 3D vestibulo-ocular reflex alignment in monkeys using a multichannel vestibular prosthesis.

PubMed

Dai, Chenkai; Fridman, Gene Y; Chiang, Bryce; Rahman, Mehdi A; Ahn, Joong Ho; Davidovics, Natan S; Della Santina, Charles C

2013-12-01

Bilateral loss of vestibular sensation can be disabling. We have shown that a multichannel vestibular prosthesis (MVP) can partly restore vestibular sensation as evidenced by improvements in the 3-dimensional angular vestibulo-ocular reflex (3D VOR). However, a key challenge is to minimize misalignment between the axes of eye and head rotation, which is apparently caused by current spread beyond each electrode's targeted nerve branch. We recently reported that rodents wearing a MVP markedly improve 3D VOR alignment during the first week after MVP activation, probably through the same central nervous system adaptive mechanisms that mediate cross-axis adaptation over time in normal individuals wearing prisms that cause visual scene movement about an axis different than the axis of head rotation. We hypothesized that rhesus monkeys would exhibit similar improvements with continuous prosthetic stimulation over time. We created bilateral vestibular deficiency in four rhesus monkeys via intratympanic injection of gentamicin. A MVP was mounted to the cranium, and eye movements in response to whole-body passive rotation in darkness were measured repeatedly over 1 week of continuous head motion-modulated prosthetic electrical stimulation. 3D VOR responses to whole-body rotations about each semicircular canal axis were measured on days 1, 3, and 7 of chronic stimulation. Horizontal VOR gain during 1 Hz, 50 °/s peak whole-body rotations before the prosthesis was turned on was <0.1, which is profoundly below normal (0.94 ± 0.12). On stimulation day 1, VOR gain was 0.4-0.8, but the axis of observed eye movements aligned poorly with head rotation (misalignment range ∼30-40 °). Substantial improvement of axis misalignment was observed after 7 days of continuous motion-modulated prosthetic stimulation under normal diurnal lighting. Similar improvements were noted for all animals, all three axes of rotation tested, for all sinusoidal frequencies tested (0.05-5 Hz), and for high-acceleration transient rotations. VOR asymmetry changes did not reach statistical significance, although they did trend toward slight improvement over time. Prior studies had already shown that directional plasticity reduces misalignment when a subject with normal labyrinths views abnormal visual scene movement. Our results show that the converse is also true: individuals receiving misoriented vestibular sensation under normal viewing conditions rapidly adapt to restore a well-aligned 3D VOR. Considering the similarity of VOR physiology across primate species, similar effects are likely to occur in humans using a MVP to treat bilateral vestibular deficiency.

The Millennium Villages Project: a retrospective, observational, endline evaluation.

PubMed

Mitchell, Shira; Gelman, Andrew; Ross, Rebecca; Chen, Joyce; Bari, Sehrish; Huynh, Uyen Kim; Harris, Matthew W; Sachs, Sonia Ehrlich; Stuart, Elizabeth A; Feller, Avi; Makela, Susanna; Zaslavsky, Alan M; McClellan, Lucy; Ohemeng-Dapaah, Seth; Namakula, Patricia; Palm, Cheryl A; Sachs, Jeffrey D

2018-05-01

The Millennium Villages Project (MVP) was a 10 year, multisector, rural development project, initiated in 2005, operating across ten sites in ten sub-Saharan African countries to achieve the Millennium Development Goals (MDGs). In this study, we aimed to estimate the project's impact, target attainment, and on-site spending. In this endline evaluation of the MVP, we retrospectively selected comparison villages that best matched the project villages on possible confounding variables. Cross-sectional survey data on 40 outcomes of interest were collected from both the project and the comparison villages in 2015. Using these data, as well as on-site spending data collected during the project, we estimated project impacts as differences in outcomes between the project and comparison villages; target attainment as differences between project outcomes and prespecified targets; and on-site spending as expenditures reported by communities, donors, governments, and the project. Spending data were not collected in the comparison villages. Averaged across the ten project sites, we found that impact estimates for 30 of 40 outcomes were significant (95% uncertainty intervals [UIs] for these outcomes excluded zero) and favoured the project villages. In particular, substantial effects were seen in agriculture and health, in which some outcomes were roughly one SD better in the project villages than in the comparison villages. The project was estimated to have no significant impact on the consumption-based measures of poverty, but a significant favourable impact on an index of asset ownership. Impacts on nutrition and education outcomes were often inconclusive (95% UIs included zero). Averaging across outcomes within categories, the project had significant favourable impacts on agriculture, nutrition, education, child health, maternal health, HIV and malaria, and water and sanitation. A third of the targets were met in the project sites. Total on-site spending decreased from US$132 per person in the first half of the project (of which $66 was from the MVP) to $109 per person in the second half of the project (of which $25 was from the MVP). The MVP had favourable impacts on outcomes in all MDG areas, consistent with an integrated rural development approach. The greatest effects were in agriculture and health, suggesting support for the project's emphasis on agriculture and health systems strengthening. The project conclusively met one third of its targets. The Open Society Foundations, the Islamic Development Bank, and the governments of Japan, South Korea, Mali, Senegal, and Uganda. Copyright © 2018 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND 4.0 license. Published by Elsevier Ltd.. All rights reserved.

The Impact of a Woman's Dyspareunia and Its Treatment on Her Intimate Partner: A Qualitative Analysis.

PubMed

Sadownik, Leslie A; Smith, Kelly B; Hui, Amber; Brotto, Lori A

2017-08-18

This study explored the experiences of male partners of women with dyspareunia, secondary to provoked vestibulodynia (PVD), who participated in the Multidisciplinary Vulvodynia Program (MVP). Participants were 16 men between 22 and 45 years of age. Data were collected with semi-structured interviews and analyzed for themes. Men were interviewed about (a) the impact of the woman's PVD on themselves; and (b) the impact of the MVP on themselves. Participants experienced negative psychological effects (e.g., guilt) in addition to activating emotions (e.g., frustration). They reported diminished quantity and quality of sex. In the relationship, PVD caused strain, communication challenges, and possibilities for growth. The benefits, perceived by the partner, of the women participating in the treatment program included improvements in knowledge, communication, and psychological and sexual health.

Advanced Infusion Techniques with 3-D Printed Tooling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nuttall, David; Elliott, Amy; Post, Brian K.

The manufacturing of tooling for large, contoured surfaces for fiber-layup applications requires significant effort to understand the geometry and then to subtractively manufacture the tool. Traditional methods for the auto industry use clay that is hand sculpted. In the marine pleasure craft industry, the exterior of the model is formed from a foam lay-up that is either hand cut or machined to create smooth lines. Engineers and researchers at Oak Ridge National Laboratory s Manufacturing Demonstration Facility (ORNL MDF) collaborated with Magnum Venus Products (MVP) in the development of a process for reproducing legacy whitewater adventure craft via digital scanningmore » and large scale 3-D printed layup molds. The process entailed 3D scanning a legacy canoe form, converting that form to a CAD model, additively manufacturing (3-D Print) the mold tool, and subtractively finishing the mold s transfer surfaces. Future work will include applying a gelcoat to the mold transfer surface and infusing using vacuum assisted resin transfer molding, or VARTM principles, to create a watertight vessel. The outlined steps were performed on a specific canoe geometry found by MVP s principal participant. The intent of utilizing this geometry is to develop an energy efficient and marketable process for replicating complex shapes, specifically focusing on this particular watercraft, and provide a finished product for demonstration to the composites industry. The culminating part produced through this agreement has been slated for public presentation and potential demonstration at the 2016 CAMX (Composites and Advanced Materials eXpo) exposition in Anaheim, CA. Phase I of this collaborative research and development agreement (MDF-15-68) was conducted under CRADA NFE-15-05575 and was initiated on May 7, 2015, with an introduction to the MVP product line, and concluded in March of 2016 with the printing of and processing of a canoe mold. The project partner Magnum Venous Products (MVP) is a small business. Phase II as discussed herein is under consideration by MVP as of this writing. Overall, it is anticipated that developing this process for manufacturing tooling for complex contoured surfaces has applicability to naval and other watercraft as well as bathrooms and large trucks.« less

Dim target trajectory-associated detection in bright earth limb background

NASA Astrophysics Data System (ADS)

Chen, Penghui; Xu, Xiaojian; He, Xiaoyu; Jiang, Yuesong

2015-09-01

The intensive emission of earth limb in the field of view of sensors contributes much to the observation images. Due to the low signal-to-noise ratio (SNR), it is a challenge to detect small targets in earth limb background, especially for the detection of point-like targets from a single frame. To improve the target detection, track before detection (TBD) based on the frame sequence is performed. In this paper, a new technique is proposed to determine the target associated trajectories, which jointly carries out background removing, maximum value projection (MVP) and Hough transform. The background of the bright earth limb in the observation images is removed according to the profile characteristics. For a moving target, the corresponding pixels in the MVP image are shifting approximately regularly in time sequence. And the target trajectory is determined by Hough transform according to the pixel characteristics of the target and the clutter and noise. Comparing with traditional frame-by-frame methods, determining associated trajectories from MVP reduces the computation load. Numerical simulations are presented to demonstrate the effectiveness of the approach proposed.

The Meningitis Vaccine Project.

PubMed

LaForce, F Marc; Konde, Kader; Viviani, Simonetta; Préziosi, Marie-Pierre

2007-09-03

Epidemic meningococcal meningitis is an important public health problem in sub-Saharan Africa. Current control measures rely on reactive immunizations with polysaccharide (PS) vaccines that do not induce herd immunity and are of limited effectiveness in those under 2 years of age. Conversely, polysaccharide conjugate vaccines are effective in infants and have consistently shown an important effect on decreasing carriage, two characteristics that facilitate disease control. In 2001 the Meningitis Vaccine Project (MVP) was created as a partnership between PATH and the World Health Organization (WHO) with the goal of eliminating meningococcal epidemics in Africa through the development, licensure, introduction, and widespread use of conjugate meningococcal vaccines. Since group A Neisseria meningitidis (N. meningitidis) is the dominant pathogen causing epidemic meningitis in Africa MVP is developing an affordable (US$ 0.40 per dose) meningococcal A (Men A) conjugate vaccine through an innovative international partnership that saw transfer of a conjugation and fermentation technology to a developing country vaccine manufacturer. A Phase 1 study of the vaccine in India has shown that the product is safe and immunogenic. Phase 2 studies have begun in Africa, and a large demonstration study of the conjugate vaccine is envisioned for 2008-2009. After extensive consultations with African public health officials a vaccine introduction plan has been developed that includes introduction of the Men A conjugate vaccine into standard Expanded Programme on Immunization (EPI) schedules but also emphasizes mass vaccination of 1-29 years old to induce herd immunity, a strategy that has been shown to be highly effective when the meningococcal C (Men C) conjugate vaccine was introduced in several European countries. The MVP model is a clear example of the usefulness of a "push mechanism" to finance the development of a needed vaccine for the developing world.

Reclaiming Gender and Power in Sexual Violence Prevention in Adolescence.

PubMed

Miller, Elizabeth

2018-03-01

The Mentors in Violence Prevention (MVP) model seeks to address the root causes of gender violence using a bystander approach and leadership training to challenge structures of patriarchy. Emerging research on adolescent relationship abuse and sexual violence points to key modifiable targets-transforming gender norms, addressing homophobia, integrating with comprehensive sexuality education, and acknowledging the needs of youth already exposed to violence. A social justice-based bystander approach such as the MVP model should be part of a multi-level approach to sexual violence prevention that addresses gender and power, encourages healthy sexuality conversations, and provides safety and support for survivors.

Empirical Study: Mentorship as a Value Proposition (MVP)

ERIC Educational Resources Information Center

Sams, Doreen; Richards, Rosalie; Lewis, Robin; McMullen, Rebecca; Hammack, Jennifer; Bacnik, Larry; Powell, Caitlin

2016-01-01

Greater access to college education, owed in part to technology and globalization, increases opportunities for students to prepare and thrive professionally. Undergraduate education must offer pedagogies of engagement to meet needs of the competitive global workforce and post-baccalaureate programs requiring advanced research and analytical…

The Evolution of the Meningitis Vaccine Project

PubMed Central

Tiffay, Kathleen; Jodar, Luis; Kieny, Marie-Paule; Socquet, Muriel; LaForce, F. Marc

2015-01-01

Background. In 2001, the Meningitis Vaccine Project (MVP) was tasked to develop, test, license, and introduce a group A meningococcal (MenA) conjugate vaccine for sub-Saharan Africa. African public health officials emphasized that a vaccine price of less than US$0.50 per dose was necessary to ensure introduction and sustained use of this new vaccine. Methods. Initially, MVP envisioned partnering with a multinational vaccine manufacturer, but the target price and opportunity costs were problematic and formal negotiations ended in 2002. MVP chose to become a “virtual vaccine company,” and over the next decade managed a network of public–private and public–public partnerships for pharmaceutical development, clinical development, and regulatory submission. MVP supported the transfer of key know-how for the production of group A polysaccharide and a new conjugation method to the Serum Institute of India, Ltd, based in Pune, India. A robust staff structure supported by technical consultants and overseen by advisory groups in Europe and Africa ensured that the MenA conjugate vaccine would meet all international standards. Results. A robust project structure including a team of technical consultants and 3 advisory groups in Europe and Africa ensured that the MenA conjugate vaccine (PsA-TT, MenAfriVac) was licensed by the Drug Controller General of India and prequalified by the World Health Organization in June 2010. The vaccine was introduced in Burkina Faso, Mali, and Niger in December 2010. Conclusions. The development, through a public–private partnership, of a safe, effective, and affordable vaccine for sub-Saharan Africa, PsA-TT, offers a new paradigm for the development of vaccines specifically targeting populations in resource-poor countries. PMID:26553666

The Evolution of the Meningitis Vaccine Project.

PubMed

Tiffay, Kathleen; Jodar, Luis; Kieny, Marie-Paule; Socquet, Muriel; LaForce, F Marc

2015-11-15

In 2001, the Meningitis Vaccine Project (MVP) was tasked to develop, test, license, and introduce a group A meningococcal (MenA) conjugate vaccine for sub-Saharan Africa. African public health officials emphasized that a vaccine price of less than US$0.50 per dose was necessary to ensure introduction and sustained use of this new vaccine. Initially, MVP envisioned partnering with a multinational vaccine manufacturer, but the target price and opportunity costs were problematic and formal negotiations ended in 2002. MVP chose to become a "virtual vaccine company," and over the next decade managed a network of public-private and public-public partnerships for pharmaceutical development, clinical development, and regulatory submission. MVP supported the transfer of key know-how for the production of group A polysaccharide and a new conjugation method to the Serum Institute of India, Ltd, based in Pune, India. A robust staff structure supported by technical consultants and overseen by advisory groups in Europe and Africa ensured that the MenA conjugate vaccine would meet all international standards. A robust project structure including a team of technical consultants and 3 advisory groups in Europe and Africa ensured that the MenA conjugate vaccine (PsA-TT, MenAfriVac) was licensed by the Drug Controller General of India and prequalified by the World Health Organization in June 2010. The vaccine was introduced in Burkina Faso, Mali, and Niger in December 2010. The development, through a public-private partnership, of a safe, effective, and affordable vaccine for sub-Saharan Africa, PsA-TT, offers a new paradigm for the development of vaccines specifically targeting populations in resource-poor countries. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Using AI Planning Techniques to Automatically Generate Image Processing Procedures: A Preliminary Report

NASA Technical Reports Server (NTRS)

Chien, S.

1994-01-01

This paper describes work on the Multimission VICAR Planner (MVP) system to automatically construct executable image processing procedures for custom image processing requests for the JPL Multimission Image Processing Lab (MIPL). This paper focuses on two issues. First, large search spaces caused by complex plans required the use of hand encoded control information. In order to address this in a manner similar to that used by human experts, MVP uses a decomposition-based planner to implement hierarchical/skeletal planning at the higher level and then uses a classical operator based planner to solve subproblems in contexts defined by the high-level decomposition.

Arterial and venous plasma levels of bupivacaine following peripheral nerve blocks.

PubMed

Moore, D C; Mather, L E; Bridenbaugh, L D; Balfour, R I; Lysons, D F; Horton, W G

1976-01-01

Mean arterial plasma (MAP) and peripheral mean venous plasma (MVP) levels of bupivacaine were ascertained in 3 groups of 10 patients each for: (1) intercostal nerve block, 400 mg; (2) block of the sciatic, femoral, and lateral femoral cutaneous nerves, with or without block of the obturator nerve, 400 mg; and (3) supraclavicular brachial plexus block, 300 mg. MAP levels were consistently higher than simultaneously sampled MVP levels, the highest levels occurring from bilateral intercostal nerve block. No evidence of systemic toxicity was observed. The results suggest that bupivacaine has a much wider margin of safety in humans than is now stated.

Implementation of MPEG-2 encoder to multiprocessor system using multiple MVPs (TMS320C80)

NASA Astrophysics Data System (ADS)

Kim, HyungSun; Boo, Kenny; Chung, SeokWoo; Choi, Geon Y.; Lee, YongJin; Jeon, JaeHo; Park, Hyun Wook

1997-05-01

This paper presents the efficient algorithm mapping for the real-time MPEG-2 encoding on the KAIST image computing system (KICS), which has a parallel architecture using five multimedia video processors (MVPs). The MVP is a general purpose digital signal processor (DSP) of Texas Instrument. It combines one floating-point processor and four fixed- point DSPs on a single chip. The KICS uses the MVP as a primary processing element (PE). Two PEs form a cluster, and there are two processing clusters in the KICS. Real-time MPEG-2 encoder is implemented through the spatial and the functional partitioning strategies. Encoding process of spatially partitioned half of the video input frame is assigned to ne processing cluster. Two PEs perform the functionally partitioned MPEG-2 encoding tasks in the pipelined operation mode. One PE of a cluster carries out the transform coding part and the other performs the predictive coding part of the MPEG-2 encoding algorithm. One MVP among five MVPs is used for system control and interface with host computer. This paper introduces an implementation of the MPEG-2 algorithm with a parallel processing architecture.

Digital Game-Based Learning Supports Student Motivation, Cognitive Success, and Performance Outcomes

ERIC Educational Resources Information Center

Woo, Jeng-Chung

2014-01-01

Traditional multimedia learning is primarily based on the cognitive load concept of information processing theory. Recent digital game-based learning (DGBL) studies have focused on exploring content support for learning motivation and related game characteristics. Motivation, volition, and performance (MVP) theory indicates that cognitive load and…

Major Vault Protein May Affect Nonhomologous End-Joining Repair and Apoptosis Through Ku70/80 and BAX Downregulation in Cervical Carcinoma Tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lloret, Marta; Instituto Canario de Investigacion del Cancer, Canary Islands; Lara, Pedro Carlos

Purpose: We investigated the relationship between major vault protein (MVP) expression, the nonhomologous end-joining (NHEJ) repair gene Ku70/80, and related genes involved in the regulation of apoptosis and proliferation to shed light on the possible causes of genetic instability, tumor progression, and resistance to oncologic treatment in patients with clinical cervical cancer. Methods and Materials: One hundred sixteen consecutive patients with localized cervix carcinoma were prospectively included in this study from July 1997 to Dec 2003. Patients were staged according to the tumor, node, metastasis (TNM) classification. Forty patients had Stage I disease, 45 had Stage II, and 31 hadmore » Stage III/IVA. Most patients had squamous tumors (98 cases) and Grades II (52 cases) and III (45 cases) carcinomas. Expression of MVP, Ku70/80, Insulin-Like Growth Factor-1 receptor (IGF-1R), BCL2-associated X protein (BAX), B-cell CLL/lymphoma 2 (BCL-2), p53, and Ki67 was studied by using immunohistochemistry in paraffin-embedded tumor tissue. Results: Tumors overexpressing MVP (65 of 116 cases) showed low levels of Ku70/80 (p = 0.013) and BAX expression (p < 0.0001). Furthermore, low Ku70/80 expression was strongly related to suppressed BAX (p < 0.001) and, to a lesser extent, upregulated BCL-2 (p = 0.042), altered p53 (p = 0.038), and increased proliferation (p = 0.002). Conclusion: We hypothesize that an early regulatory mechanism favors homologous or NHEJ repair at first, mediated by vaults along with other factors yet to be elucidated. If vaults are overexpressed, NHEJ repair may be suppressed by means of several mechanisms, with resultant genomic instability. These mechanisms may be associated with the decision of damaged cells to survive and proliferate, favoring tumor progression and reducing tumor response to oncologic treatment through the development of resistant cell phenotypes. Additional clinical studies are necessary to test this hypothesis.« less

Production and Characterization of Bacillus thuringiensis Cry1Ac-Resistant Cotton Bollworm Helicoverpa zea (Boddie)▿

PubMed Central

Anilkumar, Konasale J.; Rodrigo-Simón, Ana; Ferré, Juan; Pusztai-Carey, Marianne; Sivasupramaniam, Sakuntala; Moar, William J.

2008-01-01

Laboratory-selected Bacillus thuringiensis-resistant colonies are important tools for elucidating B. thuringiensis resistance mechanisms. However, cotton bollworm, Helicoverpa zea, a target pest of transgenic corn and cotton expressing B. thuringiensis Cry1Ac (Bt corn and cotton), has proven difficult to select for stable resistance. Two populations of H. zea (AR and MR), resistant to the B. thuringiensis protein found in all commercial Bt cotton varieties (Cry1Ac), were established by selection with Cry1Ac activated toxin (AR) or MVP II (MR). Cry1Ac toxin reflects the form ingested by H. zea when feeding on Bt cotton, whereas MVP II is a Cry1Ac formulation used for resistance selection and monitoring. The resistance ratio (RR) for AR exceeded 100-fold after 11 generations and has been maintained at this level for nine generations. This is the first report of stable Cry1Ac resistance in H. zea. MR crashed after 11 generations, reaching only an RR of 12. AR was only partially cross-resistant to MVP II, suggesting that MVP II does not have the same Cry1Ac selection pressure as Cry1Ac toxin against H. zea and that proteases may be involved with resistance. AR was highly cross-resistant to Cry1Ab toxin but only slightly cross-resistant to Cry1Ab expressing corn leaf powder. AR was not cross-resistant to Cry2Aa2, Cry2Ab2-expressing corn leaf powder, Vip3A, and cypermethrin. Toxin-binding assays showed no significant differences, indicating that resistance was not linked to a reduction in binding. These results aid in understanding why this pest has not evolved B. thuringiensis resistance, and highlight the need to choose carefully the form of B. thuringiensis protein used in experiments. PMID:18024681

Automated discrimination of lower and higher grade gliomas based on histopathological image analysis.

PubMed

Mousavi, Hojjat Seyed; Monga, Vishal; Rao, Ganesh; Rao, Arvind U K

2015-01-01

Histopathological images have rich structural information, are multi-channel in nature and contain meaningful pathological information at various scales. Sophisticated image analysis tools that can automatically extract discriminative information from the histopathology image slides for diagnosis remain an area of significant research activity. In this work, we focus on automated brain cancer grading, specifically glioma grading. Grading of a glioma is a highly important problem in pathology and is largely done manually by medical experts based on an examination of pathology slides (images). To complement the efforts of clinicians engaged in brain cancer diagnosis, we develop novel image processing algorithms and systems to automatically grade glioma tumor into two categories: Low-grade glioma (LGG) and high-grade glioma (HGG) which represent a more advanced stage of the disease. We propose novel image processing algorithms based on spatial domain analysis for glioma tumor grading that will complement the clinical interpretation of the tissue. The image processing techniques are developed in close collaboration with medical experts to mimic the visual cues that a clinician looks for in judging of the grade of the disease. Specifically, two algorithmic techniques are developed: (1) A cell segmentation and cell-count profile creation for identification of Pseudopalisading Necrosis, and (2) a customized operation of spatial and morphological filters to accurately identify microvascular proliferation (MVP). In both techniques, a hierarchical decision is made via a decision tree mechanism. If either Pseudopalisading Necrosis or MVP is found present in any part of the histopathology slide, the whole slide is identified as HGG, which is consistent with World Health Organization guidelines. Experimental results on the Cancer Genome Atlas database are presented in the form of: (1) Successful detection rates of pseudopalisading necrosis and MVP regions, (2) overall classification accuracy into LGG and HGG categories, and (3) receiver operating characteristic curves which can facilitate a desirable trade-off between HGG detection and false-alarm rates. The proposed method demonstrates fairly high accuracy and compares favorably against best-known alternatives such as the state-of-the-art WND-CHARM feature set provided by NIH combined with powerful support vector machine classifier. Our results reveal that the proposed method can be beneficial to a clinician in effectively separating histopathology slides into LGG and HGG categories, particularly where the analysis of a large number of slides is needed. Our work also reveals that MVP regions are much harder to detect than Pseudopalisading Necrosis and increasing accuracy of automated image processing for MVP detection emerges as a significant future research direction.

Immobilization of recombinant vault nanoparticles on solid substrates.

PubMed

Xia, Yun; Ramgopal, Yamini; Li, Hai; Shang, Lei; Srinivas, Parisa; Kickhoefer, Valerie A; Rome, Leonard H; Preiser, Peter R; Boey, Freddy; Zhang, Hua; Venkatraman, Subbu S

2010-03-23

Native vaults are nanoscale particles found abundantly in the cytoplasm of most eukaryotic cells. They have a capsule-like structure with a thin shell surrounding a "hollow" interior compartment. Recombinant vault particles were found to self-assemble following expression of the major vault protein (MVP) in a baculovirus expression system, and these particles are virtually identical to native vaults. Such particles have been recently studied as potential delivery vehicles. In this study, we focus on immobilization of vault particles on a solid substrate, such as glass, as a first step to study their interactions with cells. To this end, we first engineered the recombinant vaults by fusing two different tags to the C-terminus of MVP, a 3 amino acid RGD peptide and a 12 amino acid RGD-strep-tag peptide. We have demonstrated two strategies for immobilizing vaults on solid substrates. The barrel-and-cap structure of vault particles was observed for the first time, by atomic force microscopy (AFM), in a dry condition. This work proved the feasibility of immobilizing vault nanoparticles on a material surface, and the possibility of using vault nanoparticles as localized and sustainable drug carriers as well as a biocompatible surface moiety.

Computerized whole slide quantification shows increased microvascular density in pT2 prostate cancer as compared to normal prostate tissue.

PubMed

van Niekerk, Cornelis G; van der Laak, Jeroen A W M; Börger, M Elisa; Huisman, Henk-Jan; Witjes, J Alfred; Barentsz, Jelle O; Hulsbergen-van de Kaa, Christina A

2009-01-01

Contrast enhanced imaging enables powerful, non-invasive diagnostics, important for detection and staging of early prostate cancer. The uptake of contrast agent is increased in prostate cancer as compared to normal prostate tissue. To reveal the underlying physiological mechanisms, quantification of tissue components in pathology specimens may yield important information. Aim of this study was to investigate whether microvascularity is increased in prostate confined cancer (pT2). Radical prostatectomy specimens of 26 patients were selected for organ confined peripheral zone tumors which were restricted to one side of the prostate. Microvessels were visualized by immunohistochemistry against CD31. Specimens were scanned using a computer controlled microscope and scanning stage and vessels were recognized automatically. Pseudocolor mappings were produced showing number of vascular profiles (MVD), vascular area (MVA) and perimeter (MVP) in an overview of the entire prostate transection. MVD is a common measure for vascularity, whereas MVA represents the 3D vascular volume and MVP the perfused surface area. Mean, coefficient of variation and 75th percentile of these parameters were calculated automatically in manually indicated areas, consisting of the entire tumor area and the corresponding normal area in the contra lateral side of the prostate. The mappings clearly indicate areas of increased vascularity in prostate transections. In tumor tissue an increase was found compared to normal tissue of 81%, 49%, and 62% for mean MVD, mean MVA and mean MVP, respectively (P < 0.001 for all comparisons). In contrast, the heterogeneity in tumor vasculature was significantly decreased as compared to normal prostate (P < 0.001). Characteristics of microvasculature deviated significantly in pT2 prostate tumor as compared to normal tissue. Copyright 2008 Wiley-Liss, Inc.

Dogs with heart diseases causing turbulent high-velocity blood flow have changes in platelet function and von Willebrand factor multimer distribution.

PubMed

Tarnow, Inge; Kristensen, Annemarie T; Olsen, Lisbeth H; Falk, Torkel; Haubro, Lotte; Pedersen, Lotte G; Pedersen, Henrik D

2005-01-01

The purpose of this prospective study was to investigate platelet function using in vitro tests based on both high and low shear rates and von Willebrand factor (vWf) multimeric composition in dogs with cardiac disease and turbulent high-velocity blood flow. Client-owned asymptomatic, untreated dogs were divided into 4 groups: 14 Cavalier King Charles Spaniels (Cavaliers) with mitral valve prolapse (MVP) and no or minimal mitral regurgitation (MR), 17 Cavaliers with MVP and moderate to severe MR, 14 control dogs, and 10 dogs with subaortic stenosis (SAS). Clinical examinations and echocardiography were performed in all dogs. PFA100 closure times (the ability of platelets to occlude a hole in a membrane at high shear rates), platelet activation markers (plasma thromboxane B2 concentration, platelet surface P-selectin expression), platelet aggregation (in whole blood and platelet-rich plasma with 3 different agonists), and vWf multimers were analyzed. Cavaliers with moderate to severe MR and dogs with SAS had longer closure times and a lower percentage of the largest vWf multimers than did controls. Maximal aggregation responses were unchanged in dogs with SAS but enhanced in Cavaliers with MVP (regardless of MR status) compared with control dogs. No significant difference in platelet activation markers was found among groups. The data suggest that a form of platelet dysfunction detected at high shear rates was present in dogs with MR and SAS, possibly associated with a qualitative vWf defect. Aggregation results suggest increased platelet reactivity in Cavaliers, but the platelets did not appear to circulate in a preactivated state in either disease.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richter, Christian; Pawelke, Joerg; Karsch, Leonhard

Purpose: The aim of this article is to investigate the energy dependence of the radiochromic film type, Gafchromic EBT-1, when scanned with a flatbed scanner for film readout. Methods: Dose response curves were determined for 12 different beam qualities ranging from a 10 kVp x-ray beam to a 15 MVp x-ray beam and include also two high energy electron beam qualities (6 and 18 MeV). The dose responses measured as net optical density (netOD) for the different beam qualities were normalized to the response of a reference beam quality (6 MVp). Results: A strong systematic energy dependence of the filmmore » response was found. The lower the effective beam energy, the less sensitive the EBT-1 films get. The maximum decrease in dose for the same film response between the 25 kVp and 6 MVp beam qualities was 44%. Additionally, a difference in energy dependence for different doses was discovered, meaning that higher doses show a smaller dependency on energy than lower doses. The maximum decrease in the normalized netOD was found to be 25% for a dose of 0.5 Gy relative to the normalized netOD for 10 Gy. Moreover, a scaling procedure is introduced, allowing the correction of the energy dependence for the investigated beam qualities and also for comparable x-ray beam qualities within the energy range studied. Conclusions: A strong energy dependence for EBT-1 radiochromic films was found. The films were readout with a flatbed scanner. If the effective beam energy is known, the energy dependence can be corrected with the introduced scaling procedure. Further investigation of the influence of the spectral band of the readout device on energy dependence is needed to understand the reason for the different energy dependences found in this and previous works.« less

Astrionic system optimization and modular astrionics for NASA missions after 1974. Preliminary definition of astrionic system for space tug Mission Vehicle Payload (MVP)

NASA Technical Reports Server (NTRS)

1970-01-01

Results of preliminary studies to define the space tug astrionic system, subsystems, and components to meet requirements for a variety of missions are reported. Emphasis is placed on demonstration of the modular astrionics approach in the design of the space tug astrionic system.

The pseudo-Boolean optimization approach to form the N-version software structure

NASA Astrophysics Data System (ADS)

Kovalev, I. V.; Kovalev, D. I.; Zelenkov, P. V.; Voroshilova, A. A.

2015-10-01

The problem of developing an optimal structure of N-version software system presents a kind of very complex optimization problem. This causes the use of deterministic optimization methods inappropriate for solving the stated problem. In this view, exploiting heuristic strategies looks more rational. In the field of pseudo-Boolean optimization theory, the so called method of varied probabilities (MVP) has been developed to solve problems with a large dimensionality. Some additional modifications of MVP have been made to solve the problem of N-version systems design. Those algorithms take into account the discovered specific features of the objective function. The practical experiments have shown the advantage of using these algorithm modifications because of reducing a search space.

The 193-Kd Vault Protein, Vparp, Is a Novel Poly(Adp-Ribose) Polymerase

PubMed Central

Kickhoefer, Valerie A.; Siva, Amara C.; Kedersha, Nancy L.; Inman, Elisabeth M.; Ruland, Cristina; Streuli, Michel; Rome, Leonard H.

1999-01-01

Mammalian vaults are ribonucleoprotein (RNP) complexes, composed of a small ribonucleic acid and three proteins of 100, 193, and 240 kD in size. The 100-kD major vault protein (MVP) accounts for >70% of the particle mass. We have identified the 193-kD vault protein by its interaction with the MVP in a yeast two-hybrid screen and confirmed its identity by peptide sequence analysis. Analysis of the protein sequence revealed a region of ∼350 amino acids that shares 28% identity with the catalytic domain of poly(ADP-ribose) polymerase (PARP). PARP is a nuclear protein that catalyzes the formation of ADP-ribose polymers in response to DNA damage. The catalytic domain of p193 was expressed and purified from bacterial extracts. Like PARP, this domain is capable of catalyzing a poly(ADP-ribosyl)ation reaction; thus, the 193-kD protein is a new PARP. Purified vaults also contain the poly(ADP-ribosyl)ation activity, indicating that the assembled particle retains enzymatic activity. Furthermore, we show that one substrate for this vault-associated PARP activity is the MVP. Immunofluorescence and biochemical data reveal that p193 protein is not entirely associated with the vault particle, suggesting that it may interact with other protein(s). A portion of p193 is nuclear and localizes to the mitotic spindle. PMID:10477748

Single photon ionization and chemical ionization combined ion source based on a vacuum ultraviolet lamp for orthogonal acceleration time-of-flight mass spectrometry.

PubMed

Hua, Lei; Wu, Qinghao; Hou, Keyong; Cui, Huapeng; Chen, Ping; Wang, Weiguo; Li, Jinghua; Li, Haiyang

2011-07-01

A novel combined ion source based on a vacuum ultraviolet (VUV) lamp with both single photon ionization (SPI) and chemical ionization (CI) capabilities has been developed for an orthogonal acceleration time-of-flight mass spectrometer (oaTOFMS). The SPI was accomplished using a commercial 10.6 eV krypton discharge lamp with a photon flux of about 10(11) photons s(-1), while the CI was achieved through ion-molecule reactions with O(2)(+) reactant ions generated by photoelectron ionization at medium vacuum pressure (MVP). To achieve high ionization efficiency, the ion source pressure was elevated to 0.3 mbar and the photoionization length was extended to 36 mm. As a result, limits of detection (LODs) down to 3, 4, and 6 ppbv were obtained for benzene, toluene, and p-xylene in MVP-SPI mode, and values of 8 and 10 ppbv were obtained for toluene and chloroform, respectively, in SPI-CI mode. As it is feasible to switch between MVP-SPI mode and SPI-CI mode rapidly, this system is capable of monitoring complex organic mixtures with a wide range of ionization energies (IEs). The analytical capacity of this system was demonstrated by measuring dehydrogenation products of long-chain paraffins to olefins through direct capillary sampling and drinking water disinfection byproducts from chlorine through a membrane interface.

Mitral Valve Prolapse

MedlinePlus

... valve syndrome . What happens during MVP? Watch an animation of mitral valve prolapse When the heart pumps ( ... our brochures Popular Articles 1 Understanding Blood Pressure Readings 2 Sodium and Salt 3 Heart Attack Symptoms ...

Mitral Valve Prolapse

MedlinePlus

... valve. MVP puts you at risk for infective endocarditis, a kind of heart infection. To prevent it, ... surgeries. Now, only people at high risk of endocarditis need the antibiotics. NIH: National Heart, Lung, and ...

Processors for wavelet analysis and synthesis: NIFS and TI-C80 MVP

NASA Astrophysics Data System (ADS)

Brooks, Geoffrey W.

1996-03-01

Two processors are considered for image quadrature mirror filtering (QMF). The neuromorphic infrared focal-plane sensor (NIFS) is an existing prototype analog processor offering high speed spatio-temporal Gaussian filtering, which could be used for the QMF low- pass function, and difference of Gaussian filtering, which could be used for the QMF high- pass function. Although not designed specifically for wavelet analysis, the biologically- inspired system accomplishes the most computationally intensive part of QMF processing. The Texas Instruments (TI) TMS320C80 Multimedia Video Processor (MVP) is a 32-bit RISC master processor with four advanced digital signal processors (DSPs) on a single chip. Algorithm partitioning, memory management and other issues are considered for optimal performance. This paper presents these considerations with simulated results leading to processor implementation of high-speed QMF analysis and synthesis.

Space-to-Ground: Color of the Sun: 04/27/2018

NASA Image and Video Library

2018-04-26

NASA has a new administrator, a facility stands out as a "MVP", and just what color is the Sun? NASA's Space to Ground is your weekly update on what's happening aboard the International Space Station.

Glass Effect in Inbreeding-Avoidance Systems: Minimum Viable Population for Outbreeders

NASA Astrophysics Data System (ADS)

Tainaka, Kei-ichi; Itoh, Yoshiaki

1996-10-01

Many animals, birds and plants have evolved mechanisms to avoid inbreeding between close relatives.Such mating systems may have developed several methods for restricting mate choice.If fragmentation of habitats becomes serious, these methods may lead to a lack of acceptable mates. We call this “glass effect”which is a generalization of the so-called Allee effect.We present two inbreeding-avoidance (outbreeding) models.Both models show that outbreeders have a high risk infragmented environments.We thus obtain the minimum viable population (MVP). It is found that the value of MVP amounts to the range from several hundred to several thousand individuals.While this value is much larger than thoseobtained by the previous demographic theories,it is consistent with recent empirical estimations.Moreover, we find that the glass effect is caused bydynamically induced clusters of relatives.This suggests that genetic variation will be decreased by the outbreeding in a highly fragmented environment.

Influence of dentinal regions on bond strengths of different adhesive systems.

PubMed

Ozer, F; Unlü, N; Sengun, A

2003-06-01

This in vitro study assessed comparatively the shear bond strengths of three composite resins, 3M Valux Plus (3MVP), Herculite (H), Clearfil AP-X (CAP-X), a polyacid modified composite resin Dyract (D), and a resin modified glass-ionomer materials Vitremer (V), to cervical and buccal dentine regions of extracted human molar teeth. Four different bonding systems, 3M ScotchBond Multipurpose (SB), Clearfil Liner Bond 2 (LB2), Opti Bond (OB), and Prime & Bond 2.1 (PB 2.1) were used with the manufacturer's respective composite and compomer materials. One hundred freshly extracted mandibular molar teeth were selected for this study. Flat buccal dentine surfaces were created on 50 teeth and cylindrical rods of the five materials were bonded to the dentine surfaces. For assessment of cervical bond strengths, the materials were bonded to mesial and distal enamel bordered occlusal dentinal surfaces of the remaining 50 teeth. The five groups of restorative procedures were applied as follows; Group 1: SB + 3MVP, Group 2: LB2 + CAP-X, Group 3: OB + H, Group 4: PB2.1 + D, Group 5: Vitremer primer (VP) VP + V. Each restorative procedure thus had 20 specimens (10 buccal + 10 cervical). After 24 h of water storage (37 degrees C), the specimens were tested on a Universal Testing machine in shear with a cross head speed of 0.5 mm min-1. The bond strength values were calculated in MPa and the results were evaluated statistically using Kruskal-Wallis one-way/anova and Mann-Whitney U-tests. It was found that the bond strengths of SB + 3MVP, LB2 + CAP-X and VP + V to buccal dentine surfaces were significantly stronger (P < 0.05) than those to the occluso-cervical dentine floors. When the bond strengths to the occluso-cervical dentine and buccal dentine surface were compared, there was no significant difference between the materials (P > 0.05). Vitremer was found the least successful adhesive material in terms of shear bond strength on both buccal and occluso-cervical dentine surfaces.

Attempt of Serendipitous Science During the Mojave Volatile Prospector Field Expedition

NASA Technical Reports Server (NTRS)

Roush, T. L.; Colaprete, A.; Heldmann, J.; Lim, D. S. S.; Cook, A.; Elphic, R.; Deans, M.; Fluckiger, L.; Fritzler, E.; Hunt, David

2015-01-01

On 23 October a partial solar eclipse occurred across parts of the southwest United States between approximately 21:09 and 23:40 (UT), with maximum obscuration, 36%, occurring at 22:29 (UT). During 21-26 October 2014 the Mojave Volatile Prospector (MVP) field expedition deployed and operated the NASA Ames Krex2 rover in the Mojave desert west of Baker, California (Fig. 1, bottom). The MVP field expedition primary goal was to characterize the surface and sub-surface soil moisture properties within desert alluvial fans, and as a secondary goal to provide mission operations simulations of the Resource Prospector (RP) mission to a Lunar pole. The partial solar eclipse provided an opportunity during MVP operations to address serendipitous science. Science instruments on Krex2 included a neutron spectrometer, a near-infrared spectrometer with associated imaging camera, and an independent camera coupled with software to characterize the surface textures of the areas encountered. All of these devices are focused upon the surface and as a result are downward looking. In addition to these science instruments, two hazard cameras are mounted on Krex2. The chief device used to monitor the partial solar eclipse was the engineering development unit of the Near-Infrared Volatile Spectrometer System (NIRVSS) near-infrared spectrometer. This device uses two separate fiber optic fed Hadamard transform spectrometers. The short-wave and long-wave spectrometers measure the 1600-2400 and 2300-3400 nm wavelength regions with resolutions of 10 and 13 nm, respectively. Data are obtained approximately every 8 seconds. The NIRVSS stares in the opposite direction as the front Krex2.

Insulin use, adipokine profiles and breast cancer prognosis.

PubMed

Wintrob, Zachary A P; Hammel, Jeffrey P; Khoury, Thaer; Nimako, George K; Fu, Hsin-Wei; Fayazi, Zahra S; Gaile, Dan P; Forrest, Alan; Ceacareanu, Alice C

2017-01-01

Type-2 diabetes mellitus (T2DM) and breast cancer (BC) share common cytokine signaling changes resultant from adipose tissue dysfunction. This modified adipokine signaling was shown to be directly associated with changes in the body mass index (BMI) and diet and it is expected to also be influenced by T2DM pharmacotherapy. We evaluated the relationship between pre-existing diabetes treatment, circulating adipokine levels at cancer diagnosis, and long-term outcomes. All incident BC cases were reviewed (01/01/2003-12/31/2009, N=2194). Each of the subjects with baseline T2DM (cases) was matched with two other subjects without T2DM (controls) based on the following criteria: age, BMI, ethnicity, menopausal status and tumor stage. All cases and controls with available baseline plasma and tumor biopsies, and being surgery and BC treatment naïve, were included (N 1 =97, N 2 =194). Clinical history and vital status were documented. Adipokine levels (adiponectin, leptin, TNF-α, CRP, IL-1β, IL-1Ra, IL-6, and C-peptide) were assessed by either ELISA or Luminex® assays. Cancer outcomes were assessed by Kaplan-Meier analysis; associations between categorical variables were assessed by Fisher's exact test, categorical and continuous variables by Kruskal-Wallis or Wilcoxon Rank-Sum test, where appropriate. Multivariate adjustments (MVP, multivariate p-value) were performed accounting for age, tumor stage, BMI, estrogen receptor (ER) status and cumulative comorbidity. All biomarker correlations were assessed by the Pearson method. Utilization of insulin and insulin secretagogues was associated with ER (-) phenotype (p=0.008, p=0.043) and poorer BC outcomes (p=0.012, p=0.033). Insulin users were found to have lower C-peptide and higher IL-6, TNF-α and CRP levels, of which elevated CRP and TNF-α were associated with poorer BC outcomes (p=0.003, MVP=0.210). Insulin remarked by higher leptin levels as compared to controls (p=0.052), but did not differ significantly from non-users. Although lower adiponectin levels were observed among non-insulin users as compared to controls (p<0.001, MVP=0.006), insulin use seemed to have restored adiponectin production. C-peptide levels were lower among insulin users as compared to non-users (p<0.001, MVP<0.001) and approached levels comparable with those of the controls. In the overall dataset, C-peptide lower than 0.75ng/ml were strongly associated with poorer survival (p=0.007, MVP=0.002). Among insulin users, C-peptide levels were inversely correlated with IL-1β and IL-1Ra levels only after full adjustment (p=0.012, p=0.030); the correlation was unremarkable in other groups. Insulin use is associated with elevated leptin, CRP, TNFα, and lower C-peptide and also linked to poor BC outcomes. More research is needed to verify these findings; however, we are among the first to correlate pharmacotherapy use, measures of adipose tissue dysfunction and cancer outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

MVP and Faculty Evaluation

ERIC Educational Resources Information Center

Theall, Michael

2017-01-01

This chapter considers faculty evaluation and motivational and volitional issues. The focus is on the ways in which faculty evaluation influences not only faculty attitudes and beliefs but also willingness to engage in professional development and instructional improvement programs. Recommendations for effective practice that enhances motivation…

Cross-axis adaptation improves 3D vestibulo-ocular reflex alignment during chronic stimulation via a head-mounted multichannel vestibular prosthesis

PubMed Central

Dai, Chenkai; Fridman, Gene Y.; Chiang, Bryce; Davidovics, Natan; Melvin, Thuy-Anh; Cullen, Kathleen E.; Della Santina, Charles C.

2012-01-01

By sensing three-dimensional (3D) head rotation and electrically stimulating the three ampullary branches of a vestibular nerve to encode head angular velocity, a multichannel vestibular prosthesis (MVP) can restore vestibular sensation to individuals disabled by loss of vestibular hair cell function. However, current spread to afferent fibers innervating non-targeted canals and otolith endorgans can distort the vestibular nerve activation pattern, causing misalignment between the perceived and actual axis of head rotation. We hypothesized that over time, central neural mechanisms can adapt to correct this misalignment. To test this, we rendered five chinchillas vestibular-deficient via bilateral gentamicin treatment and unilaterally implanted them with a head mounted MVP. Comparison of 3D angular vestibulo-ocular reflex (aVOR) responses during 2 Hz, 50°/s peak horizontal sinusoidal head rotations in darkness on the first, third and seventh days of continual MVP use revealed that eye responses about the intended axis remained stable (at about 70% of the normal gain) while misalignment improved significantly by the end of one week of prosthetic stimulation. A comparable time course of improvement was also observed for head rotations about the other two semicircular canal axes and at every stimulus frequency examined (0.2–5 Hz). In addition, the extent of disconjugacy between the two eyes progressively improved during the same time window. These results indicate that the central nervous system rapidly adapts to multichannel prosthetic vestibular stimulation to markedly improve 3D aVOR alignment within the first week after activation. Similar adaptive improvements are likely to occur in other species, including humans. PMID:21374081

Research on the Factors Influencing the Measurement Errors of the Discrete Rogowski Coil †

PubMed Central

Xu, Mengyuan; Yan, Jing; Geng, Yingsan; Zhang, Kun; Sun, Chao

2018-01-01

An innovative array of magnetic coils (the discrete Rogowski coil—RC) with the advantages of flexible structure, miniaturization and mass producibility is investigated. First, the mutual inductance between the discrete RC and circular and rectangular conductors are calculated using the magnetic vector potential (MVP) method. The results are found to be consistent with those calculated using the finite element method, but the MVP method is simpler and more practical. Then, the influence of conductor section parameters, inclination, and eccentricity on the accuracy of the discrete RC is calculated to provide a reference. Studying the influence of an external current on the discrete RC’s interference error reveals optimal values for length, winding density, and position arrangement of the solenoids. It has also found that eccentricity and interference errors decreasing with increasing number of solenoids. Finally, a discrete RC prototype is devised and manufactured. The experimental results show consistent output characteristics, with the calculated sensitivity and mutual inductance of the discrete RC being very close to the experimental results. The influence of an external conductor on the measurement of the discrete RC is analyzed experimentally, and the results show that interference from an external current decreases with increasing distance between the external and measured conductors. PMID:29534006

Research on the Factors Influencing the Measurement Errors of the Discrete Rogowski Coil.

PubMed

Xu, Mengyuan; Yan, Jing; Geng, Yingsan; Zhang, Kun; Sun, Chao

2018-03-13

An innovative array of magnetic coils (the discrete Rogowski coil-RC) with the advantages of flexible structure, miniaturization and mass producibility is investigated. First, the mutual inductance between the discrete RC and circular and rectangular conductors are calculated using the magnetic vector potential (MVP) method. The results are found to be consistent with those calculated using the finite element method, but the MVP method is simpler and more practical. Then, the influence of conductor section parameters, inclination, and eccentricity on the accuracy of the discrete RC is calculated to provide a reference. Studying the influence of an external current on the discrete RC's interference error reveals optimal values for length, winding density, and position arrangement of the solenoids. It has also found that eccentricity and interference errors decreasing with increasing number of solenoids. Finally, a discrete RC prototype is devised and manufactured. The experimental results show consistent output characteristics, with the calculated sensitivity and mutual inductance of the discrete RC being very close to the experimental results. The influence of an external conductor on the measurement of the discrete RC is analyzed experimentally, and the results show that interference from an external current decreases with increasing distance between the external and measured conductors.

A Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM) for In-Situ Mars Surface Sample Analysis

NASA Technical Reports Server (NTRS)

Edmunson, J.; Gaskin, J. A.; Jerman, G. A.; Harvey, R. P.; Doloboff, I. J.; Neidholdt, E. L.

2016-01-01

The Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM) project, funded by the NASA Planetary Instrument Concepts for the Advancement of Solar System Observations (PICASSO) Research Opportunities in Space and Earth Sciences (ROSES), will build upon previous miniaturized SEM designs and recent advancements in variable pressure SEM's to design and build a SEM to complete analyses of samples on the surface of Mars using the atmosphere as an imaging medium. This project is a collaboration between NASA Marshall Space Flight Center (MSFC), the Jet Propulsion Laboratory (JPL), electron gun and optics manufacturer Applied Physics Technologies, and small vacuum system manufacturer Creare. Dr. Ralph Harvery and environmental SEM (ESEM) inventor Dr. Gerry Danilatos serve as advisors to the team. Variable pressure SEMs allow for fine (nm-scale) resolution imaging and micron-scale chemical study of materials without sample preparation (e.g., carbon or gold coating). Charging of a sample is reduced or eliminated by the gas surrounding the sample. It is this property of ESEMs that make them ideal for locations where sample preparation is not yet feasible, such as the surface of Mars. In addition, the lack of sample preparation needed here will simplify the sample acquisition process and allow caching of the samples for future complementary payload use.

CoSMoMVPA: Multi-Modal Multivariate Pattern Analysis of Neuroimaging Data in Matlab/GNU Octave.

PubMed

Oosterhof, Nikolaas N; Connolly, Andrew C; Haxby, James V

2016-01-01

Recent years have seen an increase in the popularity of multivariate pattern (MVP) analysis of functional magnetic resonance (fMRI) data, and, to a much lesser extent, magneto- and electro-encephalography (M/EEG) data. We present CoSMoMVPA, a lightweight MVPA (MVP analysis) toolbox implemented in the intersection of the Matlab and GNU Octave languages, that treats both fMRI and M/EEG data as first-class citizens. CoSMoMVPA supports all state-of-the-art MVP analysis techniques, including searchlight analyses, classification, correlations, representational similarity analysis, and the time generalization method. These can be used to address both data-driven and hypothesis-driven questions about neural organization and representations, both within and across: space, time, frequency bands, neuroimaging modalities, individuals, and species. It uses a uniform data representation of fMRI data in the volume or on the surface, and of M/EEG data at the sensor and source level. Through various external toolboxes, it directly supports reading and writing a variety of fMRI and M/EEG neuroimaging formats, and, where applicable, can convert between them. As a result, it can be integrated readily in existing pipelines and used with existing preprocessed datasets. CoSMoMVPA overloads the traditional volumetric searchlight concept to support neighborhoods for M/EEG and surface-based fMRI data, which supports localization of multivariate effects of interest across space, time, and frequency dimensions. CoSMoMVPA also provides a generalized approach to multiple comparison correction across these dimensions using Threshold-Free Cluster Enhancement with state-of-the-art clustering and permutation techniques. CoSMoMVPA is highly modular and uses abstractions to provide a uniform interface for a variety of MVP measures. Typical analyses require a few lines of code, making it accessible to beginner users. At the same time, expert programmers can easily extend its functionality. CoSMoMVPA comes with extensive documentation, including a variety of runnable demonstration scripts and analysis exercises (with example data and solutions). It uses best software engineering practices including version control, distributed development, an automated test suite, and continuous integration testing. It can be used with the proprietary Matlab and the free GNU Octave software, and it complies with open source distribution platforms such as NeuroDebian. CoSMoMVPA is Free/Open Source Software under the permissive MIT license. Website: http://cosmomvpa.org Source code: https://github.com/CoSMoMVPA/CoSMoMVPA.

CoSMoMVPA: Multi-Modal Multivariate Pattern Analysis of Neuroimaging Data in Matlab/GNU Octave

PubMed Central

Oosterhof, Nikolaas N.; Connolly, Andrew C.; Haxby, James V.

2016-01-01

Recent years have seen an increase in the popularity of multivariate pattern (MVP) analysis of functional magnetic resonance (fMRI) data, and, to a much lesser extent, magneto- and electro-encephalography (M/EEG) data. We present CoSMoMVPA, a lightweight MVPA (MVP analysis) toolbox implemented in the intersection of the Matlab and GNU Octave languages, that treats both fMRI and M/EEG data as first-class citizens. CoSMoMVPA supports all state-of-the-art MVP analysis techniques, including searchlight analyses, classification, correlations, representational similarity analysis, and the time generalization method. These can be used to address both data-driven and hypothesis-driven questions about neural organization and representations, both within and across: space, time, frequency bands, neuroimaging modalities, individuals, and species. It uses a uniform data representation of fMRI data in the volume or on the surface, and of M/EEG data at the sensor and source level. Through various external toolboxes, it directly supports reading and writing a variety of fMRI and M/EEG neuroimaging formats, and, where applicable, can convert between them. As a result, it can be integrated readily in existing pipelines and used with existing preprocessed datasets. CoSMoMVPA overloads the traditional volumetric searchlight concept to support neighborhoods for M/EEG and surface-based fMRI data, which supports localization of multivariate effects of interest across space, time, and frequency dimensions. CoSMoMVPA also provides a generalized approach to multiple comparison correction across these dimensions using Threshold-Free Cluster Enhancement with state-of-the-art clustering and permutation techniques. CoSMoMVPA is highly modular and uses abstractions to provide a uniform interface for a variety of MVP measures. Typical analyses require a few lines of code, making it accessible to beginner users. At the same time, expert programmers can easily extend its functionality. CoSMoMVPA comes with extensive documentation, including a variety of runnable demonstration scripts and analysis exercises (with example data and solutions). It uses best software engineering practices including version control, distributed development, an automated test suite, and continuous integration testing. It can be used with the proprietary Matlab and the free GNU Octave software, and it complies with open source distribution platforms such as NeuroDebian. CoSMoMVPA is Free/Open Source Software under the permissive MIT license. Website: http://cosmomvpa.org Source code: https://github.com/CoSMoMVPA/CoSMoMVPA PMID:27499741

76 FR 35474 - UAW-Chrysler Technical Training Center, Technology Training Joint Programs Staff, Including On...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-17

...-Chrysler Technical Training Center, Technology Training Joint Programs Staff, Including On-Site Leased Workers From Cranks, O/E Learning, DBSI, IDEA, and Tonic/MVP, Detroit, MI; UAW-Chrysler Technical Training... workers and former workers of UAW-Chrysler Technical Training Center, Technology Training Joint Programs...

77 FR 17498 - Recovery Plan for the Endangered Spigelia gentianoides (Gentian Pinkroot)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-26

... status when: Extant populations and newly discovered sites are identified and mapped; Inventories have... management protocols on selected populations are established for 15 years to track threats to the species and its habitat; Extant populations located on public land are stable; The minimum viable population (MVP...

Differences in passenger car and large truck involved crash frequencies at urban signalized intersections: an exploratory analysis.

PubMed

Dong, Chunjiao; Clarke, David B; Richards, Stephen H; Huang, Baoshan

2014-01-01

The influence of intersection features on safety has been examined extensively because intersections experience a relatively large proportion of motor vehicle conflicts and crashes. Although there are distinct differences between passenger cars and large trucks-size, operating characteristics, dimensions, and weight-modeling crash counts across vehicle types is rarely addressed. This paper develops and presents a multivariate regression model of crash frequencies by collision vehicle type using crash data for urban signalized intersections in Tennessee. In addition, the performance of univariate Poisson-lognormal (UVPLN), multivariate Poisson (MVP), and multivariate Poisson-lognormal (MVPLN) regression models in establishing the relationship between crashes, traffic factors, and geometric design of roadway intersections is investigated. Bayesian methods are used to estimate the unknown parameters of these models. The evaluation results suggest that the MVPLN model possesses most of the desirable statistical properties in developing the relationships. Compared to the UVPLN and MVP models, the MVPLN model better identifies significant factors and predicts crash frequencies. The findings suggest that traffic volume, truck percentage, lighting condition, and intersection angle significantly affect intersection safety. Important differences in car, car-truck, and truck crash frequencies with respect to various risk factors were found to exist between models. The paper provides some new or more comprehensive observations that have not been covered in previous studies. Copyright © 2013 Elsevier Ltd. All rights reserved.

MVP and Instructional Systems Design in Online Courses

ERIC Educational Resources Information Center

Franklin, Jennifer L.

2017-01-01

This chapter is based on three premises. The first premise is that the use of instructional systems design (ISD) methods is important in online as well as traditional classroom settings. A second premise is that improving the motivational design of instruction brings benefits to teachers and learners alike. The third premise, specific to this…

Synergistic effects of loxoprofen and glycine on the micturition reflex in conscious rats.

PubMed

Fukiya, Yumiko; Yoshizumi, Masaru; Saito, Mikako; Matsumoto-Miyai, Kazumasa; Nimura, Toshie; Kawatani, Masahito

2014-01-01

We examined the inhibitory effects of loxoprofen, a cyclooxygenase inhibitor, and glycine, a major inhibitory neurotransmitter, on the micturition reflex in conscious rats and hypothesized that these drugs would interact synergistically to inhibit micturition. Voiding behaviors were assessed using a metabolic cage. Oral loxoprofen decreased the urinary frequency, and only a high dose(10 mg/kg) significantly reduced the voided volume. With cystometry, intravenous loxoprofen(0.1-3 mg/kg) and glycine (30 and 100 mg/kg) prolonged the intercontraction intervals (ICI) in adose-dependent manner, but did not change the maximum voiding pressure (MVP) in conscious rats. The combination of loxoprofen (3 mg/kg) and glycine (100 mg/kg) strongly prolonged the ICI more than with either drug alone. The lowest dose of loxoprofen (0.1 mg/kg) and glycine(30 mg/kg) did not affect either the ICI or the MVP, but their combination resulted in a significant increase in the ICI. These results suggest that the combined administration of loxoprofen and glycine produced a synergistic inhibitory effect on the micturition reflex.

[Coronary revascularization in patients with preoperative electrical storm].

PubMed

Kawashima, Toshiya; Naraoka, S

2007-03-01

We report 5 cases who underwent surgical coronary revascularization for subacute myocardial ischemia with preoperative electrical storm. All patients showed severe left ventricular dysfunction. Mean ejection fraction was 24.4 +/- 7.6%. Three patients had already had implantable cardioverter-defibrillator (ICD) therapy. Procedures were on-pump coronary artery bypass grafting (CABG) and mitral valvuloplasty (MVP) [case 1], on-pump CABG, MVP, left ventricular restoration (LVR) and cryoablation (case 2), and off-pump CABG (case 3-5). Case 5 necessitated conversion to on-pump for electrical storm during left circumflex artery (LCx) anastomosis. Case 3 suddenly died on the 2nd postoperative day due to electrical storm. Case 1 had recurrent attack of electrical storm postoperatively, treated by ICD, overdrive pacing, repeated intraaortic balloon pumping (IABP), deep sedation with endotracheal intubation, and finally catheter ablation. Four patients have survived 2 years (mean) postoperatively without any arrhythmia, and are all in good condition [New York Heart Association (NYHA) I] now. It was concluded that off-pump procedure was not suitable for subacute myocardial ischemia with electrical storm and that LVR with surgical cryoablation would be effective if indicated.

Spatial variation of vessel grouping in the xylem of Betula platyphylla Roth.

PubMed

Zhao, Xiping

2016-01-01

Vessel grouping in angiosperms may improve hydraulic integration and increase the spread of cavitations through redundancy pathways. Although disputed, it is increasingly attracting research interest as a potentially significant hydraulic trait. However, the variation of vessel grouping in a tree is poorly understood. I measured the number of solitary and grouped vessels in the xylem of Betula platyphylla Roth. from the pith to the bark along the water flow path. The vessel grouping parameters included the mean number of vessels per vessel group (VG), percentage of solitary vessels (SVP), percentage of radial multiple vessels (MVP), and percentage of cluster vessels (CVP). The effects of cambial age (CA) and flow path-length (PL) on the vessel grouping were analyzed using a linear mixed model.VG and CVP increased nonlinearly, SVP decreased nonlinearly with PL. In trunks and branches, VG and CVP decreased nonlinearly, and SVP increased nonlinearly with CA. In roots, the parameters had no change with CA. MVP was almost constant with PL or CA. The results suggest that vessel grouping has a nonrandom variation pattern, which is affected deeply by cambial age and water flow path.

The Conserved Foot Domain of RNA Pol II Associates with Proteins Involved in Transcriptional Initiation and/or Early Elongation

PubMed Central

García-López, M. Carmen; Pelechano, Vicent; Mirón-García, M. Carmen; Garrido-Godino, Ana I.; García, Alicia; Calvo, Olga; Werner, Michel; Pérez-Ortín, José E.; Navarro, Francisco

2011-01-01

RNA polymerase (pol) II establishes many protein–protein interactions with transcriptional regulators to coordinate different steps of transcription. Although some of these interactions have been well described, little is known about the existence of RNA pol II regions involved in contact with transcriptional regulators. We hypothesize that conserved regions on the surface of RNA pol II contact transcriptional regulators. We identified such an RNA pol II conserved region that includes the majority of the “foot” domain and identified interactions of this region with Mvp1, a protein required for sorting proteins to the vacuole, and Spo14, a phospholipase D. Deletion of MVP1 and SPO14 affects the transcription of their target genes and increases phosphorylation of Ser5 in the carboxy-terminal domain (CTD). Genetic, phenotypic, and functional analyses point to a role for these proteins in transcriptional initiation and/or early elongation, consistent with their genetic interactions with CEG1, a guanylyltransferase subunit of the Saccharomyces cerevisiae capping enzyme. PMID:21954159

Active symptom control with or without chemotherapy in the treatment of patients with malignant pleural mesothelioma (MS01): a multicentre randomised trial.

PubMed

Muers, Martin F; Stephens, Richard J; Fisher, Patricia; Darlison, Liz; Higgs, Christopher M B; Lowry, Erica; Nicholson, Andrew G; O'Brien, Mary; Peake, Michael; Rudd, Robin; Snee, Michael; Steele, Jeremy; Girling, David J; Nankivell, Matthew; Pugh, Cheryl; Parmar, Mahesh K B

2008-05-17

Malignant pleural mesothelioma is almost always fatal, and few treatment options are available. Although active symptom control (ASC) has been recommended for the management of this disease, no consensus exists for the role of chemotherapy. We investigated whether the addition of chemotherapy to ASC improved survival and quality of life. 409 patients with malignant pleural mesothelioma, from 76 centres in the UK and two in Australia, were randomly assigned to ASC alone (treatment could include steroids, analgesic drugs, bronchodilators, palliative radiotherapy [n=136]); to ASC plus MVP (four cycles of mitomycin 6 mg/m2, vinblastine 6 mg/m2, and cisplatin 50 mg/m2 every 3 weeks [n=137]); or to ASC plus vinorelbine (one injection of vinorelbine 30 mg/m2 every week for 12 weeks [n=136]). Randomisation was done by minimisation, with stratification for WHO performance status, histology, and centre. Follow-up was every 3 weeks to 21 weeks after randomisation, and every 8 weeks thereafter. Because of slow accrual, the two chemotherapy groups were combined and compared with ASC alone for the primary outcome of overall survival. Analysis was by intention to treat. This study is registered, number ISRCTN54469112. At the time of analysis, 393 (96%) patients had died (ASC 132 [97%], ASC plus MVP 132 [96%], ASC plus vinorelbine 129 [95%]). Compared with ASC alone, we noted a small, non-significant survival benefit for ASC plus chemotherapy (hazard ratio [HR] 0.89 [95% CI 0.72-1.10]; p=0.29). Median survival was 7.6 months in the ASC alone group and 8.5 months in the ASC plus chemotherapy group. Exploratory analyses suggested a survival advantage for ASC plus vinorelbine compared with ASC alone (HR 0.80 [0.63-1.02]; p=0.08), with a median survival of 9.5 months. There was no evidence of a survival benefit with ASC plus MVP (HR 0.99 [0.78-1.27]; p=0.95). We observed no between-group differences in four predefined quality-of-life subscales (physical functioning, pain, dyspnoea, and global health status) at any of the assessments in the first 6 months. The addition of chemotherapy to ASC offers no significant benefits in terms of overall survival or quality of life. However, exploratory analyses suggested that vinorelbine merits further investigation.

Compendium 0f Dental Residents’ Research Projects and Literature Reviews

DTIC Science & Technology

1989-05-01

slow digestion to isolate chondrocytes by incubation at 370C in Ham’s F-12 with 0.1% collagenase for 24 h. Trypan-blue dye exclusion assay was used to...characteristics of matrix vesicle proteolipids (MVP). The MV were prepared from the growth cartilages of broiler chick epiphyses (All et al, 1970). Specific

A general target for MVPs: Unsupported and unnecessary

Treesearch

Curtis H. Flather; Gregory D. Hayward; Steven R. Beissinger; Philip A. Stephens

2011-01-01

In a recent article in TREE [1], we reviewed evidence for a consistent standardised estimate of minimum viable populations (MVPs) across taxa [2-4] and found that the universal MVP of 5000 adults advocated by Traill et al. [5] was unsupported by reanalyses of their data. We identified shortcomings in the original analyses, and found substantial uncertainty in...

Effects of Wound Bacteria on Postburn Energy Metabolism

DTIC Science & Technology

1990-01-01

The inflammatory response of the MVP-seeded wound was reduced by topical and systemic hydrocortisone treatments . This increased the incidence of...these organizations. In conducting the research described in this report, the investigators adhered to the "Guide for the Care and Use of Laboratory...Hydrocortisone Treatments .......................... 9 Active Immunization Against NVP .................. 9 Serum Antibody Measurements

Methylation variable position profiles of hMLH1 promoter CpG islands in human sporadic colorectal carcinoma.

PubMed

Huang, Qing; Huang, Jun-Fu; Zhang, Bo; Baum, Larry; Fu, Wei-Ling

2012-03-01

Aberrant hypermethylation of CpG islands (CGIs) in hMLH1 promoter regions has been well known to play an important role in the tumorigenesis of human sporadic colorectal carcinoma (SCRC). In this study, bisulfite sequencing was performed to analyze the methylation variable positions (MVPs) profiles of hMLH1 promoter CGIs in 30 clinical SCRC patients, and further analysis was carried out to evaluate the associations between the CGI methylation and the clinicopathological features in SCRC. Among the 2 CGIs in the hMLH1 promoter, that is, CGI-I and CGI-II, 20% (6/30) and 13% (4/30) of the patients had methylated CGI-I and CGI-II, respectively. Suppressed expression of hMLH1was significantly correlated with methylation of CGI-I but not CGI-II. Further analysis of the MVP profiles of CGI-I showed that most of the MVPs were hypermethylated and others were poorly methylated or unmethylated. The profiles could be classified into at least 4 groups based on the methylation status of 3 MVPs at positions 21 to 23 in CGI-I. All 6 patients with methylated CGI-I belonged to group I. This result suggests that the above 3 MVPs in CGI-I should be a targeted region to further analyze the epigenetic features of hMLH1 in human SCRC. Our results further suggest that MVP profiling is useful for identifying the aberrantly methylated CGIs associated with suppressed gene expression.

Method to Reduce Long-lived Fission Products by Nuclear Transmutations with Fast Spectrum Reactors.

PubMed

Chiba, Satoshi; Wakabayashi, Toshio; Tachi, Yoshiaki; Takaki, Naoyuki; Terashima, Atsunori; Okumura, Shin; Yoshida, Tadashi

2017-10-24

Transmutation of long-lived fission products (LLFPs: 79 Se, 93 Zr, 99 Tc, 107 Pd, 129 I, and 135 Cs) into short-lived or non-radioactive nuclides by fast neutron spectrum reactors without isotope separation has been proposed as a solution to the problem of radioactive wastes disposal. Despite investigation of many methods, such transmutation remains technologically difficult. To establish an effective and efficient transmutation system, we propose a novel neutron moderator material, yttrium deuteride (YD 2 ), to soften the neutron spectrum leaking from the reactor core. Neutron energy spectra and effective half-lives of LLFPs, transmutation rates, and support ratios were evaluated with the continuous-energy Monte Carlo code MVP-II/MVP-BURN and the JENDL-4.0 cross section library. With the YD 2 moderator in the radial blanket and shield regions, effective half-lives drastically decreased from 106 to 102 years and the support ratios reached 1.0 for all six LLFPs. This successful development and implementation of a transmutation system for LLFPs without isotope separation contributes to a the ability of fast spectrum reactors to reduce radioactive waste by consuming their own LLFPs.

Knowledge Management for Command and Control

DTIC Science & Technology

2004-06-01

interfaces relies on rich visual and conceptual understanding of what is sketched, rather than the pattern-recognition technologies that most systems use...recognizers) required by other approaches. • The underlying conceptual representations that nuSketch uses enable it to serve as a front end to knowledge...constructing enemy-intent hypotheses via mixed visual and conceptual analogies. II.C. Multi-ViewPoint Clustering Analysis (MVP-CA) technology To

Impact of bileaflet mitral valve prolapse on quantification of mitral regurgitation with cardiac magnetic resonance: a single-center study.

PubMed

Vincenti, Gabriella; Masci, Pier Giorgio; Rutz, Tobias; De Blois, Jonathan; Prša, Milan; Jeanrenaud, Xavier; Schwitter, Juerg; Monney, Pierre

2017-07-27

To quantify mitral regurgitation (MR) with CMR, the regurgitant volume can be calculated as the difference between the left ventricular (LV) stroke volume (SV) measured with the Simpson's method and the reference SV, i.e. the right ventricular SV (RVSV) in patients without tricuspid regurgitation. However, for patients with prominent mitral valve prolapse (MVP), the Simpson's method may underestimate the LV end-systolic volume (LVESV) as it only considers the volume located between the apex and the mitral annulus, and neglects the ventricular volume that is displaced into the left atrium but contained within the prolapsed mitral leaflets at end systole. This may lead to an underestimation of LVESV, and resulting an over-estimation of LVSV, and an over-estimation of mitral regurgitation. The aim of the present study was to assess the impact of prominent MVP on MR quantification by CMR. In patients with MVP (and no more than trace tricuspid regurgitation) MR was quantified by calculating the regurgitant volume as the difference between LVSV and RVSV. LVSV uncorr was calculated conventionally as LV end-diastolic (LVEDV) minus LVESV. A corrected LVESV corr was calculated as the LVESV plus the prolapsed volume, i.e. the volume between the mitral annulus and the prolapsing mitral leaflets. The 2 methods were compared with respect to the MR grading. MR grades were defined as absent or trace, mild (5-29% regurgitant fraction (RF)), moderate (30-49% RF), or severe (≥50% RF). In 35 patients (44.0 ± 23.0y, 14 males, 20 patients with MR) the prolapsed volume was 16.5 ± 8.7 ml. The 2 methods were concordant in only 12 (34%) patients, as the uncorrected method indicated a 1-grade higher MR severity in 23 (66%) patients. For the uncorrected/corrected method, the distribution of the MR grades as absent-trace (0 vs 11, respectively), mild (20 vs 18, respectively), moderate (11 vs 5, respectively), and severe (4 vs 1, respectively) was significantly different (p < 0.001). In the subgroup without MR, LVSV corr was not significantly different from RVSV (difference: 2.5 ± 4.7 ml, p = 0.11 vs 0) while a systematic overestimation was observed with LVSV uncorr (difference: 16.9 ± 9.1 ml, p = 0.0007 vs 0). Also, RVSV was highly correlated with aortic forward flow (n = 24, R 2  = 0.97, p < 0.001). For patients with severe bileaflet prolapse, the correction of the LVSV for the prolapse volume is suggested as it modified the assessment of MR severity by one grade in a large portion of patients.

Colorful Packages: Encapsulation of Fluorescent Proteins in Complex Coacervate Core Micelles

PubMed Central

Westphal, Adrie H.; Kleijn, J. Mieke; Borst, Jan Willem

2017-01-01

Encapsulation of proteins can be beneficial for food and biomedical applications. To study their biophysical properties in complex coacervate core micelles (C3Ms), we previously encapsulated enhanced green fluorescent protein (EGFP) and its monomeric variant, mEGFP, with the cationic-neutral diblock copolymer poly(2-methyl-vinyl-pyridinium)n-b-poly(ethylene-oxide)m (P2MVPn-b-PEOm) as enveloping material. C3Ms with high packaging densities of fluorescent proteins (FPs) were obtained, resulting in a restricted orientational freedom of the protein molecules, influencing their structural and spectral properties. To address the generality of this behavior, we encapsulated seven FPs with P2MVP41-b-PEO205 and P2MVP128-b-PEO477. Dynamic light scattering and fluorescence correlation spectroscopy showed lower encapsulation efficiencies for members of the Anthozoa class (anFPs) than for Hydrozoa FPs derived from Aequorea victoria (avFPs). Far-UV CD spectra of the free FPs showed remarkable differences between avFPs and anFPs, caused by rounder barrel structures for avFPs and more elliptic ones for anFPs. These structural differences, along with the differences in charge distribution, might explain the variations in encapsulation efficiency between avFPs and anFPs. Furthermore, the avFPs remain monomeric in C3Ms with minor spectral and structural changes. In contrast, the encapsulation of anFPs gives rise to decreased quantum yields (monomeric Kusabira Orange 2 (mKO2) and Tag red fluorescent protein (TagRFP)) or to a pKa shift of the chromophore (FP variant mCherry). PMID:28753915

Novel Rechargeable M3V2(PO4)3//Zinc (M = Li, Na) Hybrid Aqueous Batteries with Excellent Cycling Performance

NASA Astrophysics Data System (ADS)

Zhao, H. B.; Hu, C. J.; Cheng, H. W.; Fang, J. H.; Xie, Y. P.; Fang, W. Y.; Doan, T. N. L.; Hoang, T. K. A.; Xu, J. Q.; Chen, P.

2016-05-01

A rechargeable hybrid aqueous battery (ReHAB) containing NASICON-type M3V2(PO4)3 (M = Li, Na) as the cathodes and Zinc metal as the anode, working in Li2SO4-ZnSO4 aqueous electrolyte, has been studied. Both of Li3V2(PO4)3 and Na3V2(PO4)3 cathodes can be reversibly charge/discharge with the initial discharge capacity of 128 mAh g-1 and 96 mAh g-1 at 0.2C, respectively, with high up to 84% of capacity retention ratio after 200 cycles. The electrochemical assisted ex-XRD confirm that Li3V2(PO4)3 and Na3V2(PO4)3 are relative stable in aqueous electrolyte, and Na3V2(PO4)3 showed more complicated electrochemical mechanism due to the co-insertion of Li+ and Na+. The effect of pH of aqueous electrolyte and the dendrite of Zn on the cycling performance of as designed MVP/Zn ReHABs were investigated, and weak acidic aqueous electrolyte with pH around 4.0-4.5 was optimized. The float current test confirmed that the designed batteries are stable in aqueous electrolytes. The MVP//Zn ReHABs could be a potential candidate for future rechargeable aqueous battery due to their high safety, fast dynamic speed and adaptable electrochemical window. Moreover, this hybrid battery broadens the scope of battery material research from single-ion-involving to double-ions -involving rechargeable batteries.

Modified loop technique in three dogs with mitral regurgitation.

PubMed

Aoki, Takuma; Fujii, Yoko; Sunahara, Hiroshi; Takano, Hiroshi; Wakao, Yoshito

2013-01-31

Mitral valvuloplasty (MVP) is used in dogs with refractory mitral regurgitation (MR); however, it is difficult to tie the artificial chord, i.e., the expanded polytetrafluoroethylene suture, at the planned height of the mitral valve, because of the slippery nature of the knot. The loop technique has resolved these difficulties in humans. Premanufactured loops (length, 8.0-15.0 mm with 1.0-mm increments) were used in the new modified loop technique. In the current study, cardiac murmurs disappeared, and the MR markedly improved or completely disappeared approximately 3 months after surgery in 3 dogs. Therefore, this new technique might be effective in dogs.

Defense Task Force on Domestic Violence

DTIC Science & Technology

2001-02-28

problem in the following areas: • Ongoing victim safety programs Domestic Violence is an offense against the institutional values of the Military Services...All the courses have a family advocacy briefing. The Marine Corps has instituted a Mentors in Violence Prevention (MVP) program in a train-the- trainer...medicine, primary care, and obstetrics /gynecology. • Require NPSP nurses to have domestic violence awareness education within 90 days of their hiring

Enabling Technologies for Advanced Soft Tissue Modeling

DTIC Science & Technology

2005-09-01

improvements 51 vivo. They also note that the in vivo condition had more to the system for future measurements. The ex vivo 107 recovery between indentations...engineering design via SolidWorks and computer-controlled milling machines (using CamWorks), managed undergraduate teaching fellows ES149 " Muscles ...2002-present (over 100 members, raised $18k) and team MVP (2004), Collegiate National Championship Div 1 competitor (2002-4), organized 100 person

The measles virus phosphoprotein interacts with the linker domain of STAT1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devaux, Patricia, E-mail: devaux.patricia@mayo.edu; Priniski, Lauren; Cattaneo, Roberto

2013-09-15

The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainlymore » to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.« less

Miniature Variable Pressure Scanning Electron Microscope for In-Situ Imaging and Chemical Analysis

NASA Technical Reports Server (NTRS)

Gaskin, Jessica A.; Jerman, Gregory; Gregory, Don; Sampson, Allen R.

2012-01-01

NASA Marshall Space Flight Center (MSFC) is leading an effort to develop a Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM) for in-situ imaging and chemical analysis of uncoated samples. This instrument development will be geared towards operation on Mars and builds on a previous MSFC design of a mini-SEM for the moon (funded through the NASA Planetary Instrument Definition and Development Program). Because Mars has a dramatically different environment than the moon, modifications to the MSFC lunar mini-SEM are necessary. Mainly, the higher atmospheric pressure calls for the use of an electron gun that can operate at High Vacuum, rather than Ultra-High Vacuum. The presence of a CO2-rich atmosphere also allows for the incorporation of a variable pressure system that enables the in-situ analysis of nonconductive geological specimens. Preliminary testing of Mars meteorites in a commercial Environmental SEM(Tradmark) (FEI) confirms the usefulness of lowcurrent/low-accelerating voltage imaging and highlights the advantages of using the Mars atmosphere for environmental imaging. The unique capabilities of the MVP-SEM make it an ideal tool for pursuing key scientific goals of NASA's Flagship Mission Max-C; to perform in-situ science and collect and cache samples in preparation for sample return from Mars.

Optimizing Maintenance Manpower for USMC F/A-18 Squadrons

DTIC Science & Technology

2016-06-01

experience level, with the requirement of keeping a standard number of aircraft operationally ready. MVP results show areas of deficit, either manpower ...MAINTENANCE MANPOWER FOR USMC F/A-18 SQUADRONS by Kevin J. Goodwin June 2016 Thesis Co-Advisors: W. Matthew Carlyle Robert F. Dell Second...REPORT TYPE AND DATES COVERED Master’s thesis 4. TITLE AND SUBTITLE OPTIMIZING MAINTENANCE MANPOWER FOR USMC F/A-18 SQUADRONS 5. FUNDING NUMBERS 6

A pilot study and novel angiographic classification for superior sagittal sinus stenting in patients with non-thrombotic intracranial venous occlusive disease.

PubMed

Raper, Daniel M S; Buell, Thomas J; Ding, Dale; Pomeraniec, I Jonathan; Crowley, R Webster; Liu, Kenneth C

2018-01-01

Safety and efficacy of superior sagittal sinus (SSS) stenting for non-thrombotic intracranial venous occlusive disease (VOD) is unknown. The aim of this retrospective cohort study is to evaluate outcomes after SSS stenting. We evaluated an institutional database to identify patients who underwent SSS stenting. Radiographic and clinical outcomes were analyzed and a novel angiographic classification of the SSS was proposed. We identified 19 patients; 42% developed SSS stenosis after transverse sinus stenting. Pre-stent maximum mean venous pressure (MVP) in the SSS of 16.2 mm Hg decreased to 13.1 mm Hg after stenting (p=0.037). Preoperative trans-stenosis pressure gradient of 4.2 mm Hg decreased to 1.5 mm Hg after stenting (p<0.001). No intraprocedural complication or junctional SSS stenosis distal to the stent construct was noted. Improvement in headache, tinnitus, and visual obscurations was reported by 66.7%, 63.6%, and 50% of affected patients, respectively, at mean follow-up of 5.2 months. We divided the SSS into four anatomically equal segments, numbered S1-S4, from the torcula to frontal pole. SSS stenosis typically occurs in the S1 segment, and the anterior extent of SSS stents was deployed at the S1-S2 junction in all but one case. SSS stenting is reasonably safe, may improve clinical symptoms, and significantly reduces maximum MVP and trans-stenosis pressure gradients in patients with VOD with SSS stenosis. The S1 segment is most commonly stenotic, and minimum pressure gradients for symptomatic SSS stenosis may be lower than for transverse or sigmoid stenosis. Additional studies and follow-up are necessary to better elucidate appropriate clinical indications and long-term efficacy of SSS stenting. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Progress Toward Development of a Multichannel Vestibular Prosthesis for Treatment of Bilateral Vestibular Deficiency

PubMed Central

FRIDMAN, GENE Y.; DELLA SANTINA, CHARLES C.

2014-01-01

This article reviews vestibular pathology and the requirements and progress made in the design and construction of a vestibular prosthesis. Bilateral loss of vestibular sensation is disabling. When vestibular hair cells are injured by ototoxic medications or other insults to the labyrinth, the resulting loss of sensory input disrupts vestibulo-ocular reflexes (VORs) and vestibulo-spinal reflexes that normally stabilize the eyes and body. Affected individuals suffer poor vision during head movement, postural instability, chronic disequilibrium, and cognitive distraction. Although most individuals with residual sensation compensate for their loss over time, others fail to do so and have no adequate treatment options. A vestibular prosthesis analogous to cochlear implants but designed to modulate vestibular nerve activity during head movement should improve quality of life for these chronically dizzy individuals. We describe the impact of bilateral loss of vestibular sensation, animal studies supporting feasibility of prosthetic vestibular stimulation, the current status of multichannel vestibular sensory replacement prosthesis development, and challenges to successfully realizing this approach in clinical practice. In bilaterally vestibular-deficient rodents and rhesus monkeys, the Johns Hopkins multichannel vestibular prosthesis (MVP) partially restores the three-dimensional (3D) VOR for head rotations about any axis. Attempts at prosthetic vestibular stimulation of humans have not yet included the 3D eye movement assays necessary to accurately evaluate VOR alignment, but these initial forays have revealed responses that are otherwise comparable to observations in animals. Current efforts now focus on refining electrode design and surgical technique to enhance stimulus selectivity and preserve cochlear function, optimizing stimulus protocols to improve dynamic range and reduce excitation–inhibition asymmetry, and adapting laboratory MVP prototypes into devices appropriate for use in clinical trials. PMID:23044664

Novel Rechargeable M3V2(PO4)3//Zinc (M = Li, Na) Hybrid Aqueous Batteries with Excellent Cycling Performance

PubMed Central

Zhao, H. B.; Hu, C. J.; Cheng, H. W.; Fang, J. H.; Xie, Y. P.; Fang, W. Y.; Doan, T. N. L.; Hoang, T. K. A.; Xu, J. Q.; Chen, P.

2016-01-01

A rechargeable hybrid aqueous battery (ReHAB) containing NASICON-type M3V2(PO4)3 (M = Li, Na) as the cathodes and Zinc metal as the anode, working in Li2SO4-ZnSO4 aqueous electrolyte, has been studied. Both of Li3V2(PO4)3 and Na3V2(PO4)3 cathodes can be reversibly charge/discharge with the initial discharge capacity of 128 mAh g−1 and 96 mAh g−1 at 0.2C, respectively, with high up to 84% of capacity retention ratio after 200 cycles. The electrochemical assisted ex-XRD confirm that Li3V2(PO4)3 and Na3V2(PO4)3 are relative stable in aqueous electrolyte, and Na3V2(PO4)3 showed more complicated electrochemical mechanism due to the co-insertion of Li+ and Na+. The effect of pH of aqueous electrolyte and the dendrite of Zn on the cycling performance of as designed MVP/Zn ReHABs were investigated, and weak acidic aqueous electrolyte with pH around 4.0–4.5 was optimized. The float current test confirmed that the designed batteries are stable in aqueous electrolytes. The MVP//Zn ReHABs could be a potential candidate for future rechargeable aqueous battery due to their high safety, fast dynamic speed and adaptable electrochemical window. Moreover, this hybrid battery broadens the scope of battery material research from single-ion-involving to double-ions -involving rechargeable batteries. PMID:27174224

Vision function testing for a suprachoroidal retinal prosthesis: effects of image filtering

NASA Astrophysics Data System (ADS)

Barnes, Nick; Scott, Adele F.; Lieby, Paulette; Petoe, Matthew A.; McCarthy, Chris; Stacey, Ashley; Ayton, Lauren N.; Sinclair, Nicholas C.; Shivdasani, Mohit N.; Lovell, Nigel H.; McDermott, Hugh J.; Walker, Janine G.; BVA Consortium,the

2016-06-01

Objective. One strategy to improve the effectiveness of prosthetic vision devices is to process incoming images to ensure that key information can be perceived by the user. This paper presents the first comprehensive results of vision function testing for a suprachoroidal retinal prosthetic device utilizing of 20 stimulating electrodes. Further, we investigate whether using image filtering can improve results on a light localization task for implanted participants compared to minimal vision processing. No controlled implanted participant studies have yet investigated whether vision processing methods that are not task-specific can lead to improved results. Approach. Three participants with profound vision loss from retinitis pigmentosa were implanted with a suprachoroidal retinal prosthesis. All three completed multiple trials of a light localization test, and one participant completed multiple trials of acuity tests. The visual representations used were: Lanczos2 (a high quality Nyquist bandlimited downsampling filter); minimal vision processing (MVP); wide view regional averaging filtering (WV); scrambled; and, system off. Main results. Using Lanczos2, all three participants successfully completed a light localization task and obtained a significantly higher percentage of correct responses than using MVP (p≤slant 0.025) or with system off (p\\lt 0.0001). Further, in a preliminary result using Lanczos2, one participant successfully completed grating acuity and Landolt C tasks, and showed significantly better performance (p=0.004) compared to WV, scrambled and system off on the grating acuity task. Significance. Participants successfully completed vision tasks using a 20 electrode suprachoroidal retinal prosthesis. Vision processing with a Nyquist bandlimited image filter has shown an advantage for a light localization task. This result suggests that this and targeted, more advanced vision processing schemes may become important components of retinal prostheses to enhance performance. ClinicalTrials.gov Identifier: NCT01603576.

Working set selection using functional gain for LS-SVM.

PubMed

Bo, Liefeng; Jiao, Licheng; Wang, Ling

2007-09-01

The efficiency of sequential minimal optimization (SMO) depends strongly on the working set selection. This letter shows how the improvement of SMO in each iteration, named the functional gain (FG), is used to select the working set for least squares support vector machine (LS-SVM). We prove the convergence of the proposed method and give some theoretical support for its performance. Empirical comparisons demonstrate that our method is superior to the maximum violating pair (MVP) working set selection.

Ethical Challenges and Lessons Learned During the Clinical Development of a Group A Meningococcal Conjugate Vaccine.

PubMed

Martellet, Lionel; Sow, Samba O; Diallo, Aldiouma; Hodgson, Abraham; Kampmann, Beate; Hirve, Siddhivinayak; Tapia, Milagritos; Haidara, Fadima Cheick; Ndiaye, Assane; Diarra, Bou; Ansah, Patrick Odum; Akinsola, Adebayo; Idoko, Olubukola T; Adegbola, Richard A; Bavdekar, Ashish; Juvekar, Sanjay; Viviani, Simonetta; Enwere, Godwin C; Marchetti, Elisa; Chaumont, Julie; Makadi, Marie-Francoise; Pallardy, Flore; Kulkarni, Prasad S; Preziosi, Marie-Pierre; LaForce, F Marc

2015-11-15

The group A meningococcal vaccine (PsA-TT) clinical development plan included clinical trials in India and in the West African region between 2005 and 2013. During this period, the Meningitis Vaccine Project (MVP) accumulated substantial experience in the ethical conduct of research to the highest standards. Because of the public-private nature of the sponsorship of these trials and the extensive international collaboration with partners from a diverse setting of countries, the ethical review process was complex and required strategic, timely, and attentive communication to ensure the smooth review and approval for the clinical studies. Investigators and their site teams fostered strong community relationships prior to, during, and after the studies to ensure the involvement and the ownership of the research by the participating populations. As the clinical work proceeded, investigators and sponsors responded to specific questions of informed consent, pregnancy testing, healthcare, disease prevention, and posttrial access. Key factors that led to success included (1) constant dialogue between partners to explore and answer all ethical questions; (2) alertness and preparedness for emerging ethical questions during the research and in the context of evolving international ethics standards; and (3) care to assure that approaches were acceptable in the diverse community contexts. Many of the ethical issues encountered during the PsA-TT clinical development are familiar to groups conducting field trials in different cultural settings. The successful approaches used by the MVP clinical team offer useful examples of how these problems were resolved. ISRCTN17662153 (PsA-TT-001); ISRTCN78147026 (PsA-TT-002); ISRCTN87739946 (PsA-TT-003); ISRCTN46335400 (PsA-TT-003a); ISRCTN82484612 (PsA-TT-004); CTRI/2009/091/000368 (PsA-TT-005); PACTR ATMR2010030001913177 (PsA-TT-006); PACTR201110000328305 (PsA-TT-007). © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Evaluation of low-cost, objective instruments for assessing physical activity in 10-11-year-old children.

PubMed

Hart, Teresa L; Brusseau, Timothy; Kulinna, Pamela Hodges; McClain, James J; Tudor-Locke, Catrine

2011-12-01

This study compared step counts detected by four, low-cost, objective, physical-activity-assessment instruments and evaluated their ability to detect moderate-to-vigorous physical activity (MVPA) compared to the ActiGraph accelerometer (AG). Thirty-six 10-11-year-old children wore the NL-1000, Yamax Digiwalker SW 200, Omron HJ-151, and Walk4Life MVP concurrently with the AG during school hours on a single day. AG MVPA was derived from activity count data using previously validated cut points. Two of the evaluated instruments provided similar group mean MVPA and step counts compared to AG (dependent on cut point). Low-cost instruments may be useful for measurement of both MVPA and steps in children's physical activity interventions and program evaluation.

Energy harvesting influences electrochemical performance of microbial fuel cells

NASA Astrophysics Data System (ADS)

Lobo, Fernanda Leite; Wang, Xin; Ren, Zhiyong Jason

2017-07-01

Microbial fuel cells (MFCs) can be effective power sources for remote sensing, wastewater treatment and environmental remediation, but their performance needs significant improvement. This study systematically analyzes how active harvesting using electrical circuits increased MFC system outputs as compared to passive resistors not only in the traditional maximal power point (MPP) but also in other desired operating points such as the maximum current point (MCP) and the maximum voltage point (MVP). Results show that active harvesting in MPP increased power output by 81-375% and active harvesting in MCP increased Coulombic efficiency by 207-805% compared with resisters operated at the same points. The cyclic voltammograms revealed redox potential shifts and supported the performance data. The findings demonstrate that active harvesting is a very effective approach to improve MFC performance across different operating points.

Brain glucose metabolism in diffuse large B-cell lymphoma patients as assessed with FDG-PET: impact on outcome and chemotherapy effects.

PubMed

Adams, Hugo Ja; de Klerk, John Mh; Fijnheer, Rob; Heggelman, Ben Gf; Dubois, Stefan V; Nievelstein, Rutger Aj; Kwee, Thomas C

2016-06-01

There is a lack of data on the effect of rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) therapy on brain glucose metabolism of diffuse large B-cell lymphoma (DLBCL) patients, as measured by 18F-fluoro-2-deoxy-D-glucose positron emission tomography (FDG-PET). Moreover, the prognostic value of brain glucose metabolism measurements is currently unknown. To investigate the use of FDG-PET for measurement of brain glucose metabolism in R-CHOP-treated DLBCL patients, and to assess its prognostic value. This retrospective study included DLBCL patients who underwent FDG-PET including the brain. FDG-PET metabolic volume products (MVPs) of the entire brain, cerebral cortex, basal ganglia, and cerebellum were measured, before and after R-CHOP therapy. Whole-body total lesion glycolysis (TLG) was also measured. Thirty-eight patients were included, of whom 18 had an appropriate end-of-treatment FDG-PET scan. There were no significant differences (P > 0.199) between pre- and post-treatment brain glucose metabolism metrics. Low basal ganglia MVP was associated with a significantly worse progression-free survival (PFS) and overall survival (OS) (P = 0.020 and P = 0.032), and low cerebellar MVP was associated with a significantly worse OS (P = 0.034). There were non-significant very weak correlations between pretreatment brain glucose metabolism metrics and TLG. In the multivariate Cox regression, only the National Comprehensive Cancer Network International Prognostic Index (NCCN-IPI) remained an independent predictor of PFS (hazard ratio 3.787, P = 0.007) and OS (hazard ratio 2.903, P = 0.0345). Brain glucose metabolism was not affected by R-CHOP therapy. Low pretreatment brain glucose metabolism was associated with a worse outcome, but did not surpass the predictive value of the NCCN-IPI. © The Foundation Acta Radiologica 2015.

Current and Future Management of Bilateral Loss of Vestibular Sensation – An update on the Johns Hopkins Multichannel Vestibular Prosthesis Project

PubMed Central

Della Santina, Charles C.; Migliaccio, Americo A.; Hayden, Russell; Melvin, Thuy-Anh; Fridman, Gene Y.; Chiang, Bryce; Davidovics, Natan S.; Dai, Chenkai; Carey, John P.; Minor, Lloyd B.; Anderson, Iee-Ching; Park, HongJu; Lyford-Pike, Sofia; Tang, Shan

2012-01-01

Bilateral loss of vestibular sensation can disable individuals whose vestibular hair cells are injured by ototoxic medications, infection, Ménière’s disease or other insults to the labyrinth including surgical trauma during cochlear implantation. Without input to vestibulo-ocular and vestibulo-spinal reflexes that normally stabilize the eyes and body, affected patients suffer blurred vision during head movement, postural instability, and chronic disequilibrium. While individuals with some residual sensation often compensate for their loss through rehabilitation exercises, those who fail to do so are left with no adequate treatment options. An implantable neuroelectronic vestibular prosthesis that emulates the normal labyrinth by sensing head movement and modulating activity on appropriate branches of the vestibular nerve could significantly improve quality of life for these otherwise chronically dizzy patients. This brief review describes the impact and current management of bilateral loss of vestibular sensation, animal studies supporting the feasibility of prosthetic vestibular stimulation, and a vestibular prosthesis designed to restore sensation of head rotation in all directions. Similar to a cochlear implant in concept and size, the Johns Hopkins Multichannel Vestibular Prosthesis (MVP) includes miniature gyroscopes to sense head rotation, a microcontroller to process inputs and control stimulus timing, and current sources switched between pairs of electrodes implanted within the vestibular labyrinth. In rodents and rhesus monkeys rendered bilaterally vestibular-deficient via treatment with gentamicin and/or plugging of semicircular canals, the MVP partially restores the vestibulo-ocular reflex for head rotations about any axis of rotation in 3-dimensional space. Our efforts now focus on addressing issues prerequisite to human implantation, including refinement of electrode designs and surgical technique to enhance stimulus selectivity and preserve cochlear function, optimization of stimulus protocols, and reduction of device size and power consumption. PMID:21756683

Multi-viewpoint clustering analysis

NASA Technical Reports Server (NTRS)

Mehrotra, Mala; Wild, Chris

1993-01-01

In this paper, we address the feasibility of partitioning rule-based systems into a number of meaningful units to enhance the comprehensibility, maintainability and reliability of expert systems software. Preliminary results have shown that no single structuring principle or abstraction hierarchy is sufficient to understand complex knowledge bases. We therefore propose the Multi View Point - Clustering Analysis (MVP-CA) methodology to provide multiple views of the same expert system. We present the results of using this approach to partition a deployed knowledge-based system that navigates the Space Shuttle's entry. We also discuss the impact of this approach on verification and validation of knowledge-based systems.

The midgut transcriptome of Lutzomyia longipalpis: comparative analysis of cDNA libraries from sugar-fed, blood-fed, post-digested and Leishmania infantum chagasi-infected sand flies.

PubMed

Jochim, Ryan C; Teixeira, Clarissa R; Laughinghouse, Andre; Mu, Jianbing; Oliveira, Fabiano; Gomes, Regis B; Elnaiem, Dia-Eldin; Valenzuela, Jesus G

2008-01-14

In the life cycle of Leishmania within the alimentary canal of sand flies the parasites have to survive the hostile environment of blood meal digestion, escape the blood bolus and attach to the midgut epithelium before differentiating into the infective metacyclic stages. The molecular interactions between the Leishmania parasites and the gut of the sand fly are poorly understood. In the present work we sequenced five cDNA libraries constructed from midgut tissue from the sand fly Lutzomyia longipalpis and analyzed the transcripts present following sugar feeding, blood feeding and after the blood meal has been processed and excreted, both in the presence and absence of Leishmania infantum chagasi. Comparative analysis of the transcripts from sugar-fed and blood-fed cDNA libraries resulted in the identification of transcripts differentially expressed during blood feeding. This included upregulated transcripts such as four distinct microvillar-like proteins (LuloMVP1, 2, 4 and 5), two peritrophin like proteins, a trypsin like protein (Lltryp1), two chymotrypsin like proteins (LuloChym1A and 2) and an unknown protein. Downregulated transcripts by blood feeding were a microvillar-like protein (LuloMVP3), a trypsin like protein (Lltryp2) and an astacin-like metalloprotease (LuloAstacin). Furthermore, a comparative analysis between blood-fed and Leishmania infected midgut cDNA libraries resulted in the identification of the transcripts that were differentially expressed due to the presence of Leishmania in the gut of the sand fly. This included down regulated transcripts such as four microvillar-like proteins (LuloMVP1,2, 4 and 5), a Chymotrypsin (LuloChym1A) and a carboxypeptidase (LuloCpepA1), among others. Upregulated midgut transcripts in the presence of Leishmania were a peritrophin like protein (LuloPer1), a trypsin-like protein (Lltryp2) and an unknown protein. This transcriptome analysis represents the largest set of sequence data reported from a specific sand fly tissue and provides further information of the transcripts present in the sand fly Lutzomyia longipalpis. This analysis provides the detailed information of molecules present in the midgut of this sand fly and the transcripts potentially modulated by blood feeding and by the presence of the Leishmania parasite. More importantly, this analysis suggests that Leishmania infantum chagasi alters the expression profile of certain midgut transcripts in the sand fly during blood meal digestion and that this modulation may be relevant for the survival and establishment of the parasite in the gut of the fly. Moreover, this analysis suggests that these changes may be occurring during the digestion of the blood meal and not afterwards.

The Tyrrhena-Malea Volcanic Province, Mars: Overview

NASA Astrophysics Data System (ADS)

Williams, D.; Greeley, R.; Ferguson, R.; Kuzmin, R.; McCord, T.; Combe, J.-P.; Head, J.; Xiao, L.; Manfredi, L.; Poulet, F.; Pinet, P.; Baratoux, D.; Plaut, J. J.; Raitala, J.; Neukum, G.

2008-09-01

Building on previous studies of volcanoes around the Hellas basin with new studies of imaging (HRSC, THEMIS, MOC, HiRISE, CTX), multispectral (HRSC, OMEGA), topographic (MOLA) and gravity data, we define a new Martian volcanic province as the Tyrrhena-Malea Volcanic Province (T-MVP). With an area of >2.1 million sq. km, it contains the six oldest central vent volcanoes on Mars, which formed after the Hellas impact basin, between 4.0 to 3.6 Ga. These volcanoes mark a transition from the flood volcanism that formed Malea Planum ~3.8 Ga, to localized point source eruptions. The T-MVP volcanoes have two general morphologies: 1) shieldlike edifices (Tyrrhena, Hadriaca, and Amphitrites Paterae), and 2) caldera-like depressions surrounded by ridged plains (Peneus, Malea, and Pityusa Paterae). Positive gravity anomalies are found at Tyrrhena, Hadriaca, and Amphitrites, perhaps indicative of dense magma bodies below the surface. The lack of shield-like edifices and weak gravity anomalies at Peneus, Malea, and Pityusa suggest a fundamental difference in their formation, styles of eruption, and/or compositions. The northernmost volcanoes, the ~3.7- 3.9 Ga Tyrrhena and Hadriaca Paterae, have low slopes, well-channeled flanks, and smooth caldera floors (at tens of meters/pixel scale), indicative of ash shields formed from poorly-consolidated pyroclastic deposits that have been modified by fluvial and aeolian erosion and deposition. The ~3.6 Ga Amphitrites Patera also has a well-channeled flank, but it and the ~3.8 Ga Peneus Patera are dominated by scalloped and pitted terrain, pedestal and ejecta flow craters, and a general `softened' appearance. This morphology is indicative not only of surface materials subjected to periglacial processes involving water ice, but also of a surface composed of easily eroded materials such as ash and dust. The southernmost volcanoes, the ~3.8 Ga Malea and Pityusa Paterae, have no channeled flanks, no scalloped and pitted terrain, and lack the `softened' appearance of their surfaces, but they do contain pedestal and ejecta flow craters and large, smooth, bright plateaus in their central depressions. This morphology is indicative of a surface with not only a high water ice content, but also a more consolidated material that is less susceptible to degradation (relative to the other four volcanoes). We suggest that Malea and Pityusa (and possibly Peneus) Paterae are Martian equivalents to Earth's giant calderas (e.g., Yellowstone, Long Valley) that erupted large volumes of volcanic materials, and that Malea and Pityusa are probably composed of either lava flows or ignimbrites. HRSC and OMEGA spectral data indicate that dark gray to slightly red materials (often represented as blue or black pixels in HRSC color images), found in the patera floors and topographic lows throughout the T-MVP, have a basaltic composition. A key issue is whether this dark material represents concentrations of underlying basaltic material exposed by aeolian winnowing, or if the material was transported from elsewhere on Mars by regional winds. Understanding the provenance of these dark materials may be the key to understanding the volcanic diversity of the Tyrrhena-Malea Volcanic Province. References [1] Crown, D. and Greeley, R. (2007) U.S. Geol. Surv. Sci. Inves. Ser. Map 2936. [2] Gregg, T., et al. (1998) U.S. Geol. Surv. Map I- 2556. [3] Leonard, G. and Tanaka, K. (2001) U. S. Geol. Survey Misc. Invest. Series Map I-2694. [4] Kolb, E. and Tanaka, K. (2008) Geologic Map of the Planum Australe Region of Mars. U. S. Geol. Survey. Misc. Investigation Series, in review. [5] Peterson, J. (1978) Proc. 9th LPSC, 3411-3432.

Sparsely-distributed organization of face and limb activations in human ventral temporal cortex

PubMed Central

Weiner, Kevin S.; Grill-Spector, Kalanit

2011-01-01

Functional magnetic resonance imaging (fMRI) has identified face- and body part-selective regions, as well as distributed activation patterns for object categories across human ventral temporal cortex (VTC), eliciting a debate regarding functional organization in VTC and neural coding of object categories. Using high-resolution fMRI, we illustrate that face- and limb-selective activations alternate in a series of largely nonoverlapping clusters in lateral VTC along the inferior occipital gyrus (IOG), fusiform gyrus (FG), and occipitotemporal sulcus (OTS). Both general linear model (GLM) and multivoxel pattern (MVP) analyses show that face- and limb-selective activations minimally overlap and that this organization is consistent across experiments and days. We provide a reliable method to separate two face-selective clusters on the middle and posterior FG (mFus and pFus), and another on the IOG using their spatial relation to limb-selective activations and retinotopic areas hV4, VO-1/2, and hMT+. Furthermore, these activations show a gradient of increasing face selectivity and decreasing limb selectivity from the IOG to the mFus. Finally, MVP analyses indicate that there is differential information for faces in lateral VTC (containing weakly- and highly-selective voxels) relative to non-selective voxels in medial VTC. These findings suggest a sparsely-distributed organization where sparseness refers to the presence of several face- and limb-selective clusters in VTC, and distributed refers to the presence of different amounts of information in highly-, weakly-, and non-selective voxels. Consequently, theories of object recognition should consider the functional and spatial constraints of neural coding across a series of nonoverlapping category-selective clusters that are themselves distributed. PMID:20457261

Effects of zoledronic acid and geranylgeraniol on the cellular behaviour and gene expression of primary human alveolar osteoblasts.

PubMed

Zafar, S; Coates, D E; Cullinan, M P; Drummond, B K; Milne, T; Seymour, G J

2016-11-01

Bisphosphonate-related osteonecrosis of the jaw (BRONJ) is a serious complication of bisphosphonate therapy. The mechanism underlying BRONJ pathogenesis is poorly understood. To determine the effects of zoledronic acid (ZA) and geranylgeraniol (GGOH) on the mevalonate pathway (MVP) in osteoblasts generated from the human mandibular alveolar bone in terms of cell viability/proliferation, migration, apoptosis and gene expression. Primary human osteoblasts (HOBs) isolated from the mandibular alveolar bone were phenotyped. HOBs were cultured with or without ZA and GGOH for up to 72 h. Cellular behaviour was examined using a CellTiter-Blue® viability assay, an Ibidi culture-insert migration assay, an Apo-ONE® Homogeneous Caspase-3/7 apoptosis assay and transmission electron microscopy (TEM). Quantitative real-time reverse transcriptase polymerase chain reaction (qRT 2 -PCR) was used to determine the simultaneous expression of 168 osteogenic and angiogenic genes modulated in the presence of ZA and GGOH. ZA decreased cell viability and migration and induced apoptosis in HOBs. TEM revealed signs of apoptosis in ZA-treated HOBs. However, the co-addition of GGOH ameliorated the effect of ZA and partially restored the cells to the control state. Twenty-eight genes in the osteogenic array and 27 genes in the angiogenic array were significantly regulated in the presence of ZA compared with those in the controls at one or more time points. The cytotoxic effect of ZA on HOBs and its reversal by the addition of GGOH suggests that the effect of ZA on HOBs is mediated via the MVP. The results suggest that GGOH could be used as a possible therapeutic/preventive strategy for BRONJ.

Unveiling the Mysteries of Mars with a Miniaturized Variable Pressure Scanning Electron Microscope (MVP-SEM)

NASA Technical Reports Server (NTRS)

Edmunson, J.; Gaskin, J. A.; Doloboff, I. J.

2017-01-01

Development of a miniaturized scanning electron microscope that will utilize the martian atmosphere to dissipate charge during analysis continues. This instrument is expected to be used on a future rover or lander to answer fundamental Mars science questions. To identify the most important questions, a survey was taken at the 47th Lunar and Planetary Science Conference (LPSC). From the gathered information initial topics were identified for a SEM on the martian surface. These priorities are identified and discussed below. Additionally, a concept of operations is provided with the goal of maximizing the science obtained with the minimum amount of communication with the instrument.

SpaceX CRS-14 What's On Board Science Briefing

NASA Image and Video Library

2018-04-01

During the SpaceX CRS-14 "What's On Board?" Science Briefing inside the Kennedy Space Center Press Site Auditorium, members of the media learned about the research headed to the International Space Station aboard the Dragon spacecraft. The briefing focused on several science projects including the Metabolic Tracking experiment; Atmosphere-Space Interactions Monitor (ASIM); Multi-purpose Variable-g Platform (MVP), and Veggie PONDS Validation. The Dragon spacecraft is scheduled to be launched from Space Launch Complex 40 at Cape Canaveral Air Force Station in Florida atop a SpaceX Falcon 9 rocket on the company's 14th Commercial Resupply Services mission to the space station.

Design and burn-up analyses of new type holder for silicon neutron transmutation doping.

PubMed

Komeda, Masao; Arai, Masaji; Tamai, Kazuo; Kawasaki, Kozo

2016-07-01

We have developed a new silicon irradiation holder with a neutron filter to increase the irradiation efficiency. The neutron filter is made of an alloy of aluminum and B4C particles. We fabricated a new holder based on the results of design analyses. This filter has limited use in applications requiring prolonged use due to a decrease in the amount of (10)B in B4C particles. We investigated the influence of (10)B reduction on doping distribution in a silicon ingot by using the Monte Carlo Code MVP. Copyright © 2016 Elsevier Ltd. All rights reserved.

Multiplanar visualization in 3D transthoracic echocardiography for precise delineation of mitral valve pathology.

PubMed

Kuppahally, Suman S; Paloma, Allan; Craig Miller, D; Schnittger, Ingela; Liang, David

2008-01-01

A novel multiplanar reformatting (MPR) technique in three-dimensional transthoracic echocardiography (3D TTE) was used to precisely localize the prolapsed lateral segment of posterior mitral valve leaflet in a patient symptomatic with mitral valve prolapse (MVP) and moderate mitral regurgitation (MR) before undergoing mitral valve repair surgery. Transesophageal echocardiography was avoided based on the findings of this new technique by 3D TTE. It was noninvasive, quick, reproducible and reliable. Also, it did not need the time-consuming reconstruction of multiple cardiac images. Mitral valve repair surgery was subsequently performed based on the MPR findings and corroborated the findings from the MPR examination.

FRENDY: A new nuclear data processing system being developed at JAEA

NASA Astrophysics Data System (ADS)

Tada, Kenichi; Nagaya, Yasunobu; Kunieda, Satoshi; Suyama, Kenya; Fukahori, Tokio

2017-09-01

JAEA has provided an evaluated nuclear data library JENDL and nuclear application codes such as MARBLE, SRAC, MVP and PHITS. These domestic codes have been widely used in many universities and industrial companies in Japan. However, we sometimes find problems in imported processing systems and need to revise them when the new JENDL is released. To overcome such problems and immediately process the nuclear data when it is released, JAEA started developing a new nuclear data processing system, FRENDY in 2013. This paper describes the outline of the development of FRENDY and both its capabilities and performances by the analyses of criticality experiments. The verification results indicate that FRENDY properly generates ACE files.

Energy scavenging system by acoustic wave and integrated wireless communication

NASA Astrophysics Data System (ADS)

Kim, Albert

The purpose of the project was developing an energy-scavenging device for other bio implantable devices. Researchers and scientist have studied energy scavenging method because of the limitation of traditional power source, especially for bio-implantable devices. In this research, piezoelectric power generator that activates by acoustic wave, or music was developed. Follow by power generator, a wireless communication also integrated with the device for monitoring the power generation. The Lead Zirconate Titanate (PZT) bimorph cantilever with a proof mass at the free end tip was studied to convert acoustic wave to power. The music or acoustic wave played through a speaker to vibrate piezoelectric power generator. The LC circuit integrated with the piezoelectric material for purpose of wireless monitoring power generation. However, wireless monitoring can be used as wireless power transmission, which means the signal received via wireless communication also can be used for power for other devices. Size of 74 by 7 by 7cm device could generate and transmit 100mVp from 70 mm distance away with electrical resonant frequency at 420.2 kHz..

Ada Compiler Validation Summary Report: Certificate Number 910705S1. 11192 InterAct Corporation InterAct Ada Mips Cross-Compiler System, Release 2.0 MicroVAX 3100 Cluster = Lockheed Sanders STAR MVP R3000/R3010 board (Bare Machine).

DTIC Science & Technology

1991-07-31

have floating-point type declarations requiring more digits than SYSTEM.MAXDIGITS: C24113L..Y (14 tests) C35705L..Y (14 tests) C357C6L..Y (14 tests...2_147_483_648..2_147_483_647; type FLOAT is digits 6 range -2#l.0#E128.. 2#0.IIIIIIIIIIIIIIIIIIIII#El28; type LONGFLOAT is digits 15 range -2#l.0#EI024.. 2...are instan- tated into libary packages or subprograms.) F-14 Appendix F of the Ada Reference Manual F.8.1. Address Clauses for Variables Address

The midgut transcriptome of Phlebotomus (Larroussius) perniciosus, a vector of Leishmania infantum: comparison of sugar fed and blood fed sand flies.

PubMed

Dostálová, Anna; Votýpka, Jan; Favreau, Amanda J; Barbian, Kent D; Volf, Petr; Valenzuela, Jesus G; Jochim, Ryan C

2011-05-10

Parasite-vector interactions are fundamental in the transmission of vector-borne diseases such as leishmaniasis. Leishmania development in the vector sand fly is confined to the digestive tract, where sand fly midgut molecules interact with the parasites. In this work we sequenced and analyzed two midgut-specific cDNA libraries from sugar fed and blood fed female Phlebotomus perniciosus and compared the transcript expression profiles. A total of 4111 high quality sequences were obtained from the two libraries and assembled into 370 contigs and 1085 singletons. Molecules with putative roles in blood meal digestion, peritrophic matrix formation, immunity and response to oxidative stress were identified, including proteins that were not previously reported in sand flies. These molecules were evaluated relative to other published sand fly transcripts. Comparative analysis of the two libraries revealed transcripts differentially expressed in response to blood feeding. Molecules up regulated by blood feeding include a putative peritrophin (PperPer1), two chymotrypsin-like proteins (PperChym1 and PperChym2), a putative trypsin (PperTryp3) and four putative microvillar proteins (PperMVP1, 2, 4 and 5). Additionally, several transcripts were more abundant in the sugar fed midgut, such as two putative trypsins (PperTryp1 and PperTryp2), a chymotrypsin (PperChym3) and a microvillar protein (PperMVP3). We performed a detailed temporal expression profile analysis of the putative trypsin transcripts using qPCR and confirmed the expression of blood-induced and blood-repressed trypsins. Trypsin expression was measured in Leishmania infantum-infected and uninfected sand flies, which identified the L. infantum-induced down regulation of PperTryp3 at 24 hours post-blood meal. This midgut tissue-specific transcriptome provides insight into the molecules expressed in the midgut of P. perniciosus, an important vector of visceral leishmaniasis in the Old World. Through the comparative analysis of the libraries we identified molecules differentially expressed during blood meal digestion. Additionally, this study provides a detailed comparison to transcripts of other sand flies. Moreover, our analysis of putative trypsins demonstrated that L. infantum infection can reduce the transcript abundance of trypsin PperTryp3 in the midgut of P. perniciosus.

From Epidemic Meningitis Vaccines for Africa to the Meningitis Vaccine Project.

PubMed

Aguado, M Teresa; Jodar, Luis; Granoff, Dan; Rabinovich, Regina; Ceccarini, Costante; Perkin, Gordon W

2015-11-15

Polysaccharide vaccines had been used to control African meningitis epidemics for >30 years but with little or modest success, largely because of logistical problems in the implementation of reactive vaccination campaigns that are begun after epidemics are under way. After the major group A meningococcal meningitis epidemics in 1996-1997 (250,000 cases and 25,000 deaths), African ministers of health declared the prevention of meningitis a high priority and asked the World Health Organization (WHO) for help in developing better immunization strategies to eliminate meningitis epidemics in Africa. WHO accepted the challenge and created a project called Epidemic Meningitis Vaccines for Africa (EVA) that served as an organizational framework for external consultants, PATH, the US Centers for Disease Control and Prevention (CDC), and the Bill & Melinda Gates Foundation (BMGF). Consultations were initiated with major vaccine manufacturers. EVA commissioned a costing study/business plan for the development of new group A or A/C conjugate vaccines and explored the feasibility of developing these products as a public-private partnership. Representatives from African countries were consulted. They confirmed that the development of conjugate vaccines was a priority and provided information on preferred product characteristics. In parallel, a strategy for successful introduction was also anticipated and discussed. The expert consultations recommended that a group A meningococcal conjugate vaccine be developed and introduced into the African meningitis belt. The results of the costing study indicated that the "cost of goods" to develop a group A - containing conjugate vaccine in the United States would be in the range of US$0.35-$1.35 per dose, depending on composition (A vs A/C), number of doses/vials, and presentation. Following an invitation from BMGF, a proposal was submitted in the spring of 2001. In June 2001, BMGF awarded a grant of US$70 million to create the Meningitis Vaccine Project (MVP) as a partnership between PATH and WHO, with the specific goal of developing an affordable MenA conjugate vaccine to eliminate MenA meningitis epidemics in Africa. EVA is an example of the use of WHO as an important convening instrument to facilitate new approaches to address major public health problems. © 2015 World Health Organization; licensee Oxford Journals.

PC-SEAPAK - ANALYSIS OF COASTAL ZONE COLOR SCANNER AND ADVANCED VERY HIGH RESOLUTION RADIOMETER DATA

NASA Technical Reports Server (NTRS)

Mcclain, C. R.

1994-01-01

PC-SEAPAK is a user-interactive satellite data analysis software package specifically developed for oceanographic research. The program is used to process and interpret data obtained from the Nimbus-7/Coastal Zone Color Scanner (CZCS), and the NOAA Advanced Very High Resolution Radiometer (AVHRR). PC-SEAPAK is a set of independent microcomputer-based image analysis programs that provide the user with a flexible, user-friendly, standardized interface, and facilitates relatively low-cost analysis of oceanographic satellite data. Version 4.0 includes 114 programs. PC-SEAPAK programs are organized into categories which include CZCS and AVHRR level-1 ingest, level-2 analyses, statistical analyses, data extraction, remapping to standard projections, graphics manipulation, image board memory manipulation, hardcopy output support and general utilities. Most programs allow user interaction through menu and command modes and also by the use of a mouse. Most programs also provide for ASCII file generation for further analysis in spreadsheets, graphics packages, etc. The CZCS scanning radiometer aboard the NIMBUS-7 satellite was designed to measure the concentration of photosynthetic pigments and their degradation products in the ocean. AVHRR data is used to compute sea surface temperatures and is supported for the NOAA 6, 7, 8, 9, 10, 11, and 12 satellites. The CZCS operated from November 1978 to June 1986. CZCS data may be obtained free of charge from the CZCS archive at NASA/Goddard Space Flight Center. AVHRR data may be purchased through NOAA's Satellite Data Service Division. Ordering information is included in the PC-SEAPAK documentation. Although PC-SEAPAK was developed on a COMPAQ Deskpro 386/20, it can be run on most 386-compatible computers with an AT bus, EGA controller, Intel 80387 coprocessor, and MS-DOS 3.3 or higher. A Matrox MVP-AT image board with appropriate monitor and cables is also required. Note that the authors have received some reports of incompatibilities between the MVP-AT image board and ZENITH computers. Also, the MVP-AT image board is not necessarily compatible with 486-based systems; users of 486-based systems should consult with Matrox about compatibility concerns. Other PC-SEAPAK requirements include a Microsoft mouse (serial version), 2Mb RAM, and 100Mb hard disk space. For data ingest and backup, 9-track tape, 8mm tape and optical disks are supported and recommended. PC-SEAPAK has been under development since 1988. Version 4.0 was updated in 1992, and is distributed without source code. It is available only as a set of 36 1.2Mb 5.25 inch IBM MS-DOS format diskettes. PC-SEAPAK is a copyrighted product with all copyright vested in the National Aeronautics and Space Administration. Phar Lap's DOS_Extender run-time version is integrated into several of the programs; therefore, the PC-SEAPAK programs may not be duplicated. Three of the distribution diskettes contain DOS_Extender files. One of the distribution diskettes contains Media Cybernetics' HALO88 font files, also licensed by NASA for dissemination but not duplication. IBM is a registered trademark of International Business Machines. MS-DOS is a registered trademark of Microsoft Corporation. HALO88 is a registered trademark of Media Cybernetics, but the product was discontinued in 1991.

Genetic plasticity of the Shigella virulence plasmid is mediated by intra- and inter-molecular events between insertion sequences.

PubMed

Pilla, Giulia; McVicker, Gareth; Tang, Christoph M

2017-09-01

Acquisition of a single copy, large virulence plasmid, pINV, led to the emergence of Shigella spp. from Escherichia coli. The plasmid encodes a Type III secretion system (T3SS) on a 30 kb pathogenicity island (PAI), and is maintained in a bacterial population through a series of toxin:antitoxin (TA) systems which mediate post-segregational killing (PSK). The T3SS imposes a significant cost on the bacterium, and strains which have lost the plasmid and/or genes encoding the T3SS grow faster than wild-type strains in the laboratory, and fail to bind the indicator dye Congo Red (CR). Our aim was to define the molecular events in Shigella flexneri that cause loss of Type III secretion (T3S), and to examine whether TA systems exert positional effects on pINV. During growth at 37°C, we found that deletions of regions of the plasmid including the PAI lead to the emergence of CR-negative colonies; deletions occur through intra-molecular recombination events between insertion sequences (ISs) flanking the PAI. Furthermore, by repositioning MvpAT (which belongs to the VapBC family of TA systems) near the PAI, we demonstrate that the location of this TA system alters the rearrangements that lead to loss of T3S, indicating that MvpAT acts both globally (by reducing loss of pINV through PSK) as well as locally (by preventing loss of adjacent sequences). During growth at environmental temperatures, we show for the first time that pINV spontaneously integrates into different sites in the chromosome, and this is mediated by inter-molecular events involving IS1294. Integration leads to reduced PAI gene expression and impaired secretion through the T3SS, while excision of pINV from the chromosome restores T3SS function. Therefore, pINV integration provides a reversible mechanism for Shigella to circumvent the metabolic burden imposed by pINV. Intra- and inter-molecular events between ISs, which are abundant in Shigella spp., mediate plasticity of S. flexneri pINV.

Artificial intelligence applications of fast optical memory access

NASA Astrophysics Data System (ADS)

Henshaw, P. D.; Todtenkopf, A. B.

The operating principles and performance of rapid laser beam-steering (LBS) techniques are reviewed and illustrated with diagrams; their applicability to fast optical-memory (disk) access is evaluated; and the implications of fast access for the design of expert systems are discussed. LBS methods examined include analog deflection (source motion, wavefront tilt, and phased arrays), digital deflection (polarization modulation, reflectivity modulation, interferometric switching, and waveguide deflection), and photorefractive LBS. The disk-access problem is considered, and typical LBS requirements are listed as 38,000 beam positions, rotational latency 25 ms, one-sector rotation time 1.5 ms, and intersector space 87 microsec. The value of rapid access for increasing the power of expert systems (by permitting better organization of blocks of information) is illustrated by summarizing the learning process of the MVP-FORTH system (Park, 1983).

The mathematical statement for the solving of the problem of N-version software system design

NASA Astrophysics Data System (ADS)

Kovalev, I. V.; Kovalev, D. I.; Zelenkov, P. V.; Voroshilova, A. A.

2015-10-01

The N-version programming, as a methodology of the fault-tolerant software systems design, allows successful solving of the mentioned tasks. The use of N-version programming approach turns out to be effective, since the system is constructed out of several parallel executed versions of some software module. Those versions are written to meet the same specification but by different programmers. The problem of developing an optimal structure of N-version software system presents a kind of very complex optimization problem. This causes the use of deterministic optimization methods inappropriate for solving the stated problem. In this view, exploiting heuristic strategies looks more rational. In the field of pseudo-Boolean optimization theory, the so called method of varied probabilities (MVP) has been developed to solve problems with a large dimensionality.

Quinoxaline-based inhibitors of Ebola and Marburg VP40 egress.

PubMed

Loughran, H Marie; Han, Ziying; Wrobel, Jay E; Decker, Sarah E; Ruthel, Gordon; Freedman, Bruce D; Harty, Ronald N; Reitz, Allen B

2016-08-01

We prepared a series of quinoxalin-2-mercapto-acetyl-urea analogs and evaluated them for their ability to inhibit viral egress in our Marburg and Ebola VP40 VLP budding assays in HEK293T cells. We also evaluated selected compounds in our bimolecular complementation assay (BiMC) to detect and visualize a Marburg mVP40-Nedd4 interaction in live mammalian cells. Antiviral activity was assessed for selected compounds using a live recombinant vesicular stomatitis virus (VSV) (M40 virus) that expresses the EBOV VP40 PPxY L-domain. Finally selected compounds were evaluated in several ADME assays to have an early assessment of their drug properties. Our compounds had low nM potency in these assays (e.g., compounds 21, 24, 26, 39), and had good human liver microsome stability, as well as little or no inhibition of P450 3A4. Copyright © 2016 Elsevier Ltd. All rights reserved.

Stochastic acceleration of electrons from multiple uncorrelated plasma waves

NASA Astrophysics Data System (ADS)

Gee, David; Michel, Pierre; Wurtele, Jonathan

2017-10-01

One-dimensional theory puts a strict limit on the maximum energy attainable by an electron trapped and accelerated by an electron plasma wave (EPW). However, experimental measurements of hot electron distributions accelerated by stimulated Raman scattering (SRS) in ICF experiments typically show a thermal distribution with temperatures of the order of the kinetic energy of the resonant EPW's (Thot mvp2 , where vp is the phase velocity of the EPW's driven by SRS) and no clear cutoff at high energies. In this project, we are investigating conditions under which electrons can be stochastically accelerated by multiple uncorrelated EPW's, such as those generated by incoherent laser speckles in large laser spots like the ones used on NIF ( mm-size), and reproduce distributions similar to those observed in experiments. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract No. DE-AC52-07NA27344.

Optimal portfolio strategy with cross-correlation matrix composed by DCCA coefficients: Evidence from the Chinese stock market

NASA Astrophysics Data System (ADS)

Sun, Xuelian; Liu, Zixian

2016-02-01

In this paper, a new estimator of correlation matrix is proposed, which is composed of the detrended cross-correlation coefficients (DCCA coefficients), to improve portfolio optimization. In contrast to Pearson's correlation coefficients (PCC), DCCA coefficients acquired by the detrended cross-correlation analysis (DCCA) method can describe the nonlinear correlation between assets, and can be decomposed in different time scales. These properties of DCCA make it possible to improve the investment effect and more valuable to investigate the scale behaviors of portfolios. The minimum variance portfolio (MVP) model and the Mean-Variance (MV) model are used to evaluate the effectiveness of this improvement. Stability analysis shows the effect of two kinds of correlation matrices on the estimation error of portfolio weights. The observed scale behaviors are significant to risk management and could be used to optimize the portfolio selection.

Methodological review: measured and reported congruence between preferred and actual place of death.

PubMed

Bell, C L; Somogyi-Zalud, E; Masaki, K H

2009-09-01

Congruence between preferred and actual place of death is an important palliative care outcome reported in the literature. We examined methods of measuring and reporting congruence to highlight variations impairing cross-study comparisons. Medline, PsychInfo, CINAHL, and Web of Science were systematically searched for clinical research studies examining patient preference and congruence as an outcome. Data were extracted into a matrix, including purpose, reported congruence, and method for eliciting preference. Studies were graded for quality. Using tables of preferred versus actual places of death, an overall congruence (total met preferences out of total preferences) and a kappa statistic of agreement were determined for each study. Twelve studies were identified. Percentage of congruence was reported using four different definitions. Ten studies provided a table or partial table of preferred versus actual deaths for each place. Three studies provided kappa statistics. No study achieved better than moderate agreement when analysed using kappa statistics. A study which elicited ideal preference reported the lowest agreement, while longitudinal studies reporting final preferred place of death yielded the highest agreement (moderate agreement). Two other studies of select populations also yielded moderate agreement. There is marked variation in methods of eliciting and reporting congruence, even among studies focused on congruence as an outcome. Cross-study comparison would be enhanced by the use of similar questions to elicit preference, tables of preferred versus actual places of death, and kappa statistics of agreement.

Cloud-based interactive analytics for terabytes of genomic variants data.

PubMed

Pan, Cuiping; McInnes, Gregory; Deflaux, Nicole; Snyder, Michael; Bingham, Jonathan; Datta, Somalee; Tsao, Philip S

2017-12-01

Large scale genomic sequencing is now widely used to decipher questions in diverse realms such as biological function, human diseases, evolution, ecosystems, and agriculture. With the quantity and diversity these data harbor, a robust and scalable data handling and analysis solution is desired. We present interactive analytics using a cloud-based columnar database built on Dremel to perform information compression, comprehensive quality controls, and biological information retrieval in large volumes of genomic data. We demonstrate such Big Data computing paradigms can provide orders of magnitude faster turnaround for common genomic analyses, transforming long-running batch jobs submitted via a Linux shell into questions that can be asked from a web browser in seconds. Using this method, we assessed a study population of 475 deeply sequenced human genomes for genomic call rate, genotype and allele frequency distribution, variant density across the genome, and pharmacogenomic information. Our analysis framework is implemented in Google Cloud Platform and BigQuery. Codes are available at https://github.com/StanfordBioinformatics/mvp_aaa_codelabs. cuiping@stanford.edu or ptsao@stanford.edu. Supplementary data are available at Bioinformatics online. Published by Oxford University Press 2017. This work is written by US Government employees and are in the public domain in the US.

Cloud-based interactive analytics for terabytes of genomic variants data

PubMed Central

Pan, Cuiping; McInnes, Gregory; Deflaux, Nicole; Snyder, Michael; Bingham, Jonathan; Datta, Somalee; Tsao, Philip S

2017-01-01

Abstract Motivation Large scale genomic sequencing is now widely used to decipher questions in diverse realms such as biological function, human diseases, evolution, ecosystems, and agriculture. With the quantity and diversity these data harbor, a robust and scalable data handling and analysis solution is desired. Results We present interactive analytics using a cloud-based columnar database built on Dremel to perform information compression, comprehensive quality controls, and biological information retrieval in large volumes of genomic data. We demonstrate such Big Data computing paradigms can provide orders of magnitude faster turnaround for common genomic analyses, transforming long-running batch jobs submitted via a Linux shell into questions that can be asked from a web browser in seconds. Using this method, we assessed a study population of 475 deeply sequenced human genomes for genomic call rate, genotype and allele frequency distribution, variant density across the genome, and pharmacogenomic information. Availability and implementation Our analysis framework is implemented in Google Cloud Platform and BigQuery. Codes are available at https://github.com/StanfordBioinformatics/mvp_aaa_codelabs. Contact cuiping@stanford.edu or ptsao@stanford.edu Supplementary information Supplementary data are available at Bioinformatics online. PMID:28961771

Evaluation of the impact of a mobile health system on adherence to antenatal and postnatal care and prevention of mother-to-child transmission of HIV programs in Kenya.

PubMed

Mushamiri, Ivy; Luo, Chibulu; Iiams-Hauser, Casey; Ben Amor, Yanis

2015-02-07

The Millennium Villages Project (MVP) implemented in Western Kenya a mobile Health tool that uses text messages to coordinate Community Health Worker (CHW) activities around antenatal care (ANC) and Prevention of Mother-to-Child Transmission of HIV (PMTCT), named the ANC/PMTCT Adherence System (APAS). End-user changes in health-seeking behavior in ANC and postnatal care (PNC) were investigated following registration of 800 women into APAS. These investigations employed interviews of pregnant women or new mothers (n = 67) and CHWs (n = 20). Ordinal logistic regressions and exact binomial tests were used in the routine data analyses (n = 650, health registers). All CHWs interviewed agreed that APAS helped them track pregnant woman efficiently, compared to paper-based tracking forms. Women registered in APAS reported that CHWs reminded them of appointments more regularly than before its inception. The routine data analysis showed that among women who had their 1(st) ANC visit in the 2(nd) trimester, women who resided in the MVP cluster and were in APAS had: 3 times the odds of going for more ANC visits compared to women who were not registered (but resided in the cluster), after adjusting for the mother's HIV status in the multivariate model (Adjusted OR = 2.58, 95% CI [1.10-6.01]); twice the odds of going for more ANC visits compared to women who were not registered and resided outside the cluster (Adjusted OR = 2.37, 95% CI [0.99-5.67]) Among women not registered, residence inside or outside the cluster did not affect the number of ANC visits made (Adjusted OR = 0.86, 95% CI [0.45-1.69]). The APAS also greatly increased the likelihood of women making the 6 recommended post-delivery baby follow-ups. For women registered in APAS, the MTCT rate at 18 months was significantly different from that of women not registered, and from the global rate of 30%. Women not registered had a 9% MTCT rate at 18 months regardless of residence, while women registered had a 0% transmission rate at both 9 and 18 months. The incorporation of mHealth tools in CHW programs can improve adherence to ANC and PNC and enhance PMTCT efforts.

PREFERENCE FOR FLUENT VERSUS DISFLUENT WORK SCHEDULES

PubMed Central

Fienup, Daniel M; Ahlers, Ashley A; Pace, Gary

2011-01-01

Two studies were conducted that examined the preference of a student diagnosed with a brain injury. In Study 1, a preference assessment was followed by a three-choice concurrent-operants reinforcer assessment. Two choices resulted in access to preferred activities for completing work, and a third choice resulted in access to nothing (i.e., no activity). Unpredictably, the participant consistently chose the no-activity option. Study 2 examined why this student preferred work associated with no activity over preferred activities. Through a variety of concurrent-operants procedures, it was determined that she preferred fluent work followed by reinforcers rather than work that was broken up by access to preferred activities. Implications for research on preference are discussed. PMID:22219534

Mass Media Preference Patterns: A Cross-Media Study.

ERIC Educational Resources Information Center

Williams, Dwight A., Jr.

This study defined "preference types" (types of people who use various media) and looked at constructs people used in deciding their preferences. Preferences in one medium were compared with preferences in another medium for the same group of people. The six media studied were television, radio, movies, magazines, brand commercials, and political…

Neutron Spectrometer Prospecting During the Mojave Volatiles Project Analog Field Test

NASA Technical Reports Server (NTRS)

Elphic, R. C.; Heldmann, J. L.; Colaprete, A.; Hunt, D. R.; Deans, M C.; Lim, D. S.; Foil, G.; Fong, T.

2015-01-01

We know there are volatiles sequestered at the poles of the Moon. While we have evidence of water ice and a number of other compounds based on remote sensing, the detailed distribution, and physical and chemical form are largely unknown. Additional orbital studies of lunar polar volatiles may yield further insights, but the most important next step is to use landed assets to fully characterize the volatile composition and distribution at scales of tens to hundreds of meters. To achieve this range of scales, mobility is needed. Because of the proximity of the Moon, near real-time operation of the surface assets is possible, with an associated reduction in risk and cost. This concept of operations is very different from that of rovers on Mars, and new operational approaches are required to carry out such real-time robotic exploration. The Mojave Volatiles Project (MVP) is a Moon- Mars Analog Mission Activities (MMAMA) program effort aimed at (1) determining effective approaches to operating a real-time but short-duration lunar surface robotic mission, and (2) performing prospecting science in a natural setting, as a test of these approaches. We know there are volatiles sequestered at the poles of the Moon. While we have evidence of water ice and a number of other compounds based on remote sensing, the detailed distribution, and physical and chemical form are largely unknown. Additional orbital studies of lunar polar volatiles may yield further insights, but the most important next step is to use landed assets to fully characterize the volatile composition and distribution at scales of tens to hundreds of meters. To achieve this range of scales, mobility is needed. Because of the proximity of the Moon, near real-time operation of the surface assets is possible, with an associated reduction in risk and cost. This concept of operations is very different from that of rovers on Mars, and new operational approaches are required to carry out such robotic exploration. The Mojave Volatiles Project (MVP) is a Moon- Mars Analog Mission Activities (MMAMA) program effort aimed at (1) determining effective approaches to operating a real-time but short-duration lunar surface robotic mission, and (2) performing prospecting science in a natural setting, as a test of these approaches. Here we describe some results from the first such test, carried out in the Mojave Desert between 16 and 24 October, 2014. The test site was an alluvial fan just E of the Soda Mountains, SW of Baker, California. This site contains desert pavements, ranging from the late Pleistocene to early-Holocene in age. These pavements are undergoing dissection by the ongoing development of washes. A principal objective was to determine the hydration state of different types of desert pavement and bare ground features. The mobility element of the test was provided by the KREX-2 rover, designed and operated by the Intelligent Robotics Group at NASA Ames Research Center.

How Are Mate Preferences Linked with Actual Mate Selection? Tests of Mate Preference Integration Algorithms Using Computer Simulations and Actual Mating Couples

PubMed Central

Conroy-Beam, Daniel; Buss, David M.

2016-01-01

Prior mate preference research has focused on the content of mate preferences. Yet in real life, people must select mates among potentials who vary along myriad dimensions. How do people incorporate information on many different mate preferences in order to choose which partner to pursue? Here, in Study 1, we compare seven candidate algorithms for integrating multiple mate preferences in a competitive agent-based model of human mate choice evolution. This model shows that a Euclidean algorithm is the most evolvable solution to the problem of selecting fitness-beneficial mates. Next, across three studies of actual couples (Study 2: n = 214; Study 3: n = 259; Study 4: n = 294) we apply the Euclidean algorithm toward predicting mate preference fulfillment overall and preference fulfillment as a function of mate value. Consistent with the hypothesis that mate preferences are integrated according to a Euclidean algorithm, we find that actual mates lie close in multidimensional preference space to the preferences of their partners. Moreover, this Euclidean preference fulfillment is greater for people who are higher in mate value, highlighting theoretically-predictable individual differences in who gets what they want. These new Euclidean tools have important implications for understanding real-world dynamics of mate selection. PMID:27276030

How Are Mate Preferences Linked with Actual Mate Selection? Tests of Mate Preference Integration Algorithms Using Computer Simulations and Actual Mating Couples.

PubMed

Conroy-Beam, Daniel; Buss, David M

2016-01-01

Prior mate preference research has focused on the content of mate preferences. Yet in real life, people must select mates among potentials who vary along myriad dimensions. How do people incorporate information on many different mate preferences in order to choose which partner to pursue? Here, in Study 1, we compare seven candidate algorithms for integrating multiple mate preferences in a competitive agent-based model of human mate choice evolution. This model shows that a Euclidean algorithm is the most evolvable solution to the problem of selecting fitness-beneficial mates. Next, across three studies of actual couples (Study 2: n = 214; Study 3: n = 259; Study 4: n = 294) we apply the Euclidean algorithm toward predicting mate preference fulfillment overall and preference fulfillment as a function of mate value. Consistent with the hypothesis that mate preferences are integrated according to a Euclidean algorithm, we find that actual mates lie close in multidimensional preference space to the preferences of their partners. Moreover, this Euclidean preference fulfillment is greater for people who are higher in mate value, highlighting theoretically-predictable individual differences in who gets what they want. These new Euclidean tools have important implications for understanding real-world dynamics of mate selection.

Cycling provision separated from motor traffic: a systematic review exploring whether stated preferences vary by gender and age.

PubMed

Aldred, Rachel; Elliott, Bridget; Woodcock, James; Goodman, Anna

2017-01-02

In this paper, we represent a systematic review of stated preference studies examining the extent to which cycle infrastructure preferences vary by gender and by age. A search of online, English-language academic and policy literature was followed by a three-stage screening process to identify relevant studies. We found 54 studies that investigated whether preferences for cycle infrastructure varied by gender and/or by age. Forty-four of these studies considered the extent of separation from motor traffic. The remainder of the studies covered diverse topics, including preferred winter maintenance methods and attitudes to cycle track lighting. We found that women reported stronger preferences than men for greater separation from motor traffic. There was weaker evidence of stronger preferences among older people. Differences in preferences were quantitative rather than qualitative; that is, preferences for separated infrastructure were stronger in some groups than in others, but no group preferred integration with motor traffic. Thus, in low-cycling countries seeking to increase cycling, this evidence suggests focusing on the stronger preferences of under-represented groups as a necessary element of universal design for cycling.

Cycling provision separated from motor traffic: a systematic review exploring whether stated preferences vary by gender and age

PubMed Central

Aldred, Rachel; Elliott, Bridget; Woodcock, James; Goodman, Anna

2017-01-01

ABSTRACT In this paper, we represent a systematic review of stated preference studies examining the extent to which cycle infrastructure preferences vary by gender and by age. A search of online, English-language academic and policy literature was followed by a three-stage screening process to identify relevant studies. We found 54 studies that investigated whether preferences for cycle infrastructure varied by gender and/or by age. Forty-four of these studies considered the extent of separation from motor traffic. The remainder of the studies covered diverse topics, including preferred winter maintenance methods and attitudes to cycle track lighting. We found that women reported stronger preferences than men for greater separation from motor traffic. There was weaker evidence of stronger preferences among older people. Differences in preferences were quantitative rather than qualitative; that is, preferences for separated infrastructure were stronger in some groups than in others, but no group preferred integration with motor traffic. Thus, in low-cycling countries seeking to increase cycling, this evidence suggests focusing on the stronger preferences of under-represented groups as a necessary element of universal design for cycling. PMID:28190905

Resource availability hypothesis: Perceived financial and caloric status affect individuals' height preferences for potential partners.

PubMed

Sun, Qingzhou; Lou, Liandi; Lu, Jingyi; Wang, Xiaoming; Zhong, Jun; Tan, Xuyun; Li, Yanxia; Liu, Yongfang

2016-10-01

Height is an important concern in human mate choices. Prior research indicates that people who live in areas with abundant resources differ from those who live in areas with scarce resources regarding height preferences. Based on a health-maximizing principle, we propose a resource availability account for such differences. Compared with women's height preferences, men's height preferences are hypothesized to be more dependent on either financial or caloric resource availability. Specifically, taller females would be more preferred by males who are poor in resources than those who are rich in resources. Results from three studies supported these hypotheses. In Study 1, men from remote areas of China who had lower family income preferred taller women more than those from eastern China who had higher family income. In Study 2, men who were financially dissatisfied preferred taller women more than those who were financially satisfied. In Study 3, men with low caloric status preferred taller women more than men with high caloric status. In addition, women's height preferences in Studies 1, 2 and 3 were less determined by resource availability. These findings suggest that height preferences are changeable, depending on financial or caloric status. © 2015 International Union of Psychological Science.

Can Self-Reported Preference for Exercise Intensity Predict Physiologically Defined Self-Selected Exercise Intensity?

ERIC Educational Resources Information Center

Ekkekakis, Panteleimon; Lind, Erik; Joens-Matre, Roxane R.

2006-01-01

Exercise prescription guidelines emphasize the importance of individual preferences for different intensities, but such preferences have not been studied systematically. This study examined the hypothesis that the preference scale of the Preference for and Tolerance of the Intensity of Exercise Questionnaire would predict self-selected exercise…

When avoidance leads to approach: how ear preference interacts with neuroticism to predict disinhibited approach.

PubMed

Jackson, Chris J

2008-07-01

A series of eight studies focuses on how the avoidance system represented by neuroticism can lead to disinhibited approach tendencies. Based on research which argues that hemispheric preferences predispose the left hemisphere to fast action goal formation, and contralateral pathways between ear and brain, it is proposed that (a) people with a right ear preference will engage in fast action goal formation and (b) disinhibited approach results from neurotic people who reduce anxiety by means of fast action goal formation. Study 1 provides evidence from telesales operators of a link between self-rated ear preference and objective ear preference and provides evidence that disinhibited approach is predicted by a neuroticismxear preference interaction. Studies 2, 3, and 4 provide evidence that ear preference is related to other measures of objective aural preference and action goal formation. Studies 5, 6, 7, and 8 provide evidence that the neuroticismxear preference interaction predicts a variety of different disinhibited approach tendencies.

Motivation modulates the effect of approach on implicit preferences.

PubMed

Zogmaister, Cristina; Perugini, Marco; Richetin, Juliette

2016-08-01

With three studies, we investigated whether motivational states can modulate the formation of implicit preferences. In Study 1, participants played a video game in which they repeatedly approached one of two similar beverages, while disregarding the other. A subsequent implicit preference for the target beverage emerged, which increased with participants' thirst. In Study 2, participants approached one brand of potato chips while avoiding the other: Conceptually replicating the moderation observed in Study 1, the implicit preference for the approached brand increased with the number of hours from last food intake. In Study 3, we experimentally manipulated hunger, and the moderation effect emerged again, with hungry participants displaying a higher implicit preference for the approached brand, as compared to satiated participants. In the three studies, the moderation effect was not paralleled in explicit preferences although the latter were affected by the preference inducing manipulation. Theoretical implications and open questions are discussed.

Inhibition of Hepatitis E Virus Spread by the Natural Compound Silvestrol.

PubMed

Glitscher, Mirco; Himmelsbach, Kiyoshi; Woytinek, Kathrin; Johne, Reimar; Reuter, Andreas; Spiric, Jelena; Schwaben, Luisa; Grünweller, Arnold; Hildt, Eberhard

2018-06-02

Every year, there are about 20 Mio hepatitis E virus (HEV) infections and 60,000 deaths that are associated with HEV worldwide. At the present, there exists no specific therapy for HEV. The natural compound silvestrol has a potent antiviral effect against the (-)-strand RNA-virus Ebola virus, and also against the (+)-strand RNA viruses Corona-, Picorna-, and Zika virus. The inhibitory effect on virus spread is due to an inhibition of the DEAD-box RNA helicase eIF4A, which is required to unwind structured 5'-untranslated regions (UTRs). This leads to an impaired translation of viral RNA. The HEV (+)-strand RNA genome contains a 5'-capped, short 5'-UTR. This study aims to analyze the impact of silvestrol on the HEV life cycle. Persistently infected A549 cells were instrumental. This study identifies silvestrol as a potent inhibitor of the release of HEV infectious viral particles. This goes along with a strongly reduced HEV capsid protein translation, retention of viral RNA inside the cytoplasm, and without major cytotoxic effects. Interestingly, in parallel silvestrol affects the activity of the antiviral major vault protein (MVP) by translocation from the cytoplasm to the perinuclear membrane. These data further characterize the complex antiviral activity of silvestrol and show silvestrol's broad spectrum of function, since HEV is a virus without complex secondary structures in its genome, but it is still affected.

Vasopressin facilitates excitatory transmission in slices of the rat dorso-lateral septum.

PubMed

Van den Hooff, P; Urban, I J

1990-01-01

The effect of vasopressin on neurons of the rat dorso-lateral septum (DLS) was studied in brain slices with intracellular microelectrodes. Two out of 13 neurons showed a small depolarization, spontaneous activity, and increased input resistances following a 15 min exposure to 10(-6) to 10(-8) M vasopressin (VP). These membrane effects disappeared completely within 3-5 min after the application. The remaining DLS neurons treated with these vasopressin concentrations showed an increase in glutamate-mediated excitatory postsynaptic potentials (EPSPs), evoked by stimulation of the fimbria fibers. As little as 10(-12) MVP increased these EPSPs markedly in nearly 80% of the cells studied. This increase in most of the cells disappeared within 15 min after the application period, whereas the increase in EPSPs induced by 10(-10) M VP outlasted the peptide application period for more than 30 min. Neither the blockade of GABA-ergic synaptic inhibition nor the pre-treatment of the neurons with d(CH2)5-Tyr(Me)-arginine vasopressin or 2-amino-5-phosphonovaleric acid (2-APV), antagonists for the V1 type of vasopressin receptor and NMDA receptors, respectively, interfered with the EPSPs potentiating effect of the peptide. It is concluded that a type of vasopressin receptor other then the V1 type is involved in the long-lasting potentiation of the primarily non-NMDA receptor mediated transmission in DLS neurons.

Explicit Not Implicit Preferences Predict Conservation Intentions for Endangered Species and Biomes.

PubMed

Echeverri, Alejandra; Callahan, Megan M; Chan, Kai M A; Satterfield, Terre; Zhao, Jiaying

2017-01-01

Conservation of biodiversity is determined in part by human preferences. Preferences relevant to conservation have been examined largely via explicit measures (e.g., a self-reported degree of liking), with implicit measures (e.g., preconscious, automatic evaluations) receiving relatively less attention. This is the case despite psychological evidence from other contexts that implicit preferences are more informative of behavior. Thus, the type of measure that predicts conservation intentions for biodiversity is unknown. We conducted three studies to examine conservation intentions in light of people's explicit and implicit preferences toward four endangered species (sea otter, American badger, caribou, yellow-breasted chat) and four biomes (forest, ocean, grassland, tundra). In Study 1 (n = 55), we found that people implicitly preferred caribou most, but explicitly preferred sea otter most, with a significant multiple regression where participants' explicit preferences dictated their stated intended donations for conservation of each species. In Study 2 (n = 57) we found that people implicitly and explicitly preferred forest and ocean over grassland and tundra. Explicit rather than implicit preferences predicted the intended donation for conservation of the ocean biome. Study 3 involved a broader online sample of participants (n = 463) and also found that explicit preferences dictated the intended donations for conservation of biomes and species. Our findings reveal discrepancies between implicit and explicit preferences toward species, but not toward biomes. Importantly, the results demonstrate that explicit rather than implicit preferences predict conservation intentions for biodiversity. The current findings have several implications for conservation and the communication of biodiversity initiatives.

What is the preferred number of consecutive night shifts? results from a crossover intervention study among police officers in Denmark.

PubMed

Nabe-Nielsen, Kirsten; Jensen, Marie Aarrebo; Hansen, Åse Marie; Kristiansen, Jesper; Garde, Anne Helene

2016-10-01

Among police officers in Denmark, we studied (i) how many consecutive night shifts participants preferred at baseline; (ii) preferences regarding three intervention conditions (two, four, and seven consecutive night shifts followed by the same number of days off/day shifts: '2 + 2', '4 + 4', '7 + 7') at follow-up; (iii) characteristics of participants preferring each of these intervention conditions. Questionnaire data from a crossover intervention study were used (baseline: n = 73; follow-up: n = 68). At baseline, 49% preferred four consecutive night shifts. At follow-up, 57% preferred '4 + 4', 26% preferred '2 + 2' and 26% preferred '7 + 7'. Participants, who preferred longer spells of night work experienced that night work was less demanding, found it easier to sleep at different times of the day, and were more frequently evening types compared with participants who preferred shorter spells of night work. The participants' preferences are likely to be influenced by their previous shift work experience. Practitioner Summary: We investigated police officers' preferences regarding the number of consecutive night shifts. The majority preferred four consecutive night shifts. Those who preferred the longer spells of night work found night work less demanding, found it easier to sleep at different times of the day, and were more frequently evening types.

Patient involvement in decision-making: a cross-sectional study in a Malaysian primary care clinic

PubMed Central

Ambigapathy, Ranjini; Ng, Chirk Jenn

2016-01-01

Objective Shared decision-making has been advocated as a useful model for patient management. In developing Asian countries such as Malaysia, there is a common belief that patients prefer a passive role in clinical consultation. As such, the objective of this study was to determine Malaysian patients’ role preference in decision-making and the associated factors. Design A cross-sectional study. Setting Study was conducted at an urban primary care clinic in Malaysia in 2012. Participants Patients aged >21 years were chosen using systematic random sampling. Methods Consenting patients answered a self-administered questionnaire, which included demographic data and their preferred and actual role before and after consultation. Doctors were asked to determine patients’ role preference. The Control Preference Scale was used to assess patients’ role preference. Primary outcome Prevalence of patients’ preferred role in decision-making. Secondary outcomes (1) Actual role played by the patient in decision-making. (2) Sociodemographic factors associated with patients’ preferred role in decision-making. (3) Doctors’ perception of patients’ involvement in decision-making. Results The response rate was 95.1% (470/494). Shared decision-making was preferred by 51.9% of patients, followed by passive (26.3%) and active (21.8%) roles in decision-making. Higher household income was significantly associated with autonomous role preference (p=0.018). Doctors’ perception did not concur with patients’ preferred role. Among patients whom doctors perceived to prefer a passive role, 73.5% preferred an autonomous role (p=0.900, κ=0.006). Conclusions The majority of patients attending the primary care clinic preferred and played an autonomous role in decision-making. Doctors underestimated patients’ preference to play an autonomous role. PMID:26729393

White Letters on Colored Backgrounds: Legibility and Preference.

ERIC Educational Resources Information Center

Pett, Dennis

This paper reviews two studies of color preference and the relationships between color and legibility. The Gustin study in 1991 dealt with the legibility of and preference for projected slides with colored backgrounds and white text. The order of background color preference was cyan, blue, green, yellow, magenta, and red. The follow-up study by…

Young Children's Color Preferences in the Interior Environment

ERIC Educational Resources Information Center

Read, Marilyn A.; Upington, Deborah

2009-01-01

This study focuses on children's color preferences in the interior environment. Previous studies highlight young children's preferences for the colors red and blue. The methods of this study used a rank ordering technique and a semi-structured interview process with 3-, 4-, and 5-year-old children. Findings reveal that children prefer the color…

EXAMINING THE GENERALITY OF CHILDREN'S PREFERENCE FOR CONTINGENT REINFORCEMENT VIA EXTENSION TO DIFFERENT RESPONSES, REINFORCERS, AND SCHEDULES

PubMed Central

Luczynski, Kevin C; Hanley, Gregory P

2010-01-01

Studies that have assessed whether children prefer contingent reinforcement (CR) or noncontingent reinforcement (NCR) have shown that they prefer CR. Preference for CR has, however, been evaluated only under continuous reinforcement (CRF) schedules. The prevalence of intermittent reinforcement (INT) warrants an evaluation of whether preference for CR persists as the schedule of reinforcement is thinned. In the current study, we evaluated 2 children's preference for contingent versus noncontingent delivery of highly preferred edible items for academic task completion under CRF and INT schedules. Children (a) preferred CR to NCR under the CRF schedule, (b) continued to prefer CR as the schedule of reinforcement became intermittent, and (c) exhibited a shift in preference from CR to NCR as the schedule became increasingly thin. These findings extend the generality of and provide one set of limits to the preference for CR. Applied implications, variables controlling preferences, and future research are discussed. PMID:21358901

Systematic Review of Patients' and Parents' Preferences for ADHD Treatment Options and Processes of Care.

PubMed

Schatz, Nicole K; Fabiano, Gregory A; Cunningham, Charles E; dosReis, Susan; Waschbusch, Daniel A; Jerome, Stephanie; Lupas, Kellina; Morris, Karen L

2015-12-01

Patient preferences are an important topic of study with respect to attention-deficit hyperactivity disorder (ADHD) interventions, as there are multiple treatment choices available, multiple developmental levels to consider, and multiple potential individuals involved in treatment (children, parents, and adults with ADHD). Stated preference methods such as discrete choice experiment (DCE), best-worst scaling (BWS), and other utility value methods such as standard gamble interview (SGI) and time trade-off (TTO) are becoming more common in research addressing preferences for ADHD treatments. A synthesis of this research may facilitate improved patient-centered and family-centered treatment for ADHD. The purpose of this review was to synthesize reports across existing DCE, BWS, TTO, and SGI studies to assess which aspects of ADHD treatment are most studied as well as most preferred and influential in treatment decisions. MEDLINE, PsycINFO. A total of 41 studies referring to preferences for ADHD treatment were identified through the initial search and contact with researchers. Of these, 13 reported ADHD treatment preference data from a study using DCE, BWS, or SGI methods. No TTO studies were identified that met inclusion criteria. Methods and designs varied considerably across studies. Relatively few studies focused on preferences among children, adolescents, and adults compared with those that focused on the preferences of parents of children with ADHD. The majority of studies focused primarily on medication treatments, with many fewer focused on psychosocial treatments. Some studies indicated that parents of children with ADHD prefer to avoid stimulant medications in favor of behavioral or psychosocial interventions. Others report that parents see medication as a preferred treatment. Treatment outcome is a particularly salient attribute for treatment decisions for many informants. Potential outcomes of various treatments play a proximal role in patients' and families' decisions for ADHD treatment. Because the majority of studies focus on medication treatments for children with ADHD, more research is necessary to understand preferences related to behavioral and other psychosocial treatments both as stand-alone interventions and used in combination with medication. Additional research is also needed to assess the treatment preferences of adults with ADHD. In general, DCE, BWS, and SGI methods allow measurement of patient preferences in a manner that approximates the uncertainty and trade-offs inherent in real-world treatment decision making and provides valuable information to inform patient-centered and family-centered treatment.

The causes of variation in the presence of genetic covariance between sexual traits and preferences.

PubMed

Fowler-Finn, Kasey D; Rodríguez, Rafael L

2016-05-01

Mating traits and mate preferences often show patterns of tight correspondence across populations and species. These patterns of apparent coevolution may result from a genetic association between traits and preferences (i.e. trait-preference genetic covariance). We review the literature on trait-preference covariance to determine its prevalence and potential biological relevance. Of the 43 studies we identified, a surprising 63% detected covariance. We test multiple hypotheses for factors that may influence the likelihood of detecting this covariance. The main predictor was the presence of genetic variation in mate preferences, which is one of the three main conditions required for the establishment of covariance. In fact, 89% of the nine studies where heritability of preference was high detected covariance. Variables pertaining to the experimental methods and type of traits involved in different studies did not greatly influence the detection of trait-preference covariance. Trait-preference genetic covariance appears to be widespread and therefore represents an important and currently underappreciated factor in the coevolution of traits and preferences. © 2015 Cambridge Philosophical Society.

A Study on Reading Printed Books or E-Books: Reasons for Student-Teachers Preferences

ERIC Educational Resources Information Center

Tosun, Nilgun

2014-01-01

This study tried to determine the preferences of student-teachers on reading printed books or e-books and the reasons for these preferences. Reading printed books and e-books preferences of students are discussed in terms of gender and department variables. 258 student-teachers who are studying in Computer Education and Instructional Technologies…

Structural stability of vault particles.

PubMed

Esfandiary, Reza; Kickhoefer, Valerie A; Rome, Leonard H; Joshi, Sangeeta B; Middaugh, C Russell

2009-04-01

Vaults, at 13 MDa, are the largest ribonucleoprotein particles known. In vitro, expression of the major vault protein (MVP) alone in Sf9 insect cells results in the production of recombinant particles with characteristic vault structure. With the ultimate goal of using recombinant vaults as nanocapsules for the delivery of biomolecules, we have employed a variety of spectroscopic techniques (i.e., circular dichroism, fluorescence spectroscopy, and light scattering) along with electron microscopy, to characterize the structural stability of vaults over a wide range of pH (3-8) and temperature (10-90 degrees C). Ten different conformational states of the vaults were identified over the pH and temperature range studied with the most stable region at pH 6-8 below 40 degrees C and least stable at pH 4-6 above 60 degrees C. A unique intermediate molten globulelike state was also identified at pH 6 and approximately 55 degrees C. EM imaging showed the opening of intact vaults into flowerlike structures when transitioning from neutral to acidic pH. This information has potential use in the development of recombinant vaults into nanocapsules for drug delivery since one mechanism by which therapeutic agents entrapped in vaults could be released is through an opening of the intact vault structure.

Eye Movements and Reading Comprehension While Listening to Preferred and Non-Preferred Study Music

ERIC Educational Resources Information Center

Johansson, Roger; Holmqvist, Kenneth; Mossberg, Frans; Lindgren, Magnus

2012-01-01

In the present study 24 university students read four different texts in four conditions: (1) while listening to music they preferred to listen to while studying; (2) while listening to music they did not prefer to listen to while studying; (3) while listening to a recording of noise from a cafe; and finally (4) in silence. After each text they…

Tears or Fears? Comparing Gender Stereotypes about Movie Preferences to Actual Preferences.

PubMed

Wühr, Peter; Lange, Benjamin P; Schwarz, Sascha

2017-01-01

This study investigated the accuracy of gender-specific stereotypes about movie-genre preferences for 17 genres. In Study 1, female and male participants rated the extent to which 17 movie genres are preferred by women or men. In Study 2, another sample of female and male participants rated their own preference for each genre. There were three notable results. First, Study 1 revealed the existence of gender stereotypes for the majority of genres (i.e., for 15 of 17 genres). Second, Study 2 revealed the existence of actual gender differences in preferences for the majority of genres (i.e., for 11 of 17 genres). Third, in order to assess the accuracy of gender stereotypes on movie preferences, we compared the results of both studies and found that the majority of gender stereotypes were accurate in direction, but inaccurate in size. In particular, the stereotypes overestimated actual gender differences for the majority of movie genres (i.e., 10 of 17). Practical and theoretical implications of these findings are discussed.

Tears or Fears? Comparing Gender Stereotypes about Movie Preferences to Actual Preferences

PubMed Central

Wühr, Peter; Lange, Benjamin P.; Schwarz, Sascha

2017-01-01

This study investigated the accuracy of gender-specific stereotypes about movie-genre preferences for 17 genres. In Study 1, female and male participants rated the extent to which 17 movie genres are preferred by women or men. In Study 2, another sample of female and male participants rated their own preference for each genre. There were three notable results. First, Study 1 revealed the existence of gender stereotypes for the majority of genres (i.e., for 15 of 17 genres). Second, Study 2 revealed the existence of actual gender differences in preferences for the majority of genres (i.e., for 11 of 17 genres). Third, in order to assess the accuracy of gender stereotypes on movie preferences, we compared the results of both studies and found that the majority of gender stereotypes were accurate in direction, but inaccurate in size. In particular, the stereotypes overestimated actual gender differences for the majority of movie genres (i.e., 10 of 17). Practical and theoretical implications of these findings are discussed. PMID:28392774

First-time mothers' birth beliefs, preferences, and actual birth: A longitudinal observational study.

PubMed

Preis, Heidi; Eisner, Michal; Chen, Rony; Benyamini, Yael

2018-05-09

Birth preferences, such as mode and place of birth and other birth options, have important individual and societal implications, yet few studies have investigated the mechanism which predicts a wide range of childbirth options simultaneously. Basic beliefs about birth as a natural and as a medical process are both predictive factors for childbirth preferences. Studies investigating birth beliefs, preferences, and actual birth are rare. To test a predictive model of how these beliefs translate into birth preferences and into actual birth related-options. Longitudinal observational study including 342 first-time expectant mothers recruited at women's health centres and natural birth communities in Israel. All women filled out questionnaires including basic birth beliefs and preferred birth options. Two months postpartum, they filled out a questionnaire including detailed questions regarding actual birth. Stronger beliefs about birth being natural were related to preferring a more natural place and mode of birth and preferring more natural birth-related options. Stronger beliefs about birth being medical were associated with opposite options. The preferences mediated the association between the birth beliefs and actual birth. The beliefs predicted the preferences better than they predicted actual birth. Birth beliefs are pivotal in the decision-making process regarding preferred and actual birth options. In a medicalized obstetric system, where natural birth is something women need to actively seek out and insist on, the predictive powers of beliefs and of preferences decrease. Women's beliefs should be recognized and birth preferences respected. Copyright © 2018 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.

Avian fruit preferences across a Puerto Rican forested landscape: pattern consistency and implications for seed removal.

PubMed

Carlo, Tomás A; Collazo, Jaime A; Groom, Martha J

2003-01-01

Avian fruit consumption may ensure plant reproductive success when frugivores show consistent preference patterns and effectively remove and disperse seeds. In this study we examined avian fruit preferences and their seed-removal services at five study sites in north-central Puerto Rico. At each site, we documented the diet of seven common fruit-eating avian species from February to September 1998. Using foraging observations and area-based estimates of fruit abundance, we examined preference patterns of birds. We found that 7 out of 68 fleshy-fruited plant species were responsible for most of the fruit diet of birds. Seventeen plant species were preferred and four of them were repeatedly preferred across several study sites and times by at least one avian species. Preferred plant species comprised a small percentage of fleshy fruits at each site (<15% in four out of five study sites), but showed extended phenology patterns. The quantity of seeds removed by frugivore species was not strictly related to preferences. Some frugivores showing no preference could effectively remove more seeds from plants at some locations than species exhibiting constancy in their patterns of preference. Only two frugivores, Euphonia musica and Vireo altiloquous, removed most of the seeds of plants for which they exhibited repeated preference across the landscape. Preference patterns, particularly those exhibiting consistency in space and time for plant species having prolonged fruiting periods, may have important mechanistic consequences for the persistence, succession, and regeneration of tropical plant communities.

Avian fruit preferences across a Puerto Rican forested landscape: Pattern consistency and implications for seed removal

USGS Publications Warehouse

Carlo, T.A.; Collazo, J.A.; Groom, Martha J.

2003-01-01

Avian fruit consumption may ensure plant reproductive success when frugivores show consistent preference patterns and effectively remove and disperse seeds. In this study we examined avian fruit preferences and their seed-removal services at five study sites in north-central Puerto Rico. At each site, we documented the diet of seven common fruit-eating avian species from February to September 1998. Using foraging observations and area-based estimates of fruit abundance, we examined preference patterns of birds. We found that 7 out of 68 fleshy-fruited plant species were responsible for most of the fruit diet of birds. Seventeen plant species were preferred and four of them were repeatedly preferred across several study sites and times by at least one avian species. Preferred plant species comprised a small percentage of fleshy fruits at each site (<15% in four out of five study sites), but showed extended phenology patterns. The quantity of seeds removed by frugivore species was not strictly related to preferences. Some frugivores showing no preference could effectively remove more seeds from plants at some locations than species exhibiting constancy in their patterns of preference. Only two frugivores, Euphonia musica and Vireo altiloquous, removed most of the seeds of plants for which they exhibited repeated preference across the landscape. Preference patterns, particularly those exhibiting consistency in space and time for plant species having prolonged fruiting periods, may have important mechanistic consequences for the persistence, succession, and regeneration of tropical plant communities.

Modeling Individual Differences in Unfolding Preference Data: A Restricted Latent Class Approach.

ERIC Educational Resources Information Center

Bockenholt, Ulf; Bockenholt, Ingo

1990-01-01

A latent-class scaling approach is presented for modeling paired comparison and "pick any/t" data obtained in preference studies. The utility of this approach is demonstrated through analysis of data from studies involving consumer preference and preference for political candidates. (SLD)

Sex-dimorphic face shape preference in heterosexual and homosexual men and women.

PubMed

Glassenberg, Aaron N; Feinberg, David R; Jones, Benedict C; Little, Anthony C; Debruine, Lisa M

2010-12-01

Studies have used manipulated faces to test the preferences of heterosexual individuals for sexually dimorphic facial cues. In contrast to previous studies, which have generally excluded homosexual participants, we directly compared homosexual and heterosexual male and female preferences for manipulated sexual dimorphism in faces (homosexual males: n = 311; heterosexual males: n = 215; homosexual females: n = 159; heterosexual females: n = 218). Prior studies on sexual orientation and preferences for faces that were paired with masculine and feminine behavioral descriptors suggest that homosexual men prefer more masculine men and that homosexual women demonstrate no preference for either masculinity or femininity in women. In our study, we tested for similarities and differences among heterosexual and homosexual males and females with regard to their preferences for a more specific aspect of faces: sexual dimorphism of face shape. Homosexual men demonstrated stronger preferences for masculinity in male faces than did all of the other groups. Homosexual women demonstrated stronger preferences for masculinity in female faces than did heterosexual women. These results suggest attractiveness judgments of same-sex faces made by homosexual individuals are not a mirror image of those made by heterosexual individuals of the opposite sex. Our data suggest that face preferences of homosexual individuals reflect a system of biologically and socially guided preferences at least as complex as those found among heterosexual individuals.

Effective Partnering in Conducting Benefit-Risk Patient Preference Studies: Perspectives From a Patient Advocacy Organization, a Pharmaceutical Company, and Academic Stated-Preference Researchers.

PubMed

Wolka, Anne M; Fairchild, Angelyn O; Reed, Shelby D; Anglin, Greg; Johnson, F Reed; Siegel, Michael; Noel, Rebecca

2017-01-01

Formal incorporation of patients' perspectives is becoming increasingly important in medical product development and decision making. This article shares practical advice regarding how patient advocacy organizations, the pharmaceutical industry, and academic experts in stated-preference research can effectively partner on benefit-risk patient preference studies. The authors partnered on a benefit-risk patient preference study related to the treatment of psoriasis. The authors from Duke Clinical Research Institute also share their experiences in collaborating with numerous other organizations in conducting benefit-risk patient preference studies. Upon initiation of the study partnership with appropriate experts, training is important to ensure all collaborators have a common understanding of the methodology, what objectives stated-preference methods can support, and expectations for the project. To the extent possible, partners should align on and document relevant clinical and logistical details prior to study implementation. During study implementation, partners should use good communication practices and document and maintain a record of any changes to the original plan. Presentation of the study results should be tailored to the particular audience, with the appropriate partner leading the presentation based on its format and audience. Partners from patient advocacy organizations, the pharmaceutical industry, and academia can effectively collaborate on benefit-risk patient preference studies with sufficient planning and ongoing communication. This article is a call for action for other organizations to engage in sharing of experiences regarding effective partnering in quantifying patient preferences in medical product development.

Patient preferences versus physicians' judgement: does it make a difference in healthcare decision making?

PubMed

Mühlbacher, Axel C; Juhnke, Christin

2013-06-01

Clinicians and public health experts make evidence-based decisions for individual patients, patient groups and even whole populations. In addition to the principles of internal and external validity (evidence), patient preferences must also influence decision making. Great Britain, Australia and Germany are currently discussing methods and procedures for valuing patient preferences in regulatory (authorization and pricing) and in health policy decision making. However, many questions remain on how to best balance patient and public preferences with physicians' judgement in healthcare and health policy decision making. For example, how to define evaluation criteria regarding the perceived value from a patient's perspective? How do physicians' fact-based opinions also reflect patients' preferences based on personal values? Can empirically grounded theories explain differences between patients and experts-and, if so, how? This article aims to identify and compare studies that used different preference elicitation methods and to highlight differences between patient and physician preferences. Therefore, studies comparing patient preferences and physician judgements were analysed in a review. This review shows a limited amount of literature analysing and comparing patient and physician preferences for healthcare interventions and outcomes. Moreover, it shows that methodology used to compare preferences is diverse. A total of 46 studies used the following methods-discrete-choice experiments, conjoint analyses, standard gamble, time trade-offs and paired comparisons-to compare patient preferences with doctor judgements. All studies were published between 1985 and 2011. Most studies reveal a disparity between the preferences of actual patients and those of physicians. For most conditions, physicians underestimated the impact of intervention characteristics on patients' decision making. Differentiated perceptions may reflect ineffective communication between the provider and the patient. This in turn may keep physicians from fully appreciating the impact of certain medical conditions on patient preferences. Because differences exist between physicians' judgement and patient preferences, it is important to incorporate the needs and wants of the patient into treatment decisions.

Musical Preferences Predict Personality: Evidence From Active Listening and Facebook Likes.

PubMed

Nave, Gideon; Minxha, Juri; Greenberg, David M; Kosinski, Michal; Stillwell, David; Rentfrow, Jason

2018-03-01

Research over the past decade has shown that various personality traits are communicated through musical preferences. One limitation of that research is external validity, as most studies have assessed individual differences in musical preferences using self-reports of music-genre preferences. Are personality traits communicated through behavioral manifestations of musical preferences? We addressed this question in two large-scale online studies with demographically diverse populations. Study 1 ( N = 22,252) shows that reactions to unfamiliar musical excerpts predicted individual differences in personality-most notably, openness and extraversion-above and beyond demographic characteristics. Moreover, these personality traits were differentially associated with particular music-preference dimensions. The results from Study 2 ( N = 21,929) replicated and extended these findings by showing that an active measure of naturally occurring behavior, Facebook Likes for musical artists, also predicted individual differences in personality. In general, our findings establish the robustness and external validity of the links between musical preferences and personality.

Mental Simulation of Visceral States Affects Preferences and Behavior

PubMed Central

Steinmetz, Janina; Tausen, Brittany M.; Risen, Jane L.

2017-01-01

Preferences and behavior are heavily influenced by one’s current visceral experience, yet people often fail to anticipate such effects. Although research suggests that this gap is difficult to overcome—to act as if in another visceral state—research on mental simulation has demonstrated that simulations can substitute for experiences, albeit to a weaker extent. We examine whether mentally simulating visceral states can impact preferences and behavior. We show that simulating a specific visceral state (e.g., being cold or hungry) shifts people’s preferences for relevant activities (Studies 1a-2) and choices of food portion sizes (Study 3). Like actual visceral experiences, mental simulation only affects people’s current preferences but not their general preferences (Study 4). Finally, people project simulated states onto similar others, as is the case for actual visceral experiences (Study 5). Thus, mental simulation may help people anticipate their own and others’ future preferences, thereby improving their decision making. PMID:29161953

Assessment of Preference for Edible and Leisure Items in Individuals with Dementia

ERIC Educational Resources Information Center

Ortega, Javier Virues; Iwata, Brian A.; Nogales-Gonzalez, Celia; Frades, Belen

2012-01-01

We conducted 2 studies on reinforcer preference in patients with dementia. Results of preference assessments yielded differential selections by 14 participants. Unlike prior studies with individuals with intellectual disabilities, all participants showed a noticeable preference for leisure items over edible items. Results of a subsequent analysis…

The Learning Preferences among Nursing Students in the King Saud University in Saudi Arabia: A Cross-Sectional Survey

PubMed Central

Almutairi, Adel F.; Alhelih, Eyad M.; Alshehry, Abdualrahman S.

2017-01-01

Objective The present study aimed to identify the most common learning preferences among the nursing students in Saudi Arabia and to investigate the associations of certain demographic variables with the learning preferences. Methods All the undergraduate nursing students in the nursing college were requested to participate in this descriptive cross-sectional study. An Arabic version of the Felder-Silverman learning style model (FSLSM) questionnaire was used to examine the learning preferences among undergraduate nursing students. Results A total of 56 (43%) completed questionnaires were included in the final analysis. Results of the present study indicate that the most common learning preferences among the nursing students were visual (67.9%), followed by active (50%) and sequential (37.5%) learning preferences. The verbal style was the least common learning preference (3.6%) among the nursing students. There was no association between gender and learning preferences (p > .05). Conclusion The present study concluded that the visual, active, and sequential styles are the commonest learning preferences among the nursing students. The nursing educators should emphasize the use of this information in their teaching methods to improve learning skills among the nursing students. PMID:28630767

Beauty at the ballot box: disease threats predict preferences for physically attractive leaders.

PubMed

White, Andrew Edward; Kenrick, Douglas T; Neuberg, Steven L

2013-12-01

Why does beauty win out at the ballot box? Some researchers have posited that it occurs because people ascribe generally positive characteristics to physically attractive candidates. We propose an alternative explanation-that leadership preferences are related to functional disease-avoidance mechanisms. Because physical attractiveness is a cue to health, people concerned with disease should especially prefer physically attractive leaders. Using real-world voting data and laboratory-based experiments, we found support for this relationship. In congressional districts with elevated disease threats, physically attractive candidates are more likely to be elected (Study 1). Experimentally activating disease concerns leads people to especially value physical attractiveness in leaders (Study 2) and prefer more physically attractive political candidates (Study 3). In a final study, we demonstrated that these findings are related to leadership preferences, specifically, rather than preferences for physically attractive group members more generally (Study 4). Together, these findings highlight the nuanced and functional nature of leadership preferences.

Associations of alcoholic beverage preference with cardiometabolic and lifestyle factors: the NQplus study

PubMed Central

Sluik, Diewertje; Brouwer-Brolsma, Elske M; de Vries, Jeanne H M; Geelen, Anouk; Feskens, Edith J M

2016-01-01

Objectives The preference for a specific alcoholic beverage may be related to an individual's overall lifestyle and health. The objective was to investigate associations between alcoholic beverage preference and several cardiometabolic and lifestyle factors, including adiposity, cholesterol, glycated haemoglobin (HbA1c), liver enzymes and dietary patterns. Design Cross-sectional study. Setting The Dutch Longitudinal Nutrition Questionnaires plus (NQplus) Study. Participants 1653 men and women aged 20–77 years. Methods Diet, including alcohol, was assessed by Food Frequency Questionnaire. Based on the average number of reported glasses of alcoholic beverage, a person was classified as having a preference for beer, wine, spirit/no specific preference, or as a non-consumer. Mixed linear models were used to calculate crude and adjusted means of cardiometabolic and lifestyle factors across alcoholic beverage preference categories. Primary outcome measures Anthropometric measures, blood pressure, lipids, HbA1c, albumin, creatinine, uric acid, liver enzymes and dietary patterns. Results In the study population, 43% had a wine preference, 13% a beer preference, 29% had a spirit or no specific preference, and 15% did not consume alcohol. Men who preferred wine had lowest measures of adiposity; the preference for alcoholic beverages was not associated with adiposity measures in women. Wine consumers had higher high density lipoprotein-cholesterol, lower HbA1c and were more likely to follow the ‘Salad’ pattern. Beer consumers had highest levels of triglycerides and liver enzymes, and had higher scores for the ‘Meat’ and ‘Bread’ pattern. Conclusions Few differences in dietary patterns across alcoholic beverage preference categories were observed. Those differences in cardiometabolic parameters that were observed according to alcoholic beverage preference, suggested that wine consumers have a better health status than beer consumers. PMID:27311903

Sweet Preference Associated with the Risk of Hypercholesterolemia Among Middle-Aged Women in Korea.

PubMed

Shin, Yoonjin; Lee, Soojin; Kim, Yangha

2018-04-05

Sweet preference has been reported to be associated with various health problems. This study examined the influence of sweet taste preference on the risk of dyslipidemia in Korean middle-aged women. The study selected 3,609 middle-aged women from the Korean Genome and Epidemiology Study (KoGES) and classified them into two groups on the basis of whether or not they preferred sweet taste. Dietary intake was analyzed using a semiquantitative food frequency questionnaire. Serum lipid profiles and anthropometric variables were measured. Subjects who preferred the sweet taste had significantly higher intakes of sugar products and sweet drink than those who did not prefer the sweet taste. Subjects who preferred the sweet taste showed higher carbohydrate and fat intake and less fiber intake than those who did not prefer the sweet taste. The serum concentrations of total cholesterol and low-density lipoprotein (LDL) cholesterol were significantly higher in subjects who preferred the sweet taste than those who did not prefer. Furthermore, subjects who preferred the sweet taste showed a significantly higher odds ratio (OR) for hypercholesterolemia (OR 1.22; 95% CI (1.01-1.45)) and hyper-LDL cholesterolemia (OR 1.33; 95% CI (1.11-1.60)) than those who did not prefer the sweet taste. Our results suggested that preference for sweet taste may increase the consumption of sugar products and sweet drinks, which is partially linked to the risk of hypercholesterolemia and hyper-LDL cholesterolemia in Korean middle-aged women.

Gender preferences among antenatal women: a cross-sectional study from coastal South India.

PubMed

Nithin, Kumar; Tanuj, Kanchan; Unnikrishnan, Bhaskaran; Rekha, T; Prasanna, Mithra; Vaman, Kulkarni; Ramesh, Holla; Darshan, Bhagwan; Samskruthi, Reddy

2015-06-01

A balanced sex ratio is essential for a stable society. The main objective of the present research was to study the perceptions of women attending the antenatal care (ANC) facility regarding their gender preferences and family composition. In this cross-sectional study 132 antenatal women were interviewed in their preferred language using a predesigned semi-structured questionnaire. The collected information was analyzed using SPSS version 11.5. The mean age of the study participants was 27.2 ± 4.1 years. The majority of the antenatal women (60.6%, n=80) did not have any gender preferences. Among those who had a gender preference (39.4%, n=52), male and female preference was reported by 55.7% (n=29) and 44.3% (n=23) of the participants respectively. The overall son preference index was observed to be 1.3. No consistent relationship could be established between the socio-demographic factors and the preference for gender. The mean preferred family size in our study was 1.85±0.531 and more than half of the participants had a balanced gender preference. The majority of the participants were aware that the adverse sex ratio can lead to fall in the number of brides and that it would bring about a social imbalance. As a developed society we need to ensure that both the genders get equal respect and are free from any sort of preferences and prejudices. To achieve this, more and more people need to be made aware of the consequences of gender imbalance and adverse sex ratio in a society.

The Vocational Preference Inventory Scores and Environmental Preferences

ERIC Educational Resources Information Center

Kunce, Joseph T.; Kappes, Bruno Maurice

1976-01-01

This study investigated the relationship between vocational interest measured by the Vocational Preference Inventory (VPI) and preferences of 175 undergraduates for structured or unstructured environments. Males having clear-cut preferences for structured situations had significantly higher Realistic-Conventional scores than those without…

MHC-correlated mate choice in humans: a review.

PubMed

Havlicek, Jan; Roberts, S Craig

2009-05-01

Extremely high variability in genes of the major histocompatibility complex (MHC) in vertebrates is assumed to be a consequence of frequency-dependent parasite-driven selection and mate preferences based on promotion of offspring heterozygosity at MHC, or potentially, genome-wide inbreeding avoidance. Where effects have been found, mate choice studies on rodents and other species usually find preference for MHC-dissimilarity in potential partners. Here we critically review studies on MHC-associated mate choice in humans. These are based on three broadly different aspects: (1) odor preferences, (2) facial preferences and (3) actual mate choice surveys. As in animal studies, most odor-based studies demonstrate disassortative preferences, although there is variation in the strength and nature of the effects. In contrast, facial attractiveness research indicates a preference for MHC-similar individuals. Results concerning MHC in actual couples show a bias towards similarity in one study, dissimilarity in two studies and random distribution in several other studies. These vary greatly in sample size and heterogeneity of the sample population, both of which may significantly bias the results. This pattern of mixed results across studies may reflect context-dependent and/or life history sensitive preference expression, in addition to higher level effects arising out of population differences in genetic heterogeneity or cultural and ethnic restrictions on random mating patterns. Factors of special relevance in terms of individual preferences are reproductive status and long- vs. short-term mating context. We discuss the idea that olfactory and visual channels may work in a complementary way (i.e. odor preference for MHC-dissimilarity and visual preference for MHC-similarity) to achieve an optimal level of genetic variability, methodological issues and interesting avenues for further research.

Preferred Roles in Treatment Decision Making Among Patients With Cancer: A Pooled Analysis of Studies Using the Control Preferences Scale

PubMed Central

Singh, Jasvinder A.; Sloan, Jeff A.; Atherton, Pamela J.; Smith, Tenbroeck; Hack, Thomas F.; Huschka, Mashele M.; Rummans, Teresa A.; Clark, Matthew M.; Diekmann, Brent; Degner, Lesley F.

2010-01-01

Objectives To collect normative data, assess differences between demographic groups, and indirectly compare US and Canadian medical systems relative to patient expectations of involvement in cancer treatment decision making. Study Design Meta-analysis. Methods Individual patient data were compiled across 6 clinical studies among 3491 patients with cancer who completed the 2-item Control Preferences Scale indicating the roles they preferred versus actually experienced in treatment decision making. Results The roles in treatment decision making that patients preferred were 26% active, 49% collaborative, and 25% passive. The roles that patients reported actually experiencing were 30% active, 34% collaborative, and 36% passive. Roughly 61% of patients reported having their preferred role; only 6% experienced extreme discordance between their preferred versus actual roles. More men than women (66% vs 60%, P = .001) and more US patients than Canadian patients (84% vs 54%, P <.001) reported concordance between their preferred versus actual roles. More Canadian patients than US patients preferred and actually experienced (42% vs 18%, P <.001) passive roles. More women than men reported taking a passive role (40% vs 24%, P <.001). Older patients preferred and were more likely than younger patients to assume a passive role. Conclusions Roughly half of the studied patients with cancer indicated that they preferred to have a collaborative relationship with physicians. Although most patients had the decision-making role they preferred, about 40% experienced discordance. This highlights the need for incorporation of individualized patient communication styles into treatment plans. PMID:20873956

Student Orientations to Independent Learning.

ERIC Educational Resources Information Center

Jones, Alice; Jones, Douglas

1996-01-01

A study investigated the relationship of 46 college students' preferred teaching method (conventional lecture versus independent study package) and their own approaches to study (surface, deep, achieving). Results indicated that while students preferred the conventional lecture method, preference did not correlate with their study approach and…

Exploring comfort food preferences across age and gender.

PubMed

Wansink, Brian; Cheney, Matthew M; Chan, Nina

2003-09-01

Building on findings related to physiological and psychological motivations of food preference, this research develops a framework to examine preferences toward comfort foods. Study 1 used a North American survey of 411 people to determine favored comfort foods, and Study 2 quantified the preferences for these foods across gender and across age groups using a stratified sample of 1005 additional people. Consistent with hypotheses, the findings showed different comfort food preferences across gender and across age. Males preferred warm, hearty, meal-related comfort foods (such as steak, casseroles, and soup), while females instead preferred comfort foods that were more snack related (such as chocolate and ice cream). In addition, younger people preferred more snack-related comfort foods compared to those over 55 years of age. Associations with guilty feelings underscored how these different preferences between males and females may extend to areas of application.

Cultural and gender effects on Israeli children's preferences for activities.

PubMed

Engel-Yeger, Batya; Jarus, Tal

2008-06-01

Knowledge about factors that affect participation, as preference of activities, has major intervention implications. To evaluate culture and gender effects on Israeli Jewish and Druze children's preference of activities performed outside mandated school. This study used the "Preference Assessment of Children" (PAC) (King et al., 2004). On most scales, the Jewish children showed significantly less interest in activities than the Druze children. Among the Jews, girls showed higher preference in most PAC scales than boys while among the Druze girls showed higher preference than the boys only in social skills. Culture and gender may influence children's preference of activity. More studies should elaborate the knowledge about individuals' preferred activities; understanding the factors that affect these preferences may enhance occupational therapy evaluation and intervention processes. Canadian occupational therapists, as health care professionals in a multicultural society, must develop cultural competency and explore people's experience as cultural beings.

Historical-Cultural Change in the Expression of Vocational Preference and Expectation by Preschool and Elementary School Age Children.

ERIC Educational Resources Information Center

Adams, Gerald R.; Hicken, Mandy

1984-01-01

Presents a replication of Looft's 1971 study on vocational preference and expectation in a 1981 study of 108 preschool and primary students. Results showed modest changes in occupational preferences, still mediated by sex role implications. Girls' expectations of obtaining preferred occupations were very low. (JAC)

Skin-Tone Preferences and Self-Representation in Hispanic Children

ERIC Educational Resources Information Center

Kaufman, Erin A.; Wiese, Deborah L.

2012-01-01

Skin-tone preferences and colourism within Hispanic children have been largely unexamined in the psychological literature. The objectives of the current study were to investigate Hispanic children's skin-tone preferences and the effect of assessor race and ethnicity on those preferences. To carry out the study, Clark and Clark's colouring task was…

Lifestyle Correlates of Musical Preference: 3. Travel, Money, Education, Employment and Health

ERIC Educational Resources Information Center

North, Adrian C.; Hargreaves, David J.

2007-01-01

Several studies indicate that musical preferences provide a means of discriminating between social groups, and suggest indirectly that musical preferences should correlate with a variety of different lifestyle choices. In this study, 2532 participants responded to a questionnaire asking them to state their musical preference and also to provide…

Songs Are Taught, Songs Are Learnt: Musical Preferences in Early Childhood

ERIC Educational Resources Information Center

Arriaga-Sanz, Cristina; Riaño-Galán, María-Elena; Cabedo-Mas, Alberto; Berbel-Gómez, Noemy

2017-01-01

This study analyses the musical preferences of children in early childhood education. It also strives to determine the learning environment where these preferences develop, as well as to identify both teachers' and families' degree of knowledge of these preferences. The study was conducted in four Spanish autonomous communities: the Basque…

Strategic use of preference confirmation in group decision making: the role of competition and dissent.

PubMed

Toma, Claudia; Gilles, Ingrid; Butera, Fabrizio

2013-03-01

The present research investigates the moderating role of goal interdependence and dissent on individual preference confirmation in hidden-profile tasks. We propose that preference confirmation can be used strategically to deal with competition and dissent likely to arise in group decision making. In two studies, participants first received incomplete information about a car accident investigation, and then read a fictitious discussion with two other participants containing full information. The interaction with the fictitious participants was presented either as cooperative or competitive. We predicted and found preference confirmation to be higher in competition than cooperation, when initial preferences were dissenting (Studies 1 & 2), but to be higher in cooperation than in competition, when initial preferences were consensual (Study 2). Also, the increased versus decreased preference confirmation in competition with, respectively, dissent and no dissent were found to be predicted by self-enhancement strategies (Study 2). These findings contribute to a better understanding of the boundary conditions of preference confirmation in hidden profiles and shed a new light on the role of motivated information processing in these tasks. © 2011 The British Psychological Society.

Changes in salivary estradiol predict changes in women's preferences for vocal masculinity.

PubMed

Pisanski, Katarzyna; Hahn, Amanda C; Fisher, Claire I; DeBruine, Lisa M; Feinberg, David R; Jones, Benedict C

2014-08-01

Although many studies have reported that women's preferences for masculine physical characteristics in men change systematically during the menstrual cycle, the hormonal mechanisms underpinning these changes are currently poorly understood. Previous studies investigating the relationships between measured hormone levels and women's masculinity preferences tested only judgments of men's facial attractiveness. Results of these studies suggested that preferences for masculine characteristics in men's faces were related to either women's estradiol or testosterone levels. To investigate the hormonal correlates of within-woman variation in masculinity preferences further, here we measured 62 women's salivary estradiol, progesterone, and testosterone levels and their preferences for masculine characteristics in men's voices in five weekly test sessions. Multilevel modeling of these data showed that changes in salivary estradiol were the best predictor of changes in women's preferences for vocal masculinity. These results complement other recent research implicating estradiol in women's mate preferences, attention to courtship signals, sexual motivation, and sexual strategies, and are the first to link women's voice preferences directly to measured hormone levels. Copyright © 2014 Elsevier Inc. All rights reserved.

Similarities in human visual and declared measures of preference for opposite-sex faces.

PubMed

Griffey, Jack A F; Little, Anthony C

2014-01-01

Facial appearance in humans is associated with attraction and mate choice. Numerous studies have identified that adults display directional preferences for certain facial traits including symmetry, averageness, and sexually dimorphic traits. Typically, studies measuring human preference for these traits examine declared (e.g., choice or ratings of attractiveness) or visual preferences (e.g., looking time) of participants. However, the extent to which visual and declared preferences correspond remains relatively untested. In order to evaluate the relationship between these measures we examined visual and declared preferences displayed by men and women for opposite-sex faces manipulated across three dimensions (symmetry, averageness, and masculinity) and compared preferences from each method. Results indicated that participants displayed significant visual and declared preferences for symmetrical, average, and appropriately sexually dimorphic faces. We also found that declared and visual preferences correlated weakly but significantly. These data indicate that visual and declared preferences for manipulated facial stimuli produce similar directional preferences across participants and are also correlated with one another within participants. Both methods therefore may be considered appropriate to measure human preferences. However, while both methods appear likely to generate similar patterns of preference at the sample level, the weak nature of the correlation between visual and declared preferences in our data suggests some caution in assuming visual preferences are the same as declared preferences at the individual level. Because there are positive and negative factors in both methods for measuring preference, we suggest that a combined approach is most useful in outlining population level preferences for traits.

Rough Evaluation Structure: Application of Rough Set Theory to Generate Simple Rules for Inconsistent Preference Relation

NASA Astrophysics Data System (ADS)

Gehrmann, Andreas; Nagai, Yoshimitsu; Yoshida, Osamu; Ishizu, Syohei

Since management decision-making becomes complex and preferences of the decision-maker frequently becomes inconsistent, multi-attribute decision-making problems were studied. To represent inconsistent preference relation, the concept of evaluation structure was introduced. We can generate simple rules to represent inconsistent preference relation by the evaluation structures. Further rough set theory for the preference relation was studied and the concept of approximation was introduced. One of our main aims of this paper is to introduce a concept of rough evaluation structure for representing inconsistent preference relation. We apply rough set theory to the evaluation structure, and develop a method for generating simple rules for inconsistent preference relations. In this paper, we introduce concepts of totally ordered information system, similarity class of preference relation, upper and lower approximation of preference relations. We also show the properties of rough evaluation structure and provide a simple example. As an application of rough evaluation structure, we analyze questionnaire survey of customer preferences about audio players.

Men's strategic preferences for femininity in female faces.

PubMed

Little, Anthony C; Jones, Benedict C; Feinberg, David R; Perrett, David I

2014-08-01

Several evolutionarily relevant sources of individual differences in face preference have been documented for women. Here, we examine three such sources of individual variation in men's preference for female facial femininity: term of relationship, partnership status and self-perceived attractiveness. We show that men prefer more feminine female faces when rating for a short-term relationship and when they have a partner (Study 1). These variables were found to interact in a follow-up study (Study 2). Men who thought themselves attractive also preferred more feminized female faces for short-term relationships than men who thought themselves less attractive (Study 1 and Study 2). In women, similar findings for masculine preferences in male faces have been interpreted as adaptive. In men, such preferences potentially reflect that attractive males are able to compete for high-quality female partners in short-term contexts. When a man has secured a mate, the potential cost of being discovered may increase his choosiness regarding short-term partners relative to unpartnered men, who can better increase their short-term mating success by relaxing their standards. Such potentially strategic preferences imply that men also face trade-offs when choosing relatively masculine or feminine faced partners. In line with a trade-off, women with feminine faces were seen as more likely to be unfaithful and more likely to pursue short-term relationships (Study 3), suggesting that risk of cuckoldry is one factor that may limit men's preferences for femininity in women and could additionally lead to preferences for femininity in short-term mates. © 2013 The British Psychological Society.

Kinematic comparison of the preferred and non-preferred foot punt kick.

PubMed

Ball, Kevin A

2011-11-01

Kicking with the non-preferred leg is important in Australian Football and becoming important in the rugby codes. The aim of this study was to examine differences between preferred and non-preferred leg kicking in the drop punt kick. Seventeen elite Australian Football players performed kicks with the preferred and non-preferred leg. Optotrak Certus collected kinematic data of the kick leg and pelvis (200 Hz) from kick leg toe-off until ball contact. Foot speed, knee and shank angular velocity at ball contact, and pelvis range of motion were significantly larger for the preferred leg (P < 0.05). In contrast, hip and thigh angular velocity at ball contact and hip range of motion were significantly larger for the non-preferred leg. This indicates different movement patterns, with preferred-leg kicks making greater use of the pelvis, knee, and shank while non-preferred leg kicks rely relatively more on the hip and thigh (P < 0.05). Reasons for this difference might be due to locking degrees of freedom or sub-optimal sequencing in the non-preferred leg. The thigh-knee continuum identified by Ball ( 2008 ) was also evident in this study. Findings have implications for training non-preferred leg kicking for performance and injury prevention.

Leadership Competency Preferences of Student Affairs Administrators: Does Generation Matter?

ERIC Educational Resources Information Center

Katherine, Lindsey

2011-01-01

The purpose of this study was to identify the leadership competencies and characteristics that are "preferred" by student affairs administrators, and to compare these preferences across generations to determine if there were any differences. The term "preferred" was used to indicate that the study asked respondents to assign a value or a level of…

Behind the mask of method: political orientation and constitutional interpretive preferences.

PubMed

Furgeson, Joshua R; Babcock, Linda; Shane, Peter M

2008-12-01

Debate about how to best interpret the Constitution often revolves around interpretive methodologies (e.g., originalism or expansive interpretation). This article examines whether individuals' political orientation influences the methodologies they prefer to use to interpret the Constitution. We study this proposed relationship using a survey of federal law clerks and an experimental study with college students. The survey results indicate that, compared to conservatives, liberal clerks prefer the current meaning or the most plausible appealing meaning of the constitutional text, while conservatives prefer the original meaning of the text. Liberal clerks also prefer to interpret the Constitution much more expansively. The second study manipulates the policy implications of expansive interpretation and finds this manipulation differentially affects liberals' and conservatives' expansiveness preferences.

Good genes, complementary genes and human mate preferences.

PubMed

Roberts, S Craig; Little, Anthony C

2008-03-01

The past decade has witnessed a rapidly growing interest in the biological basis of human mate choice. Here we review recent studies that demonstrate preferences for traits which might reveal genetic quality to prospective mates, with potential but still largely unknown influence on offspring fitness. These include studies assessing visual, olfactory and auditory preferences for potential good-gene indicator traits, such as dominance or bilateral symmetry. Individual differences in these robust preferences mainly arise through within and between individual variation in condition and reproductive status. Another set of studies have revealed preferences for traits indicating complementary genes, focussing on discrimination of dissimilarity at genes in the major histocompatibility complex (MHC). As in animal studies, we are only just beginning to understand how preferences for specific traits vary and inter-relate, how consideration of good and compatible genes can lead to substantial variability in individual mate choice decisions and how preferences expressed in one sensory modality may reflect those in another. Humans may be an ideal model species in which to explore these interesting complexities.

Sexual differences in food preferences in the white stork: an experimental study

NASA Astrophysics Data System (ADS)

Kwieciński, Zbigniew; Rosin, Zuzanna M.; Dylewski, Łukasz; Skórka, Piotr

2017-06-01

Sex differences in the foraging ecology of monomorphic species are poorly understood, due to problems with gender identification in field studies. In the current study, we used experimental conditions to investigate the food preferences of the white stork Ciconia ciconia, an opportunistic species in terms of food, but characterised by a low level of sexual dimorphism. During a 10-day experiment, 29 individuals (20 females and 9 males) were studied by means of a `cafeteria test' in which the storks' diet consisted of mammals, birds, fish, amphibians, insects and earthworms. The storks preferred food characterised by high calorific and protein values such as mammals, birds and fish. Sexes differed strongly in their preferences; males preferred mammals, whereas females preferred birds. Moreover, females consumed insects and earthworms less often than males. Interestingly, males spent significantly less time foraging than females. We have demonstrated that the white stork exhibits clear sexual differences in food preferences which are mostly attributable to differences in parental duties, physiology and anatomy.

Good genes, complementary genes and human mate preferences.

PubMed

Roberts, S Craig; Little, Anthony C

2008-09-01

The past decade has witnessed a rapidly growing interest in the biological basis of human mate choice. Here we review recent studies that demonstrate preferences for traits which might reveal genetic quality to prospective mates, with potential but still largely unknown influence on offspring fitness. These include studies assessing visual, olfactory and auditory preferences for potential good-gene indicator traits, such as dominance or bilateral symmetry. Individual differences in these robust preferences mainly arise through within and between individual variation in condition and reproductive status. Another set of studies have revealed preferences for traits indicating complementary genes, focussing on discrimination of dissimilarity at genes in the major histocompatibility complex (MHC). As in animal studies, we are only just beginning to understand how preferences for specific traits vary and inter-relate, how consideration of good and compatible genes can lead to substantial variability in individual mate choice decisions and how preferences expressed in one sensory modality may reflect those in another. Humans may be an ideal model species in which to explore these interesting complexities.

Do you want the good news or the bad news first? The nature and consequences of news order preferences.

PubMed

Legg, Angela M; Sweeny, Kate

2014-03-01

Information often comes as a mix of good and bad news, prompting the question, "Do you want the good news or the bad news first?" In such cases, news-givers and news-recipients differ in their concerns and considerations, thus creating an obstacle to ideal communication. In three studies, we examined order preferences of news-givers and news-recipients and the consequences of these preferences. Study 1 confirmed that news-givers and news-recipients differ in their news order preferences. Study 2 tested two solutions to close the preference gap between news-givers and recipients and found that both perspective-taking and priming emotion-protection goals shift news-givers' delivery patterns to the preferred order of news-recipients. Study 3 provided evidence that news order has consequences for recipients, such that opening with bad news (as recipients prefer) reduces worry, but this emotional benefit undermines motivation to change behavior.

Preferences for emotional information in older and younger adults: a meta-analysis of memory and attention tasks.

PubMed

Murphy, Nora A; Isaacowitz, Derek M

2008-06-01

The authors conducted a meta-analysis to determine the magnitude of older and younger adults' preferences for emotional stimuli in studies of attention and memory. Analyses involved 1,085 older adults from 37 independent samples and 3,150 younger adults from 86 independent samples. Both age groups exhibited small to medium emotion salience effects (i.e., preference for emotionally valenced stimuli over neutral stimuli) as well as positivity preferences (i.e., preference for positively valenced stimuli over neutral stimuli) and negativity preferences (i.e., preference for negatively valenced stimuli to neutral stimuli). There were few age differences overall. Type of measurement appeared to influence the magnitude of effects; recognition studies indicated significant age effects, where older adults showed smaller effects for emotion salience and negativity preferences than younger adults.

Homosexual mating preferences from an evolutionary perspective: sexual selection theory revisited.

PubMed

Gobrogge, Kyle L; Perkins, Patrick S; Baker, Jessica H; Balcer, Kristen D; Breedlove, S Marc; Klump, Kelly L

2007-10-01

Studies in evolutionary psychology and sexual selection theory show that heterosexual men prefer younger mating partners than heterosexual women in order to ensure reproductive success. However, previous research has generally not examined differences in mating preferences as a function of sexual orientation or the type of relationship sought in naturalistic settings. Given that homosexual men seek partners for reasons other than procreation, they may exhibit different mating preferences than their heterosexual counterparts. Moreover, mating preferences may show important differences depending on whether an individual is seeking a long-term versus a short-term relationship. The purpose of the present study was to examine these issues by comparing partner preferences in terms of age and relationship type between homosexual and heterosexual men placing internet personal advertisements. Participants included 439 homosexual and 365 heterosexual men who placed internet ads in the U.S. or Canada. Ads were coded for the participant's age, relationship type (longer-term or short-term sexual encounter) sought, and partner age preferences. Significantly more homosexual than heterosexual men sought sexual encounters, although men (regardless of sexual orientation) seeking sexual encounters preferred a significantly wider age range of partners than men seeking longer-term relationships. These findings suggest that partner preferences are independent of evolutionary drives to procreate, since both types of men preferred similar ages in their partners. In addition, they highlight the importance of examining relationship type in evolutionary studies of mating preferences, as men's partner preferences show important differences depending upon the type of relationship sought.

Alcohol demand and risk preference.

PubMed

Dave, Dhaval; Saffer, Henry

2008-12-01

Both economists and psychologists have studied the concept of risk preference. Economists categorize individuals as more or less risk-tolerant based on the marginal utility of income. Psychologists categorize individuals' propensity towards risk based on harm avoidance, novelty seeking and reward dependence traits. The two concepts of risk are related, although the instruments used for empirical measurement are quite different. Psychologists have found risk preference to be an important determinant of alcohol consumption; however economists have not included risk preference in studies of alcohol demand. This is the first study to examine the effect of risk preference on alcohol consumption in the context of a demand function. The specifications employ multiple waves from the Panel Study of Income Dynamics (PSID) and the Health and Retirement Study (HRS), which permit the estimation of age-specific models based on nationally representative samples. Both of these data sets include a unique and consistent survey instrument designed to directly measure risk preference in accordance with the economist's definition. This study estimates the direct impact of risk preference on alcohol demand and also explores how risk preference affects the price elasticity of demand. The empirical results indicate that risk preference has a significant negative effect on alcohol consumption, with the prevalence and consumption among risk-tolerant individuals being 6-8% higher. Furthermore, the tax elasticity is similar across both risk-averse and risk-tolerant individuals. This suggests that tax policies are as equally effective in deterring alcohol consumption among those who have a higher versus a lower propensity for alcohol use.

Preferences for female and male nurses: the role of age, gender and previous experience --year 2000 compared with 1984.

PubMed

Chur-Hansen, Anna

2002-01-01

The situations in which patients prefer a male or female nurse are not clear, as the literature reports differing relationships between gender and preference. Furthermore, most research has focused on female preferences. This questionnaire study investigated the preferences of both males and females for a male or female nurse, depending on four clinical situations. The role of age and previous experience with a male nurse was also taken into account. Gender, age and experience were further examined in relation to attitudes towards professional nursing practice. To determine whether preferences and attitudes have changed over time, the study was replicated in 2000, having been first conducted in 1984. Data were collected from the same general practice waiting room on each occasion. Consistent with previous research, the degree of intimacy in a clinical situation was found to be predictive of same-gender preferences. Younger females may prefer female nurses more than older females. Experience with male nurses was limited in both samples, but was not predictive of preferences or attitudes. Generally speaking, results from 1984 and 2000 were not significantly different. As a quantitative study, this research contributes to an understanding of patient preferences. However, in-depth, qualitative research is recommended to understand better the reasons for preferences and attitudes, for both male and female patients.

Prolonged stimulation of corticosterone secretion by corticotropin-releasing hormone in rats exhibiting high preference for dietary fat

USGS Publications Warehouse

Herminghuysen, D.; Plaisance, K.; Pace, R. M.; Prasad, C.

1998-01-01

Through the secretion of corticosterone, the hypothalamo-pituitary-adrenal (HPA) axis is thought to play an important role in the regulation of caloric intake and dietary fat preference. In an earlier study, we demonstrated a positive correlation between urinary corticosterone output and dietary fat preference. Furthermore, dietary fat preference was augmented following chronic but not acute hypercorticosteronemia produced by exogenous corticosterone administration. These observations led us to explore whether the HPA axis of rats exhibiting high preference for fat may have exaggerated sensitivity to corticotropin-releasing hormone (CRH). The results of these studies show a delayed and blunted but more prolonged corticosterone response to CRH in the fat-preferring rats compared with that of the carbohydrate-preferring rats.

Patients' preferences for nurses' gender in Jordan.

PubMed

Ahmad, Muayyad M; Alasad, Jafar A

2007-08-01

The purpose of the study was to examine patients' preferences for nurses' gender in Jordan. The public, private and university hospitals are represented by selecting one major hospital from each health sector. The sample size was 919 participants. Data were collected by a questionnaire through standardized individual interviews with patients. The findings of the study indicate that gender preferences are stronger among female patients than among male patients. Furthermore, two-thirds of female patients preferred female nurses, whereas only 3.4% preferred male nurses to care for them. In contrast, one-third of male patients' preferred male nurses, and only 10% preferred female nurses. The authors recommend that the high percentage of male nursing students need to be reconsidered by health policy-makers in Jordan.

Syrian Women’s Preferences for Birth Attendant and Birth Place

PubMed Central

Bashour, Hyam; Abdulsalam, Asmaa

2006-01-01

Background Women’s preferences for type of maternity caregiver and birth place have gained importance and have been documented in studies reported from the developed world. The purpose of our study was to identify Syrian women’s preferences for birth attendant and place of delivery. Methods Interviews with 500 women living in Damascus and its suburbs were conducted using a pretested structured questionnaire. Women were asked about their preferences for the birth attendant and place of delivery, and an open-ended question asked them to give an explanation for their preferences. We analyzed preferences and their determinants, and also agreement between actual and preferred place of delivery and birth attendant. Results Only a small minority of women (5–10%) had no preference. Most (65.8%) preferred to give birth at the hospital, and 60.4 percent preferred to be attended by doctors compared with midwives (21.2%). More than 85 percent of women preferred the obstetrician to be a female. The actual place of delivery and type of birth attendant did not match the preferred place of delivery and type of birth attendant. Women’s reasons for preferences were a perception of safety and competence, and communication style of caregiver. Conclusions Most women preferred to be delivered by female doctors at a hospital in this population sample in Syria. The findings suggest that proper understanding of women’s preferences is needed, and steps should be taken to enable women to make good choices. Policies about maternity education and services should take into account women’s preferences. PMID:15725201

Modelling memory colour region for preference colour reproduction

NASA Astrophysics Data System (ADS)

Zeng, Huanzhao; Luo, Ronnier

2010-01-01

Colour preference adjustment is an essential step for colour image enhancement and perceptual gamut mapping. In colour reproduction for pictorial images, properly shifting colours away from their colorimetric originals may produce more preferred colour reproduction result. Memory colours, as a portion of the colour regions for colour preference adjustment, are especially important for preference colour reproduction. Identifying memory colours or modelling the memory colour region is a basic step to study preferred memory colour enhancement. In this study, we first created gamut for each memory colour region represented as a convex hull, and then used the convex hull to guide mathematical modelling to formulate the colour region for colour enhancement.

Gender and competitive preferences: The role of competition size.

PubMed

Hanek, Kathrin J; Garcia, Stephen M; Tor, Avishalom

2016-08-01

In a series of 8 studies, we examine whether gender differences in competition entry preferences are moderated by the size of the competition. Drawing on theories of gender roles and stereotypes, we show that women, relative to men, prefer to enter smaller compared with larger competitions. Studies 1a and 1b demonstrate this effect in observational data on preferences for working in differently sized firms and applying to differently sized colleges. Studies 2a and 2b replicate the effect with real behavioral decisions in different domains. We also find empirical evidence that prescriptive gender norms and stereotypes underlie this effect. In Study 3, we find experimental evidence that women and men differ in their preferences for differently sized groups under competition, but not in noncompetitive settings. Three additional experimental studies (Studies 4, 5a, and 5b) show that perceptions of comfort in small versus larger competitions underlie women's preferences. These findings suggest that women's preferences for smaller competitions may be driven by an adherence to prescriptive gender norms. We discuss the implications of the current findings for gender inequalities in organizations. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

I'm no longer torn after choice: how explicit choices implicitly shape preferences of odors.

PubMed

Coppin, Géraldine; Delplanque, Sylvain; Cayeux, Isabelle; Porcherot, Christelle; Sander, David

2010-04-01

Several studies have shown that preferences can be strongly modulated by cognitive processes such as decision making and choices. However, it is still unclear whether choices can influence preferences of sensory stimuli implicitly. This question was addressed here by asking participants to evaluate odors, to choose their preferred odors within pairs, to reevaluate the odors, and to perform an unexpected memory test. Results revealed, for the first time in the study of olfaction, the existence of postchoice preference changes, in the sense of an overvaluation of chosen odors and a devaluation of rejected ones, even when choices were forgotten. These results suggest that chemosensory preferences can be modulated by explicit choices and that such modulation might rely on implicit mechanisms. This finding rules out any explanation of postchoice preference changes in terms of experimental demand and strongly challenges the classical cognitive-dissonance-reduction account of such preference changes.

Associations of alcoholic beverage preference with cardiometabolic and lifestyle factors: the NQplus study.

PubMed

Sluik, Diewertje; Brouwer-Brolsma, Elske M; de Vries, Jeanne H M; Geelen, Anouk; Feskens, Edith J M

2016-06-15

The preference for a specific alcoholic beverage may be related to an individual's overall lifestyle and health. The objective was to investigate associations between alcoholic beverage preference and several cardiometabolic and lifestyle factors, including adiposity, cholesterol, glycated haemoglobin (HbA1c), liver enzymes and dietary patterns. Cross-sectional study. The Dutch Longitudinal Nutrition Questionnaires plus (NQplus) Study. 1653 men and women aged 20-77 years. Diet, including alcohol, was assessed by Food Frequency Questionnaire. Based on the average number of reported glasses of alcoholic beverage, a person was classified as having a preference for beer, wine, spirit/no specific preference, or as a non-consumer. Mixed linear models were used to calculate crude and adjusted means of cardiometabolic and lifestyle factors across alcoholic beverage preference categories. Anthropometric measures, blood pressure, lipids, HbA1c, albumin, creatinine, uric acid, liver enzymes and dietary patterns. In the study population, 43% had a wine preference, 13% a beer preference, 29% had a spirit or no specific preference, and 15% did not consume alcohol. Men who preferred wine had lowest measures of adiposity; the preference for alcoholic beverages was not associated with adiposity measures in women. Wine consumers had higher high density lipoprotein-cholesterol, lower HbA1c and were more likely to follow the 'Salad' pattern. Beer consumers had highest levels of triglycerides and liver enzymes, and had higher scores for the 'Meat' and 'Bread' pattern. Few differences in dietary patterns across alcoholic beverage preference categories were observed. Those differences in cardiometabolic parameters that were observed according to alcoholic beverage preference, suggested that wine consumers have a better health status than beer consumers. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Prey preference of Myopopone castanea (hymenoptera: formicidae) toward larvae Oryctes rhinoceros Linn (coleoptera: scarabidae)

NASA Astrophysics Data System (ADS)

Widihastuty; Tobing, M. C.; Marheni; Kuswardani, R. A.

2018-02-01

Myopoponecastanea (Hymenoptera: Formicidae) ant is a predator for larvae Oryctes rhinoceros (Coleoptera: Scarabidae) which is a pest on oil palm. These ants are able to prey on all stadia of O. rhinoceros larvae. This study was conducted to determine prey preference of M. castaneatoward its prey O. rhinoceros larvae.. The study was conducted using a Factorial Complete Random Design with two factors (using log and no log) and five replications. Preferences test was done by choice test and no choice test. The results of no choice preference test on the log treatment, M. castaneaprefer preyed on firstinstar larvae of O. rhinoceros (\\bar{X}=2.6 individual) with a preference index was 0.194 and on no log treatment, M. castanea prefer for both first instar larvae and second instarlarvae (\\bar{X}=4.6 individual) with a preference index 0.197. The results of the choice preference test using logs, showed that M. castanea prefer the firstinstar larvae of O. rhinoceros (\\bar{X}=2.6 individual), with a preference index (0.35), and on no log treatment, M. castaneaprefer the second instar larvae(\\bar{X}=1.4 individual) with a preference index 0.189. Both first and secondinstarlarvaeof O. rhinoceros were preferred by predator M. castanea

‘Beauty Is No Quality in Things Themselves’: Epistemic Motivation Affects Implicit Preferences for Art

PubMed Central

Chirumbolo, Antonio; Brizi, Ambra; Mastandrea, Stefano; Mannetti, Lucia

2014-01-01

Art preferences are affected by a number of subjective factors. This paper reports two studies which investigated whether need for closure shapes implicit art preferences. It was predicted that higher need for closure would negatively affect implicit preferences for abstract art. In study one, 60 participants were tested for dispositional need for closure and then completed an Implicit Association Test (IAT) task to measure their implicit preference for abstract (vs. figurative) paintings. In study two, 54 participants completed the same IAT task. In this experiment need for closure was both manipulated by cognitive load and tapped as a dispositional trait. Results of the studies converged in showing that after controlling for other important individual factors such as participants'expertise and cognitive ability, need for closure, both as a dispositional trait and as a situationally induced motivational state, was negatively associated with implicit preference for abstract art. PMID:25360697

'Beauty is no quality in things themselves': epistemic motivation affects implicit preferences for art.

PubMed

Chirumbolo, Antonio; Brizi, Ambra; Mastandrea, Stefano; Mannetti, Lucia

2014-01-01

Art preferences are affected by a number of subjective factors. This paper reports two studies which investigated whether need for closure shapes implicit art preferences. It was predicted that higher need for closure would negatively affect implicit preferences for abstract art. In study one, 60 participants were tested for dispositional need for closure and then completed an Implicit Association Test (IAT) task to measure their implicit preference for abstract (vs. figurative) paintings. In study two, 54 participants completed the same IAT task. In this experiment need for closure was both manipulated by cognitive load and tapped as a dispositional trait. Results of the studies converged in showing that after controlling for other important individual factors such as participants'expertise and cognitive ability, need for closure, both as a dispositional trait and as a situationally induced motivational state, was negatively associated with implicit preference for abstract art.

Food and Food-Odor Preferences in Dogs: A Pilot Study

PubMed Central

Péron, Franck; Cambou, Stéphanie; Callejon, Laurence; Wynne, Clive D.L.

2017-01-01

Abstract Evaluation of food palatability and preference is of great importance to the pet food industry. One common technique for evaluating palatability is a 2-bowl test in which 2 products are offered simultaneously and food consumption is measured. This yields clear results with dogs trained to routinely conduct such comparisons, but it is less clear how this extends to untrained pet dogs. In addition, prior research indicates that olfaction is important in food preference, but methods for evaluating odor preference in canines are currently lacking. In this study, we developed a modified 2-bowl test for evaluation of food preferences in pet dogs with minimal training, and an olfactometer technique for the evaluation of odor preferences. In our 2-bowl procedure, we observed clear preferences among 4 commercial food products in 6 pet dogs. Across repeated testing, preferences strengthened, but the first evaluation accurately estimated the direction and significance of preference. In addition, dogs typically (89% of the time) consumed more of the food they chose first, suggesting they did not need to taste each food to choose. Our odor preference olfactometer assessment, however, did not reveal odor preferences other than that dogs preferred to sniff a food odor over clean air. Further work will be needed to identify methods of measuring odor preferences amongst food odors for dogs, but the modified 2-bowl test shows promise for further testing in pet dogs.

Do patient and practice characteristics confound age-group differences in preferences for general practice care? A quantitative study

PubMed Central

2013-01-01

Background Previous research showed inconsistent results regarding the relationship between the age of patients and preference statements regarding GP care. This study investigates whether elderly patients have different preference scores and ranking orders concerning 58 preference statements for GP care than younger patients. Moreover, this study examines whether patient characteristics and practice location may confound the relationship between age and the categorisation of a preference score as very important. Methods Data of the Consumer Quality Index GP Care were used, which were collected in 32 general practices in the Netherlands. The rank order and preference score were calculated for 58 preference statements for four age groups (0–30, 31–50, 51–74, 75 years and older). Using chi-square tests and logistic regression analyses, it was investigated whether a significant relationship between age and preference score was confounded by patient characteristics and practice location. Results Elderly patients did not have a significant different ranking order for the preference statements than the other three age groups (r = 0.0193; p = 0.41). However, in 53% of the statements significant differences were found in preference score between the four age groups. Elderly patients categorized significantly less preference statements as ‘very important’. In most cases, the significant relationships were not confounded by gender, education, perceived health, the number of GP contacts and location of the GP practice. Conclusion The preferences of elderly patients for GP care concern the same items as younger patients. However, their preferences are less strong, which cannot be ascribed to gender, education, perceived health, the number of GP contacts and practice location. PMID:23800156

Parallel female preferences for call duration in a diploid ancestor of an allotetraploid treefrog.

PubMed

Bee, Mark A

2008-09-01

The gray treefrog species complex (Hyla chrysoscelis and H. versicolor) comprises a single allotetraploid species (H. versicolor) that arose multiple times from hybrid matings between an extant diploid species (H. chrysoscelis) and at least two other extinct diploid treefrogs. While previous studies have investigated female preferences for call duration in the tetraploid, we know little about these preferences in its putative diploid anscestors. Here, I report results from two-choice phonotaxis experiments investigating call duration preferences in H. chrysoscelis. Females preferred an average-length call over shorter-than-average calls (0.5-2.0 standard deviations [SD] below average), and they preferred longer-than-average calls over average or shorter-than-average calls if the difference in pulse number was at least 2.0 SD. When the amplitude of the longer alternative was attenuated by 6 dB, females still preferred an average-length call over a shorter-than-average call, but there was no preference for longer-than-average calls over an average call. In the presence of chorus noise, female preferences for both average and longer-than-average calls over shorter alternatives were weakened or reversed. Together, the results from this study reveal patterns of female preferences for call duration that are strikingly similar among two members of a species complex with a novel evolutionary history. In both species, female preferences are directional, nonlinear, and limited by environmental noise. Furthermore, these results also highlight the need for caution in studies of sexual selection when extrapolating from patterns of female preference obtained under ideal laboratory conditions to conclusions about how those preferences are expressed in the real world.

Taste preference and psychopathology.

PubMed

Aguayo, G A; Vaillant, M T; Arendt, C; Bachim, S; Pull, C B

2012-01-01

Excessive food intake has been linked to many factors including taste preference and the presence of psychopathology. The purpose of this study was to investigate the association between sweet and salty taste preference and psychopathology in patients with severe obesity. A consecutive series of patients applying for bariatric surgery was recruited for the study. Taste preference was self-reported. Psychopathology was assessed using the revised version of the Minnesota Multiphasic Personality Inventory-2 (MMPI-2). 190 patients were included in the study. In comparison with patients who had salty taste preference, patients with sweet taste preference had significantly higher elevations on the depression (OD: 4.090, p = 0.010) and the hysteria (OD: 2.951, p = 0.026) clinical scales of the MMPI-2. The results suggest the presence of an association between taste preference and psychopathology. The findings may be of interest for clinicians who are involved in the treatment of obesity. In particular, they may wish to pay increased attention to patients with sweet taste preference or who have a strong attraction for both sweet and salty foods, in order to detect psychopathology and to adapt the treatment.

Correlated preferences for facial masculinity and ideal or actual partner's masculinity

PubMed Central

DeBruine, Lisa M; Jones, Benedict C; Little, Anthony C; Boothroyd, Lynda G; Perrett, David I; Penton-Voak, Ian S; Cooper, Philip A; Penke, Lars; Feinberg, David R; Tiddeman, Bernard P

2006-01-01

Studies of women's preferences for male faces have variously reported preferences for masculine faces, preferences for feminine faces and no effect of masculinity–femininity on male facial attractiveness. It has been suggested that these apparently inconsistent findings are, at least partly, due to differences in the methods used to manipulate the masculinity of face images or individual differences in attraction to facial cues associated with youth. Here, however, we show that women's preferences for masculinity manipulated in male faces using techniques similar to the three most widely used methods are positively inter-related. We also show that women's preferences for masculine male faces are positively related to ratings of the masculinity of their actual partner and their ideal partner. Correlations with partner masculinity were independent of real and ideal partner age, which were not associated with facial masculinity preference. Collectively, these findings suggest that variability among studies in their findings for women's masculinity preferences reflects individual differences in attraction to masculinity rather than differences in the methods used to manufacture stimuli, and are important for the interpretation of previous and future studies of facial masculinity. PMID:16777723

Science choices and preferences of middle and secondary school students in Utah

NASA Astrophysics Data System (ADS)

Baird, J. Hugh; Lazarowitz, Reuven; Allman, Verl

This research sought to answer two questions: (1) What are Utah junior and senior high school students' preferences and choices regarding science subjects? (2) Could preferences and choices be related to the type of school, age or gender? Two thousand students from grades six through twelve participated in this study. Findings show that zoology and human anatomy and physiology were most preferred. Ecology was least prefered. Topics in the physical sciences were also low. There was a trend among girls to prefer natural sciences such as botany while boys tended to prefer the physical sciences. Generally, students' choices were limited to those subjects presently taught in the formal school curriculum. They appeared unaware of the many science related subjects outside the texts or the approved course of study.

Patient preference for counselling predicts postpartum depression: a prospective 1-year follow up study in high-risk women.

PubMed

Verkerk, Gerda J M; Denollet, Johan; Van Heck, Guus L; Van Son, Maarten J M; Pop, Victor J M

2004-11-15

Patient preferences have been associated with a positive effect of depression treatment. Little is known about patient preferences in at-risk samples. The aim of this study was to examine the role of patient preference for counselling in the occurrence of postpartum depression in high-risk women. We conducted a prospective 1-year follow up study in two hospitals and four midwifery practices in The Netherlands. Participants were 90 pregnant women at high risk for postpartum depression: 45 high-risk women who preferred no counselling, 45 high-risk women who preferred counselling. Both groups received care as usual. The main outcome measure was clinical depression (Research Diagnostic Criteria) at 3, 6, and 12 months postpartum. Point-prevalence rates of clinical depression were significantly higher in high-risk women who preferred counselling compared with high-risk women who did not prefer counselling (24% versus 9%, P=0.048; 19% versus 5%, P=0.048, at 3 and 6 months postpartum, respectively). No significant difference was found at 12 months postpartum. Across the first-year postpartum, high-risk women who preferred counselling were at seven-fold increased risk for clinical depression (OR=7.7, 95% CI 1.7-33.8, P=0.007). Patient preference for counselling is an important predictor of postpartum depression in pregnant women at high risk for postpartum depression. Patient preferences may reflect validly a perceived need for intervention in high-risk women. This finding emphasises the need to take patient preference for counselling into account as an important variable to identify a high-risk population.

Alcohol demand and risk preference

PubMed Central

Dave, Dhaval; Saffer, Henry

2008-01-01

Both economists and psychologists have studied the concept of risk preference. Economists categorize individuals as more or less risk-tolerant based on the marginal utility of income. Psychologists categorize individuals' propensity towards risk based on harm avoidance, novelty seeking and reward dependence traits. The two concepts of risk are related, although the instruments used for empirical measurement are quite different. Psychologists have found risk preference to be an important determinant of alcohol consumption; however economists have not included risk preference in studies of alcohol demand. This is the first study to examine the effect of risk preference on alcohol consumption in the context of a demand function. The specifications employ multiple waves from the Panel Study of Income Dynamics (PSID) and the Health and Retirement Study (HRS), which permit the estimation of age-specific models based on nationally representative samples. Both of these data sets include a unique and consistent survey instrument designed to directly measure risk preference in accordance with the economist's definition. This study estimates the direct impact of risk preference on alcohol demand and also explores how risk preference affects the price elasticity of demand. The empirical results indicate that risk preference has a significant negative effect on alcohol consumption, with the prevalence and consumption among risk-tolerant individuals being 6–8% higher. Furthermore, the tax elasticity is similar across both risk-averse and risk-tolerant individuals. This suggests that tax policies are as equally effective in deterring alcohol consumption among those who have a higher versus a lower propensity for alcohol use. PMID:19956353

Relationship between the learning style preferences of medical students and academic achievement.

PubMed

Almigbal, Turky H

2015-03-01

To investigate the relationship between the learning style preferences of Saudi medical students and their academic achievements. A cross-sectional study was conducted among 600 medical students at King Saud University in Riyadh, Kingdom of Saudi Arabia from October 2012 to July 2013. The Visual, Aural, Read/Write, and Kinesthetic questionnaire (VARK) questionnaire was used to categorize learning style preferences. Descriptive and analytical statistics were used to identify the learning style preferences of medical students and their relationship to academic achievement, gender, marital status, residency, different teaching curricula, and study resources (for example, teachers' PowerPoint slides, textbooks, and journals). The results indicated that 261 students (43%) preferred to learn using all VARK modalities. There was a significant difference in learning style preferences between genders (p=0.028). The relationship between learning style preferences and students in different teaching curricula was also statistically significant (p=0.047). However, learning style preferences are not related to a student's academic achievements, marital status, residency, or study resources (for example, teachers' PowerPoint slides, textbooks, and journals). Also, after being adjusted to other studies' variables, the learning style preferences were not related to GPA. Our findings can be used to improve the quality of teaching in Saudi Arabia; students would be advantaged if teachers understood the factors that can be related to students' learning styles.

Socially transmitted mate preferences in a monogamous bird: a non-genetic mechanism of sexual selection.

PubMed

Swaddle, John P; Cathey, Mark G; Correll, Maureen; Hodkinson, Brendan P

2005-05-22

There is increasing evidence that animals can acquire mate preferences through the use of public information, notably by observing (and copying) the mate preferences of others in the population. If females acquire preferences through social mechanisms, sexual selection could act very rapidly to spread the preference and drive elaboration of the preferred trait(s). Although there are reports of 'mate-choice copying' in polygynous species, there is no clear evidence for this process in monogamous species. Here, we investigated whether adult female zebra finches Taeniopygia guttata can socially acquire sexual preferences for individual males and, in a separate study, for a generalized trait (coloured leg bands) of males. In both studies, test females observed males in two simultaneous conditions: a ('chosen') mixed-sex situation in which a male was paired with a (model) female, and a ('unchosen') same-sex situation in which a male was paired with another male. In the first experiment, after two weeks of females observing males, test females significantly preferred individual males who had been paired with another female (i.e. chosen males). In the second experiment, test females significantly preferred novel males that were wearing the same leg band colour as the apparently chosen males. Our findings are consistent with the conclusion that female zebra finches' mate preferences are altered by public information. Our study implies that mate preferences can spread rapidly through populations by social mechanisms, affecting the strength of sexual selection in a monogamous species.

Longitudinal Changes in Emerging Adults' Attachment Preferences for Their Mother, Father, Friends, and Romantic Partner: Focusing on the Start and End of Romantic Relationships

ERIC Educational Resources Information Center

Umemura, Tomo; Lacinová, Lenka; Macek, Petr; Kunnen, E. Saskia

2017-01-01

Only a few studies have longitudinally explored to whom emerging adults prefer to turn to seek closeness, comfort, and security (called "attachment preferences"), and previous studies on attachment preferences in emerging adults have focused only on the beginning of romantic relationships but not on the end of relationships. Czech…

Public Preferences Regarding Informed Consent Models for Participation in Population-based Genomic Research

PubMed Central

Platt, Jodyn; Bollinger, Juli; Dvoskin, Rachel; Kardia, Sharon LR; Kaufman, David

2013-01-01

Purpose Some large population biobanks that house biospecimens and health information for research seek broad consent from participants, while others re-consent for specific new studies. Understanding research participants’ attitudes and preferences about broad and narrow consent may improve recruitment, retention, and public support. Methods An online survey was conducted among a representative sample of 4,659 US adults to examine relationships between consent preferences and demographic factors, beliefs about privacy, the value of research, and the perceived trustworthiness of researchers. Results Participants preferred broad consent (52%) over study-by-study consent models (48%). Higher preferences for study-by-study consent observed among Black non-Hispanic respondents, and respondents with lower income and education were explained by differences in the prevalence of one or more beliefs about the study. Respondents with fears about research and those that would feel respected if asked for permission for each research use preferred study-by-study consent. Preference for broad consent was related to the desire not to be bothered with multiple requests and the belief that the study could lead to improved treatments, cures, and lives saved. Conclusion These data suggest that support for broad consent is contingent on sufficient information about data use. Work with research participants and community leaders to understand, respond to, and influence opinions about a given, ongoing study may improve uptake of broad consent. PMID:23660530

Science Choices and Preferences of Middle and Secondary School Students in Utah.

ERIC Educational Resources Information Center

Baird, J. Hugh; And Others

1984-01-01

Examined grades 6-12 students' (N=2000) preferences and choices regarding science subjects and relationships of these preferences to school type, age, and sex. Findings indicate that zoology and human anatomy/physiology were most preferred while ecology was least preferred. These and other findings are related to a previous study conducted in…

Study preferences for exemplar variability in self-regulated category learning.

PubMed

Wahlheim, Christopher N; DeSoto, K Andrew

2017-02-01

Increasing exemplar variability during category learning can enhance classification of novel exemplars from studied categories. Four experiments examined whether participants preferred variability when making study choices with the goal of later classifying novel exemplars. In Experiments 1-3, participants were familiarised with exemplars of birds from multiple categories prior to making category-level assessments of learning and subsequent choices about whether to receive more variability or repetitions of exemplars during study. After study, participants classified novel exemplars from studied categories. The majority of participants showed a consistent preference for variability in their study, but choices were not related to category-level assessments of learning. Experiment 4 provided evidence that study preferences were based primarily on theoretical beliefs in that most participants indicated a preference for variability on questionnaires that did not include prior experience with exemplars. Potential directions for theoretical development and applications to education are discussed.

Do Portuguese and UK health state values differ across valuation methods?

PubMed

Ferreira, Lara N; Ferreira, Pedro L; Rowen, Donna; Brazier, John E

2011-05-01

There has been an increasing interest in developing country-specific preference weights for widely used measures of health-related quality of life. The valuation of health states has usually been done using cardinal preference elicitation techniques of standard gamble (SG) or time trade-off (TTO). Yet there is increasing interest in the use of ordinal methods to elicit health state utility values as an alternative to the more conventional cardinal techniques.This raises the issue of firstly whether ordinal and cardinal methods of preference elicitation provide similar results and secondly whether this relationship is robust across different valuation studies and different populations. This study examines SG and rank preference weights for the SF-6D derived from samples of the UK and Portuguese general population. The preference weights for the Portuguese sample (n = 140) using rank data are estimated here with 810 health state valuations. The study further examines whether the use of these different preference weights has an impact when comparing the health of different age and severity groups in the Portuguese working population (n = 2,459). The rank model performed well across the majority of measures of goodness of fit used. The preference weights for the Portuguese sample using rank data are systematically lower than the UK weights for physical functioning and pain. Yet our results suggest higher similarity between preference weights derived using rank data than using standard gamble across the UK and Portuguese samples. Our results further suggest that the SF-6D values for a sample of the Portuguese working-age population and differences across groups are affected by the use of different preference weights. We suggest that the use of a Portuguese SF-6D weighting system is preferred for studies aiming to reflect the health state preferences of the Portuguese population.

Do we prescribe what patients prefer? Pilot study to assess patient preferences for medication regimen characteristics.

PubMed

Witticke, Diana; Seidling, Hanna Marita; Klimm, Hans-Dieter; Haefeli, Walter Emil

2012-01-01

The aim of this pilot study was to evaluate patients' self-reported attitudes towards medication-related factors known to impair adherence and to assess their prevalence in ambulatory care as an essential prerequisite to improve patient adherence. We conducted a face-to-face interview with 110 primary care patients maintained on at least one drug. For each drug, the patient was asked to specify medication-related factors of interest, ie, dosage form, dosage interval, required relationship with food intake, and the planned time of day for intake, and to rate the individual relevance of each prevalent parameter on a three-point Likert scale (discriminating between prefer, neutral, and dislike). Tablets with a once-daily dosage frequency were the most preferred dosage form, with a high prevalence in the ambulatory setting. Drug intake in the morning and evening were most preferred, and drug intake at noon was least preferred, but also had a low prevalence in contrast with drug intake independent of meals that was most preferred. Interestingly, only one quarter (26.4%) of all the patients were able to indicate clear preferences or dislikes. When patients are asked to specify their preferences for relevant medication regimen characteristics, they clearly indicated regimens that have been associated with better adherence in earlier studies. Therefore, our results suggest that adaptation of drug regimens to individual preferences might be a promising strategy to improve adherence. Because the German health care system may differ from other systems in relevant aspects, our findings should be confirmed by evaluation of patient preferences in other health care systems. Once generalizability of the study results is shown, these findings could be a promising basis upon which to promote patient adherence right from the beginning of drug therapy.

Preferential hydrophobic interactions are responsible for a preference of D-amino acids in the aminoacylation of 5'-AMP with hydrophobic amino acids

NASA Technical Reports Server (NTRS)

Lacey, J. C. Jr; Wickramasinghe, N. S.; Sabatini, R. S.

1992-01-01

We have studied the chemistry of aminoacyl AMP to model reactions at the 3' terminus of aminoacyl tRNA for the purpose of understanding the origin of protein synthesis. The present studies relate to the D, L preference in the esterification of 5'-AMP. All N-acetyl amino acids we studied showed faster reaction of the D-isomer, with a generally decreasing preference for D-isomer as the hydrophobicity of the amino acid decreased. The beta-branched amino acids, Ile and Val, showed an extreme preference for D-isomer. Ac-Leu, the gamma-branched amino acid, showed a slightly low D/L ratio relative to its hydrophobicity. The molecular basis for these preferences for D-isomer is understandable in the light of our previous studies and seems to be due to preferential hydrophobic interaction of the D-isomer with adenine. The preference for hydrophobic D-amino acids can be decreased by addition of an organic solvent to the reaction medium. Conversely, peptidylation with Ac-PhePhe shows a preference for the LL isomer over the DD isomer.

Alterations in taste perception due to recreational drug use are due to smoking a substance rather than ingesting it.

PubMed

Dovey, Terence M; Boyland, Emma J; Trayner, Penelope; Miller, Jo; Rarmoul-Bouhadjar, Amin; Cole, Jon; Halford, Jason C G

2016-12-01

Two studies explored the differences in tastant (salt, sour, bitter, sweet and spicy) concentration preference between recreational drug users and abstainers. In study 1, 250 opportunistically recruited abstainers, cannabis only users and multiple-drug users completed psychometric questionnaires and a concentration preference tastant test. In study 2, 76 participants purposefully recruited abstainers, daily tobacco users, recreational cannabis users and daily cannabis users completed the same protocol as study 1. Study 1 demonstrated that both multiple drug users and cannabis users had a higher preference for salt and sour tastants than abstainers. Study 2 showed that daily cannabis and tobacco users had a higher preference for sweet and spicy tastants than recreational cannabis users and abstainers. As predicted, recreational drug users scored higher on both sensation-seeking and impulsivity compared to abstainers. Participants who habitually smoke tobacco or cannabis daily have different concentration preference for specific tastants. The aim of the current study was to provide an explanation for the inconsistency in published results on taste preferences in recreational drug users. The data offered in this paper indicate that variation in recruitment strategy, definition of 'drug users', and mode of drug delivery, as well as multiple drug use, may explain the preference for stronger tastants in habitual drug users. Future research exploring the psychobiological underpinnings of the impact of drug use on food preferences should carefully define recreational drug user groups. Copyright © 2016 Elsevier Ltd. All rights reserved.

Hand preference for writing and associations with selected demographic and behavioral variables in 255,100 subjects: the BBC internet study.

PubMed

Peters, Michael; Reimers, Stian; Manning, John T

2006-11-01

In an Internet study unrelated to handedness, 134,317 female and 120,783 male participants answered a graded question as to which hand they preferred for writing. This allowed determination of hand preference patterns across 7 ethnic groups. Sex differences in left-handedness were found in 4 ethnic groups, favoring males, while no significant sex differences were found in three of the groups. Prevalence of left-handedness in the largest of the ethnic groups (self-labelled as "White") was comparable to contemporary hand preference data for this group [Gilbert, A. N., & Wysocki, C. J. (1992). Hand preference and age in the United states. Neuropsychologia, 30, 601-608] but the prevalence of left-handedness in individuals >70 years of age was considerably higher in the present study. Individuals who indicated "either" hand for writing preference had significantly lower spatial performance (mental rotation task) and significantly higher prevalence of hyperactivity, dyslexia, asthma than individuals who had clear left or right hand preferences, in support of Crow et al. [Crow, T., Crow, L., Done, D., & Leask, S. (1998). Relative hand skill predicts academic ability: global deficits at the point of hemispheric indecision. Neuropsychologia, 36, 1275-1282]. Similarly, an association of writing hand preference and non-heterosexual orientation was clearest for individuals with "either" writing hand responses. We conclude that contradictions in the literature as to whether or not these variables are linked to handedness stem largely from different definitions of hand preference. Due to a lack of statistical power in most studies in the literature, the "either" hand writing preference group that yielded the most salient results in this study is not normally available for analysis.

Kinematics of preferred and non-preferred handballing in Australian football.

PubMed

Parrington, Lucy; Ball, Kevin; MacMahon, Clare

2015-01-01

In Australian football (AF), handballing proficiently with both the preferred and non-preferred arm is important at elite levels; yet, little information is available for handballing on the non-preferred arm. This study compared preferred and non-preferred arm handballing techniques. Optotrak Certus (100 Hz) collected three-dimensional data for 19 elite AF players performing handballs with the preferred and non-preferred arms. Position data, range of motion (ROM), and linear and angular velocities were collected and compared between preferred and non-preferred arms using dependent t-tests. The preferred arm exhibited significantly greater forearm and humerus ROM and angular velocity and significantly greater shoulder angular velocity at ball contact compared to the non-preferred arm. In addition, the preferred arm produced a significantly greater range of lateral bend and maximum lower-trunk speed, maximum strike-side hip speed and hand speed at ball contact than the non-preferred arm. The non-preferred arm exhibited a significantly greater shoulder angle and lower- and upper-trunk orientation angle, but significantly lower support-elbow angle, trunk ROM, and trunk rotation velocity compared to the preferred arm. Reduced ROM and angular velocities found in non-preferred arm handballs indicates a reduction in the degrees of freedom and a less developed skill. Findings have implication for development of handballing on the non-preferred arm.

The Relationship between Partners' Family-Size Preferences in Southern Malawi.

PubMed

Yeatman, Sara; Sennott, Christie

2014-09-01

Studies of the relative influence of partners' fertility preferences on behaviors tend to treat preferences as fixed, largely independent traits despite existing theoretical arguments and empirical evidence suggesting that they are moving targets that may be jointly developed within relationships. In this study, we use couple-level panel data from married and unmarried young adults in southern Malawi to examine the relationship between partners' family-size preferences. We find evidence of assortative mating: young Malawians are more likely to partner with individuals who have similar family-size goals. Additionally, although partners' family-size preferences do not perfectly converge, changes among men's and women's preferences are significantly more likely to be "toward" than "away from" those of their partner. Our findings point to a need for studies regarding the relative influence of partners on reproductive outcomes to consider the interdependence of partners' preferences and the varied ways in which partners can influence shared reproductive behaviors. © 2014 The Population Council, Inc.

The Relationship between Partners’ Family-Size Preferences in Southern Malawi

PubMed Central

Yeatman, Sara; Sennott, Christie

2015-01-01

Studies of the relative influence of partners’ fertility preferences on behaviors tend to treat preferences as fixed, largely independent traits despite existing theoretical arguments and empirical evidence suggesting that they are moving targets that may be jointly developed within relationships. In this study, we use couple-level panel data from married and unmarried young adults in southern Malawi to examine the relationship between partners’ family-size preferences. We find evidence of assortative mating: young Malawians are more likely to partner with individuals who have similar family-size goals. Additionally, although partners’ family-size preferences do not perfectly converge, changes among men’s and women’s preferences are significantly more likely to be “toward” than “away from” those of their partner. Our findings point to a need for studies regarding the relative influence of partners on reproductive outcomes to consider the interdependence of partners’ preferences and the varied ways in which partners can influence shared reproductive behaviors. PMID:25207497

Caregiver Preference and Treatment Compliance in Patients with Mild-to-Moderate Alzheimer's Disease in South Korea: RECAP Study Results.

PubMed

Lee, Kang Joon; Cho, Seong-Jin; Kim, Byeong Chae; Park, Minseok; Lee, Jae-Hong

2017-02-01

The aim of this study was to assess caregiver preference and treatment compliance with oral and transdermal medications in a "real-world" setting in patients with mild-to-moderate Alzheimer's disease (AD) in South Korea. Real-world evaluation of compliance and preference in Alzheimer's disease treatment (RECAP) was a 24-week, multicenter, prospective, non-interventional study in patients with AD treated with oral or transdermal therapy. Here, we report data from patients living in South Korea. Eligible patients were grouped into one of two treatment cohorts: oral (donepezil, galantamine, rivastigmine, or memantine) or transdermal (rivastigmine patch). Caregiver preference, patient compliance, and physician preference were assessed at week 24 (end of the study). Safety was assessed by reported adverse events (AEs). A total of 398 patients were enrolled (oral 51.8%; transdermal 48.2%) and 79.4% completed the study. Caregivers of patients that were exposed to either the oral or transdermal monotherapy showed a preference for the treatment to which the patients were exposed (both p < 0.0001). However, caregivers of patients that were exposed to both forms of treatments reported a higher preference for transdermal monotherapy (65.9%; p < 0.0041). Patients in both treatment cohorts showed good compliance, with an overall mean (SD) score of 8.84 (1.514) (a median of 9). Of the 15 participating physicians, eight indicated their preference for transdermal therapy and seven preferred oral therapy at week 24. A total of 133 (33.4%) patients reported at least one AE during the study period (oral: 60 patients; transdermal: 73 patients). The study showed higher caregiver preference for transdermal monotherapy over oral monotherapy when patients with AD were exposed to both forms of treatment and good patient compliance for both oral and transdermal treatments.

A survey of factors influencing career preference in new-entrant and exiting medical students from four UK medical schools.

PubMed

Cleland, Jennifer A; Johnston, Peter W; Anthony, Micheal; Khan, Nadir; Scott, Neil W

2014-07-23

Workforce planning is a central issue for service provision and has consequences for medical education. Much work has been examined the career intentions, career preferences and career destinations of UK medical graduates but there is little published about medical students career intentions. How soon do medical students formulate careers intentions? How much do these intentions and preferences change during medical school? If they do change, what are the determining factors? Our aim was to compare medical students' career preferences upon entry into and exit from undergraduate medical degree programmes. This was a cross-sectional questionnaire survey. Two cohorts [2009-10, 2010-11] of first and final year medical students at the four Scottish graduating medical schools took part in career preference questionnaire surveys. Questions were asked about demographic factors, career preferences and influencing factors. The response rate was 80.9% [2682/3285]. Significant differences were found across the four schools, most obviously in terms of student origin [Scotland, rest of UK or overseas], age group, and specialty preferences in Year 1 and Year 5. Year 1 and Year 5 students' specialty preferences also differed within each school and, while there were some common patterns, each medical school had a different profile of students' career preferences on exit. When the analysis was adjusted for demographic and job-related preferences, specialty preferences differed by gender, and wish for work-life balance and intellectual satisfaction. This is the first multi-centre study exploring students' career preferences and preference influences upon entry into and exit from undergraduate medical degree programmes. We found various factors influenced career preference, confirming prior findings. What this study adds is that, while acknowledging student intake differs by medical school, medical school itself seems to influence career preference. Comparisons across medical school populations must therefore control for differences in input [the students] as well as context and process [the medical school] when looking at output [e.g., performance]. A robust, longitudinal study is required to explore how medical students' career preferences change as they progress through medical school and training to understand the influence of the learning environment on training choice and outcomes.

The Learning Preferences of Applicants Who Interview for General Surgery Residency: A Multiinstitutional Study.

PubMed

Kim, Roger H; Kurtzman, Scott H; Collier, Ashley N; Shabahang, Mohsen M

Learning styles theory posits that learners have distinct preferences for how they assimilate new information. The VARK model categorizes learners based on combinations of 4 learning preferences: visual (V), aural (A), read/write (R), and kinesthetic (K). A previous single institution study demonstrated that the VARK preferences of applicants who interview for general surgery residency are different from that of the general population and that learning preferences were associated with performance on standardized tests. This multiinstitutional study was conducted to determine the distribution of VARK preferences among interviewees for general surgery residency and the effect of those preferences on United States Medical Licensing Examination (USMLE) scores. The VARK learning inventory was administered to applicants who interviewed at 3 general surgery programs during the 2014 to 2015 academic year. The distribution of VARK learning preferences among interviewees was compared with that of the general population of VARK respondents. Performance on USMLE Step 1 and Step 2 Clinical Knowledge was analyzed for associations with VARK learning preferences. Chi-square, analysis of variance, and Dunnett's test were used for statistical analysis, with p < 0.05 considered statistically significant. The VARK inventory was completed by a total of 140 residency interviewees. Sixty-four percent of participants were male, and 41% were unimodal, having a preference for a single learning modality. The distribution of VARK preferences of interviewees was different than that of the general population (p = 0.02). By analysis of variance, there were no overall differences in USMLE Step 1 and Step 2 Clinical Knowledge scores by VARK preference (p = 0.06 and 0.21, respectively). However, multiple comparison analysis using Dunnett's test revealed that interviewees with R preferences had significantly higher scores than those with multimodal preferences on USMLE Step 1 (239 vs. 222, p = 0.02). Applicants who interview for general surgery residency have a different pattern of VARK preferences than that of the general population. Interviewees with preferences for read/write learning modalities have higher scores on the USMLE Step 1 than those with multimodal preferences. Learning preferences may have impact on residency applicant selection and represents a topic that warrants further investigation. Copyright © 2016 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

Medical students' preferences for problem-based learning in relation to culture and personality: a multicultural study.

PubMed

Holen, Are; Manandhar, Kedar; Pant, Devendra S; Karmacharya, Biraj M; Olson, Linda M; Koju, Rajendra; Mansur, Dil I

2015-07-19

The aim of this study was to explore positive and negative preferences towards problem-based learning in relation to personality traits and socio-cultural context. The study was an anonymous and voluntary cross-sectional survey of medical students (N=449) in hybrid problem-based curricula in Nepal, Norway and North Dakota. Data was collected on gender, age, year of study, cohabitation and medical school. The PBL Preference Inventory identified students' positive and negative preferences in relation to problem-based learning; the personality traits were detected by the NEO Five-Factor Inventory. The determinants of the two kinds of preferences were analyzed by hierarchical multiple linear regressions. Positive preferences were mostly determined by personality; associations were found with the traits Extra-version, Openness to experience, Conscientiousness and Neuroticism; the first three are related to sociability, curiosity and orderliness, the last, to mental health. The learn-ing environments of such curricula may be supportive for some and unnerving for others who score high on Neuroticism. Negative preferences were rather determined by culture, but also, they correlated with Neuroticism and Conscientiousness. Negative preferences were lower among females and students living in symmetrical relationships. Some high on Conscientiousness disliked group work, and the negative correlation with Agreeableness indicated that less sociable students were not predisposed to this kind of learning activity. Preferences related to problem-based learning were significantly and independently determined both by personality traits and culture. More insights into the nature of students' preferences may guide aspects of curriculum modifications and the daily facilitation of groups.

Men's preferences for women's body odours are not associated with human leucocyte antigen.

PubMed

Probst, Fabian; Fischbacher, Urs; Lobmaier, Janek S; Wirthmüller, Urs; Knoch, Daria

2017-10-11

Body odours reportedly portray information about an individual's genotype at the major histocompatibility complex (MHC, called human leucocyte antigen, HLA, in humans). While there is strong experimental support for MHC-associated mating behaviour in animals, the situation in humans is more complex. A lot of effort has been spent on testing HLA-associated odour preferences of women. To date, only very few studies have looked at HLA-linked olfactory preferences in men and these studies have revealed inconsistent results. Here, we investigate men's HLA-associated preferences for women's body odours. Importantly, and in contrast to previous studies, these odours were gathered at peak fertility (i.e. just before ovulation) when any HLA-associated odour preferences should be strongest. We scrutinized whether men's preference for women's body odours is influenced by (i) the number of shared HLA alleles between men and women, (ii) HLA heterozygosity, and (iii) the frequency of rare HLA alleles. We found that men could readily differentiate between odours they found attractive and odours they found less attractive, but that these preferences were not associated with HLA. Specifically, men did not prefer odours from women who are HLA dissimilar, HLA heterozygous, or who have rare HLA alleles. Together, these findings suggest that HLA has no effect on men's odour preferences. © 2017 The Author(s).

Music through the ages: Trends in musical engagement and preferences from adolescence through middle adulthood.

PubMed

Bonneville-Roussy, Arielle; Rentfrow, Peter J; Xu, Man K; Potter, Jeff

2013-10-01

Are there developmental trends in how individuals experience and engage with music? Data from 2 large cross-sectional studies involving more than a quarter of a million individuals were used to investigate age differences in musical attitudes and preferences from adolescence through middle age. Study 1 investigated age trends in musical engagement. Results indicated that (a) the degree of importance attributed to music declines with age but that adults still consider music important, (b) young people listen to music significantly more often than do middle-aged adults, and (c) young people listen to music in a wide variety of contexts, whereas adults listen to music primarily in private contexts. Study 2 examined age trends in musical preferences. Results indicated that (a) musical preferences can be conceptualized in terms of a 5-dimensional age-invariant model, (b) certain music-preference dimensions decrease with age (e.g., Intense, Contemporary), whereas preferences for other music dimensions increase with age (e.g., Unpretentious, Sophisticated), and (c) age trends in musical preferences are closely associated with personality. Normative age trends in musical preferences corresponded with developmental changes in psychosocial development, personality, and auditory perception. Overall, the findings suggest that musical preferences are subject to a variety of developmental influences throughout the life span.

Female partner preferences enhance offspring ability to survive an infection.

PubMed

Raveh, Shirley; Sutalo, Sanja; Thonhauser, Kerstin E; Thoß, Michaela; Hettyey, Attila; Winkelser, Friederike; Penn, Dustin J

2014-01-23

It is often suggested that mate choice enhances offspring immune resistance to infectious diseases. To test this hypothesis, we conducted a study with wild-derived house mice (Mus musculus musculus) in which females were experimentally mated either with their preferred or non-preferred male, and their offspring were infected with a mouse pathogen, Salmonella enterica (serovar Typhimurium). We found that offspring sired by preferred males were significantly more likely to survive the experimental infection compared to those sired by non-preferred males. We found no significant differences in the pathogen clearance or infection dynamics between the infected mice, suggesting that offspring from preferred males were better able to cope with infection and had improved tolerance rather than immune resistance. Our results provide the first direct experimental evidence within a single study that partner preferences enhance offspring resistance to infectious diseases.

When Preferences Are in the Way: Children's Predictions of Goal-Directed Behaviors.

PubMed

Yang, Fan; Frye, Douglas

2017-12-18

Across three studies, we examined 4- to 7-year-olds' predictions of goal-directed behaviors when goals conflict with preferences. In Study 1, when presented with stories in which a character had to act against basic preferences to achieve an interpersonal goal (e.g., playing with a partner), 6- and 7-year-olds were more likely than 4- and 5-year-olds to predict the actor would act in accordance with the goal to play with the partner, instead of fulfilling the basic preference of playing a favored activity. Similar results were obtained in Study 2 with scenarios that each involved a single individual pursuing intrapersonal goals that conflicted with his or her basic preferences. In Study 3, younger children's predictions of goal-directed behaviors did not increase for novel goals and preferences, when the influences of their own preferences, future thinking, or a lack of impulse control were minimized. The results suggest that between ages 4 and 7, children increasingly integrate and give more weight to other sources of motivational information (e.g., goals) in addition to preferences when predicting people's behaviors. This increasing awareness may have implications for children's self-regulatory and goal pursuit behaviors. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

The relationship between children's sensory processing patterns and their leisure preferences and participation patterns.

PubMed

Ismael, Noor T; Lawson, Lisa A Mische; Cox, Jane A

2015-12-01

Sensory processing patterns may be associated with children's preferences for different activities; however, knowledge about how different sensory processing patterns may relate to children's participation in leisure activities is scarce. This study investigated in what leisure activities children with extreme sensory processing patterns participate and if relationships exist between children's sensory processing patterns and their leisure preferences and participation patterns. This correlational study analyzed data from children's Sensory Profiles and reported play and leisure preferences. All 91 children in the sample completed the Children's Assessment for Participation and Enjoyment (CAPE) and the Preferences for Activities of Children (PAC). Parents of children ages 6 to 10 years completed the Sensory Profile, and children ages 11 to 14 years completed the Adolescent/Adult Sensory Profile. Children with different sensory processing patterns preferred both similar and distinct leisure activities. Low-registration quadrant summary z scores negatively correlated with CAPE overall diversity scores (rs=-.23, p=.03), sensitivity quadrant summary z scores negatively correlated with preferences for social activities (rs=-.23, p=.03) and preferences for skill-based activities (rs=-.22, p=.04), and avoiding quadrant summary z scores negatively correlated with preferences for social activities (rs=-.26, p=.01). Children's sensory preferences are related to leisure preferences and participation. © CAOT 2015.

Preference for place-of-death among terminally ill cancer patients in Denmark.

PubMed

Neergaard, Mette Asbjoern; Jensen, Anders Bonde; Sondergaard, Jens; Sokolowski, Ineta; Olesen, Frede; Vedsted, Peter

2011-12-01

Achieving home death is often seen as an important endpoint in palliative care, but no studies of the preferred place-of-death have yet been conducted in Scandinavia. Furthermore, we do not know if professionals' report on deceased patients' preference of place-of-death is a valid information. The aim of this study was to describe where terminally ill Danish cancer patients prefer to die and to determine if their preference changed during the palliative period, as reported retrospectively by bereaved relatives, general practitioners (GPs) and community nurses (CNs) and to assess the agreement of their accounts. The study was a population-based, cross-sectional combined register and questionnaire study in Aarhus County, Denmark. The population comprised 599 deceased adult cancer patients who had died from 1 March to 30 November 2006 and were identified through merging of health registers. Relatives returned 198 questionnaires about patients' preferred place-of-death, GPs 333 and CNs 201. The study showed that most terminally ill cancer patients preferred home death (up to 80.7%). The reported preference for home death weakened as death approached (down to 64.4%). A better congruence was seen between relatives' and GPs' accounts of preference for place of death at the end of the palliative period (κ 0.71) than between relatives' and CNs' accounts (κ 0.37). In conclusion, bereaved relatives (and GPs and CNs) report retrospectively that most terminally ill cancer patients wish to die at home. The preference weakened significantly as death approached. The agreement between relatives' and GPs' accounts on patients' preferences at the end of the palliative period was 'substantial', whereas the agreement between relatives' and CNs' accounts at the same time was significantly less outspoken. This indicates that CNs may be facing a problem in assessing their patients' wishes retrospectively. © 2011 The Authors. Scandinavian Journal of Caring Sciences © 2011 Nordic College of Caring Science.

The majority of men with lifelong premature ejaculation prefer daily drug treatment: an observation study in a consecutive group of Dutch men.

PubMed

Waldinger, Marcel D; Zwinderman, Aeilko H; Olivier, Berend; Schweitzer, Dave H

2007-07-01

Whether men with lifelong premature ejaculation (PE) prefer on-demand drug treatment to delay ejaculation time to daily drug treatment, has never been studied as a separate study question. To study how men with lifelong PE feel about the use of serotonergic antidepressants, and which option they would prefer for themselves: either a daily drug, a drug to be used on demand, or a topical anesthetic cream to be applied on demand. Treatment preference was determined by questionnaire. An observational questionnaire survey in a clinical sample. Preferences of different treatment strategies were queried before and after standard efficacy and safety information. A consecutive group of 88 men with lifelong PE who decided for themselves to be seen for rapid ejaculation was studied. The age was 37 +/- 11 years (mean +/- SD), range 18-64 years. None of these men was ever treated for PE and 21% used medication that did not affect sexual performance. Of them, 71 (81%) preferred a drug for daily use, 14 (16%) a drug on demand, while three men preferred topical anesthetic cream. Those men who initially preferred daily treatment did not change their view after standard information about efficacy and side effects, while 9 of 17 men who initially preferred on-demand drug treatment had switched their preferences to daily oral drug usage. Around 60% of men did not care about the nature of the drug, i.e., an antidepressant. The most frequently reported argument to prefer daily drug treatment was that this strategy would have the least effects toward the spontaneity of having sex. As opposed to agents that must be taken 4-6 hours prior to coitus and with the methods used here, this group of Dutch men with lifelong PE favor uninterrupted daily drug treatment to delay ejaculation mainly because daily treatment guarantees no interference with the spontaneity of having sex.

Correlated Preferences for Male Facial Masculinity and Partner Traits in Gay and Bisexual Men in China.

PubMed

Zheng, Lijun; Zheng, Yong

2015-07-01

Previous studies have documented the correlation between preferences for male facial masculinity and perceived masculinity: women who rate their male partner as more masculine tend to prefer more masculine faces. Men's self-rated masculinity predicts their female partner's preference for masculinity. This study examined the association between other trait preferences and preference for male facial masculinity among 556 gay and bisexual men across multiple cities in China. Participants were asked to choose the three most important traits in a romantic partner from a list of 23 traits. Each participant was then asked to choose a preferred face in each of 10 pairs of male faces presented sequentially, with each pair consisting of a masculinized and feminized version of the same base face. The results indicated that preferences for health and status-related traits were correlated with preferences for male facial masculinity in gay and bisexual men in China; individuals who were more health- or status-oriented in their preferences for a romantic partner preferred more masculine male faces than individuals with lower levels of these orientations. The findings have implications for the correlated preferences for facial masculinity and health- and status-related traits and may be related to perceived health and dominance/aggression of masculine faces based on a sample of non-Western gay and bisexual men.

Tobacco brand preference among Mexican adolescents.

PubMed

West, Joshua H; Hall, P Cougar; Page, Randy M; Trinidad, Dennis R; Lindsay, Gordon B

2012-01-01

Advertising plays a major role in smoking behavior and forming brand preferences. Additionally, the most advertised tobacco brands have also been the most preferred. Maintaining brand loyalty in Latin America remains a priority for the tobacco industry. The purpose of this study was to explore tobacco brand preference trends from 2003 to 2006, and explore marketing and advertising factors that might be associated with these trends. Data for this study came from Mexican adolescents residing in cities that participated in the Global Youth Tobacco Survey in both 2003 and 2006 and reported smoking either Marlboro or Camel cigarettes in the past 30 days. Respondents reported the brand name of their preferred cigarette during the past 30 days. Multivariate regression analysis was used to determine differences by brand preference and exposure to tobacco marketing and advertising, which was assessed using six items. In 2003, most adolescents preferred Marlboro. By 2006, older boys preferred Camel cigarettes to Marlboro, while girls' preference for Camel was similar to their preference for Marlboro. Adolescents that preferred Camel cigarettes in 2003 also reported greater exposure to tobacco marketing and advertising. Findings indicate that there are ongoing shifts in youth brand preference in Mexico, and that these shifts might be related to marketing and advertising practices. There is an ongoing need for monitoring marketing and advertising practices in an effort to protect adolescents from tobacco company exploits.

Random preferences towards bioenergy environmental externalities: a case study of woody biomass based electricity in the Southern United States

Treesearch

Andres Susaeta; Pankaj Lal; Janaki Alavalapati; Evan Mercer

2011-01-01

This paper contrasts alternate methodological approaches of investigating public preferences, the random parameter logit (RPL) where tastes and preferences of respondents are assumed to be heterogeneous and the conditional logit (CL) approach where tastes and preferences remain fixed for individuals. We conducted a choice experiment to assess preferences for woody...

Children's Preferences for Pediatric Dentist Attire: A Multicenter Study.

PubMed

Ram, Diana; Hermida, Maria Laura; Jerozolimsky, Andrea Braun; Slav, Or-Yan; Wang, Hao-Yu; Abbate, Florencia Puig; Rodriguez, Ana Lorente; Cuadros-Fernández, Cristina; Leon, Roberto Vofovics; Davidovich, Esti

2018-01-01

Data are conflicting regarding the effect of professional staff attire on children at pediatric dental clinics. To compare the preferences of children and their parents in three countries, regarding the gender and attire of pediatric dentists. A multi-centered study was conducted in pediatric dental clinics in Israel (N=100), Uruguay (N=270) and Spain (N=200). Children, aged 4-12 years, and their parents were asked to choose the pediatric dentist they preferred from 5 pictures of the same male and 5 pictures of the same female, in different attire. In Israeli clinics, where half of the pediatric dentists were male, and they wore white coats or casual attire, these were preferred by children, with no preference regarding the dentist's gender. In Spain, where the majority of dentists were females, wearing surgical scrubs, children preferred female dentists with this attire. In Uruguay, where female dentists wore surgical or pediatric scrubs, these were preferred by children. Parents more often selected female than male dentists; they preferred pediatric scrubs for their children's dentists more often than their children preferred such attire. Children's preferences for the attire of pediatric dentists reflected the common wearing apparel for dentists at the clinics they attended.

Breast Cancer Patients' Preferences for Adjuvant Radiotherapy Post Lumpectomy: Whole Breast Irradiation vs. Partial Breast Irradiation-Single Institutional Study.

PubMed

Bonin, Katija; McGuffin, Merrylee; Presutti, Roseanna; Harth, Tamara; Mesci, Aruz; Feldman-Stewart, Deb; Chow, Edward; Di Prospero, Lisa; Vesprini, Danny; Rakovitch, Eileen; Lee, Justin; Paszat, Lawrence; Doherty, Mary; Soliman, Hany; Ackerman, Ida; Cao, Xingshan; Kiss, Alex; Szumacher, Ewa

2018-02-01

This study was conducted to elucidate patients with early breast cancer preference for standard whole breast irradiation (WBI) or partial breast irradiation (PBI) following lumpectomy, as well as identify important factors for patients when making their treatment decisions. Based on relevant literature and ASTRO consensus statement guidelines, an educational tool and questionnaire were developed. Consenting, eligible women reviewed the educational tool and completed the trade-off questionnaire. Descriptive statistics were calculated, as well as chi-squares and a logistic regression model. Of the 90 patients who completed the study, 62 % preferred WBI, 30 % preferred PBI, 4 % required more information, and 3 % had no preferences. Of the patients who chose WBI, 58 % preferred hypofractionated RT, whereas 25 % preferred the conventional RT regimen. The majority of patients rated recurrence rate [WBI = 55/55 (100 %), PBI = 26/26 (100 %)] and survival [WBI = 54/55 (98 %), PBI = 26/26 (100 %)] as important factors contributing to their choice of treatment preference. Financial factors [WBI = 21/55 (38 %), PBI = 14/26 (53 %)] and convenience [WBI = 36/54 (67 %), PBI = 18/26 (69 %)] were rated as important less frequently. Significantly, more patients who preferred WBI also rated standard method of treatment as important when compared to patients who preferred PBI [WBI = 52/54 (96 %), PBI = 16/26 (61 %), χ 2  = 16.63, p = 0.001]. The majority of patients with early breast cancer who were surveyed for this study preferred WBI as an adjuvant treatment post lumpectomy, yet there was a sizeable minority who preferred PBI. This was associated with the importance patients place on standard treatment. These results will help medical professionals treat patients according to patient values.

Patient values and preferences for antithrombotic therapy in atrial fibrillation. A Narrative Systematic Review.

PubMed

Loewen, Peter S; Ji, Angela Tianshu; Kapanen, Anita; McClean, Alison

2017-06-02

Guidelines recommend that patients' values and preferences should be considered when selecting stroke prevention therapy for atrial fibrillation (SPAF). However, doing so is difficult, and tools to assist clinicians are sparse. We performed a narrative systematic review to provide clinicians with insights into the values and preferences of AF patients for SPAF antithrombotic therapy. Narrative systematic review of published literature from database inception. 1) What are patients' AF and SPAF therapy values and preferences? 2) How are SPAF therapy values and preferences affected by patient factors? 3) How does conveying risk information affect SPAF therapy preferences? and 4) What is known about patient values and preferences regarding novel oral anticoagulants (NOACs) for SPAF? Twenty-five studies were included. Overall study quality was moderate. Severe stroke was associated with the greatest disutility among AF outcomes and most patients value the stroke prevention efficacy of therapy more than other attributes. Utilities, values, and preferences about other outcomes and attributes of therapy are heterogeneous and unpredictable. Patients' therapy preferences usually align with their values when individualised risk information is presented, although divergence from this is common. Patients value the attributes of NOACs but frequently do not prefer NOACs over warfarin when all therapy-related attributes are considered. In conclusion, patients' values and preferences for SPAF antithrombotic therapy are heterogeneous and there is no substitute for directly clarifying patients' individual values and preferences. Research using choice modelling and tools to help clinicians and patients clarify their SPAF therapy values and preferences are needed.

Preferences for salty and sweet tastes are elevated and related to each other during childhood.

PubMed

Mennella, Julie A; Finkbeiner, Susana; Lipchock, Sarah V; Hwang, Liang-Dar; Reed, Danielle R

2014-01-01

The present study aimed to determine if salty and sweet taste preferences in children are related to each other, to markers of growth, and to genetic differences. We conducted a 2-day, single-blind experimental study using the Monell two-series, forced-choice, paired-comparison tracking method to determine taste preferences. The volunteer sample consisted of a racially/ethnically diverse group of children, 5-10 years of age (n = 108), and their mothers (n = 83). After excluding those mothers who did not meet eligibility and children who did not understand or comply with study procedures, the final sample was 101 children and 76 adults. The main outcome measures were most preferred concentration of salt in broth and crackers; most preferred concentration of sucrose in water and jelly; reported dietary intake of salty and sweet foods; levels of a bone growth marker; anthropometric measurements such as height, weight, and percent body fat; and TAS1R3 (sweet taste receptor) genotype. Children preferred higher concentrations of salt in broth and sucrose in water than did adults, and for both groups, salty and sweet taste preferences were significantly and positively correlated. In children, preference measures were related to reported intake of sodium but not of added sugars. Children who were tall for their age preferred sweeter solutions than did those that were shorter and percent body fat was correlated with salt preference. In mothers but not in children, sweet preference correlated with TAS1R3 genotype. For children, sweet and salty taste preferences were positively correlated and related to some aspects of real-world food intake. Complying with recommendations to reduce added sugars and salt may be more difficult for some children, which emphasizes the need for new strategies to improve children's diets.

Family preference for place of death mediates the relationship between patient preference and actual place of death: a nationwide retrospective cross-sectional study.

PubMed

Ishikawa, Yoshiki; Fukui, Sakiko; Saito, Toshiya; Fujita, Junko; Watanabe, Minako; Yoshiuchi, Kazuhiro

2013-01-01

Discrepancy between preferred and actual place of death is common in cancer patients. While previous research has elucidated the factors associated with congruence between patients' preferred and actual place of death, it is not known how the perspective of the family influences the place of death. This study examined whether family preference for place of death mediates the relationship between patient preference and actual place of death. A total of 258 cancer patients (home death, n = 142; hospital death, n = 116) who had received terminal care in Japan were analyzed. Measures included patients' demographic variables, patient and family preferences for place for death, actual place of death, patients' functional status, use and intensity of home care, availability of inpatient bed, living arrangement, and amount of extended family support. Patient-family congruence on preferred place of death was 66% in patients who died at home and 47% in patients who died at other places (kappa coefficient: 0.20 and 0.25, respectively). In a multiple logistic regression model, patients were more likely to die at home when patients were male (odds ratio [OR], 95% confidence interval [CI]: 2.53, 1.06-6.05) and when their family preferred death at home (OR, 95% CI: 37.37, 13.82-101.03). A Sobel test revealed that family preference mediated the relationship between patient preference and place of death (p<0.05). This study is, to our knowledge, the first to unveil the role of the family in the relationship between patient preference and place of death in Japan. In order to honor patients' wishes to die at home, supporting caregivers in the family may be an essential component of terminal care.

Colour preference between adults and children during a dental treatment session.

PubMed

Oner Ozdas, Didem; Kazak, Magrur

2017-02-01

It is evidently shown that colour has physical, psychological and sociological effects on human beings. There are many studies showing the effects of colours on brain activity. Colour preferences may change from childhood to adulthood and are significantly different in various age groups. The aim of this study was to evaluate the adults and children in their preference for mouthrinses in various colours under stress condition during a dental treatment session. 240 adults and 263 children were included in the study. Three transparent cups were filled with water, two of which were coloured green/pink rinsing by dissolving a tablet in the water. Cups were placed near the dental unit. During dental treatment sessions, patients were told to rinse their mouth with whichever cup they preferred. Preferred colour of cup, gender and age of patient, number of sessions were recorded. Data were statistically analysed by SPSS 15.0 programme and chi-square tests. Half of all cases preferred water. In adults, while females statistically significantly preferred water, males chose cups with coloured contents (p<0.01). Male adults preferred more than one rinsing solution in a dental treatment session. Children mostly preferred water. Even if adults preferred cups with coloured contents in multi-dental treatment sessions, children regularly preferred water (p<0.001). Female and male children mostly preferred water as a rinsing solution. Water was the most often choice for all patients. Both patients' gender and colours of cups affected choices made by adults and children. Female adults and children were not interested in trying colourful mouthrinses, while male adults were curious about trying colourful mouthrinses during dental treatment sessions under stress condition. Copyright © 2016 Elsevier Inc. All rights reserved.

Nursing students at a university - a study about learning style preferences.

PubMed

Hallin, Karin

2014-12-01

In most adult education, teachers use methods that assume all students learn in the same way. But knowledge of students' learning style preferences highlights the importance of adequate teaching and learning adaptation. The aim of the study was to describe and compare final year nursing students' learning style preferences in two campuses during three semesters. A further aim was to identify differences between learning style preferences and personal characteristics. A descriptive cross-sectional study using the Productivity Environmental Preference Survey (PEPS) questionnaire was conducted at a Swedish rural university. Three semester groups with 263 nursing students participated in 2012-2013. The majority of the students were 'flexible' in their learning style preferences and had none or few strong preferences. Students with strong preferences preferred high structure (75%) and an authority figure present (40%). About a third were highly auditory, tactile and/or kinesthetic while 8% were highly visual. Few significant differences were revealed between the groups of campuses and the groups of semesters or between learning style preferences and upper secondary school and care experience. There were no significant differences between learning style preferences and age and assistant nurse graduation. More women than men were highly motivated, auditory, tactile and kinesthetic and preferred structure and mobility. The PEPS questionnaire provides nursing students with self-awareness regarding their strengths and shortcomings in learning and teachers with a valuable and practical basis for their selection of adapted individual and group teaching methods. The findings suggest the need for wide variation and interactive teaching approaches, conscious didactic actions between cooperating teachers and conscious learning strategies for nursing students. Copyright © 2014 Elsevier Ltd. All rights reserved.

Plants or animals - which do junior high school students prefer to study?

NASA Astrophysics Data System (ADS)

Wandersee, James H.

This research addressed the following questions: (1) Which science topic do junior high school students prefer to study - plants or animals? (2) Is their preference related to the variables of grade level and sex of student? Public school students from grades 7, 8, and 9 in Avoca, New York participated in the study. Findings show that 9th grade students have a greater interest in biological science topics than do students in the other grades studied. Girls are more interested in biological science topics than boys are. Girls also showed a significant preference for animals over plants. As a group, junior high school students revealed that they prefer animal study over plant study. About half of the student responses categorized as biological science did not express a clear-cut preference for either plants or animals. A caution about generalizability is expressed. Interviews of students suggest that the following characteristics of animals are important determinants of preferences: Animals move, eat, have eyes for sight, communicate by sound, exhibit behaviors that are fun to watch, have short and observable live cycles, interact with humans, can learn, have mates, give birth, and raise their young. It was obvious that most students think of mammals when they hear the term animal.

WHAT IS THE ROLE OF COMMUNITY PREFERENCE INFORMATION IN HEALTH TECHNOLOGY ASSESSMENT DECISION MAKING? A CASE STUDY OF COLORECTAL CANCER SCREENING.

PubMed

Wortley, Sally; Flitcroft, Kathy; Howard, Kirsten

2015-01-01

The aim of this study was to determine the role of community preference information from discrete choice studies of colorectal cancer (CRC) screening in health technology assessment (HTA) reports and subsequent policy decisions. We undertook a systematic review of discrete choice studies of CRC screening. Included studies were reviewed to assess the policy context of the research. For those studies that cited a recent or pending review of CRC screening, further searches were undertaken to determine the extent to which community preference information was incorporated into the HTA decision-making process. Eight discrete choice studies that evaluated preferences for CRC screening were identified. Four of these studies referred to a national or local review of CRC screening in three countries: Australia, Canada, and the Netherlands. Our review of subsequently released health policy documents showed that while consideration was given to community views on CRC, policy was not informed by discrete choice evidence. Preferences and values of patients are increasingly being considered "evidence" to be incorporated into HTA reports. Discrete choice methodology is a rigorous quantitative method for eliciting preferences and while as a methodology it is growing in profile, it would appear that the results of such research are not being systematically translated or integrated into HTA reports. A formalized approach is needed to incorporate preference literature into the HTA decision-making process.

A Study of Children's Musical Preference: A Data Mining Approach

ERIC Educational Resources Information Center

Yim, Hoi Yin Bonnie; Boo, Yee Ling; Ebbeck, Marjory

2014-01-01

Musical preference has long been a research interest in the field of music education, and studies consistently confirm the importance of musical preference in one's musical learning experiences. However, only a limited number of studies have been focussed on the field of early childhood education (e.g., Hargreaves, North, & Tarrant, 2006;…

Preference limits of the visual dynamic range for ultra high quality and aesthetic conveyance

NASA Astrophysics Data System (ADS)

Daly, Scott; Kunkel, Timo; Sun, Xing; Farrell, Suzanne; Crum, Poppy

2013-03-01

A subjective study was conducted to investigate the preferred maximum and minimum display luminances in order to determine the dynamic ranges for future displays. Two studies address the diffuse reflective regions, and a third study tested preferences of highlight regions. Preferences, as opposed to detection thresholds, were studied to provide results more directly relevant to the viewing of entertainment or art. Test images were specifically designed to test these limits without the perceptual conflicts that usually occur in these types of studies. For the diffuse range, we found a display with a dynamic range having luminances between 0.1 and 650 cd/m2 matches the average preferences. However, to satisfy 90% of the population, a dynamic range from 0.005 and ~3,000 cd/m2 is needed. Since a display should be able to produce values brighter than the diffuse white maximum, as in specular highlights and emissive sources, the highlight study concludes that even the average preferred maximum luminance for highlight reproduction is ~4,000 cd/m2.

Comparing individual preferences for four meditation techniques: Zen, Vipassana (Mindfulness), Qigong, and Mantra.

PubMed

Burke, Adam

2012-01-01

A significant number of studies have been published examining the mind-body effects of meditation and its clinical efficacy. There are very few studies, however, which directly compare different meditation methods with each other to explore potentially distinct mechanisms and effects, and no studies comparing individual preferences for different methods. As preference is seen as an important factor in consumer healthcare decision making, greater understanding of this aspect is needed as meditation becomes a more widely used therapeutic modality. For this reason a pilot study was conducted to compare four meditation techniques for personal preference. A within-subjects comparison design was employed. A convenience sample of 247 undergraduate university students participated in the study. Participants learned two open observing meditation techniques-Vipassana (Mindfulness) and Zen, and two focused attention techniques-Mantra and Qigong Visualization, practicing one method per week. At the end of a six-week training period participants ranked the four meditation methods in order of personal preference. Ranking of subjective preference of meditations practiced. A within subjects comparison revealed that significantly more participants chose Vipassana or Mantra meditation as their preferred techniques compared with Qigong Visualization and Zen. This study provides information on differences in preference for type of meditation. As the benefits of meditation accrue over time, selecting a method that motivates sustained practice is a critical objective if therapeutic effects are to be achieved. Copyright © 2012 Elsevier Inc. All rights reserved.

Color Perception in Pediatric Patient Room Design: American versus Korean Pediatric Patients.

PubMed

Phillip Park, Jin Gyu; Park, Changbae

2013-01-01

This study simultaneously addresses the issues of the scarcity of information about pediatric patient color preferences, conflicting findings about the impact of culture on color preferences, and limitations of previous research instruments. Effects of culture and gender on color preferences were investigated using American and Korean pediatric patients. Much of the existing research in environmental design has focused on environments for healthy children and adults, but those findings cannot be confidently applied to environments for pediatric patients. In previous studies, the impact of culture on color preferences has been suggested, though the effects appear to vary. Moreover, the results of previous studies were typically based on perceptions of small color chips, which are different from seeing a color on wall surfaces. Previous studies also failed to control for confounding variables such as color attributes and light sources. Instead of using color chips, this study used physical model simulation to investigate environmental color preferences in real contexts. Cultural difference was found in white. Other than white, no significant cultural difference was found. Gender differences were found across both of the groups. Korean pediatric patients showed significantly higher preference scores for white than Americans did. Other than white, both groups reported blue and green as their most preferred colors; white was the least preferred. Both groups reported similar gender effects. Overall, male patients reported significantly lower preference scores for red and purple than female patients did. These results can help healthcare providers and professionals better understand appropriate colors for pediatric populations. Evidence-based design, healing environment, patients, pediatric, satisfaction.

Musical Preferences are Linked to Cognitive Styles.

PubMed

Greenberg, David M; Baron-Cohen, Simon; Stillwell, David J; Kosinski, Michal; Rentfrow, Peter J

2015-01-01

Why do we like the music we do? Research has shown that musical preferences and personality are linked, yet little is known about other influences on preferences such as cognitive styles. To address this gap, we investigated how individual differences in musical preferences are explained by the empathizing-systemizing (E-S) theory. Study 1 examined the links between empathy and musical preferences across four samples. By reporting their preferential reactions to musical stimuli, samples 1 and 2 (Ns = 2,178 and 891) indicated their preferences for music from 26 different genres, and samples 3 and 4 (Ns = 747 and 320) indicated their preferences for music from only a single genre (rock or jazz). Results across samples showed that empathy levels are linked to preferences even within genres and account for significant proportions of variance in preferences over and above personality traits for various music-preference dimensions. Study 2 (N = 353) replicated and extended these findings by investigating how musical preferences are differentiated by E-S cognitive styles (i.e., 'brain types'). Those who are type E (bias towards empathizing) preferred music on the Mellow dimension (R&B/soul, adult contemporary, soft rock genres) compared to type S (bias towards systemizing) who preferred music on the Intense dimension (punk, heavy metal, and hard rock). Analyses of fine-grained psychological and sonic attributes in the music revealed that type E individuals preferred music that featured low arousal (gentle, warm, and sensual attributes), negative valence (depressing and sad), and emotional depth (poetic, relaxing, and thoughtful), while type S preferred music that featured high arousal (strong, tense, and thrilling), and aspects of positive valence (animated) and cerebral depth (complexity). The application of these findings for clinicians, interventions, and those on the autism spectrum (largely type S or extreme type S) are discussed.

Musical Preferences are Linked to Cognitive Styles

PubMed Central

Greenberg, David M.; Baron-Cohen, Simon; Stillwell, David J.; Kosinski, Michal; Rentfrow, Peter J.

2015-01-01

Why do we like the music we do? Research has shown that musical preferences and personality are linked, yet little is known about other influences on preferences such as cognitive styles. To address this gap, we investigated how individual differences in musical preferences are explained by the empathizing-systemizing (E-S) theory. Study 1 examined the links between empathy and musical preferences across four samples. By reporting their preferential reactions to musical stimuli, samples 1 and 2 (Ns = 2,178 and 891) indicated their preferences for music from 26 different genres, and samples 3 and 4 (Ns = 747 and 320) indicated their preferences for music from only a single genre (rock or jazz). Results across samples showed that empathy levels are linked to preferences even within genres and account for significant proportions of variance in preferences over and above personality traits for various music-preference dimensions. Study 2 (N = 353) replicated and extended these findings by investigating how musical preferences are differentiated by E-S cognitive styles (i.e., ‘brain types’). Those who are type E (bias towards empathizing) preferred music on the Mellow dimension (R&B/soul, adult contemporary, soft rock genres) compared to type S (bias towards systemizing) who preferred music on the Intense dimension (punk, heavy metal, and hard rock). Analyses of fine-grained psychological and sonic attributes in the music revealed that type E individuals preferred music that featured low arousal (gentle, warm, and sensual attributes), negative valence (depressing and sad), and emotional depth (poetic, relaxing, and thoughtful), while type S preferred music that featured high arousal (strong, tense, and thrilling), and aspects of positive valence (animated) and cerebral depth (complexity). The application of these findings for clinicians, interventions, and those on the autism spectrum (largely type S or extreme type S) are discussed. PMID:26200656

Assessment of Preferences for Treatment: Validation of a Measure

PubMed Central

Sidani, Souraya; Epstein, Dana R.; Bootzin, Richard R.; Moritz, Patricia; Miranda, Joyal

2009-01-01

Systematic measurement of treatment preferences is needed to obtain well-informed preferences. Guided by a conceptualization of treatment preferences, a measure was developed to assess treatment acceptability and preference. The purpose of this study was to evaluate the psychometric properties of the Treatment Acceptability and Preferences (TAP) measure. The TAP measure contains a description of each treatment under evaluation, items to rate its acceptability, and questions about participants’ preferred treatment option. The items measuring treatment acceptability were internally consistent (alpha > .80) and demonstrated validity, evidenced by a one-factor structure and differences in the scores between participants with preferences for particular interventions. The TAP measure has the potential for the assessment of acceptability and preferences for various behavioral interventions. PMID:19434647

Assessing potency of high- and low-preference reinforcers with respect to response rate and response patterns.

PubMed

Penrod, Becky; Wallace, Michele D; Dyer, Edwin J

2008-01-01

Previous research has suggested that the availability of high-preference stimuli may override the reinforcing efficacy of concurrently available low-preference stimuli under relatively low schedule requirements (e.g., fixed-ratio 1 schedule). It is unknown if similar effects would be obtained under higher schedule requirements. Thus, the current study compared high-preference and low-preference reinforcers under progressively increasing schedule requirements. Results for 3 of the 4 participants indicated that high-preference stimuli maintained responding under higher schedule requirements relative to low-preference stimuli. For 1 participant, high-preference and low-preference stimuli were demonstrated to be equally effective reinforcers under increasing schedule requirements. Implications with respect to rate of performance and response patterns are discussed.

Values and preferences in oral anticoagulation in patients with atrial fibrillation, physicians' and patients' perspectives: protocol for a two-phase study.

PubMed

Alonso-Coello, Pablo; Montori, Victor M; Solà, Ivan; Schünemann, Holger J; Devereaux, Philipe; Charles, Cathy; Roura, Mercè; Díaz, M Gloria; Souto, Juan Carlos; Alonso, Rafael; Oliver, Sven; Ruiz, Rafael; Coll-Vinent, Blanca; Diez, Ana Isabel; Gich, Ignasi; Guyatt, Gordon

2008-10-27

Oral anticoagulation prevents strokes in patients with atrial fibrillation but, for reasons that remain unclear, less than 40% of all patients with atrial fibrillation receive warfarin. The literature postulates that patient and clinician preferences may explain this low utilization. The proposed research seeks to answer the following questions: i) When assessed systematically, do patients' and clinicians' preferences explain the utilization of warfarin to prevent strokes associated with atrial fibrillation? ii) To what extent do patients' and clinicians' treatment preferences differ? iii) What factors explain any differences that exist in treatment preferences between patients and clinicians? To answer these questions we will conduct a two-phase study of patient and clinician preferences for health states and treatments. In the first phase of this study we will conduct structured interviews to determine their treatment preferences for warfarin vs. aspirin to prevent strokes associated with atrial fibrillation using the probability trade-off technique. In the same interview, we will conduct preference-elicitation exercises using the feeling thermometer to identify the utilities that patients place on taking medication (warfarin and aspirin), and on having a mild stroke, a severe stroke, and a major bleed. In the second phase of the study we will convene focus groups of clinicians and patients to explore their answers to the exercises in the first phase. This is a study of patient and clinician preferences for health states and treatments. Because of its clinical importance and our previous work in this area, we will conduct our study in the clinical context of the decision to use antithrombotic agents to reduce the risk of stroke in patients with non-valvular chronic atrial fibrillation.

Evaluation of color preference in zebrafish for learning and memory.

PubMed

Avdesh, Avdesh; Martin-Iverson, Mathew T; Mondal, Alinda; Chen, Mengqi; Askraba, Sreten; Morgan, Newman; Lardelli, Michael; Groth, David M; Verdile, Giuseppe; Martins, Ralph N

2012-01-01

There is growing interest in using zebrafish (Danio rerio) as a model of neurodegenerative disorders such as Alzheimer's disease. A zebrafish model of tauopathies has recently been developed and characterized in terms of presence of the pathological hallmarks (i.e., neurofibrillary tangles and cell death). However, it is also necessary to validate these models for function by assessing learning and memory. The majority of tools to assess memory and learning in animal models involve visual stimuli, including color preference. The color preference of zebrafish has received little attention. To validate zebrafish as a model for color-associated-learning and memory, it is necessary to evaluate its natural preferences or any pre-existing biases towards specific colors. In the present study, we have used four different colors (red, yellow, green, and blue) to test natural color preferences of the zebrafish using two procedures: Place preference and T-maze. Results from both experiments indicate a strong aversion toward blue color relative to all other colors (red, yellow, and green) when tested in combinations. No preferences or biases were found among reds, yellows, and greens in the place preference procedure. However, red and green were equally preferred and both were preferred over yellow by zebrafish in the T-maze procedure. The results from the present study show a strong aversion towards blue color compared to red, green, and yellow, with yellow being less preferred relative to red and green. The findings from this study may underpin any further designing of color-based learning and memory paradigms or experiments involving aversion, anxiety, or fear in the zebrafish.

Beyond the treatment effect: Evaluating the effects of patient preferences in randomised trials.

PubMed

Walter, S D; Turner, R; Macaskill, P; McCaffery, K J; Irwig, L

2017-02-01

The treatments under comparison in a randomised trial should ideally have equal value and acceptability - a position of equipoise - to study participants. However, it is unlikely that true equipoise exists in practice, because at least some participants may have preferences for one treatment or the other, for a variety of reasons. These preferences may be related to study outcomes, and hence affect the estimation of the treatment effect. Furthermore, the effects of preferences can sometimes be substantial, and may even be larger than the direct effect of treatment. Preference effects are of interest in their own right, but they cannot be assessed in the standard parallel group design for a randomised trial. In this paper, we describe a model to represent the impact of preferences on trial outcomes, in addition to the usual treatment effect. In particular, we describe how outcomes might differ between participants who would choose one treatment or the other, if they were free to do so. Additionally, we investigate the difference in outcomes depending on whether or not a participant receives his or her preferred treatment, which we characterise through a so-called preference effect. We then discuss several study designs that have been proposed to measure and exploit data on preferences, and which constitute alternatives to the conventional parallel group design. Based on the model framework, we determine which of the various preference effects can or cannot be estimated with each design. We also illustrate these ideas with some examples of preference designs from the literature.

Graduate Student Preferences in Online Environment

ERIC Educational Resources Information Center

Keener, Cheryl P.

2017-01-01

This research explored online graduate students' preferences using the Constructivist Internet-Based Learning Environment Survey (CILES) and how everyday learner attributes affected their preferences. The purpose of this study was to identify graduate students' preferences for various types of learning in order to aid designers with aligning…

Individual Dlfferences in Children's Preferences among Recent Paintings.

ERIC Educational Resources Information Center

Bell, R.; Bell, G.

1979-01-01

Preferences of Melbourne, Australia, students for twentieth-century paintings were examined. The identified dimensions of preference (represention, color, complexity) were similar to those found in previous studies. Age and sex differences were found only for color and complexity. Preference for representational, over nonrepresentational,…

Individual differences in bitter taste preferences are associated with antisocial personality traits.

PubMed

Sagioglou, Christina; Greitemeyer, Tobias

2016-01-01

In two studies, we investigated how bitter taste preferences might be associated with antisocial personality traits. Two US American community samples (total N = 953; mean age = 35.65 years; 48% females) self-reported their taste preferences using two complementary preference measures and answered a number of personality questionnaires assessing Machiavellianism, psychopathy, narcissism, everyday sadism, trait aggression, and the Big Five factors of personality. The results of both studies confirmed the hypothesis that bitter taste preferences are positively associated with malevolent personality traits, with the most robust relation to everyday sadism and psychopathy. Regression analyses confirmed that this association holds when controlling for sweet, sour, and salty taste preferences and that bitter taste preferences are the overall strongest predictor compared to the other taste preferences. The data thereby provide novel insights into the relationship between personality and the ubiquitous behaviors of eating and drinking by consistently demonstrating a robust relation between increased enjoyment of bitter foods and heightened sadistic proclivities. Copyright © 2015 Elsevier Ltd. All rights reserved.

Women's birth place preferences in the United Kingdom: a systematic review and narrative synthesis of the quantitative literature.

PubMed

Hollowell, Jennifer; Li, Yangmei; Malouf, Reem; Buchanan, James

2016-08-08

Current clinical guidelines and national policy in England support offering 'low risk' women a choice of birth setting, but despite an increase in provison of midwifery units in England the vast majority of women still give birth in obstetric units and there is uncertainty around how best to configure services. There is therefore a need to better understand women's birth place preferences. The aim of this review was to summarise the recent quantitative evidence on UK women's birth place preferences with a focus on identifying the service attributes that 'low risk' women prefer and on identifying which attributes women prioritise when choosing their intended maternity unit or birth setting. We searched Medline, Embase, PsycINFO, Science Citation Index, Social Science Index, CINAHL and ASSIA to identify quantitative studies published in scientific journals since 1992 and designed to describe and explore women's preferences in relation to place of birth. We included experimental stated preference studies, surveys and mixed-methods studies containing relevant quantitative data, where participants were 'low risk' or 'unselected' groups of women with experience of UK maternity services. We included five experimental stated preference studies and four observational surveys, including a total of 4201 respondents. Most studies were old with only three conducted since 2000. Methodological quality was generally poor. The attributes and preferences most commonly explored related to pain relief, continuity of midwife, involvement/availability of medical staff, 'homely' environment/atmosphere, decision-making style, distance/travel time and need for transfer. Service attributes that were almost universally valued by women included local services, being attended by a known midwife and a preference for a degree of control and involvement in decision-making. A substantial proportion of women had a strong preference for care in a hospital setting where medical staff are not necessarily involved in their care, but are readily available. The majority of women appear to value some service attributes while preferences differ for others. Policy makers, commissioners and service providers might usefully consider how to extend the availability of services that most women value while offering a choice of options that enable women to access services that best fit their needs and preferences.

Preferred Place of Care and Death in Terminally Ill Patients with Lung and Heart Disease Compared to Cancer Patients.

PubMed

Skorstengaard, Marianne H; Neergaard, Mette A; Andreassen, Pernille; Brogaard, Trine; Bendstrup, Elisabeth; Løkke, Anders; Aagaard, Susanne; Wiggers, Henrik; Bech, Per; Jensen, Anders B

2017-11-01

The dual aim of this study is, first, to describe preferred place of care (PPOC) and preferred place of death (PPOD) in terminally ill patients with lung and heart diseases compared with cancer patients and second, to describe differences in level of anxiety among patients with these diagnoses. Previous research on end-of-life preferences focuses on cancer patients, most of whom identify home as their PPOC and PPOD. These preferences may, however, not mirror those of patients suffering from nonmalignant fatal diseases. The study was designed as a cross-sectional study. Eligible patients from the recruiting departments filled in questionnaires regarding sociodemographics, PPOC and PPOD, and level of anxiety. Of the 354 eligible patients, 167 patients agreed to participate in the study. Regardless of their diagnosis, most patients wished to be cared for and to die at home. Patients with cancer and heart diseases chose hospice as their second most common preference for both PPOC and PPOD, whereas patients with lung diseases chose nursing home and hospice equally frequent as their second most common preference. Regardless of their diagnosis, all patients had a higher level of anxiety than the average Danish population; patients with heart diseases had a much higher level of anxiety than patients with lung diseases and cancer. Patient preferences for PPOC and PPOD vary according to their diagnoses; tailoring palliative needs to patients' preferences is important regardless of their diagnosis.

Developing a National-Level Concept Dictionary for EHR Implementations in Kenya.

PubMed

Keny, Aggrey; Wanyee, Steven; Kwaro, Daniel; Mulwa, Edwin; Were, Martin C

2015-01-01

The increasing adoption of Electronic Health Records (EHR) by developing countries comes with the need to develop common terminology standards to assure semantic interoperability. In Kenya, where the Ministry of Health has rolled out an EHR at 646 sites, several challenges have emerged including variable dictionaries across implementations, inability to easily share data across systems, lack of expertise in dictionary management, lack of central coordination and custody of a terminology service, inadequately defined policies and processes, insufficient infrastructure, among others. A Concept Working Group was constituted to address these challenges. The country settled on a common Kenya data dictionary, initially derived as a subset of the Columbia International eHealth Laboratory (CIEL)/Millennium Villages Project (MVP) dictionary. The initial dictionary scope largely focuses on clinical needs. Processes and policies around dictionary management are being guided by the framework developed by Bakhshi-Raiez et al. Technical and infrastructure-based approaches are also underway to streamline workflow for dictionary management and distribution across implementations. Kenya's approach on comprehensive common dictionary can serve as a model for other countries in similar settings.

The clinical effect of nicorandil on perioperative myocardial protection in patients undergoing elective PCI: A Systematic Review and Meta-Analysis.

PubMed

Ye, Ziliang; Su, Qiang; Li, Lang

2017-03-21

Many scholars have studied the effect of nicorandil on perioperative myocardial protection in patients undergoing elective percutaneous coronary intervention (PCI), but results are inconsistent. Therefore, we performed this meta-analysis. Finally, 16 articles, including 1616 patients, were included into this meta-analysis. Meta-analysis results showed that: (1) Nicorandil can reduce the level of CK-MB after PCI, including at 6 hours, 12 hours, 18 hours and 24 hours. (2) Nicorandil can reduce the level of TnT after PCI, including at 6 hours, 12 hours, 18 hours and 24 hours. (3) Nicorandil can reduce the incidence of adverse reactions after PCI. (4) Nicorandil cannot reduce the level of MVP after PCI, including at 12 hours and 24 hours. (5) Subgroup analysis showed that nicorandil can reduce CK-MB and TnT level at 24 hours after PCI for Chinese's population (P < 0.05), but can not reduce CK-MB and TnT level at 24 hours after PCI for non Chinese's population (P > 0.05). Our meta-analysis indicate that nicorandil can reduce myocardial injury and reduce the incidence of adverse reaction caused by PCI for Chinese's population, but is not obvious for non Chinese's population. However, this conclusion still needs to be confirmed in the future.

Angiotensin receptors modulate the renal hemodynamic effects of nitric oxide in conscious newborn lambs

PubMed Central

Vinturache, Angela E.; Smith, Francine G.

2014-01-01

Abstract This study aimed to elucidate the roles of both angiotensin II (ANG II) receptors – type 1 (AT1Rs) and type 2 (AT2Rs) – separately and together in influencing hemodynamic effects of endogenously produced nitric oxide (NO) during postnatal development. In conscious, chronically instrumented lambs aged ~1 week (8 ± 1 days, N = 8) and ~6 weeks (41 ± 2 days, N = 8), systolic, diastolic, and mean arterial pressure (SAP, DAP, MAP) and venous pressure (MVP), renal blood flow (RBF), and renal vascular resistance (RVR) were measured in response to the l‐arginine analog, l‐NAME after pretreatment with either the AT1R antagonist, ZD 7155, the AT2R antagonist, PD 123319, or both antagonists. The increase in SAP, DAP, and MAP by l‐NAME was not altered by either ATR antagonist in either age group. The increase in RBF after l‐NAME was, however, altered by both ATR antagonists in an age‐dependent manner, which was mediated predominantly through AT2Rs in newborn lambs. These findings reveal that there is an age‐dependent interaction between the renin–angiotensin (RAS) and the NO pathway in regulating renal but not systemic hemodynamics through both ATRs, whereas AT2Rs appear to be important in the renal hemodynamic effects of NO early in life. PMID:24872358

An Adaptive Nonlinear Basal-Bolus Calculator for Patients With Type 1 Diabetes

PubMed Central

Boiroux, Dimitri; Aradóttir, Tinna Björk; Nørgaard, Kirsten; Poulsen, Niels Kjølstad; Madsen, Henrik; Jørgensen, John Bagterp

2016-01-01

Background: Bolus calculators help patients with type 1 diabetes to mitigate the effect of meals on their blood glucose by administering a large amount of insulin at mealtime. Intraindividual changes in patients physiology and nonlinearity in insulin-glucose dynamics pose a challenge to the accuracy of such calculators. Method: We propose a method based on a continuous-discrete unscented Kalman filter to continuously track the postprandial glucose dynamics and the insulin sensitivity. We augment the Medtronic Virtual Patient (MVP) model to simulate noise-corrupted data from a continuous glucose monitor (CGM). The basal rate is determined by calculating the steady state of the model and is adjusted once a day before breakfast. The bolus size is determined by optimizing the postprandial glucose values based on an estimate of the insulin sensitivity and states, as well as the announced meal size. Following meal announcements, the meal compartment and the meal time constant are estimated, otherwise insulin sensitivity is estimated. Results: We compare the performance of a conventional linear bolus calculator with the proposed bolus calculator. The proposed basal-bolus calculator significantly improves the time spent in glucose target (P < .01) compared to the conventional bolus calculator. Conclusion: An adaptive nonlinear basal-bolus calculator can efficiently compensate for physiological changes. Further clinical studies will be needed to validate the results. PMID:27613658

Application of the whole-transcriptome shotgun sequencing approach to the study of Philadelphia-positive acute lymphoblastic leukemia

PubMed Central

Iacobucci, I; Ferrarini, A; Sazzini, M; Giacomelli, E; Lonetti, A; Xumerle, L; Ferrari, A; Papayannidis, C; Malerba, G; Luiselli, D; Boattini, A; Garagnani, P; Vitale, A; Soverini, S; Pane, F; Baccarani, M; Delledonne, M; Martinelli, G

2012-01-01

Although the pathogenesis of BCR–ABL1-positive acute lymphoblastic leukemia (ALL) is mainly related to the expression of the BCR–ABL1 fusion transcript, additional cooperating genetic lesions are supposed to be involved in its development and progression. Therefore, in an attempt to investigate the complex landscape of mutations, changes in expression profiles and alternative splicing (AS) events that can be observed in such disease, the leukemia transcriptome of a BCR–ABL1-positive ALL patient at diagnosis and at relapse was sequenced using a whole-transcriptome shotgun sequencing (RNA-Seq) approach. A total of 13.9 and 15.8 million sequence reads was generated from de novo and relapsed samples, respectively, and aligned to the human genome reference sequence. This led to the identification of five validated missense mutations in genes involved in metabolic processes (DPEP1, TMEM46), transport (MVP), cell cycle regulation (ABL1) and catalytic activity (CTSZ), two of which resulted in acquired relapse variants. In all, 6390 and 4671 putative AS events were also detected, as well as expression levels for 18 315 and 18 795 genes, 28% of which were differentially expressed in the two disease phases. These data demonstrate that RNA-Seq is a suitable approach for identifying a wide spectrum of genetic alterations potentially involved in ALL. PMID:22829256

Patients' preferences for selection of endpoints in cardiovascular clinical trials.

PubMed

Chow, Robert D; Wankhedkar, Kashmira P; Mete, Mihriye

2014-01-01

To reduce the duration and overall costs of cardiovascular trials, use of the combined endpoints in trial design has become commonplace. Though this methodology may serve the needs of investigators and trial sponsors, the preferences of patients or potential trial subjects in the trial design process has not been studied. To determine the preferences of patients in the design of cardiovascular trials. Participants were surveyed in a pilot study regarding preferences among various single endpoints commonly used in cardiovascular trials, preference for single vs. composite endpoints, and the likelihood of compliance with a heart medication if patients similar to them participated in the trial design process. One hundred adult English-speaking patients, 38% male, from a primary care ambulatory practice located in an urban setting. Among single endpoints, participants rated heart attack as significantly more important than death from other causes (4.53 vs. 3.69, p=0.004) on a scale of 1-6. Death from heart disease was rated as significantly more important than chest pain (4.73 vs. 2.47, p<0.001), angioplasty/PCI/CABG (4.73 vs. 2.43, p<0.001), and stroke (4.73 vs. 2.43, p<0.001). Participants also expressed a slight preference for combined endpoints over single endpoint (43% vs. 57%), incorporation of the opinions of the study patient population into the design of trials (48% vs. 41% for researchers), and a greater likelihood of medication compliance if patient preferences were considered during trial design (67% indicated a significant to major effect). Patients are able to make judgments and express preferences regarding trial design. They prefer that the opinions of the study population rather than the general population be incorporated into the design of the study. This novel approach to study design would not only incorporate patient preferences into medical decision making, but it also has the potential to improve compliance with cardiovascular medications.

Goal preference shapes confrontations of sexism.

PubMed

Mallett, Robyn K; Melchiori, Kala J

2014-05-01

Although most women assume they would confront sexism, assertive responses are rare. We test whether women's preference for respect or liking during interpersonal interactions explains this surprising tendency. Women report preferring respect relative to liking after being asked sexist, compared with inappropriate, questions during a virtual job interview (Study 1, n = 149). Women's responses to sexism increase in assertiveness along with their preference for being respected, and a respect-preference mediates the relation between the type of questions and response assertiveness (Studies 1 and 2). In Study 2 (n = 105), women's responses to sexist questions are more assertive when the sense of belonging is enhanced with a belonging manipulation. Moreover, preference for respect mediates the effect of the type of questions on response assertiveness, but only when belonging needs are met. Thus the likelihood of confrontation depends on the goal to be respected outweighing the goal to be liked.

Online Learners and Their Self-Disclosure Preferences

ERIC Educational Resources Information Center

Doring, Anne; Hodge, Ashley; Heo, Misook

2014-01-01

To understand and identify information-sharing preferences among online students, a US survey collected data from university students. Specifically, this study analyzes students' information disclosure preferences and to what extent demographics influence a student's willingness to disclose personal information. This study also examines whether or…

Developmental Study on Leg-to-Body Ratio Preferences.

PubMed

Sabiniewicz, Agnieszka; Sorokowska, Agnieszka; Oleszkiewicz, Anna; Sorokowski, Piotr

2015-09-01

Few studies have tested developmental differences in the perception of human body attractiveness and none have investigated development of Leg-to-Body Ratio (LBR) preferences. The aim of the current study was to determine whether preferences for LBR are largely innate and present among children in their early childhood, acquired in the course of socialization, and/or triggered by biological and hormonal changes. The study included 450 Polish men and women from Lower Silesia and Opole Province, Poland, whose ages ranged from 3 to 20 years. Participants were asked to choose which figurine they found the most attractive from a set of male and female figurines of various LBRs. We found that children below 8 years of age did not prefer any particular LBR and starting from about 9 years of age, preferences towards the legs of average length emerged. Importantly an LBR higher than the population average was not perceived as the most attractive until the age of 15 years. Therefore, we have empirically confirmed that LBR preferences change during develop ment.

Depression Treatment Preferences in Older Primary Care Patients

ERIC Educational Resources Information Center

Gum, Amber M.; Arean, Patricia A.; Hunkeler, Enid; Tang, Lingqi; Katon, Wayne; Hitchcock, Polly; Steffens, David C.; Dickens, Jeanne; Unutzer, Jurgen

2006-01-01

Purpose: For depressed older primary care patients, this study aimed to examine (a) characteristics associated with depression treatment preferences; (b) predictors of receiving preferred treatment; and (c) whether receiving preferred treatment predicted satisfaction and depression outcomes. Design and Methods: Data are from 1,602 depressed older…

Student Preferences for Instructional Methods in an Accounting Curriculum

ERIC Educational Resources Information Center

Abeysekera, Indra

2015-01-01

Student preferences among instructional methods are largely unexplored across the accounting curriculum. The algorithmic rigor of courses and the societal culture can influence these preferences. This study explored students' preferences of instructional methods for learning in six courses of the accounting curriculum that differ in algorithmic…

Millennial Instructional Preferences in Post-Secondary Business Programs

ERIC Educational Resources Information Center

West, Cynthia Elaine

2017-01-01

The purpose of this mixed method study was to examine the instructional preferences of millennial learners and how their instructional preferences affect their choice in post-secondary business programs. The instructional preferences of millennial learners are an important question for post-secondary business programs enrolling learners from…

Preference effects on friendship choice: Evidence from an online field experiment.

PubMed

Yu, Siyu; Xie, Yu

2017-08-01

Observed friendship choices are constrained by social structures and thus problematic indicators for underlying personal preferences. In this paper, we report on a study demonstrating the causal effects of preference in friendship choice based on an online field experiment. Specifically, we tested two important forces that govern friendship choices: preference for shared group identity (operationalized as the desire to befriend others sharing the same place-of-origin identity) and preference for high status (operationalized as the desire to befriend others from high-status institutions). Using an online field experiment in one of the largest social network service websites in China, we investigated the causal preference effects of these two forces free from structural constraints. The results of our study confirm the preference effects on friendship choice in both of the two dimensions we tested. Copyright © 2017. Published by Elsevier Inc.

Sexual Preferences and Partnerships of Transgender Persons Mid- or Post-Transition.

PubMed

Fein, Lydia A; Salgado, Christopher J; Sputova, Klara; Estes, Christopher M; Medina, Carlos A

2018-01-01

The process of gender transition has varying effects on various aspects of sexuality. The purpose of this study was to investigate the effects of transitioning on transgender persons' sexual preferences and partnerships. Data were collected through an anonymous online survey. Questions focused on timing of gender transition in relation to change in sexual preference. Transgender individuals have a variety of sexual partners, predominantly cisgender, and may change sexual preference when they transition. Transitioning can be associated with having no primary sexual partner, despite past sexual partnerships. Length of time between identifying as transgender and starting the transition might be associated with changing sexual partner preference, particularly in transgender women. The emerging trends of sexual partnerships and changing sexual preferences related to the transition in this study warrant further investigation. These data provide more understanding of the relationship between transitioning and sexual preferences and partnerships.

Message in a ballad: the role of music preferences in interpersonal perception.

PubMed

Rentfrow, Peter J; Gosling, Samuel D

2006-03-01

How is information about people conveyed through their preferences for certain kinds of music? Here we show that individuals use their music preferences to communicate information about their personalities to observers, and that observers can use such information to form impressions of others. Study 1 revealed that music was the most common topic in conversations among strangers given the task of getting acquainted. Why was talk about music so prevalent? Study 2 showed that (a) observers were able to form consensual and accurate impressions on the basis of targets' music preferences, (b) music preferences were related to targets' personalities, (c) the specific cues that observers used tended to be the ones that were valid, and (d) music preferences reveal information that is different from that obtained in other zero-acquaintance contexts. Discussion focuses on the mechanisms that may underlie the links between personality and music preferences.

Preferred viewing distance of liquid crystal high-definition television.

PubMed

Lee, Der-Song

2012-01-01

This study explored the effect of TV size, illumination, and viewing angle on preferred viewing distance in high-definition liquid crystal display televisions (HDTV). Results showed that the mean preferred viewing distance was 2856 mm. TV size and illumination significantly affected preferred viewing distance. The larger the screen size, the greater the preferred viewing distance, at around 3-4 times the width of the screen (W). The greater the illumination, the greater the preferred viewing distance. Viewing angle also correlated significantly with preferred viewing distance. The more deflected from direct frontal view, the shorter the preferred viewing distance seemed to be. Copyright © 2011 Elsevier Ltd and The Ergonomics Society. All rights reserved.

Development of a Partner Preference Test that Differentiates between Established Pair Bonds and Other Relationships in Socially Monogamous Titi Monkeys (Callicebus cupreus)

PubMed Central

Carp, Sarah B.; Rothwell, Emily S.; Bourdon, Alexis; Freeman, Sara M.; Ferrer, Emilio; Bales, Karen L.

2017-01-01

Partner preference, or the selective social preference for a pair mate, is a key behavioral indicator of social monogamy. Standardized partner preference testing has been used extensively in rodents but a single test has not been standardized for primates. The goal of this study was to develop a partner preference test with socially monogamous titi monkeys (Callicebus cupreus) adapted from the widely used rodent test. In Experiment 1, we evaluated the test with pairs of titi monkeys (N=12) in a three-chambered apparatus for three hours. The subject was placed in the middle chamber, with grated windows separating it from its partner on one side and an opposite sex stranger on the other side. Subjects spent a greater proportion of time in proximity to their partners’ windows than the strangers’, indicating a consistent preference for the partner over the stranger. Touching either window did not differ between partners and strangers, suggesting it is not a reliable measure of preference. Subjects chose their partner more than the stranger during catch and release sessions at the end of the test. In Experiment 2, we compared responses of females with current partners (N=12) in the preference test with other relationship types representing former attachment bonds (N=13) and no attachment bond (N=8). Only females from established pair bonds spent significantly more time near their partner’s window compared to the stranger indicating that this measure of preference is unique to current partners. Other measures of preference did not differentiate behavior toward a current partner and other relationship types. This test reproduces behavioral patterns found in previous studies in titi monkeys highlighting the accuracy of this new partner preference test. This test can be used as a standardized measure of partner preference in titi monkeys to quantitatively study pair bonding and evaluate factors influencing partner preference. PMID:26235811

Specificity in Sociality: Mice and Prairie Voles Exhibit Different Patterns of Peer Affiliation

PubMed Central

Beery, Annaliese K.; Christensen, Jennifer D; Lee, Nicole S.; Blandino, Katrina L.

2018-01-01

Social behavior is often described as a unified concept, but highly social (group-living) species exhibit distinct social structures and may make different social decisions. Prairie voles (Microtus ochrogaster) are socially monogamous rodents that often reside in extended family groups, and exhibit robust preferences for familiar social partners (same- and opposite-sex) during extended choice tests, although short-term preferences are not known. Mice (Mus musculus) are gregarious and colonial, but in brief laboratory tests of social preference they typically prefer social novelty. This preference for novel vs. familiar peers may represent a species-specific difference in social decision-making between mice and prairie voles. However, the tests used to measure preferences in each species differ markedly in duration and degree of contact, such that the behaviors cannot be directly compared. We assessed whether social preferences for novelty or familiarity differed between mice and prairie voles of both sexes when assessed with matching protocols: the sociability/social preference test (SPT) typically used in mice (short, no direct contact), and the partner preference test (PPT) used in voles (long, direct contact). A subset of voles also underwent a PPT using barriers (long, no direct contact). In the short SPT, behavior did not differ between species. In the longer test, pronounced partner preferences emerged in prairie voles, but mice exhibited no social preferences and rarely huddled. No sex differences were evident in either test. Direct physical contact was required for partner preferences in huddling time in voles, but preference for the partner chamber was evident with or without contact. Both prairie voles and mice are social, but they exhibit important differences in the specificity and extent of their social behavior. While mice are often used to study social approach and other behaviors, voles are a more suitable species for the study of selective social relationships. Consideration of these differences will be important for studies examining the neural mechanisms supporting different kinds of peer social behavior. PMID:29615879

Conjoint Analysis of Study Abroad Preferences: Key Attributes, Segments and Implications for Increasing Student Participation

ERIC Educational Resources Information Center

Garver, Michael S.; Divine, Richard L.

2008-01-01

An adaptive conjoint analysis was performed on the study abroad preferences of a sample of undergraduate college students. The results indicate that trip location, cost, and time spent abroad are the three most important determinants of student preference for different study abroad trip scenarios. The analysis also uncovered four different study…

Eliciting women's cervical screening preferences: a mixed methods systematic review protocol.

PubMed

Wood, Brianne; Van Katwyk, Susan Rogers; El-Khatib, Ziad; McFaul, Susan; Taljaard, Monica; Wright, Erica; Graham, Ian D; Little, Julian

2016-08-11

With the accumulation of evidence regarding potential harms of cancer screening in recent years, researchers, policy-makers, and the public are becoming more critical of population-based cancer screening. Consequently, a high-quality cancer screening program should consider individuals' values and preferences when determining recommendations. In cervical cancer screening, offering women autonomy is considered a "person-centered" approach to health care services; however, it may impact the effectiveness of the program should women choose to not participate. As part of a larger project to investigate women's cervical screening preferences and correlates of these preferences, this systematic review will capture quantitative and qualitative investigations of women's cervical screening preferences and the methods used to elicit them. This mixed methods synthesis will use a thematic analysis approach to synthesize qualitative, quantitative, and mixed methods evidence. This protocol describes the methods that will be used in this investigation. A search strategy has been developed with a health librarian and peer reviewed using PRESS. Based on this strategy, five databases and the gray literature will be searched for studies that meet the inclusion criteria. The quality of the included individual studies will be examined using the Mixed Methods Appraisal Tool. Three reviewers will extract data from the primary studies on the tools or instruments used to elicit women's preferences regarding cervical cancer screening, theoretical frameworks used, outcomes measured, the outstanding themes from quantitative and qualitative evidence, and the identified preferences for cervical cancer screening. We will describe the relationships between study results and the study population, "intervention" (e.g., tool or instrument), and context. We will follow the PRISMA reporting guideline. We will compare findings across studies and between study methods (e.g., qualitative versus quantitative study designs). The strength of the synthesized findings will be assessed using the validated GRADE and CERQual tool. This review will inform the development of a tool to elicit women's cervical screening preferences. Understanding the methods used to elicit women's preferences and what is known about women's cervical screening preferences will be useful for guideline developers who wish to incorporate a woman-centered approach specifically for cervical screening guidelines. PROSPERO CRD42016035737.

Adult Attachment Affects Neural Response to Preference-Inferring in Ambiguous Scenarios: Evidence From an fMRI Study

PubMed Central

Zhang, Xing; Ran, Guangming; Xu, Wenjian; Ma, Yuanxiao; Chen, Xu

2018-01-01

Humans are highly social animals, and the ability to cater to the preferences of other individuals is encouraged by society. Preference-inferring is an important aspect of the theory of mind (TOM). Many previous studies have shown that attachment style is closely related to TOM ability. However, little is known about the effects of adult attachment style on preferences inferring under different levels of certainty. Here, we investigated how adult attachment style affects neural activity underlying preferences inferred under different levels of certainty by using functional magnetic resonance imaging (fMRI). The fMRI results demonstrated that adult attachment influenced the activation of anterior insula (AI) and inferior parietal lobule (IPL) in response to ambiguous preference-inferring. More specifically, in the ambiguous preference condition, the avoidant attached groups exhibited a significantly enhanced activation than secure and anxious attached groups in left IPL; the anxious attached groups exhibited a significantly reduced activation secure attached group in left IPL. In addition, the anxious attached groups exhibited a significantly reduced activation than secure and avoidant attached groups in left AI. These results were also further confirmed by the subsequent PPI analysis. The results from current study suggest that, under ambiguous situations, the avoidant attached individuals show lower sensitivity to the preference of other individuals and need to invest more cognitive resources for preference-reasoning; while compared with avoidant attached group, the anxious attached individuals express high tolerance for uncertainty and a higher ToM proficiency. Results from the current study imply that differences in preference-inferring under ambiguous conditions associated with different levels of individual attachment may explain the differences in interpersonal interaction. PMID:29559932

Millennial Dental Hygiene Students' Learning Preferences Compared to Non-Millennial Faculty Members' Teaching Methods: A National Study.

PubMed

Turner, April M; Prihoda, Thomas J; English, Dana K; Chismark, Aubreé; Jacks, Mary E

2016-09-01

The aim of this study was to compare the learning preferences of millennial dental hygiene students (born between 1982 and 2002) in the U.S. with the teaching methods used by their non-millennial instructors. Cross-sectional surveys were developed with 21-item, five-point Likert scales to examine students' preferences for and faculty use of lecture, collaborative activities, technology, independent work, and group discussion. Surveys were emailed to U.S. dental hygiene program directors in September 2015. The respondents totaled 800 students and 343 faculty members-approximately 5% of all dental hygiene students and 6.8% of all dental hygiene faculty members in the U.S. The results showed that the responding faculty members (88.7%) used case studies more than the students (61.2%) preferred and that the students (71.4%) preferred games when learning more than the faculty members (57.2%) used them (p<0.0001). Student respondents (82.1%) preferred handouts for lecture more than did the faculty respondents (58.8%; p<0.0001). Faculty respondents expected students to read before class 39.3% more than student respondents read (p<0.0001). Student respondents preferred study guides for exams 39.2% more than the faculty respondents provided them (p<0.0001). Participating faculty members (84.0%) had students work in groups more than these students preferred (57.8%), and 92% of these faculty members used group activities in class (p<0.0001). The responses of the millennial dental hygiene students in this study were consistent with previous research on millennial traits. This study found areas of disagreement between students and faculty members on the use of case studies, study guides, and group work. Although these students stated they preferred lecture over group work, trends in education stress using active learning over lecture.

At-Risk Learner Preference in Engineering/Technical Graphics: An Exploratory Study

ERIC Educational Resources Information Center

Ernst, Jeremy V.

2011-01-01

This exploratory study investigated learner preferences of secondary Career and Technical Education (CTE) Engineering/Technical Graphics students using the VARK Questionnaire. The VARK Questionnaire is an instrument that assists in determining students' dominant preferred learning styles, whether visual, aural, reading, or kinesthetic. This study…

[The role of animacy in European Portuguese relative clause attachment: evidence from production and comprehension tasks].

PubMed

Soares, Ana Paula; Fraga, Isabel; Comesaña, Montserrat; Piñeiro, Ana

2010-11-01

This work presents an analysis of the role of animacy in attachment preferences of relative clauses to complex noun phrases in European Portuguese (EP). The study of how the human parser solves this kind of syntactic ambiguities has been focus of extensive research. However, what is known about EP is both limited and puzzling. Additionally, as recent studies have stressed the importance of extra-syntactic variables in this process, two experiments were carried out to assess EP attachment preferences considering four animacy conditions: Study 1 used a sentence-completion-task, and Study 2 a self-paced reading task. Both studies indicate a significant preference for high attachment in EP. Furthermore, they showed that this preference was modulated by the animacy of the host NP: if the first host was inanimate and the second one was animate, the parser's preference changed to low attachment preference. These findings shed light on previous results regarding EP and strengthen the idea that, even in early stages of processing, the parser seems to be sensitive to extra-syntactic information.

Evaluating off-campus student housing preferences: A pilot survey

NASA Astrophysics Data System (ADS)

Johari, Noraini; Mohd, Thuraiya; Abdullah, Lizawati; Ahmad@Mohamed, Nurulanis; Sani, Suwaibatul Islamiah Abdullah

2017-10-01

In recent decades, the term student housing has been highlighted as a body of knowledge in housing studies. In providing better quality of life, student housing evolved into a critical agenda in developing higher education learning. This research paper aims to discuss on a pilot study examining student housing preferences among university and college students should they reside off-campus. The research aims at identifying the attributes of off-campus student housing preferences to give a significant input for the development of an off-campus student housing preferences conceptual framework. This research is a cross-sectional study in which survey participants are currently-enrolled students throughout the period of survey. During this pilot study, questionnaires were distributed among university students in Shah Alam, Selangor in Malaysia. A total of 86 survey questionnaires were collected, consisting of questions reflecting students' background, Likert scale questions to specify their preferences, and open-ended questions. This preliminary pilot result shows that the 46 variables student housing preferences have a good reliability and validity. The outcomes from this research provide insight into students' preferences on how off-campus housing should be developed. Since Selangor is divided into various districts with a plethora of different local contexts including different university campuses, there is a need for further study to avoid generalization.

Awareness of general practitioners concerning cancer patients' preferences for place of death: evidence from four European countries.

PubMed

Ko, Winne; Beccaro, Monica; Miccinesi, Guido; Van Casteren, Viviane; Donker, Gé A; Onwuteaka-Philipsen, Bregje; Miralles Espí, María Teresa; Deliens, Luc; Costantini, Massimo; Van den Block, Lieve

2013-05-01

General Practitioners (GPs) are at the first level of contact in many European healthcare systems and they supposedly have a role in supporting cancer patients in achieving their desired place of death. A four-country (Belgium, the Netherlands, Italy and Spain) study was carried out exploring current practices. EURO SENTI-MELC adopted a retrospective study design and data for this study were collected in 2010 through representative GPs' networks in four countries. In the current study all non-sudden cancer deaths were included with weekly GP registrations. The main study sample included 930 deceased cancer patients: preference for place of death was known by GPs for only 377. GP awareness on the preferred place of death varied across countries, 27% in Italy, 36% in Spain, 45% in Belgium and 72% in the Netherlands (p<0.01). The general level of preferences met was high, from 68% (Italy) to 92% (Spain). Despite the importance of being able to die in a preferred location, GPs were often unaware about patient preferences, especially in Italy and Spain. If GPs were informed, the preference was often met in all countries, indicating room for improvement in end-of-life care. Copyright © 2013 Elsevier Ltd. All rights reserved.

Individual counseling is the preferred treatment for depression in breast cancer survivors.

PubMed

Wu, Salene M; Brothers, Brittany M; Farrar, William; Andersen, Barbara L

2014-01-01

A substantial number of cancer patients experience depression. This study investigated treatment preferences for depression. Breast cancer survivors (N = 134) completed an anonymous survey asking preference and interest in three treatments for depression: individual counseling (IC), antidepressant medication (MED), or support groups (SG). Participants were recruited from a surgical oncology office and asked to complete the survey as they waited for their appointment. Preference was compared using Wilcoxon Signed Ranks tests. More than 50% ranked IC as first choice of treatment. Preference for IC was significantly higher than preference for MED and SG. Preference between MED and SG did not differ. Survivors prefered counseling for treatment of depression. Cancer centers should be prepared to provide preferred treatment methods, particulary as screening, and therefore management, of psychosocial distress is to be required.

Exposure to visual cues of pathogen contagion changes preferences for masculinity and symmetry in opposite-sex faces.

PubMed

Little, Anthony C; DeBruine, Lisa M; Jones, Benedict C

2011-07-07

Evolutionary approaches to human attractiveness have documented several traits that are proposed to be attractive across individuals and cultures, although both cross-individual and cross-cultural variations are also often found. Previous studies show that parasite prevalence and mortality/health are related to cultural variation in preferences for attractive traits. Visual experience of pathogen cues may mediate such variable preferences. Here we showed individuals slideshows of images with cues to low and high pathogen prevalence and measured their visual preferences for face traits. We found that both men and women moderated their preferences for facial masculinity and symmetry according to recent experience of visual cues to environmental pathogens. Change in preferences was seen mainly for opposite-sex faces, with women preferring more masculine and more symmetric male faces and men preferring more feminine and more symmetric female faces after exposure to pathogen cues than when not exposed to such cues. Cues to environmental pathogens had no significant effects on preferences for same-sex faces. These data complement studies of cross-cultural differences in preferences by suggesting a mechanism for variation in mate preferences. Similar visual experience could lead to within-cultural agreement and differing visual experience could lead to cross-cultural variation. Overall, our data demonstrate that preferences can be strategically flexible according to recent visual experience with pathogen cues. Given that cues to pathogens may signal an increase in contagion/mortality risk, it may be adaptive to shift visual preferences in favour of proposed good-gene markers in environments where such cues are more evident.

Exposure to visual cues of pathogen contagion changes preferences for masculinity and symmetry in opposite-sex faces

PubMed Central

Little, Anthony C.; DeBruine, Lisa M.; Jones, Benedict C.

2011-01-01

Evolutionary approaches to human attractiveness have documented several traits that are proposed to be attractive across individuals and cultures, although both cross-individual and cross-cultural variations are also often found. Previous studies show that parasite prevalence and mortality/health are related to cultural variation in preferences for attractive traits. Visual experience of pathogen cues may mediate such variable preferences. Here we showed individuals slideshows of images with cues to low and high pathogen prevalence and measured their visual preferences for face traits. We found that both men and women moderated their preferences for facial masculinity and symmetry according to recent experience of visual cues to environmental pathogens. Change in preferences was seen mainly for opposite-sex faces, with women preferring more masculine and more symmetric male faces and men preferring more feminine and more symmetric female faces after exposure to pathogen cues than when not exposed to such cues. Cues to environmental pathogens had no significant effects on preferences for same-sex faces. These data complement studies of cross-cultural differences in preferences by suggesting a mechanism for variation in mate preferences. Similar visual experience could lead to within-cultural agreement and differing visual experience could lead to cross-cultural variation. Overall, our data demonstrate that preferences can be strategically flexible according to recent visual experience with pathogen cues. Given that cues to pathogens may signal an increase in contagion/mortality risk, it may be adaptive to shift visual preferences in favour of proposed good-gene markers in environments where such cues are more evident. PMID:21123269

Student-Centred Learning Environments: An Investigation into Student Teachers' Instructional Preferences and Approaches to Learning

ERIC Educational Resources Information Center

Baeten, Marlies; Dochy, Filip; Struyven, Katrien; Parmentier, Emmeline; Vanderbruggen, Anne

2016-01-01

The use of student-centred learning environments in education has increased. This study investigated student teachers' instructional preferences for these learning environments and how these preferences are related to their approaches to learning. Participants were professional Bachelor students in teacher education. Instructional preferences and…

Subject Characteristics and Preferences for Different Approaches to Psychotherapy: A Multivariate Study

ERIC Educational Resources Information Center

Helweg, Gregory C.; Gaines, Lawrence S.

1977-01-01

Selected personality variables, sex, age, interpersonal values, and educational level, were examined as antecedents to preferences for a nondirective (Carl Rogers) or directive (Albert Ellis) therapist. Individuals who preferred the Ellis presentation proved to more dogmatic and externalized than individuals preferring the Rogers presentation.…

Temporal (In)Stability of Employee Preferences for Rewards

ERIC Educational Resources Information Center

Wine, Byron; Gilroy, Shawn; Hantula, Donald A.

2012-01-01

This study examined the temporal stability of employee preferences for rewards over seven monthly evaluations. Participants completed a ranking stimulus preference assessment monthly, and the latter six monthly assessments were compared to the initial assessment. Correlations of preferences from month to month ranged from r = -0.89 to 0.99.…

Strategies used by parents to influence their children's food preferences.

PubMed

Russell, Catherine G; Worsley, Anthony; Campbell, Karen J

2015-07-01

Food preferences are important determinants of children's food intakes. Parental feeding behaviours have a significant influence on the development of children's food preferences. The aim of the present study was to describe the ways in which parents attempt to influence their children's food preferences. Parents of 2-5 year old children participated in semi-structured qualitative interviews, which were transcribed and content analysed using a thematic coding manual. The parents described the ways in which they tried to influence the foods their child liked and disliked. Participants (N = 57) were separated into three separate groups based on an a priori study measuring food preferences and food neophobia: those who either had children with healthy food preferences (i.e. closely aligned with dietary guidelines) (N = 20), or unhealthy food preferences (i.e. not closely aligned with dietary guidelines) (N = 18), or high levels of food neophobia (N = 19). The parents used many, diverse behaviours to influence their child's food preferences. Some of these behaviours were likely to be effective in promoting healthy food preferences in children (e.g. parental modelling, food exposure), whilst others were likely to be ineffective (e.g. forcing consumption, restricting food access). Parents of children with healthy food preferences appeared to use more of the feeding behaviours predicted to promote healthy preferences than parents in the other two groups. Parents of children with unhealthy food preferences and those of food neophobic children appeared to rely more on ineffective behaviours. Parents used a mixture of effective and ineffective behaviours, with parents of children with unhealthy food preferences or high food neophobia using fewer behaviours known to be effective. Interventions aimed at influencing parental feeding behaviours should include those behaviours targeted at children's food preferences. Copyright © 2015 Elsevier Ltd. All rights reserved.

Relationship between the learning style preferences of medical students and academic achievement

PubMed Central

Almigbal, Turky H.

2015-01-01

Objectives: To investigate the relationship between the learning style preferences of Saudi medical students and their academic achievements. Methods: A cross-sectional study was conducted among 600 medical students at King Saud University in Riyadh, Kingdom of Saudi Arabia from October 2012 to July 2013. The Visual, Aural, Read/Write, and Kinesthetic questionnaire (VARK) questionnaire was used to categorize learning style preferences. Descriptive and analytical statistics were used to identify the learning style preferences of medical students and their relationship to academic achievement, gender, marital status, residency, different teaching curricula, and study resources (for example, teachers’ PowerPoint slides, textbooks, and journals). Results: The results indicated that 261 students (43%) preferred to learn using all VARK modalities. There was a significant difference in learning style preferences between genders (p=0.028). The relationship between learning style preferences and students in different teaching curricula was also statistically significant (p=0.047). However, learning style preferences are not related to a student’s academic achievements, marital status, residency, or study resources (for example, teachers’ PowerPoint slides, textbooks, and journals). Also, after being adjusted to other studies’ variables, the learning style preferences were not related to GPA. Conclusion: Our findings can be used to improve the quality of teaching in Saudi Arabia; students would be advantaged if teachers understood the factors that can be related to students’ learning styles. PMID:25737179

Sex preference and contraceptive behaviour among men in Mbeya region, Tanzania.

PubMed

Mwageni, E A; Ankomah, A; Powell, R A

2001-04-01

While recent studies confirm parental child sex preference in less developed countries, its pattern varies. Son preference is especially prevalent in Bangladesh, China, India, and Pakistan. Sex preference in sub-Saharan Africa is a neglected area of enquiry. Completed research focuses on women's views to the neglect of men, despite the latter's importance as primary decision-makers. This study identifies factors influencing contraceptive behaviour among men in Mbeya region, Tanzania, demonstrating how it is affected by their preferred family sex composition. Data used were collected from a cross-sectional survey of 600 men aged 16-50 and six focus groups conducted in the region's rural and urban areas. Using single statements and Coombs' Scales, sex preference was found to be prevalent in the study area, with sons strongly preferred to daughters. Sex preference is significantly associated with the number of existing daughters a man has, his marital status, residence and occupation. Findings suggest programmes should be initiated to challenge men's attitudes towards one-sex family composition. Men should be educated about the advantages of small family sizes and persuaded that both children's sexes are equally important. Such measures can assist men in reconsidering their desired family sizes, reduce biases towards one sex, minimise marital problems and improve women's status. Efforts to increase contraceptive use in Tanzania will be hampered, however, if men maintain their preference for sons over daughters.

An Exploratory Study of the Language-Learning Style Preferences of Iranian EFL High School Students

ERIC Educational Resources Information Center

Ramezani, Afsaneh Effatdokht; Dehgahi, Meysam; Hashemi, Hanie

2015-01-01

This study explored the learning style preferences of 40 Iranian students at Marefat Iranian high school in Kuala Lumpur of which, 20 are females and 20 are males. To this end, this study used structured interview to elicit in-depth information from the students. The results of the study showed that learning style preferences of Iranian students…

Learning Styles Preferences of Statistics Students: A Study in the Faculty of Business and Economics at the UAE University

ERIC Educational Resources Information Center

Yousef, Darwish Abdulrahman

2016-01-01

Purpose: Although there are many studies addressing the learning styles of business students as well as students of other disciplines, there are few studies which address the learning style preferences of statistics students. The purpose of this study is to explore the learning style preferences of statistics students at a United Arab Emirates…

A Bayesian approach to the statistical analysis of device preference studies.

PubMed

Fu, Haoda; Qu, Yongming; Zhu, Baojin; Huster, William

2012-01-01

Drug delivery devices are required to have excellent technical specifications to deliver drugs accurately, and in addition, the devices should provide a satisfactory experience to patients because this can have a direct effect on drug compliance. To compare patients' experience with two devices, cross-over studies with patient-reported outcomes (PRO) as response variables are often used. Because of the strength of cross-over designs, each subject can directly compare the two devices by using the PRO variables, and variables indicating preference (preferring A, preferring B, or no preference) can be easily derived. Traditionally, methods based on frequentist statistics can be used to analyze such preference data, but there are some limitations for the frequentist methods. Recently, Bayesian methods are considered an acceptable method by the US Food and Drug Administration to design and analyze device studies. In this paper, we propose a Bayesian statistical method to analyze the data from preference trials. We demonstrate that the new Bayesian estimator enjoys some optimal properties versus the frequentist estimator. Copyright © 2012 John Wiley & Sons, Ltd.

Social support influences preferences for feminine facial cues in potential social partners.

PubMed

Watkins, Christopher D; DeBruine, Lisa M; Little, Anthony C; Jones, Benedict C

2012-01-01

Most previous studies of individual differences in women's and men's preferences for sexually dimorphic physical characteristics have focused on the importance of mating-related factors for judgments of opposite-sex individuals. Although studies have suggested that people may show stronger preferences for feminine individuals of both sexes under conditions where social support may be at a premium (e.g., during phases of the menstrual cycle where raised progesterone prepares women's bodies for pregnancy), these studies have not demonstrated that perceptions of available social support directly influence femininity preferences. Here we found that (1) women and men randomly allocated to low social support priming conditions demonstrated stronger preferences for feminine shape cues in own- and opposite-sex faces than did individuals randomly allocated to high social support priming conditions and (2) that people perceived men and women displaying feminine characteristics as more likely to provide them with high-quality social support than those displaying relatively masculine characteristics. Together, these findings suggest that social support influences face preferences directly, potentially implicating facultative responses whereby people increase their preferences for pro-social individuals under conditions of low social support.

Preferences of colorectal cancer patients for treatment and decision-making: a systematic literature review.

PubMed

Damm, K; Vogel, A; Prenzler, A

2014-11-01

Treatment decisions in life-threatening diseases, like colorectal cancer (CRC), are crucial, since they have a great impact on patient's survival and health-related quality of life. Thereby, the inclusion of patient's preferences becomes more and more important; however, these first need to be identified. Therefore, we conducted a systematic literature review in 12 electronic databases, published between 2000 and 2012, in order to identify patient's preferences concerning treatment preferences and involvement in the decision-making process. Nineteen studies were included and thoroughly analysed. This review shows that CRC patients do have preferences regarding different treatment options and outcomes; however, these preferences are not homogenous and seem to depend on personal factors like age and gender. Despite the existence of these preferences, the majority of patients prefer a passive role in the decision-making process, which in part may be explained by the severity of the disease. Again, subgroup analyses reveal the impact of personal factors like gender and education on the preference. Due to the importance of personal factors in the analysis of patient preferences, we identified an urgent need for larger studies that are suitable for subgroup analyses and incorporate multi-attributive measurement techniques, like discrete choice methods. © 2014 John Wiley & Sons Ltd.

Multimorbidity and Decision-Making Preferences Among Older Adults.

PubMed

Chi, Winnie C; Wolff, Jennifer; Greer, Raquel; Dy, Sydney

2017-11-01

Understanding individuals' preferences for participating in health care decisions is foundational to delivering person-centered care. We aimed to (1) explore preferences for health care decision making among older adults, and (2) identify multimorbidity profiles associated with preferring less active, ie, passive, participation among older US adults. Ours was a cross-sectional, nationally representative study of 2,017 National Health and Aging Trends Study respondents. Passive decision-making preference was defined as preferring to leave decisions to physicians. Multimorbidity profiles, based on 13 prevalent chronic conditions, were examined as (1) presence of 2 or more conditions, (2) a simple conditions count, and (3) a condition clusters count. Multiple logistic regression was used with adjustment for age, sex, education, English proficiency, and mobility limitation. Most older adults preferred to participate actively in making health care decisions. Older adults with 4 or more conditions, however, and those with multiple condition clusters are relatively less likely to prefer active decision making. Primary care physicians should initiate a shared decision-making process with older adults with 4 or more conditions or multiple condition clusters. Physicians should anticipate variation in decision-making preferences among older adults and adapt a decision-making process that suits individuals' preferences for participation to ensure person-centered care delivery. © 2017 Annals of Family Medicine, Inc.

Patients' involvement in decisions about medicines: GPs' perceptions of their preferences

PubMed Central

Cox, Kate; Britten, Nicky; Hooper, Richard; White, Patrick

2007-01-01

Background Patients vary in their desire to be involved in decisions about their care. Aim To assess the accuracy and impact of GPs' perceptions of their patients' desire for involvement. Design of study Consultation-based study. Setting Five primary care centres in south London. Method Consecutive patients completed decision-making preference questionnaires before and after consultation. Eighteen GPs completed a questionnaire at the beginning of the study and reported their perceptions of patients' preferences after each consultation. Patients' satisfaction was assessed using the Medical Interview Satisfaction Scale. Analyses were conducted in 190 patient–GP pairs that identified the same medicine decision about the same main health problem. Results A total of 479 patients participated (75.7% of those approached). Thirty-nine per cent of these patients wanted their GPs to share the decision, 45% wanted the GP to be the main (28%) or only (17%) decision maker regarding their care, and 16% wanted to be the main (14%) or only (2%) decision maker themselves. GPs accurately assessed patients' preferences in 32% of the consultations studied, overestimated patients' preferences for involvement in 45%, and underestimated them in 23% of consultations studied. Factors protective against GPs underestimating patients' preferences were: patients preferring the GP to make the decision (odds ratio [OR] 0.2 per point on the five-point scale; 95% confidence interval [CI] = 0.1 to 0.4), and the patient having discussed their main health problem before (OR 0.3; 95% CI = 0.1 to 0.9). Patients' educational attainment was independently associated with GPs underestimation of preferences. Conclusion GPs' perceptions of their patients' desire to be involved in decisions about medicines are inaccurate in most cases. Doctors are more likely to underestimate patients' preferred level of involvement when patients have not consulted about their condition before. PMID:17925134

Use of preferred music to decrease agitated behaviours in older people with dementia: a review of the literature.

PubMed

Sung, Huei-Chuan; Chang, Anne M

2005-10-01

This paper reviews study findings of preferred music on agitated behaviours for older people with dementia and provides implications for future research and practice. Music has been suggested as a feasible and less costly intervention to manage agitated behaviours in older people with dementia. However, no review of the literature focusing on study findings of preferred music on agitated behaviours in older people with dementia had been reported. A review was undertaken using electronic databases with specified search terms for the period of 1993-2005. The references listed in the publications selected were also searched for additional studies. Eight research-based articles met the inclusion criteria and were included in the review. The preferred music intervention demonstrated positive outcomes in reducing the occurrence of some types of agitated behaviours in older people with dementia. The findings from these studies were relatively consistent in finding improvement in agitated behaviours although the findings in one study did not reach statistical significance. The small sample sizes and some variations in the application of the preferred music intervention mean that caution is needed in drawing conclusions from these studies. This review highlights that preferred music has positive effects on decreasing agitated behaviours in older people with dementia; however, the methodological limitations indicate the need for further research. Findings from the review highlight the beneficial outcomes of preferred music in reducing agitated behaviours for older people with dementia. The incorporation of preferred music has the potential to provide a therapeutic approach to the care of older people with dementia.

Preference and Expectation for Treatment Assignment in a Randomized Controlled Trial of Once- vs Twice-weekly Yoga for Chronic Low Back Pain

PubMed Central

Weinberg, Janice; Sherman, Karen J.; Saper, Robert B.

2015-01-01

Background: In studies involving nonpharmacological complementary and alternative medicine interventions, participant blinding is very difficult. Participant expectations may affect perceived benefit of therapy. In studies of yoga as treatment for chronic low back pain, little is known about the relationship between patient expectations and preferences on outcomes. This study was designed to identify baseline predictors of preference and to determine if expectations and preferences for different doses of yoga affect back-related function and low back pain intensity. Methods: This was a secondary data analysis of a 12-week randomized controlled trial comparing once-weekly vs twice-weekly yoga for treatment of chronic low back pain in 93 adults from a predominantly low-income minority population. At baseline, participants were asked about back function, back pain, treatment expectations, and treatment preferences. We created a variable “concordance” to describe the matching of participant preference to randomized treatment. Our outcome variables were change in back function and pain intensity after 12 weeks of yoga instruction. We performed logistic regression to identify predictors of preference for once- or twice-weekly yoga instruction. We created linear regression models to identify independent associations between expectations, preference, concordance, and outcomes. Results: Worse back function at baseline was associated with 20% higher odds of preferring twice-weekly yoga (OR 1.2, CI 1.1, 1.3). Individuals with higher expectation scores for twice-weekly yoga had 90% higher odds of preferring twice-weekly vs once-weekly yoga (OR 1.9, CI 1.3, 2.7). Individuals with higher expectation scores for once-weekly yoga had 40% less odds of preferring twice-weekly yoga (OR 0.6, CI 0.5, 0.9). After controlling for baseline characteristics, we found no statistically significant relationship between treatment outcomes, preference, expectation scores, or concordance. Conclusion: In a population of predominantly low-income minority participants with chronic low back pain, worse back function was associated with preference for more frequent yoga classes. Those who preferred more yoga classes had higher expectations for those classes. Twelve-week change in back pain intensity and back function were not affected by dosing preference, expectation score, or concordance. More research is needed to better measure and quantify preference, expectations, and their relationship to outcomes in yoga research. PMID:25694850

A survey of factors influencing career preference in new-entrant and exiting medical students from four UK medical schools

PubMed Central

2014-01-01

Background Workforce planning is a central issue for service provision and has consequences for medical education. Much work has been examined the career intentions, career preferences and career destinations of UK medical graduates but there is little published about medical students career intentions. How soon do medical students formulate careers intentions? How much do these intentions and preferences change during medical school? If they do change, what are the determining factors? Our aim was to compare medical students’ career preferences upon entry into and exit from undergraduate medical degree programmes. Methods This was a cross-sectional questionnaire survey. Two cohorts [2009–10, 2010–11] of first and final year medical students at the four Scottish graduating medical schools took part in career preference questionnaire surveys. Questions were asked about demographic factors, career preferences and influencing factors. Results The response rate was 80.9% [2682/3285]. Significant differences were found across the four schools, most obviously in terms of student origin [Scotland, rest of UK or overseas], age group, and specialty preferences in Year 1 and Year 5. Year 1 and Year 5 students’ specialty preferences also differed within each school and, while there were some common patterns, each medical school had a different profile of students’ career preferences on exit. When the analysis was adjusted for demographic and job-related preferences, specialty preferences differed by gender, and wish for work-life balance and intellectual satisfaction. Conclusions This is the first multi-centre study exploring students’ career preferences and preference influences upon entry into and exit from undergraduate medical degree programmes. We found various factors influenced career preference, confirming prior findings. What this study adds is that, while acknowledging student intake differs by medical school, medical school itself seems to influence career preference. Comparisons across medical school populations must therefore control for differences in input [the students] as well as context and process [the medical school] when looking at output [e.g., performance]. A robust, longitudinal study is required to explore how medical students’ career preferences change as they progress through medical school and training to understand the influence of the learning environment on training choice and outcomes. PMID:25056270

Learning and Classroom Preferences of Gifted Eighth Graders: A Qualitative Study

ERIC Educational Resources Information Center

Samardzija, Nadine; Peterson, Jean Sunde

2015-01-01

The purpose of this phenomenological qualitative study was to explore how academically gifted eighth graders experience learning, with special attention to learning and classroom preferences. Twenty-three students were interviewed individually. The central phenomenon was that their learning preferences were complex, nuanced, and idiosyncratic, and…

Preferences and Experiences of Traditional and Nontraditional University Students

ERIC Educational Resources Information Center

Woods, Kathryn; Frogge, George

2017-01-01

This study compared and contrasted preferences and experiences of traditional and nontraditional students. Students at a midsized state university in the southeast region of the United States were surveyed to determine the number of hours spent working off campus, hours spent studying, their preferred learning format, and current grade point…

Implicit Learning of Semantic Preferences of Verbs

ERIC Educational Resources Information Center

Paciorek, Albertyna; Williams, John N.

2015-01-01

Previous studies of semantic implicit learning in language have only examined learning grammatical form-meaning connections in which learning could have been supported by prior linguistic knowledge. In this study we target the domain of verb meaning, specifically semantic preferences regarding novel verbs (e.g., the preference for a novel verb to…

A Method to Assess Work Task Preferences

ERIC Educational Resources Information Center

Cobigo, Virginie; Morin, Diane; Lachapelle, Yves

2009-01-01

Persons with intellectual disability may encounter difficulties in making choices and expressing preferences because of restricted communication skills or a tendency to acquiesce. In addition, many studies provide evidence that these persons have less opportunity to make choices and express their preferences. The aim of this study was to conduct a…

Students' Preferred Learning Styles in Graphic Communications

ERIC Educational Resources Information Center

Ernst, Jeremy V.; Clark, Aaron C.

2008-01-01

The objective of this study was to identify changes in dominant preferred learning styles of students based on instructional presentation of course content. This study evaluates dominant preferred learning styles of two groups of university students. The first group of students was enrolled in a course that introduces graphical representation in…

Decisional control preferences, disclosure of information preferences, and satisfaction among Hispanic patients with advanced cancer.

PubMed

Noguera, Antonio; Yennurajalingam, Sriram; Torres-Vigil, Isabel; Parsons, Henrique Afonseca; Duarte, Eva Rosina; Palma, Alejandra; Bunge, Sofia; Palmer, J Lynn; Bruera, Eduardo

2014-05-01

Studies to determine the decisional control preferences (DCPs) in Hispanic patients receiving palliative care are limited. The aims of this study were to describe DCPs, disclosure of information, and satisfaction with decision making among Hispanics and to determine the degree of concordance between patients' DCPs and their self-reported decisions. We surveyed 387 cancer patients referred to outpatient palliative care clinics in Argentina, Chile, Guatemala, and the U.S. DCPs were measured with the Control Preference Scale, disclosure preferences with the Disclosure of Information Preferences questionnaire, and satisfaction with care with the Satisfaction with Decision Scale. In this study, 182 patients (47.6%) preferred shared decisional control, 119 (31.2%) preferred active decisional control, and 81 (21.2%) preferred a passive approach. Concerning their diagnosis and prognosis, 345 (92%) patients wanted to know their diagnosis, and 355 (94%) wanted to know their prognosis. Three hundred thirty-seven (87%) patients were satisfied with the decision-making process. DCPs were concordant with the self-reported decision-making process in 264 (69%) patients (weighted kappa = 0.55). Patients' greater satisfaction with the decision-making process was correlated with older age (P ≤ 0.001) and with a preference for enhanced diagnostic disclosure (P ≤ 0.024). Satisfaction did not correlate with concordance in the decision-making process. The vast majority preferred a shared or active decision-making process and wanted information about their diagnosis and prognosis. Older patients and those who wanted to know their diagnosis seemed to be more satisfied with the way treatment decisions were made. Copyright © 2014 U.S. Cancer Pain Relief Committee. Published by Elsevier Inc. All rights reserved.

The development of basic taste sensitivity and preferences in children.

PubMed

Fry Vennerød, Frida Felicia; Nicklaus, Sophie; Lien, Nanna; Almli, Valérie L

2018-08-01

This study aims at understanding how preference and sensitivity to the basic tastes develop in the preschool years, and how the two relate to each other. To expand on the existing literature regarding taste preferences conducted in cross-sectional studies, a longitudinal design was applied with children from age four to six years old. During the springs of 2015, 2016, and 2017, 131 children born in 2011 were tested in their kindergartens. To investigate preferences for sweet, sour and bitter tastes, the children performed ranking-by-elimination procedures on fruit-flavored beverages and chocolates with three taste intensity levels. The beverages varied in either sucrose, citric acid, or the bitter component isolone. The chocolates varied in the bitter component theobromine from cocoa and sucrose content. Each year, the children also performed paired-comparison tasks opposing plain water to tastant dilutions at four concentrations. The stimuli consisted of the five basic tastes: sweet (sucrose) sour (citric acid monohydrate) umami (monosodium glutamate), salty (sodium chloride), and bitter (quinine hydrochloride dihydrate). Preference for sweetness levels increased with age, while preference for bitterness and sourness levels were stable. Concerning taste sensitivity, the children showed an increase in sensitivity for sourness and saltiness, a decrease for sweetness, and stability for umami and bitterness. A negative association was found between sweetness sensitivity and preference for sweetness. The study highlights different trajectories of sensitivity and preferences across tastes. On average, a reduction in sweetness sensitivity combined with an increase in preference for higher sweetness was observed from the age of four to six. The weak relationship between taste sensitivity and taste preference in our data suggests that taste preference development is shaped by a multitude of factors in addition to taste sensitivity. Copyright © 2018 Elsevier Ltd. All rights reserved.

Pleasure to play, arousal to stay: the effect of player emotions on digital game preferences and playing time.

PubMed

Poels, Karolien; van den Hoogen, Wouter; Ijsselsteijn, Wijnand; de Kort, Yvonne

2012-01-01

This study investigated how player emotions during game-play, measured through self-report and physiological recordings, predict playing time and game preferences. We distinguished between short-term (immediately after game-play) and long-term (after 3 weeks) playing time and game preferences. While pleasure was most predictive for short-term playing time and game preferences, arousal, particularly for game preferences, was most predictive on the longer term. This result was found through both self-report and physiological emotion measures. This study initiates theorizing about digital gaming as a hedonic consumer product and sketches future research endeavors of this topic.

Adolescent preferences and reactions to language about body weight.

PubMed

Puhl, R M; Himmelstein, M S; Armstrong, S C; Kingsford, E

2017-07-01

Over 30% of youth and adolescents have overweight or obesity, and health care providers are increasingly discussing weight-based health with these patients. Stigmatizing language in provider-patient communication about obesity is well documented and could be particularly detrimental to youth and adolescents. Although some research has examined preferences for weight-based terminology among adults, no studies have addressed these issues in youth populations. This study represents a preliminary and systematic investigation of weight-based language preferences among adolescents with overweight and obesity enrolled in a summer weight loss camp. Participants (N=50) indicated preferences for weight-based language and emotional responses to words that their family members used in reference to their body weight. Weight neutral terminology ('weight', 'body mass index') were most preferred, although some differences in word preferences emerged by the participants' gender. Boys preferred having their weight described as 'overweight' and 'heavy', while girls preferred the word 'curvy'. A large proportion of participants, particularly girls, reported experiencing sadness, shame, and embarrassment if parents used certain words to describe their body weight, which highlights the importance of considering the emotional impact of weight-based terminology. Providers may consider asking youth and adolescents for their preferences when discussing weight-based health.

Relationships Between Personal Beliefs and Treatment Acceptability, and Preferences for Behavioral Treatments

PubMed Central

Sidani, Souraya; Miranda, Joyal; Epstein, Dana R.; Bootzin, Richard R.; Cousins, Jennifer; Moritz, Patricia

2009-01-01

Background The literature on preferences for behavioral interventions is limited in terms of understanding treatment-related factors that underlie treatment choice. The objectives of this study were to examine the direct relationships between personal beliefs about clinical condition, perception of treatment acceptability, and preferences for behavioral interventions for insomnia. Methods The data set used in this study was obtained from 431 persons with insomnia who participated in a partially randomized clinical trial and expressed preferences for treatment options. The data were collected at baseline. Logistic regression was used to examine the relationships between personal beliefs and treatment acceptability, and preferences. The relationships between personal beliefs and perception of treatment acceptability were explored with correlational analysis. Results Perception of treatment acceptability was associated with preferences. Persons viewing the option as convenient tended to choose that option for managing insomnia. Personal beliefs were not related to preferences. However, beliefs about sleep promoting behaviors were correlated with perceived treatment effectiveness. Conclusions Perception of treatment acceptability underlies expressed preferences for behavioral interventions. Personal beliefs about insomnia are not directly associated with preferences. Importance is highlighted for providing information about treatment options and exploring perception of each option’s acceptability during the process of treatment selection. PMID:19604500

Sexual dimorphism of male face shape, partnership status and the temporal context of relationship sought modulate women's preferences for direct gaze.

PubMed

Conway, Claire A; Jones, Benedict C; DeBruine, Lisa M; Little, Anthony C

2010-02-01

Most previous studies of face preferences have investigated the physical cues that influence face preferences. Far fewer studies have investigated the effects of cues to the direction of others' social interest (i.e. gaze direction) on face preferences. Here we found that unpartnered women demonstrated stronger preferences for direct gaze (indicating social interest) from feminine male faces than from masculine male faces when judging men's attractiveness for long-term relationships, but not when judging men's attractiveness for short-term relationships. Moreover, unpartnered women's preferences for direct gaze from feminine men were stronger for long-term than short-term relationships, but there was no comparable effect for judgements of masculine men. No such effects were evident among women with romantic partners, potentially reflecting different motivations underlying partnered and unpartnered women's judgements of men's attractiveness. Collectively these findings (1) complement previous findings whereby women demonstrated stronger preferences for feminine men as long-term than short-term partners, (2) demonstrate context-sensitivity in the integration of physical and social cues in face preferences, and (3) suggest that gaze preferences may function, at least in part, to facilitate efficient allocation of mating effort.

Work-family conflict and retirement preferences.

PubMed

Raymo, James M; Sweeney, Megan M

2006-05-01

This study investigates relationships between retirement preferences and perceived levels of work-family conflict. Using the large sample of 52-54-year-old respondents to the 1992 Wisconsin Longitudinal Study, we estimated multinomial logistic regression models of preferences for partial and full retirement within the next 10 years. We examined the association between retirement preferences and perceived work-family conflict, evaluated the extent to which work-family conflict was a mediating mechanism between stressful work and family circumstances and preferences to retire, and explored potential gender differences in the association between work-family conflict and preferring retirement. Work-family conflict was positively related to preferences for both full and partial retirement. Yet work-family conflict did not appear to mediate relationships between stressful work and family environments and retirement preferences, nor did significant gender differences emerge in this association. Our analyses provide the first direct evidence of the role played by work-family conflict in the early stages of the retirement process, although we were not able to identify the sources of conflict underlying this relationship. Identifying the sources of this conflict and the psychological mechanisms linking work-family conflict to retirement preferences is an important task for future researchers.

The influence of familiar characters and other appealing images on young children's preference for low-quality objects.

PubMed

Danovitch, Judith H; Mills, Candice M

2017-09-01

This study examines the factors underlying young children's preference for products bearing a familiar character's image. Three-year-olds (N = 92) chose between low-quality objects with images on or near the objects and high-quality objects without images. Children showed stronger preferences for damaged objects bearing images of a preferred familiar character than for objects bearing images of a preferred colour star, and they showed weak preferences for damaged objects with the character near, but not on, the object. The results suggest that children's preference for low-quality products bearing character images is driven by prior exposure to characters, and not only by the act of identifying a favourite. Statement of contribution What is already known on this subject? Children are exposed to characters in the media and on products such as clothing and school supplies. Products featuring familiar characters appeal to preschool children, even if they are of low quality. What does this study add? Three-year-olds prefer damaged objects with an image of a favourite character over plain undamaged objects. Children's preference is not solely a function of having identified a favourite image or of attentional cues. © 2017 The British Psychological Society.

Multivariate representation of food preferences in the human brain.

PubMed

Pogoda, Luca; Holzer, Matthias; Mormann, Florian; Weber, Bernd

2016-12-01

One major goal in decision neuroscience is to investigate the neuronal mechanisms being responsible for the computation of product preferences. The aim of the present fMRI study was to investigate whether similar patterns of brain activity, reflecting category dependent and category independent preference signals, can be observed in case of different food product categories (i.e. chocolate bars and salty snacks). To that end we used a multivariate searchlight approach in which a linear support vector machine (l-SVM) was trained to distinguish preferred from non-preferred chocolate bars and subsequently tested its predictive power in case of chocolate bars (within category prediction) and salty snacks (across category prediction). Preferences were measured by a binary forced choice decision paradigm before the fMRI task. In the scanner, subjects saw only one product per trial which they had to rate after presentation. Consistent with previous multi voxel pattern analysis (MVPA) studies, we found category dependent preference signals in the ventral parts of medial prefrontal cortex (mPFC), but also in dorsal anterior cingulate cortex (dACC) and dorsolateral prefrontal cortex (dlPFC). Category independent preference signals were observed in the dorsal parts of mPFC, dACC, and dlPFC. While the first two results have also been reported in a closely related study, the activation in dlPFC is new in this context. We propose that the dlPFC activity does not reflect the products' value computation per se, but rather a modulatory signal which is computed in anticipation of the forthcoming product rating after stimulus presentation. Furthermore we postulate that this kind of dlPFC activation emerges only if the anticipated choices fall into the domain of primary rewards, such as foods. Thus, in contrast to previous studies which investigated preference decoding for stimuli from utterly different categories, the present study revealed some food domain specific aspects of preference processing in the human brain. Copyright © 2016 Elsevier Inc. All rights reserved.

Effects of a school reform on longitudinal stability of students' preferences with regard to education.

PubMed

Könings, Karen D; Brand-Gruwel, Saskia; Elen, Jan

2012-09-01

Students' perspective on education is of crucial importance for its effectivity, but students' opinions are seldom acknowledged by teachers and designers. Student participation in the educational design process could be a suitable tool to better take students' preferences into account. However, for effective participatory design, it is necessary to know whether students have stable preferences for the design of their education. Changeability of preferences would require a more continuing design process allowing continuous adaptations. This longitudinal survey study aimed to determine the changeability over time of students' preferences for different aspects of a learning environment. Additionally, causes of possible changes in preferences are investigated. The participants were 1,335 high school students of five schools for secondary education in the Netherlands, joining this study during a period of 2 years. Data about students' preferences were collected at three moments, using the Inventory of Perceived Study Environment Extended. Learning-related student characteristics, such as processing strategies and motivational orientations, were measured with the Inventory of Learning Styles. Additionally, data on learning performances were collected. The results showed stability on preferences for almost all studied characteristics of the learning environment. Particularly remarkable was a drop in desirability for student autonomy. This was larger for students with a certificate-oriented motivation and smaller for self-regulated students. Additionally, poorly performing students had a larger decrease in preference for autonomy. The stability on most aspects supports that participatory design might result in fairly stable instructional designs, although caution is needed with respect to student autonomy. ©2011 The British Psychological Society.

The Differences in Preference for Truth-telling of Patients With Cancer of Different Genders.

PubMed

Chen, Shih-Ying; Wang, Hung-Ming; Tang, Woung-Ru

Patients' personality traits, especially age, gender, and cancer stage, tend to affect doctors' truth-telling methods. However, there is a lack of studies investigating the influence of patients' gender on truth-telling, especially for Asian cultures. The aims of this study were to qualitatively investigate the differences in preferences for truth-telling for patients with cancer of different genders and explore patients' preferences for decision making. For this descriptive qualitative study, in-depth interviews were conducted with 20 patients with cancer (10 men and 10 women) using a semistructured interview guide. All interviews were audiotaped and transcribed verbatim. Data collection and analysis occurred concurrently; content analysis developed categories and themes. Data analysis revealed 2 themes: (1) similar gender preferences for truth-telling and decision making: knowledge of their medical condition, direct and frank truthfulness, and assistance in decision making for subsequent treatment programs, and (2) preferences in truth-telling that differed by gender: women wanted family members present for confirmation of diagnosis, whereas men did not; men preferred truth-telling for only key points of their cancer, whereas women wanted detailed information; and men did not want to know their survival period, whereas women wanted this information. Our study revealed similar gender preferences for truth-telling regarding knowledge and decision making; however, preferences differed for family support, scope of information, and survival time. These findings can serve as a reference for nurses and other healthcare personnel when implementing truth-telling for patients given a diagnosis of cancer. Strategies can be targeted for specific preferences of men and women.

The influence of international medical electives on career preference for primary care and rural practice.

PubMed

Law, Iain R; Walters, Lucie

2015-11-11

Previous studies have demonstrated a correlation between medical students who undertake international medical electives (IMEs) in resource poor settings and their reported career preference for primary care in underserved areas such as rural practice. This study examines whether a similar correlation exists in the Australian medical school context. Data was extracted from the Medical Schools Outcomes Database (MSOD) of Australian medical students that completed commencing student and exit questionnaires between 2006 and 2011. Student responses were categorized according to preferred training program and preferred region of practice at commencement. The reported preferences at exit of students completing IMEs in low and middle income countries (LMIC) were compared to those completing electives in high income countries (HIC). The effect of elective experience for students expressing a preference for primary care at commencement was non-significant, with 40.32 % of LMIC and 42.11 % of HIC students maintaining a preference for primary care. Similarly there were no significant changes following LMIC electives for students expressing a preference for specialist training at commencement with 11.81 % of LMIC and 10.23 % of HIC students preferring primary care at exit. The effect of elective experience for students expressing a preference for rural practice at commencement was non-significant, with 41.51 % of LMIC and 49.09 % of HIC students preferring rural practice at exit. Similarly there were no significant changes following LMIC electives for students expressing a preference for urban practice at commencement, with 7.84 % of LMIC and 6.70 % of HIC students preferring rural practice at exit. This study did not demonstrate an association between elective experience in resource poor settings and a preference for primary care or rural practice. This suggests that the previously observed correlation between LMIC electives and interest in primary care in disadvantaged communities is likely dependent on student and elective program characteristics and supports the need for further research and critical examination of elective programs at Australian medical schools.

Infants Prefer Motionese to Adult-Directed Action

ERIC Educational Resources Information Center

Brand, Rebecca J.; Shallcross, Wendy L.

2008-01-01

In two studies, we investigated infants' preference for infant-directed (ID) action or "motionese" (Brand, Baldwin & Ashburn, 2002) relative to adult-directed (AD) action. In Study 1, full-featured videos were shown to 32 6- to 8-month-olds, who demonstrated a strong preference for ID action. In Study 2, infants at 6-8 months (n= 28) and 11-13…

An Assessment of Student Preferences for PowerPoint Presentation Structure in Undergraduate Courses

ERIC Educational Resources Information Center

Apperson, Jennifer M.; Laws, Eric L.; Scepansky, James A.

2008-01-01

Studies have demonstrated that students prefer PowerPoint and respond favorably to classes when it is used. Few studies have addressed the physical structure of PowerPoint. In this study, students enrolled in several psychology classes on two campuses completed a 36 item questionnaire regarding their preferences for the use of PowerPoint in the…

Factors Influencing Parents' Preferences and Parents' Perceptions of Child Preferences of Picturebooks

PubMed Central

Wagner, Laura

2017-01-01

This study examined factors influencing parents' preferences and their perceptions of their children's preferences for picturebooks. First, a content analysis was conducted on a set of picturebooks (N = 87) drawn from the sample described in Wagner (2013); Then, parents (N = 149) rated the books and several content properties were examined for their ability to predict parents' preferences and their perception of their children's preferences. The initial content analysis found correlated clusters of disparate measures of complexity (linguistic, cognitive, narrative) and identified a distinctive sub-genre of modern books featuring female protagonists. The experimental preference analysis found that parents' own preferences were most influenced by the books' age and status; parents' perceptions of their children's preferences were influenced by gender, with parents perceiving their sons (but not daughters) as dis-preferring books with female protagnoists. In addition, influences of the child's reading ability and the linguistic complexity of the book on preferences suggested a sensitivity to the cultural practice of joint book-reading. PMID:28919869

Music Preferences, Friendship, and Externalizing Behavior in Early Adolescence: A SIENA Examination of the Music Marker Theory Using the SNARE Study.

PubMed

Franken, Aart; Keijsers, Loes; Dijkstra, Jan Kornelis; Ter Bogt, Tom

2017-08-01

Music Marker Theory posits that music is relevant for the structuring of peer groups and that rock, urban, or dance music preferences relate to externalizing behavior. The present study tested these hypotheses, by investigating the role of music preference similarity in friendship selection and the development of externalizing behavior, while taking the effects of friends' externalizing behavior into account. Data were used from the first three waves of the SNARE (Social Network Analysis of Risk behavior in Early adolescence) study (N = 1144; 50% boys; M age  = 12.7; SD = 0.47), including students who entered the first-year of secondary school. Two hypotheses were tested. First, adolescents were expected to select friends based both on a similarity in externalizing behavior and music genre preference. Second, a preference for rock, urban, or dance, music types was expected to predict the development of externalizing behavior, even when taking friends' influence on externalizing behavior into account. Stochastic Actor-Based Modeling indicated that adolescents select their friends based on both externalizing behavior and highbrow music preference. Moreover, both friends' externalizing behavior and a preference for dance music predicted the development of externalizing behavior. Intervention programs might focus on adolescents with dance music preferences.

Decisional Control Preferences, Disclosure of Information Preferences, and Satisfaction Among Hispanic Patients With Advanced Cancer

PubMed Central

Noguera, Antonio; Yennurajalingam, Sriram; Torres-Vigil, Isabel; Parsons, Henrique Afonseca; Duarte, Eva Rosina; Palma, Alejandra; Bunge, Sofia; Palmer, J. Lynn; Bruera, Eduardo

2017-01-01

Context Studies to determine the decisional control preferences (DCPs) in Hispanic patients receiving palliative care are limited. Objectives The aims of this study were to describe DCPs, disclosure of information, and satisfaction with decision making among Hispanics, and to determine the degree of concordance between patients’ DCPs and their self-reported decisions. Methods We surveyed 387 cancer patients referred to outpatient palliative care clinics in Argentina, Chile, Guatemala, and the U.S. DCPs were measured with the Control Preference Scale, disclosure preferences with the Disclosure of Information Preferences questionnaire, and satisfaction with care with the Satisfaction with Decision Scale. Results In this study, 182 patients (47.6%) preferred shared decisional control, 119 (31.2%) active decisional control, and 81 (21.2%) preferred a passive approach. Concerning diagnosis and prognosis, 345 (92%) patients wanted to know their diagnosis, and 355 (94%) wanted to know their prognosis. Three hundred thirty-seven (87%) patients were satisfied with the decision-making process. DCPs were concordant with the self-reported decision-making process in 264 (69%) patients (weighted kappa, 0.55). Patients’ greater satisfaction with the decision-making process was correlated with older age (P≤0.001) and with a preference for enhanced diagnostic disclosure (P≤0.024). Satisfaction did not correlate with concordance in the decision-making process. Conclusion The vast majority preferred a shared or active decision-making process and wanted information about their diagnosis and prognosis. Older patients and those who wanted to know their diagnosis seemed to be more satisfied with the way treatment decisions were made. PMID:24035071

Patient characteristics as predictors of primary health care preferences: a systematic literature analysis

PubMed Central

Jung, Hans Peter; Baerveldt, Cor; Olesen, Frede; Grol, Richard; Wensing, Michel

2003-01-01

Abstract Objective To identify associations between various cultural and demographic factors and patients’ primary health care preferences. Search strategy Searches were performed in MEDLINE (1966–December 2000), PsycINFO (1977–May 2001) and Sociological Abstracts (1963–December 2000). Identified papers were checked for more papers. Inclusion criteria Studies with a focus on primary health care or health care in general, asking patients about preferences with regard to health care, reporting quantitative results and examining the relations between specific patient characteristics and patient preferences. Data extraction and synthesis Data were extracted from studies using a scoring form to register what methods were used, which patient characteristics were analysed and which patient characteristics significantly influenced patients’ preferences with regard to different aspects of health care (P < 0.05). Main results A total of 145 studies were included with 2276 comparisons between subgroups of patients. Of all the comparisons, 607 (27%) showed a significant association between patient characteristics and preferences with regard to primary health care. Age and economic status significantly related to patient preferences in 38 and 33% of the comparisons, respectively. Education, health status, family situation, sex, and utilization of health care related significantly to patient preferences in less than 25% of the comparisons. Conclusions This review of the literature showed patient characteristics to be an important determinant of preferences regarding many aspects of primary health care defined as general practice care or health care, in general. All of the patient characteristics examined here showed at least some significant associations with preferences for primary health care. PMID:12752744

Preliminary Investigation of a Video-Based Stimulus Preference Assessment

ERIC Educational Resources Information Center

Snyder, Katie; Higbee, Thomas S.; Dayton, Elizabeth

2012-01-01

Video clips may be an effective format for presenting complex stimuli in preference assessments. In this preliminary study, we evaluated the correspondence between preference hierarchies generated from preference assessments that included either toys or videos of the toys. The top-ranked item corresponded in both assessments for 5 of the 6…

Influence of the onsite experience on recreation experience preference judgments

Treesearch

William P. Stewart

1992-01-01

This study was designed to investigate the impact of actual experience on experience preference. Experience preference measurements were taken before and after a hiking experience. A shift between pre-activity and post-activity experience preference judgments was hypothesized due to the effect of psychological adjustment to reduce dissonance between pre-activity...

Developmental Stability in Gender-Typed Preferences between Infancy and Preschool Age

ERIC Educational Resources Information Center

Lauer, Jillian E.; Ilksoy, Sibel D.; Lourenco, Stella F.

2018-01-01

Infants exhibit visual preferences for gender-typed objects (e.g., dolls, toy vehicles) that parallel the gender-typed play preferences of preschool-aged children, but the developmental stability of individual differences in early emerging gender-typed preferences has not yet been characterized. In the present study, we examined the longitudinal…

Collaboration, Engagement & Fun: How Youth Preferences in Video Gaming Can Inform 21st Century Education

ERIC Educational Resources Information Center

Trespalacios, Jesus; Chamberlin, Barbara; Gallagher, Rachel R.

2011-01-01

In this content analysis study, researchers explored middle school students' preference for playing video games and the possible implications for learning environments. During two-week, summer sessions, learners played videos games and answered questions related to their preferences in different settings. Students' preferences and justifications…

A Comparison of Students' Choices of 9th Grade Physical Education Activities by Ethnicity

ERIC Educational Resources Information Center

Hill, Grant M.; Cleven, Brian

2006-01-01

The purposes of this study were to determine physical education activity preferences of 9th grade students in a southern California school district and to compare preferences by ethnicity. Results indicated that basketball, football, bowling, softball/baseball, swimming, and volleyball were the most preferred activities. These preferences may be…

"I Know What I Like": Stability of Aesthetic Preference in Alzheimer's Patients

ERIC Educational Resources Information Center

Halpern, Andrea R.; Ly, Jenny; Elkin-Frankston, Seth; O'Connor, Margaret G.

2008-01-01

Two studies explored the stability of art preference in patients with Alzheimer's disease and age-matched control participants. Preferences for three different styles of paintings, displayed on art postcards, were examined over two sessions. Preference for specific paintings differed among individuals but AD and non-AD groups maintained about the…

Preference for locus of punishment in a response sequence.

NASA Technical Reports Server (NTRS)

Dardano, J. F.

1972-01-01

Study of differences in the aversiveness of response-dependent shock when scheduled on the first, middle or final response of a sequence of 70 responses of food-deprived pigeons, using a procedure to identify relative preferences. The preferred shock schedule and the strength of the preference were found to vary among the pigeons.

Academic reading format preferences and behaviors among university students worldwide: A comparative survey analysis

PubMed Central

Kurbanoglu, Serap; Boustany, Joumana

2018-01-01

This study reports the descriptive and inferential statistical findings of a survey of academic reading format preferences and behaviors of 10,293 tertiary students worldwide. The study hypothesized that country-based differences in schooling systems, socioeconomic development, culture or other factors might have an influence on preferred formats, print or electronic, for academic reading, as well as the learning engagement behaviors of students. The main findings are that country of origin has little to no relationship with or effect on reading format preferences of university students, and that the broad majority of students worldwide prefer to read academic course materials in print. The majority of participants report better focus and retention of information presented in print formats, and more frequently prefer print for longer texts. Additional demographic and post-hoc analysis suggests that format preference has a small relationship with academic rank. The relationship between task demands, format preferences and reading comprehension are discussed. Additional outcomes and implications for the fields of education, psychology, computer science, information science and human-computer interaction are considered. PMID:29847560

A cross-cultural perspective on the preference for potential effect: an individual participant data (IPD) meta-analysis approach.

PubMed

Sun, Xiaomin; Xu, Dan; Luo, Fang; Wei, Zihan; Wei, Cong; Xue, Gang

2015-01-01

A recent paper [Tormala ZL, Jia JS, Norton MI (2012). The preference for potential. Journal of personality and social psychology, 103: 567-583] demonstrated that persons often prefer potential rather than achievement when evaluating others, because information regarding potential evokes greater interest and processing, resulting in more favorable evaluations. This research aimed to expand on this finding by asking two questions: (a) Is the preference for potential effect replicable in other cultures? (b) Is there any other mechanism that accounts for this preference for potential? To answer these two questions, we replicated Tormala et al.'s study in multiple cities (17 studies with 1,128 participants) in China using an individual participant data (IPD) meta-analysis approach to test our hypothesis. Our results showed that the preference for potential effect found in the US is also robust in China. Moreover, we also found a pro-youth bias behind the preference for potential effect. To be specific, persons prefer a potential-oriented applicant rather than an achievement-oriented applicant, partially because they believe that the former is younger than the latter.

Using personas to tailor educational messages to the preferences of coronary heart disease patients.

PubMed

Vosbergen, S; Mulder-Wiggers, J M R; Lacroix, J P; Kemps, H M C; Kraaijenhagen, R A; Jaspers, M W M; Peek, N

2015-02-01

Although tailoring health education messages to individual characteristics of patients has shown promising results, most patient education materials still take a one-size-fits-all approach. The aim of this study was to develop a method for tailoring health education messages to patients' preferences for various message features, using the concept of personas. This is a preliminary study focused on education for coronary heart disease (CHD) patients. This study used a three-step approach. First, we created personas by (i) performing k-means cluster analysis on data from an online survey that assessed the preferences of 213 CHD patients for various message features and, (ii) creating a vivid description of the preferences per patient cluster in an iterative process with the research team. Second, we developed adaptation rules to tailor existing educational messages to the resulting personas. Third, we conducted a pilot validation by adapting nine existing educational messages to each of the personas. These messages and the resulting personas were then presented to a separate group of 38 CHD patients who visited the cardiology outpatient clinic. They were first asked to choose their most preferred, second most preferred, and least preferred persona. Subsequently, they were asked to rate three of the adapted messages; one for every of the persona choices. We created five personas that pertained to five patient clusters. Personas varied mainly on preferences for medical or lay language, current or future temporal perspective, and including or excluding explicit health risks. Fifty-five different adaptation rules were developed, primarily describing adaptations to the message's perspective, level of detail, sentence structure, and terminology. Most participants in the validation study could identify with one of the five personas, although some of them found it hard to choose. On average, 68.5% of all participants rated the messages that matched their most preferred persona more positively than, or in the same way as, the messages that matched their least preferred persona. The persona-based method developed in this study can be used to create a manageable set of patient-centered tailored messages, while additionally using the developed personas to assess patients' preferences. Copyright © 2014 Elsevier Inc. All rights reserved.

CAST/EiJ and C57BL/6J Mice Differ in Their Oral and Postoral Attraction to Glucose and Fructose.

PubMed

Sclafani, Anthony; Vural, Austin S; Ackroff, Karen

2017-03-01

A recent study indicated that CAST/EiJ and C57BL/6J mice differ in their taste preferences for maltodextrin but display similar sucrose preferences. The present study revealed strain differences in preferences for the constituent sugars of sucrose. Whereas B6 mice preferred 8% glucose to 8% fructose in 2-day tests, the CAST mice preferred fructose to glucose. These preferences emerged with repeated testing which suggested post-oral influences. In a second experiment, 2-day choice tests were conducted with the sugars versus a sucralose + saccharin (SS) mixture which is highly preferred in brief access tests. B6 mice strongly preferred glucose but not fructose to the non-nutritive SS whereas CAST mice preferred SS to both glucose and fructose even when food restricted. This implied that CAST mice are insensitive to the postoral appetite stimulating actions of the 2 sugars. A third experiment revealed, however, that intragastric glucose and fructose infusions conditioned significant but mild flavor preferences in CAST mice, whereas in B6 mice glucose conditioned a robust preference but fructose was ineffective. Thus, unlike other mouse strains and rats, glucose is not more reinforcing than fructose in CAST mice. Their oral preference for fructose over glucose may be related to a subsensitive maltodextrin receptor or glucose-specific receptor which is stimulated by glucose but not fructose. The failure of CAST mice to prefer glucose to a non-nutritive sweetener distinguishes this strain from other mouse strains and rats. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Preferences for Salty and Sweet Tastes Are Elevated and Related to Each Other during Childhood

PubMed Central

Mennella, Julie A.; Finkbeiner, Susana; Lipchock, Sarah V.; Hwang, Liang-Dar; Reed, Danielle R.

2014-01-01

Background The present study aimed to determine if salty and sweet taste preferences in children are related to each other, to markers of growth, and to genetic differences. Methods We conducted a 2-day, single-blind experimental study using the Monell two-series, forced-choice, paired-comparison tracking method to determine taste preferences. The volunteer sample consisted of a racially/ethnically diverse group of children, 5–10 years of age (n = 108), and their mothers (n = 83). After excluding those mothers who did not meet eligibility and children who did not understand or comply with study procedures, the final sample was 101 children and 76 adults. The main outcome measures were most preferred concentration of salt in broth and crackers; most preferred concentration of sucrose in water and jelly; reported dietary intake of salty and sweet foods; levels of a bone growth marker; anthropometric measurements such as height, weight, and percent body fat; and TAS1R3 (sweet taste receptor) genotype. Results Children preferred higher concentrations of salt in broth and sucrose in water than did adults, and for both groups, salty and sweet taste preferences were significantly and positively correlated. In children, preference measures were related to reported intake of sodium but not of added sugars. Children who were tall for their age preferred sweeter solutions than did those that were shorter and percent body fat was correlated with salt preference. In mothers but not in children, sweet preference correlated with TAS1R3 genotype. Conclusions and Relevance For children, sweet and salty taste preferences were positively correlated and related to some aspects of real-world food intake. Complying with recommendations to reduce added sugars and salt may be more difficult for some children, which emphasizes the need for new strategies to improve children's diets. PMID:24637844

The preference to receive chemotherapy and cancer-related outcomes in older adults with breast cancer CALGB 49907 (Alliance).

PubMed

Gajra, Ajeet; McCall, Linda; Muss, Hyman B; Cohen, Harvey J; Jatoi, Aminah; Ballman, Karla V; Partridge, Ann H; Sutton, Linda; Parker, Barbara A; Magrinat, Gustav; Klepin, Heidi D; Lafky, Jacqueline M; Hurria, Arti

2018-05-01

Chemotherapy preference refers to a patient's interest in receiving chemotherapy. This study examined whether chemotherapy preference was associated with toxicity, efficacy, quality of life (QoL), and functional outcomes during and after completion of adjuvant chemotherapy in older women with breast cancer. This study is a secondary analysis of CALGB 49907, a randomized trial that compared standard adjuvant chemotherapy versus capecitabine in patients age 65 years or older with breast cancer. A subset of 145 patients completed a questionnaire to describe chemotherapy preference pre-treatment. The association of this pre-treatment preference with the patient's perception of self-health, predicted and actual QoL, patient- and professional-reported toxicity, mental health, self-rated function, and survival was studied during and after treatment. The median age of patients was 71 years and 47% had a high preference for chemotherapy. On baseline demographics, the low preference group had a higher proportion of white patients (95% vs. 78%, p = 0.004). Before treatment, low chemotherapy preference was associated with greater nausea/vomiting (p = 0.008). Mid-treatment, low preference was associated with lower QoL, worse social, emotional and physical function (all p ≤ 0.02) and worse nausea/vomiting, cancer symptoms and financial worries (all p < 0.05). The association noted mid-treatment, resolved after treatment completion except with financial worries which persisted at 24 months. Low preference was associated with higher rates of grade 3-5 adverse events (53% vs. 34%, p = 0.02) but was not associated with survival. Low chemotherapy preference prior to treatment initiation was associated with lower QoL, worse physical symptoms and self-rated function and more adverse events mid-treatment. There is no association of chemotherapy preference with survival. Copyright © 2018 Elsevier Ltd. All rights reserved.

Communicating with child patients in pediatric oncology consultations: a vignette study on child patients', parents', and survivors' communication preferences.

PubMed

Zwaanswijk, Marieke; Tates, Kiek; van Dulmen, Sandra; Hoogerbrugge, Peter M; Kamps, Willem A; Beishuizen, A; Bensing, Jozien M

2011-03-01

To investigate the preferences of children with cancer, their parents, and survivors of childhood cancer regarding medical communication with child patients and variables associated with these preferences. Preferences regarding health-care provider empathy in consultations, and children's involvement in information exchange and medical decision making were investigated by means of vignettes. Vignettes are brief descriptions of hypothetical situations, in which important factors are systematically varied following an experimental design. In total, 1440 vignettes were evaluated by 34 children with cancer (aged 8-16), 59 parents, and 51 survivors (aged 8-16 at diagnosis, currently aged 10-30). Recruitment of participants took place in three Dutch university-based pediatric oncology centers. Data were analyzed by multilevel analyses. Patients, parents, and survivors indicated the importance of health-care providers' empathy in 81% of the described situations. In most situations (70%), the three respondent groups preferred information about illness and treatment to be given to patients and parents simultaneously. Preferences regarding the amount of information provided to patients varied. The preference whether or not to shield patients from information was mainly associated with patients' age and emotionality. In most situations (71%), the three respondent groups preferred children to participate in medical decision making. This preference was mainly associated with patients' age. To be able to adapt communication to parents' and patients' preferences, health-care providers should repeatedly assess the preferences of both groups. Future studies should investigate how health-care providers balance their communication between the sometimes conflicting preferences of patients and parents. Copyright © 2010 John Wiley & Sons, Ltd.

Predictive Validity and Adjustment of Ideal Partner Preferences Across the Transition Into Romantic Relationships.

PubMed

Gerlach, Tanja M; Arslan, Ruben C; Schultze, Thomas; Reinhard, Selina K; Penke, Lars

2017-09-18

Although empirical research has investigated what we ideally seek in a romantic partner for decades, the crucial question of whether ideal partner preferences actually guide our mating decisions in real life has remained largely unanswered. One reason for this is the lack of designs that assess individuals' ideal partner preferences before entering a relationship and then follow up on them over an extended period. In the Göttingen Mate Choice Study (GMCS), a preregistered, large-scale online study, we used such a naturalistic prospective design. We investigated partner preferences across 4 preference domains in a large sample of predominantly heterosexual singles (N = 763, aged 18-40 years) and tracked these individuals across a period of 5 months upon a possible transition into romantic relationships. Attesting to their predictive validity, partner preferences prospectively predicted the characteristics of later partners. This was equally true for both sexes, except for vitality-attractiveness where men's preferences were more predictive of their later partners' standing on this dimension than women's. Self-perceived mate value did not moderate the preference-partner characteristics relations. Preferences proved to be relatively stable across the 5 months interval, yet were less stable for those who entered a relationship. Subgroup analyses using a newly developed indicator of preference adjustment toward (vs. away from) partner characteristics revealed that participants adjusted their preferences downward when partners fell short of initial preferences, but showed no consistent adjustment when partners exceeded them. Results and implications are discussed against the background of ongoing controversies in mate choice and romantic relationship research. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Alcoholic beverage preference and diet in a representative Dutch population: the Dutch national food consumption survey 2007-2010.

PubMed

Sluik, D; van Lee, L; Geelen, A; Feskens, E J

2014-03-01

The habitual consumption of a specific type of alcoholic beverage may be related to the overall dietary pattern. The objective of this cross-sectional study was to investigate associations between alcoholic beverage preference and dietary intake in The Netherlands. A total of 2100 men and women from the Dutch National Food Consumption Survey 2007-2010 were studied. A general questionnaire assessed alcoholic beverage preference and two non-consecutive 24-h dietary recalls assessed overall diet. Mean nutrient and food group intakes, and adherence to the 2006 Dutch dietary guidelines across categories of alcoholic beverage preference were compared and adjusted for age, sex, body mass index (BMI), education, smoking, physical activity, energy intake and frequency and absolute alcohol consumption. Largest differences in dietary habits were detected between persons who preferred wine and those who preferred beer. Persons with a beer preference had a higher absolute intake of meat, soft drinks, margarine and snacks. In contrast, persons with a wine preference had a higher absolute consumption of healthy foods. However, after multiple adjustments, wine consumers still consumed less energy and more vegetables and fruit juices compared with beer consumers. Adherence to the Dutch dietary guidelines did not differ between preference categories after multiple adjustments. In this cross-sectional analysis in a representative sample of the Dutch population, a beer preference was associated with less healthy dietary behaviour, especially compared with wine preference. However, these differences were largely explained by other socio-demographic and lifestyle factors. These results suggest that alcoholic beverage preference may not be independently related to diet.

Music Listening Preferences of Macau Students

ERIC Educational Resources Information Center

Hui, Wanfong Viny

2009-01-01

This is a pioneer study of Macau's music education focusing on music listening preference. Adopting models from Western cultures, the study, launched in 2006, aimed to explore the factors of age and gender in regard to music preference. The subjects ranged from fourth-graders to university students (N=2495) (15 missing). Participants rated their…

Students' Reasons for Preferences of Contexts in Learning Mathematics

ERIC Educational Resources Information Center

Kazima, Mercy

2015-01-01

This paper reports on findings from a study that investigated reasons Malawian students have for preferring particular contexts in mathematics. The study explored students' preferences of contexts using a survey questionnaire that contained 27 contexts and asked students to indicate their level of interest for each context on a 4-point scale and…

Korean Secondary School Students' Occupational Preferences across School Types: Specificity Versus Broad Levels

ERIC Educational Resources Information Center

Kim, Kyung-Nyun

2015-01-01

This study considers the specificity of 3,136 Korean students' occupational preferences during secondary school and examines whether the types of high school are related to the crystallization in occupational preferences by applying binary growth models. Based on Super's developmental stage, this study shows that students largely formulate solid…

EFL Students' Preferences toward the Lecturer's Corrective Feedback in Business Letters Writing

ERIC Educational Resources Information Center

Sanu, La Ode

2016-01-01

This study aimed to investigate the students' preferences toward the lecturer's corrective feedback in the business letter writing and their reasons why they preferred particular corrective feedback types. A case study was used by involving 15 EFL students who enrolled in the Business Correspondence Course. The questionnaire and interview were…

Psychological Type Preferences of Roman Catholic Priests in the United Kingdom

ERIC Educational Resources Information Center

Craig, Charlotte L.; Duncan, Bruce; Francis, Leslie J.

2006-01-01

This study explores the psychological type profile of Roman Catholic priests. A sample of 79 priests completed the Myers-Briggs Type Indicator (Form G). The study shows that Roman Catholic priests tend to prefer introversion over extraversion, feeling over thinking and judging over perceiving. Near equal preferences are shown for sensing and…

A Lifespan Study of Classification Preference.

ERIC Educational Resources Information Center

Pearce, Kathy A.; Denney, Nancy Wadsworth

Previous research in classification preference has focused on only a few selected age groups. To investigate the classification preferences of individuals from early childhood through old age in the same study, 144 individuals between the ages of 4 and 70 completed a revised version of the Conceptual Styles Test. Analysis of results showed that…

Adult Learners' Preferred Methods of Learning Preventative Heart Disease Care

ERIC Educational Resources Information Center

Alavi, Nasim

2016-01-01

The purpose of this study was to investigate the preferred method of learning about heart disease by adult learners. This research study also investigated if there was a statistically significant difference between race/ethnicity, age, and gender of adult learners and their preferred method of learning preventative heart disease care. This…

Perceptual Learning Style Preferences for EFL Students in Junior Colleges in Taiwan.

ERIC Educational Resources Information Center

Lin, Hsiang-Pao; Shen, Shan-shan

This study investigated the learning style preferences of Taiwanese junior college students of English-as-a-Second-Language (ESL) and student characteristics, language experience, and attitudes that appeared related to learning style preference. Subjects were approximately 1,000 EFL students in the first through third years of study at seven…

University Programme Preferences of High School Science Students in Singapore and Reasons that Matter in their Preferences: A Rasch analysis

NASA Astrophysics Data System (ADS)

Oon, Pey-Tee; Subramaniam, R.

2015-01-01

This study explored an under-researched area in science education-the university programmes preferred by high school students who take physical science subjects and the reasons that matter in their preferences. A total of 1,071 upper secondary and pre-university students in Singapore, who take physical science subjects among their range of subjects, participated in this study. A survey method was adopted and the Rasch model was used to analyse the data. Overall, Business Studies was ranked as the predominant choice; nonetheless, scientific programmes such as Science, Engineering, and Mathematics are generally still well liked by the students. When gender differences were examined, we found that students largely followed gender-typical programme preferences, in which males tend to incline towards Engineering while females tend to incline towards Arts and Social Sciences. Students prefer a university programme based on their individual interest and ability, with career aspiration and remuneration coming next. Interestingly, females place greater emphasis on career aspiration than males. Some implications of the study are discussed.

The Effects of Preference for Information on Consumers’ Online Health Information Search Behavior

PubMed Central

2013-01-01

Background Preference for information is a personality trait that affects people’s tendency to seek information in health-related situations. Prior studies have focused primarily on investigating its impact on patient-provider communication and on the implications for designing information interventions that prepare patients for medical procedures. Few studies have examined its impact on general consumers’ interactions with Web-based search engines for health information or the implications for designing more effective health information search systems. Objective This study intends to fill this gap by investigating the impact of preference for information on the search behavior of general consumers seeking health information, their perceptions of search tasks (representing information needs), and user experience with search systems. Methods Forty general consumers who had previously searched for health information online participated in the study in our usability lab. Preference for information was measured using Miller’s Monitor-Blunter Style Scale (MBSS) and the Krantz Health Opinion Survey-Information Scale (KHOS-I). Each participant completed four simulated health information search tasks: two look-up (fact-finding) and two exploratory. Their behaviors while interacting with the search systems were automatically logged and ratings of their perceptions of tasks and user experience with the systems were collected using Likert-scale questionnaires. Results The MBSS showed low reliability with the participants (Monitoring subscale: Cronbach alpha=.53; Blunting subscale: Cronbach alpha=.35). Thus, no further analyses were performed based on the scale. KHOS-I had sufficient reliability (Cronbach alpha=.77). Participants were classified into low- and high-preference groups based on their KHOS-I scores. The high-preference group submitted significantly shorter queries when completing the look-up tasks (P=.02). The high-preference group made a significantly higher percentage of parallel movements in query reformulation than did the low-preference group (P=.04), whereas the low-preference group made a significantly higher percentage of new concept movements than the high-preference group when completing the exploratory tasks (P=.01). The high-preference group found the exploratory tasks to be significantly more difficult (P=.05) and the systems to be less useful (P=.04) than did the low-preference group. Conclusions Preference for information has an impact on the search behavior of general consumers seeking health information. Those with a high preference were more likely to use more general queries when searching for specific factual information and to develop more complex mental representations of health concerns of an exploratory nature and try different combinations of concepts to explore these concerns. High-preference users were also more demanding on the system. Health information search systems should be tailored to fit individuals’ information preferences. PMID:24284061

The effects of preference for information on consumers' online health information search behavior.

PubMed

Zhang, Yan

2013-11-26

Preference for information is a personality trait that affects people's tendency to seek information in health-related situations. Prior studies have focused primarily on investigating its impact on patient-provider communication and on the implications for designing information interventions that prepare patients for medical procedures. Few studies have examined its impact on general consumers' interactions with Web-based search engines for health information or the implications for designing more effective health information search systems. This study intends to fill this gap by investigating the impact of preference for information on the search behavior of general consumers seeking health information, their perceptions of search tasks (representing information needs), and user experience with search systems. Forty general consumers who had previously searched for health information online participated in the study in our usability lab. Preference for information was measured using Miller's Monitor-Blunter Style Scale (MBSS) and the Krantz Health Opinion Survey-Information Scale (KHOS-I). Each participant completed four simulated health information search tasks: two look-up (fact-finding) and two exploratory. Their behaviors while interacting with the search systems were automatically logged and ratings of their perceptions of tasks and user experience with the systems were collected using Likert-scale questionnaires. The MBSS showed low reliability with the participants (Monitoring subscale: Cronbach alpha=.53; Blunting subscale: Cronbach alpha=.35). Thus, no further analyses were performed based on the scale. KHOS-I had sufficient reliability (Cronbach alpha=.77). Participants were classified into low- and high-preference groups based on their KHOS-I scores. The high-preference group submitted significantly shorter queries when completing the look-up tasks (P=.02). The high-preference group made a significantly higher percentage of parallel movements in query reformulation than did the low-preference group (P=.04), whereas the low-preference group made a significantly higher percentage of new concept movements than the high-preference group when completing the exploratory tasks (P=.01). The high-preference group found the exploratory tasks to be significantly more difficult (P=.05) and the systems to be less useful (P=.04) than did the low-preference group. Preference for information has an impact on the search behavior of general consumers seeking health information. Those with a high preference were more likely to use more general queries when searching for specific factual information and to develop more complex mental representations of health concerns of an exploratory nature and try different combinations of concepts to explore these concerns. High-preference users were also more demanding on the system. Health information search systems should be tailored to fit individuals' information preferences.

Green roof systems: a study of public attitudes and preferences in southern Spain.

PubMed

Fernandez-Cañero, Rafael; Emilsson, Tobias; Fernandez-Barba, Carolina; Herrera Machuca, Miguel Ángel

2013-10-15

This study investigates people's preconceptions of green roofs and their visual preference for different green roof design alternatives in relation to behavioral, social and demographical variables. The investigation was performed as a visual preference study using digital images created to represent eight different alternatives: gravel roof, extensive green roof with Sedums not in flower, extensive green roof with sedums in bloom, semi-intensive green roof with sedums and ornamental grasses, semi-intensive green roof with shrubs, intensive green roof planted with a lawn, intensive green roof with succulent and trees and intensive green roof with shrubs and trees. Using a Likert-type scale, 450 respondents were asked to indicate their preference for each digital image. Results indicated that respondents' sociodemographic characteristics and childhood environmental background influenced their preferences toward different green roof types. Results also showed that green roofs with a more careful design, greater variety of vegetation structure, and more variety of colors were preferred over alternatives. Copyright © 2013 Elsevier Ltd. All rights reserved.

How should periods without social interaction be scheduled? Children's preference for practical schedules of positive reinforcement.

PubMed

Luczynski, Kevin C; Hanley, Gregory P

2014-01-01

Several studies have shown that children prefer contingent reinforcement (CR) rather than yoked noncontingent reinforcement (NCR) when continuous reinforcement is programmed in the CR schedule. Preference has not, however, been evaluated for practical schedules that involve CR. In Study 1, we assessed 5 children's preference for obtaining social interaction via a multiple schedule (periods of fixed-ratio 1 reinforcement alternating with periods of extinction), a briefly signaled delayed reinforcement schedule, and an NCR schedule. The multiple schedule promoted the most efficient level of responding. In general, children chose to experience the multiple schedule and avoided the delay and NCR schedules, indicating that they preferred multiple schedules as the means to arrange practical schedules of social interaction. In Study 2, we evaluated potential controlling variables that influenced 1 child's preference for the multiple schedule and found that the strong positive contingency was the primary variable. © Society for the Experimental Analysis of Behavior.

Patient Preference for Instructional Reinforcement Regarding Prevention of Radiation Dermatitis.

PubMed

Laszewski, Pamela; Zelko, Cynthia; Andriths, Lena; Vera Cruz, Eva; Bauer, Carole; Magnan, Morris A

2016-04-01

Although patient preference is a core value within the context of patient-centered models of care, little attention has been paid to determining patient preference for instructional media. Nurses have traditionally used verbal face-to-face instruction as the mainstay of patient education, with written materials being used extensively as teaching guides to supplement verbal instruction or for instructional reinforcement. However, advances in technology have made possible the adding of video instruction to nurses' repertoire of instructional media. The purpose of this study was to determine patients' media preferences (verbal, video, written) when receiving instructional reinforcement about self-care needed to prevent radiation dermatitis. The current study was conducted as a secondary analysis of data from a process improvement initiative. In the parent study, patients received multimedia education related to skin care to prevent radiation dermatitis. This secondary analysis examined patient preference for verbal, video, or written education reinforcement at treatment weeks 1 and 3. Results suggest that, when given a choice, verbal and video reinforcement are preferred over written reinforcement.

Personal value preferences, group identifications, and cultural practices of Palestinian Israelis working in close contact with Jewish Israelis.

PubMed

Tartakovsky, Eugene; Abu Kheit, Ayat

2017-01-01

The present study investigates the connection between personal value preferences, group identifications, and cultural practices among Palestinian Israelis working in close contact with the Jewish population in Israel. One hundred twenty-two Palestinian Israelis participated in the study. The participants were employed in different professional positions in the Tel Aviv Metropolitan area and were recruited to the study using the snowball technique. A stronger national identification was associated with a higher preference for the security and conformity values, and a lower preference for the humility values. A stronger ethnic identification was associated with a lower preference for the security, power, and stimulation values. Group identifications mediated the connection between personal value preferences and cultural practices. A longer time working in close contact with the majority group and less frequent visits home were associated with a greater adherence to the majority group's cultural practices but not with adherence to the ethnic group's practices and not with the group identifications.

Decision heuristic or preference? Attribute non-attendance in discrete choice problems.

PubMed

Heidenreich, Sebastian; Watson, Verity; Ryan, Mandy; Phimister, Euan

2018-01-01

This paper investigates if respondents' choice to not consider all characteristics of a multiattribute health service may represent preferences. Over the last decade, an increasing number of studies account for attribute non-attendance (ANA) when using discrete choice experiments to elicit individuals' preferences. Most studies assume such behaviour is a heuristic and therefore uninformative. This assumption may result in misleading welfare estimates if ANA reflects preferences. This is the first paper to assess if ANA is a heuristic or genuine preference without relying on respondents' self-stated motivation and the first study to explore this question within a health context. Based on findings from cognitive psychology, we expect that familiar respondents are less likely to use a decision heuristic to simplify choices than unfamiliar respondents. We employ a latent class model of discrete choice experiment data concerned with National Health Service managers' preferences for support services that assist with performance concerns. We present quantitative and qualitative evidence that in our study ANA mostly represents preferences. We also show that wrong assumptions about ANA result in inadequate welfare measures that can result in suboptimal policy advice. Future research should proceed with caution when assuming that ANA is a heuristic. Copyright © 2017 John Wiley & Sons, Ltd.

Effects of test method and participant musical training on preference ratings of stimuli with different reverberation times.

PubMed

Lawless, Martin S; Vigeant, Michelle C

2017-10-01

Selecting an appropriate listening test design for concert hall research depends on several factors, including listening test method and participant critical-listening experience. Although expert listeners afford more reliable data, their perceptions may not be broadly representative. The present paper contains two studies that examined the validity and reliability of the data obtained from two listening test methods, a successive and a comparative method, and two types of participants, musicians and non-musicians. Participants rated their overall preference of auralizations generated from eight concert hall conditions with a range of reverberation times (0.0-7.2 s). Study 1, with 34 participants, assessed the two methods. The comparative method yielded similar results and reliability as the successive method. Additionally, the comparative method was rated as less difficult and more preferable. For study 2, an additional 37 participants rated the stimuli using the comparative method only. An analysis of variance of the responses from both studies revealed that musicians are better than non-musicians at discerning their preferences across stimuli. This result was confirmed with a k-means clustering analysis on the entire dataset that revealed five preference groups. Four groups exhibited clear preferences to the stimuli, while the fifth group, predominantly comprising non-musicians, demonstrated no clear preference.

Mobile phone usage does not affect sudden sensorineural hearing loss.

PubMed

Sagiv, D; Migirov, L; Madgar, O; Nakache, G; Wolf, M; Shapira, Y

2018-01-01

Recent studies found that mobile phone users had a significantly greater risk of having elevated thresholds in speech frequencies. This study investigated the correlation between the laterality of sudden sensorineural hearing loss, handedness and the preferred ear for mobile phone use. The study included all patients who presented with sudden sensorineural hearing loss to the Department of Otolaryngology - Head and Neck Surgery in our tertiary referral medical centre between 2014 and 2016. Patients were asked to indicate their dominant hand and preferred ear for mobile phone use. The study comprised 160 patients. No correlation was found between the dominant hand or preferred ear for mobile phone use and the side of sudden sensorineural hearing loss. There was no correlation between the side of the sudden sensorineural hearing loss (preferable or non-preferable for mobile phone use) and audiometric characteristics. No correlation was found between the laterality of ears used for mobile phone and sudden sensorineural hearing loss.

Do Italian women prefer cesarean section? Results from a survey on mode of delivery preferences

PubMed Central

2013-01-01

Background About 20 million cesareans occur each year in the world and rates have steadily increased in almost all middle- and high-income countries over the last decades. Maternal request is often argued as one of the key forces driving this increase. Italy has the highest cesarean rate of Europe, yet there are no national surveys on the views of Italian women about their preferences on route of delivery. This study aimed to assess Italian women´s preference for mode of delivery, as well as reasons and factors associated with this preference, in a nationally representative sample of women. Methods This cross sectional survey was conducted between December 2010-March 2011. An anonymous structured questionnaire asked participants what was their preferred mode of delivery and explored the reasons for this preference by assessing their agreement to a series of statements. Participants were also asked to what extent their preference was influenced by a series of possible sources. The 1st phase of the study was carried out among readers of a popular Italian women´s magazine (Io Donna). In a 2nd phase, the study was complemented by a structured telephone interview. Results A total of 1000 Italian women participated in the survey and 80% declared they would prefer to deliver vaginally if they could opt. The preference for vaginal delivery was significantly higher among older (84.7%), more educated (87.6%), multiparous women (82.3%) and especially among those without any previous cesareans (94.2%). The main reasons for preferring a vaginal delivery were not wanting to be separated from the baby during the first hours of life, a shorter hospital stay and a faster postpartum recovery. The main reasons for preferring a cesarean were fear of pain, convenience to schedule the delivery and because it was perceived as being less traumatic for the baby. The source which most influenced the preference of these Italian women was their obstetrician, followed by friends or relatives. Conclusion Four in five Italian women would prefer to deliver vaginally if they could opt. Factors associated with a higher preference for cesarean delivery were youth, nulliparity, lower education and a previous cesarean. PMID:23530472

Identifying and prioritizing the preference criteria using analytical hierarchical process for a student-lecturer allocation problem of internship programme

NASA Astrophysics Data System (ADS)

Faudzi, Syakinah; Abdul-Rahman, Syariza; Rahman, Rosshairy Abd; Hew, Jafri Hj. Zulkepli

2016-10-01

This paper discusses on identifying and prioritizing the student's preference criteria towards supervisor using Analytical Hierarchical Process (AHP) for student-lecturer allocation problem of internship programme. Typically a wide number of students undertake internship every semester and many preferences criteria may involve when assigning students to lecturer for supervision. Thus, identifying and prioritizing the preference criteria of assigning students to lecturer is critically needed especially when involving many preferences. AHP technique is used to prioritize the seven criteria which are capacity, specialization, academic position, availability, professional support, relationship and gender. Student's preference alternative is classified based on lecturer's academic position which are lecturer, senior lecturer, associate professor and professor. Criteria are ranked to find the best preference criteria and alternatives of the supervisor that students prefer to have. This problem is solved using Expert Choice 11 software. A sample of 30 respondents who are from semester 6 and above are randomly selected to participate in the study. By using questionnaire as our medium in collecting the student's data, consistency index is produced to validate the proposed study. Findings and result showed that, the most important preference criteria is professional support. It is followed by specialization, availability, relationship, gender, academic position and capacity. This study found that student would like to have a supportive supervisor because lack of supervision can lead the students to achieve low grade and knowledge from the internship session.

Age and Environment Determined Children's Preference Towards Dentist Attire - A Cross - Sectional Study.

PubMed

Ravikumar, Dhanalakshmi; Gurunathan, Deepa; Karthikeyan, Shanmugaavel; Subbramanian, Emg; Samuel, Victor A

2016-10-01

The attire of the dentist has an influence on child's behaviour in dental setup. Recent research has shown that the children have preferences towards the outfit worn by the dentist. The aim of the study was to determine the preference of children towards dentists' attire based on various age groups and environment. A total of 534 children aged between 6-11 years participated in the study. Children were divided into three groups based on their age as younger, middle and older age groups. Photographs of the dentist in different attires such as white coat, surgical scrubs and regular outfit were shown to children and the questionnaire was evaluated by a single, qualified Paediatric dentist in two different environmental set ups, namely school and dental environment. The anxiety level was evaluated by using Modified Child Dental Anxiety Scale [MCDAS (f)]. Data was collected and tabulated. Statistical analysis was done using SPSS version 20.0. A statistically significant difference was evident in the preference level of children towards dentist attire (p-value= 0.002). There was a positive correlation in the preference level of children towards dentist attire in different age groups. A statistically significant difference was evident in the preference level of children towards the dentist attire in school and dental environment (p-value <0.001). Younger age group children preferred regular outfit and middle and older age group preferred white coat and surgical scrubs respectively. Children preferred white coat in school environment and surgical scrubs in dental environment.

Visual Preferences of Young School Children for Paintings from the 20th Century

ERIC Educational Resources Information Center

Kuscevic, Dubravka; Kardum, Goran; Brajcic, Marija

2014-01-01

The aim of this study was to investigate the differences of young school children in the visual preferences of paintings from the 20th century. The study was conducted at 4 elementary schools around Split, Croatia. A total of 200 children participated in the study, of which 87 were girls and 113 were boys aged 6-10 years. Visual preference testing…

Using Typologies to Interpret Study Abroad Preferences of American Business Students: Applying a Tourism Framework to International Education

ERIC Educational Resources Information Center

Cardon, Peter W.; Marshall, Bryan; Poddar, Amit

2011-01-01

The authors describe research that applies a tourist framework to study abroad attitudes and preferences. A total of 371 university business students in the Southern region of the United States completed a survey that included the International Tourist Role scale and study abroad attitudes and preferences. These students were grouped into one of 4…

The role of mating context and fecundability in women's preferences for men's facial masculinity and beardedness.

PubMed

Dixson, Barnaby J W; Blake, Khandis R; Denson, Thomas F; Gooda-Vossos, Amany; O'Dean, Siobhan M; Sulikowski, Danielle; Rantala, Markus J; Brooks, Robert C

2018-07-01

The ovulatory shift hypothesis proposes that women's preferences for masculine physical and behavioral traits are greater at the peri-ovulatory period than at other points of the menstrual cycle. However, many previous studies used self-reported menstrual cycle data to estimate fecundability rather than confirming the peri-ovulatory phase hormonally. Here we report two studies and three analyses revisiting the ovulatory shift hypothesis with respect to both facial masculinity and beardedness. In Study 1, a large sample of female participants (N = 2,161) self-reported their cycle phase and provided ratings for faces varying in beardedness (clean-shaven, light stubble, heavy stubble, full beards) and masculinity (-50%, -25%, natural, +25% and +50%) in a between-subjects design. In Study 2, 68 women provided the same ratings data, in a within-subjects design in which fertility was confirmed via luteinising hormone (LH) tests and analysed categorically. In Study 2, we also measured salivary estradiol (E) and progesterone (P) at the low and high fertility phases of the menstrual cycle among 36 of these women and tested whether shifts in E, P or E:P ratios predicted face preferences. Preferences for facial masculinity and beardedness did not vary as predicted with fecundability in Study 1, or with respect to fertility as confirmed via LH in Study 2. However, consistent with the ovulatory shift hypothesis, increasing E (associated with cyclical increases in fecundability) predicted increases in preferences for relatively more masculine faces; while high P (associated with cyclical decreases in fecundability) predicted increases in preferences for relatively more feminine faces. We also found an interaction between E and preferences for facial masculinity and beardedness, such that stubble was more attractive on un-manipulated than more masculine faces among women with high E. We consider discrepancies between our findings and those of other recent studies and suggest that closer scrutiny of the stimuli used to measure masculinity preferences across studies may help account for the many conflicting findings that have recently appeared regarding cycle phase preference shifts for facial masculinity. Copyright © 2018 Elsevier Ltd. All rights reserved.

Treatment preference among suicidal and self-injuring women with borderline personality disorder and PTSD.

PubMed

Harned, Melanie S; Tkachuck, Mathew A; Youngberg, Kelly A

2013-07-01

This study examined treatment preferences among suicidal and self-injuring women with borderline personality disorder (BPD) and PTSD. Women (N = 42, M(age) = 34) with BPD, PTSD and recent intentional self-injury were evaluated upon entry into a psychotherapy outcome study. The majority preferred a combined dialectical behavior therapy (DBT) and prolonged exposure (PE) treatment (73.8%), followed by DBT alone (26.2%), and PE alone (0%). Women who preferred the combined treatment were more likely to report a desire to obtain relief from PTSD and to receive specific DBT and PE treatment components as reasons underlying this preference. Few women (21.4%) reported concerns about PE, but those who did were more likely to prefer DBT alone. More severe PTSD re-experiencing symptoms, a childhood index trauma, and less reduction in positive affect after a trauma interview predicted a preference for the combined treatment. These results may help to inform treatment for these complex patients. © 2013 Wiley Periodicals, Inc.

Dutch women in midwife-led care at the onset of labour: which pain relief do they prefer and what do they use?

PubMed Central

2013-01-01

Background Pain experienced during labour is more extreme than many other types of physical pain. Many pregnant women are concerned about labour pain and about how they can deal with this pain effectively. The aim of this study was to examine the associations among low risk pregnant women’s characteristics and their preferred use and actual use of pain medication during labour. Methods Our study is part of the DELIVER study: a dynamic prospective multi-centre cohort study. The data for this study were collected between September 2009 and March 2011, from women at 20 midwifery practices throughout the Netherlands. Inclusion criteria for women were: singleton pregnancies, in midwife–led care at the onset of labour and speaking Dutch, English, Turkish or Arabic. Our study sample consisted of 1511 women in primary care who completed both questionnaire two (from 34 weeks of pregnancy up to birth) and questionnaire three (around six week post partum). These questionnaires were presented either online or on paper. Results Fifteen hundred and eleven women participated. Prenatally, 15.9% of women preferred some method of medicinal pain relief. During labour 15.2% of the total sample used medicinal pain relief and 25.3% of the women who indicated a preference to use medicinal pain relief during pregnancy, used pain medication. Non-Dutch ethnic background and planned hospital birth were associated with indicating a preference for medicinal pain relief during pregnancy. Primiparous and planned hospital birth were associated with actual use of the preferred method of medicinal pain relief during labour. Furthermore, we found that 85.5% of women who indicated a preference not to use pain medication prenatally, did not use any medication. Conclusions Only a small minority of women had a preference for intrapartum pain medication prenatally. Most women did not receive medicinal pain relief during labour, even if they had indicated a preference for it. Care providers should discuss the unpredictability of the labour process and the fact that actual use of pain medication often does not match with women’s preference prenatally. PMID:24325387

Healthcare decision-making in end stage renal disease-patient preferences and clinical correlates.

PubMed

Jayanti, Anuradha; Neuvonen, Markus; Wearden, Alison; Morris, Julie; Foden, Philip; Brenchley, Paul; Mitra, Sandip

2015-11-14

Medical decision-making is critical to patient survival and well-being. Patients with end stage renal disease (ESRD) are faced with incrementally complex decision-making throughout their treatment journey. The extent to which patients seek involvement in the decision-making process and factors which influence these in ESRD need to be understood. 535 ESRD patients were enrolled into the cross-sectional study arm and 30 patients who started dialysis were prospectively evaluated. Patients were enrolled into 3 groups- 'predialysis' (group A), 'in-centre' haemodialysis (HD) (group B) and self-care HD (93 % at home-group C) from across five tertiary UK renal centres. The Autonomy Preference Index (API) has been employed to study patient preferences for information-seeking (IS) and decision-making (DM). Demographic, psychosocial and neuropsychometric assessments are considered for analyses. 458 complete responses were available. API items have high internal consistency in the study population (Cronbach's alpha > 0.70). Overall and across individual study groups, the scores for information-seeking and decision-making are significantly different indicating that although patients had a strong preference to be well informed, they were more neutral in their preference to participate in DM (p < 0.05). In the age, education and study group adjusted multiple linear regression analysis, lower age, female gender, marital status; higher API IS scores and white ethnicity background were significant predictors of preference for decision-making. DM scores were subdivided into tertiles to identify variables associated with high (DM > 70: and low DM (≤30) scores. This shows association of higher DM scores with lower age, lower comorbidity index score, higher executive brain function, belonging in the self-caring cohort and being unemployed. In the prospectively studied cohort of predialysis patients, there was no change in decision-making preference scores after commencement of dialysis. ESRD patients prefer to receive information, but this does not always imply active involvement in decision-making. By understanding modifiable and non-modifiable factors which affect patient preferences for involvement in healthcare decision-making, health professionals may acknowledge the need to accommodate individual patient preferences to the extent determined by the individual patient factors.

Nursing students' career preferences: a Norwegian study.

PubMed

Kloster, Torill; Høie, Magnhild; Skår, Randi

2007-07-01

This paper is a report of a study to identify Norwegian undergraduate nursing students' career preferences at the beginning and end of their nursing education programme, together with their reasons for these preferences. International studies have shown that recruitment and retention of nurses in areas such as aged care and psychiatric nursing is difficult. It is important to know why some working areas are popular whilst others are not, so that nursing schools produce graduates who meet the needs of the community. All students starting their nursing education programme in 2001/2002 in five Norwegian university colleges were invited to complete questionnaires at the beginning and end of their nursing education programme. In phase 1, 620 of 782 commencing students completed questionnaires (response rate 79.2%). In their third year, phase 2, 473 questionnaires were distributed (response rate 82.6%, n = 386). The questionnaire included closed questions about career preferences and open-ended questions seeking the reasons for the preferences. The study revealed changes in preferences between the beginning and the end of the nursing education programme. In phase 1, midwifery and paediatric nursing were ranked highest and in phase 2 working in medical/surgical ward, midwifery and psychiatric nursing were preferred. Working in aged care institutions remained unpopular throughout. Clinical experiences and professional challenges were often given as reasons for preferences. Nursing educators, clinical nurses and policymakers must reconsider their priorities and improve working conditions for nurses in aged care in order to meet society's need for nurses.

Role of intrinsic search cues in the formation of consumer preferences and choice for pork chops.

PubMed

Verbeke, Wim; De Smet, Stefaan; Vackier, Isabelle; Van Oeckel, Monique J; Warnants, Nathalie; Van Kenhove, Patrick

2005-02-01

This study investigates the role of drip, colour, marbling and fat cover as intrinsic search cues in the formation of pork chop preferences and individual determinants. Data are collected from a sample of 443 pork consumers in Belgium through using repeated selection of chops from randomised photobooks and questionnaires including socio-demographic, attitudinal and behavioural variables. Data analysis includes mixture regression analysis, bivariate descriptive statistics and the estimation of multivariate probit models. Consumers sampled in this study prefer pork chops without fat cover. Preference for fat cover is stronger among male, 35+ aged consumers with lower levels of awareness of the relation between food and health and who like pork for other reasons than taste and nutritional value (all p<0.05). Preference for colour is equally consistent within an individual, though fifty-fifty light-dark, with dark chops being more preferred by 35+ aged consumers (p<0.05). Preferences for marbling and drip are not consistent and not determined by joint socio-demographic, attitudinal and behavioural factors. Preferences for cue levels are not correlated, except a weak relation between preference for dark chops without drip (r=0.116). Preferences are apparently formed by deductions with the use of single cues as key information, mainly based on fat cover or colour, and random choice on marbling and drip.

Contrast-enhanced spectral mammography (CESM) versus MRI in the high-risk screening setting: patient preferences and attitudes.

PubMed

Phillips, Jordana; Miller, Matthew M; Mehta, Tejas S; Fein-Zachary, Valerie; Nathanson, Audrey; Hori, Wendy; Monahan-Earley, Rita; Slanetz, Priscilla J

Our study evaluates patient preferences toward screening CESM versus MRI. As part of a prospective study, high-risk patients had breast MRI and CESM. Patients completed an anonymous survey to evaluate preferences regarding the two modalities. 88% of participants completed the survey. 79% preferred CESM over MRI if the exams had equal sensitivity. 89% would be comfortable receiving contrast as part of an annual screening test. High-risk populations may accept CESM as a screening exam and may prefer it over screening MRI if ongoing trials demonstrate screening CESM to be clinically non-inferior MRI. Copyright © 2016 Elsevier Inc. All rights reserved.

Childrens' left-turning preference is not modulated by magical ideation.

PubMed

Streuli, Jürg C; Obrist, Gina; Brugger, Peter

2017-01-01

The literature on human turning preferences is inconsistent. While the few studies with children below 14 years of age uniformly describe an overall left-turning (counterclockwise) tendency, a recent Internet study with more than 1500 adults found a right-sided (clockwise) bias. We set out to investigate spontaneous turning behaviour in children age 5-3 years and, based on neuropsychiatric work in adults, also explored a potential association with magical thinking. Findings indicated a clear left-turning preference, independent of a participant's sex and handedness. Whether a child responded a question about the existence of extrasensory communication in the affirmative or not was unrelated to direction and size of turning bias and lateral preference. Our results are consistent with a left-sided turning preference reported for children, but in opposition to the clockwise bias recently described in a large-scale study with adults. Whether they point to a maturational gradient in the preferred direction of spontaneous whole-body rotation or rather to a lack of comparability between measures used in observational versus Internet-based studies remains to be further investigated. Regarding a purported association between body turns and magical thinking, our study is preliminary, as only one single question was used to probe the latter.

Observational Effects on the Preferences of Children with Autism

ERIC Educational Resources Information Center

Leaf, Justin B.; Oppenheim-Leaf, Misty L.; Leaf, Ronald; Courtemanche, Andrea B.; Taubman, Mitchell; McEachin, John; Sheldon, Jan B.; Sherman, James A.

2012-01-01

Children with an autism spectrum disorder (ASD) may play with limited objects or toys, making it difficult for teachers to identify reinforcers to use in teaching new skills. The goal of this study was to alter children's preferences from highly preferred toys to toys that were originally less preferred using an observational pairing procedure.…

"What I Want and What You Want": Children's Thinking about Competing Personal Preferences

ERIC Educational Resources Information Center

Komolova, Masha; Wainryb, Cecilia

2011-01-01

This study examined how children reason about competing personal preferences. Seventy-two participants (mean ages 5 years 5 months, 10 years 4 months, and 17 years 7 months) considered three hypothetical scenarios in which a protagonist's personal preference was in conflict with her or his friend's personal preference. Scenarios varied in the…

A Comparison of Work Value Preferences of Individuals with Disabilities and Individuals without Disabilities

ERIC Educational Resources Information Center

Lustig, Daniel C.; Zanskas, Stephen

2014-01-01

Purpose: The purpose of this pilot study was to compare the work value preferences of individuals with disabilities with the work value preferences for a sample of individuals without disabilities. Methods: The preferred work values of a sample of vocational rehabilitation consumers were compared to workers employed in a Southeastern university.…

The Association between Learning Preferences and Preferred Methods of Assessment of Dental Students

ERIC Educational Resources Information Center

Buchanan, Phil

2016-01-01

This study is designed to gather information concerning a possible relationship between how dental students prefer to take in and communicate new information and how they prefer to be assessed. Though there are numerous references in the literature regarding the learning styles of students there are also references to the inaccuracy of such…

A Comparative Analysis of the English-Language Accent Preferences of Prospective and Practicing Businesspersons from around the World

ERIC Educational Resources Information Center

Scott, James C.; Green, Diana J.; Blaszczynski, Carol; Rosewarne, David D.

2007-01-01

Problem: The studies of the English-language accent preferences of prospective and practicing businesspersons from around the world have not been integrated. Research Questions: What are the English-language accent preferences of prospective and practicing businesspersons from around the world, and how are those preferences influenced by the…

An Investigation of Some Cognitive Style Variables and Their Relationships to Science Achievement.

ERIC Educational Resources Information Center

Zambotti, Geno; Fazio, Frank

This study was designed to survey the cognitive style preferences of college students. Two instruments were used in obtaining data for this inquiry. The Cognitive Preference Survey for Physical Science, developed by the authors, gave three preference scores: Memory, a preference for simple content facts; Principle, for a concept or theoretical…

On the Correspondence between Preference Assessment Outcomes and Progressive-Ratio Schedule Assessments of Stimulus Value

ERIC Educational Resources Information Center

DeLeon, Iser G.; Frank, Michelle A.; Gregory, Meagan K.; Allman, Melissa J.

2009-01-01

The current study examined whether stimuli of different preference levels would be associated with different amounts of work maintained by the stimuli, as determined through progressive-ratio schedule break points. Using a paired-choice preference assessment, stimuli were classified as high, moderate, or low preference for 4 individuals with…

Text Communication Preferences of Deaf People in the United Kingdom

ERIC Educational Resources Information Center

Pilling, Doria; Barrett, Paul

2008-01-01

This study is the only comprehensive survey to date of the text communication preferences of deaf people who cannot or prefer not to use voice telephony in the United Kingdom. Respondents covered a wide age range, became deaf or hard of hearing at different ages, and had different communication preferences. Generally, respondents used several…

Preferred Writing Topics of Urban and Rural Middle School Students

ERIC Educational Resources Information Center

Shippen, Margaret E.; Houchins, David E.; Puckett, DaShaunda; Ramsey, Michelle

2007-01-01

This study compared the preferred writing topics of urban and rural middle school students. Eighth graders (n = 205) responded to a brief survey of preferred writing topics in the descriptive writing genres of real or imagined stories, reports, and opinions. While some preferred writing topics were divergent such as society, crime, and violence,…

A Study of Color Preferences for Drugs and Implications for Compliance and Drug-taking.

ERIC Educational Resources Information Center

Coffield, K. E.; Buckalew, L. W.

1988-01-01

Examined medication capsule color preferences of male and female college students, both on and not on medication. Sex and medication status were insignificant in preference rankings. Blacks, grays, tans, and browns were clearly rejected colors while blues and some reds and yellows were preferred. Findings have relevance for patient compliance…

Learning Preferences and Impacts of Education Programs in Dog Health Programs in Five Rural and Remote Australian Indigenous Communities

ERIC Educational Resources Information Center

Constable, Sophie; Dixon, Roselyn; Dixon, Robert

2011-01-01

As part of strategies to improve dog and community health in rural and remote Indigenous communities, this study investigated preferences and impacts of dog health education programs. Semistructured interviews with 63 residents from five communities explored learning preferences. Though each community differed, on average yarning was preferred by…

Phonological Processing in Human Auditory Cortical Fields

PubMed Central

Woods, David L.; Herron, Timothy J.; Cate, Anthony D.; Kang, Xiaojian; Yund, E. W.

2011-01-01

We used population-based cortical-surface analysis of functional magnetic imaging data to characterize the processing of consonant–vowel–consonant syllables (CVCs) and spectrally matched amplitude-modulated noise bursts (AMNBs) in human auditory cortex as subjects attended to auditory or visual stimuli in an intermodal selective attention paradigm. Average auditory cortical field (ACF) locations were defined using tonotopic mapping in a previous study. Activations in auditory cortex were defined by two stimulus-preference gradients: (1) Medial belt ACFs preferred AMNBs and lateral belt and parabelt fields preferred CVCs. This preference extended into core ACFs with medial regions of primary auditory cortex (A1) and the rostral field preferring AMNBs and lateral regions preferring CVCs. (2) Anterior ACFs showed smaller activations but more clearly defined stimulus preferences than did posterior ACFs. Stimulus preference gradients were unaffected by auditory attention suggesting that ACF preferences reflect the automatic processing of different spectrotemporal sound features. PMID:21541252

Impact of referral source and study applicants' preference for randomly assigned service on research enrollment, service engagement, and evaluative outcomes.

PubMed

Macias, Cathaleene; Barreira, Paul; Hargreaves, William; Bickman, Leonard; Fisher, William; Aronson, Elliot

2005-04-01

The inability to blind research participants to their experimental conditions is the Achilles' heel of mental health services research. When one experimental condition receives more disappointed participants, or more satisfied participants, research findings can be biased in spite of random assignment. The authors explored the potential for research participants' preference for one experimental program over another to compromise the generalizability and validity of randomized controlled service evaluations as well as cross-study comparisons. Three Cox regression analyses measured the impact of applicants' service assignment preference on research project enrollment, engagement in assigned services, and a service-related outcome, competitive employment. A stated service preference, referral by an agency with a low level of continuity in outpatient care, and willingness to switch from current services were significant positive predictors of research enrollment. Match to service assignment preference was a significant positive predictor of service engagement, and mismatch to assignment preference was a significant negative predictor of both service engagement and employment outcome. Referral source type and service assignment preference should be routinely measured and statistically controlled for in all studies of mental health service effectiveness to provide a sound empirical base for evidence-based practice.

Singer Responses to Sound Fields with a Simulated Reflection

NASA Astrophysics Data System (ADS)

NOSON, D.; SATO, S.; SAKAI, H.; ANDO, Y.

2000-04-01

While numerous recent studies have reported results concerning improvements to stage acoustics for orchestral performers, the preferred acoustical conditions on performing stages for singers has received limited attention in the past 20 years. A series of acoustical modifications have been proposed for a Seattle church to improve the acoustics for both the listeners and the performing choir. An on-site preliminary study was made to determine what acoustical changes might be important to singers. During solo fast-tempo singing and duet singing, singer preference increased with simulated short-delay reflections. The results suggest a potential for new reflectors to produce noticeable improvement in the choir acoustics. Subsequently, a solo singer study was conducted to establish preferred range of time delays for a single-simulated reflection. When singing faster-tempo music, the consensus of preference is statistically significant and the preferred delay averages 20 ms, while with a slow-tempo piece, the singers were not consistent in their judgment of preference and a strong individual variability predominated in the pair-comparison tests. The results point the way for an examination of a wider range of time delays and music motifs to acquire a clearer picture of consensus and individual preference for time-delayed reflections.

"In the physio we trust": A qualitative study on patients' preferences for physiotherapy.

PubMed

Bernhardsson, Susanne; Larsson, Maria E H; Johansson, Kajsa; Öberg, Birgitta

2017-07-01

Patients' preferences should be integrated in evidence-based practice. This study aimed to explore patients' preferences for physiotherapy treatment and participation in decision making. A qualitative study set in an urban physiotherapy clinic in Gothenburg, Sweden. Individual, semi-structured interviews were conducted with 20 individuals who sought physiotherapy for musculoskeletal disorders. The interviews were recorded, transcribed, and analyzed with qualitative content analysis. An overarching theme, embracing six categories, was conceptualized: Trust in the physiotherapist fosters active engagement in therapy. The participants preferred active treatment strategies such as exercise and advice for self-management, allowing them to actively engage in their therapy. Some preferred passive treatments. Key influencers on treatment preferences were previous experiences and media. All participants wanted to be involved in the clinical decision making, but to varying extents. Some expressed a preference for an active role and wanting to share decisions while others were content with a passive role. Expectations for a professional management were reflected in trust and confidence in physiotherapists' skills and competence, expectations for good outcomes, and believing that treatment methods should be evidence-based. Trust in the physiotherapist's competence, as well as a desire to participate in clinical decision making, fosters active engagement in physiotherapy.

Stated time preferences for health: a systematic review and meta analysis of private and social discount rates.

PubMed

Mahboub-Ahari, Alireza; Pourreza, Abolghasem; Sari, Ali Akbari; Rahimi Foroushani, Abbas; Heydari, Hassan

2014-01-01

The present study aimed to provide better insight on methodological issues related to time preference studies, and to estimate private and social discount rates, using a rigorous systematic review and meta-analysis. We searched PubMed, EMBASE and Proquest databases in June 2013. All studies had estimated private and social time preference rates for health outcomes through stated preference approach, recognized eligible for inclusion. We conducted both fixed and random effect meta-analyses using mean discount rate and standard deviation of the included studies. I-square statistics was used for testing heterogeneity of the studies. Private and social discount rates were estimated separately via Stata11 software. Out of 44 screened full texts, 8 population-based empirical studies were included in qualitative synthesis. Reported time preference rates for own health were from 0.036 to 0.07 and for social health from 0.04 to 0.2. Private and social discount rates were estimated at 0.056 (95% CI: 0.038, 0.074) and 0.066 (95% CI: 0.064, 0.068), respectively. Considering the impact of time preference on healthy behaviors and because of timing issues, individual's time preference as a key determinant of policy making should be taken into account. Direct translation of elicited discount rates to the official discount rates has been remained questionable. Decisions about the proper discount rate for health context, may need a cross-party consensus among health economists and policy makers.

Learning strategy preferences, verbal-visual cognitive styles, and multimedia preferences for continuing engineering education instructional design

NASA Astrophysics Data System (ADS)

Baukal, Charles Edward, Jr.

A literature search revealed very little information on how to teach working engineers, which became the motivation for this research. Effective training is important for many reasons such as preventing accidents, maximizing fuel efficiency, minimizing pollution emissions, and reducing equipment downtime. The conceptual framework for this study included the development of a new instructional design framework called the Multimedia Cone of Abstraction (MCoA). This was developed by combining Dale's Cone of Experience and Mayer's Cognitive Theory of Multimedia Learning. An anonymous survey of 118 engineers from a single Midwestern manufacturer was conducted to determine their demographics, learning strategy preferences, verbal-visual cognitive styles, and multimedia preferences. The learning strategy preference profile and verbal-visual cognitive styles of the sample were statistically significantly different than the general population. The working engineers included more Problem Solvers and were much more visually-oriented than the general population. To study multimedia preferences, five of the seven levels in the MCoA were used. Eight types of multimedia were compared in four categories (types in parantheses): text (text and narration), static graphics (drawing and photograph), non-interactive dynamic graphics (animation and video), and interactive dynamic graphics (simulated virtual reality and real virtual reality). The first phase of the study examined multimedia preferences within a category. Participants compared multimedia types in pairs on dual screens using relative preference, rating, and ranking. Surprisingly, the more abstract multimedia (text, drawing, animation, and simulated virtual reality) were preferred in every category to the more concrete multimedia (narration, photograph, video, and real virtual reality), despite the fact that most participants had relatively little prior subject knowledge. However, the more abstract graphics were only slightly preferred to the more concrete graphics. In the second phase, the more preferred multimedia types in each category from the first phase were compared against each other using relative preference, rating, and ranking and overall rating and ranking. Drawing was the most preferred multimedia type overall, although only slightly more than animation and simulated virtual reality. Text was a distant fourth. These results suggest that instructional content for continuing engineering education should include problem solving and should be highly visual.

Preferences for masculinity in male bodies change across the menstrual cycle.

PubMed

Little, Anthony C; Jones, Benedict C; Burriss, Robert P

2007-05-01

In human females cyclic shifts in preference have been documented for odour and physical and behavioral male traits. Women prefer the smell of dominant males, more masculine male faces and men behaving more dominantly when at peak fertility than at other times in their menstrual cycle. Here we examine variation in preferences for body sexual dimorphism. Across two studies, both between- and within-participant, we show that women prefer greater masculinity in male bodies at times when their fertility is likely highest, in the follicular phase of their cycle. Shifts were seen when rating for a short-term but not when rating for a long-term relationship. In line with studies showing similar effects for facial sexual dimorphism, we also show that women prefer greater masculinity when they think themselves attractive than when they think themselves less attractive. These results indicate that women's preferences for sexual dimorphism in male bodies follow a similar pattern as found for sexual dimorphism and dominance in other domains and such differences in preference may serve a similar function. Cyclic preferences could influence women to select partners when most likely to become pregnant that possess traits that may be most likely to maximize their offspring's quality via attraction to masculinity or serve to help acquire investment via attraction to femininity.

Mate choice screening in captive solitary carnivores: The role of male behavior and cues on mate preference and paternity in females of a model species, American mink (Neovison vison).

PubMed

Noer, Christina Lehmkuhl; Balsby, Thorsten Johannes Skovbjerg; Anistoroaei, Razvan; Stelvig, Mikkel; Dabelsteen, Torben

2017-12-01

Mate choice studies suggest that choosy females benefit from increased fecundity, litter size, and offspring survival. Thus, providing females with the opportunity to choose among potential mates, deemed genetically suitable based on studbook data, might improve breeding management in production and zoo animals and thereby the sustainability of captive populations. Investigating mate preference via odor from potential mates before animal transfer is a proposed strategy for incorporating mate choice into breeding management. In this study, we test whether olfactory cues and signals from males can be used to assess and measure female mate preference in American mink. Eighteen females were subjected to a 4-day stimulus test in which females showed a preference for one of two males' urine and feces. Subsequently, each female was subjected to a 10-day mate preference test involving the same two males of the first test. Paternity tests revealed that 13 females had offspring, which could be assigned to only one male, suggesting that these females performed a mate choice. In nine of these females preference during the stimulus test was directed toward the male that fathered their offspring. Our results suggest that even though there was a preference difference in scent stimulus trials from potential mates this preference was not predictive of eventual mate preference or paternity. Other factors such as aspects of male behavior seem to play a role, when the mates are introduced. Our study supports that mate preference and mate choice are complex matters influenced by multiple cues and signals. © 2017 Wiley Periodicals, Inc.

How Does a Shared Decision-Making (SDM) Intervention for Oncologists Affect Participation Style and Preference Matching in Patients with Breast and Colon Cancer?

PubMed

Bieber, Christiane; Nicolai, Jennifer; Gschwendtner, Kathrin; Müller, Nicole; Reuter, Katrin; Buchholz, Angela; Kallinowski, Birgit; Härter, Martin; Eich, Wolfgang

2018-06-01

The aims of this study are to assess patients' preferred and perceived decision-making roles and preference matching in a sample of German breast and colon cancer patients and to investigate how a shared decision-making (SDM) intervention for oncologists influences patients' preferred and perceived decision-making roles and the attainment of preference matches. This study is a post hoc analysis of a randomised controlled trial (RCT) on the effects of an SDM intervention. The SDM intervention was a 12-h SDM training program for physicians in combination with decision board use. For this study, we analysed a subgroup of 107 breast and colon cancer patients faced with serious treatment decisions who provided data on specific questionnaires with regard to their preferred and perceived decision-making roles (passive, SDM or active). Patients filled in questionnaires immediately following a decision-relevant consultation (t1) with their oncologist. Eleven of these patients' 27 treating oncologists had received the SDM intervention within the RCT. A majority of cancer patients (60%) preferred SDM. A match between preferred and perceived decision-making roles was reached for 72% of patients. The patients treated by SDM-trained physicians perceived greater autonomy in their decision making (p < 0.05) with more patients perceiving SDM or an active role, but their preference matching was not influenced. A SDM intervention for oncologists boosted patient autonomy but did not improve preference matching. This highlights the already well-known reluctance of physicians to engage in explicit role clarification. German Clinical Trials Register DRKS00000539; Funding Source: German Cancer Aid.

Relationship of prior knowledge and working engineers' learning preferences: implications for designing effective instruction

NASA Astrophysics Data System (ADS)

Baukal, Charles E.; Ausburn, Lynna J.

2017-05-01

Continuing engineering education (CEE) is important to ensure engineers maintain proficiency over the life of their careers. However, relatively few studies have examined designing effective training for working engineers. Research has indicated that both learner instructional preferences and prior knowledge can impact the learning process, but it has not established if these factors are interrelated. The study reported here considered relationships of prior knowledge and three aspects of learning preferences of working engineers at a manufacturing company: learning strategy choices, verbal-visual cognitive styles, and multimedia preferences. Prior knowledge was not found to be significantly related to engineers' learning preferences, indicating independence of effects of these variables on learning. The study also examined relationships of this finding to the Multimedia Cone of Abstraction and implications for its use as an instructional design tool for CEE.

Landscape preference assessment of Louisiana river landscapes: a methodological study

Treesearch

Michael S. Lee

1979-01-01

The study pertains to the development of an assessment system for the analysis of visual preference attributed to Louisiana river landscapes. The assessment system was utilized in the evaluation of 20 Louisiana river scenes. Individuals were tested for their free choice preference for the same scenes. A statistical analysis was conducted to examine the relationship...

Heavy Metal and Hip-Hop Style Preferences and Externalizing Problem Behavior: A Two-Wave Longitudinal Study

ERIC Educational Resources Information Center

Selfhout, Maarten H. W.; Delsing, Marc J. M. H.; ter Bogt, Tom F. M.; Meeus, Wim H. J.

2008-01-01

This study examines (a) the stability of Dutch adolescents' preferences for heavy metal and hip-hop youth culture styles, (b) longitudinal associations between their preferences and externalizing problem behavior, and (c) the moderating role of gender in these associations. Questionnaire data were gathered from 931 adolescents between the ages of…

Ten Engineers Reading: Disjunctions between Preference and Practice in Civil Engineering Faculty Responses

ERIC Educational Resources Information Center

Taylor, Summer Smith; Patton, Martha D.

2006-01-01

Previous research has indicated that engineering faculty do not follow best practices when commenting on students' technical writing. However, it is unclear whether the faculty prefer to comment in these ineffective ways, or whether they prefer more effective practices but simply do not enact them. This study adapts a well known study of response…

An Exploration of the Relationship between Students' Preferences for Formative Feedback and Self-Regulated Learning Skills

ERIC Educational Resources Information Center

Çakir, Recep; Korkmaz, Özgen; Bacanak, Ahmet; Arslan, Ömer

2016-01-01

The purpose of this study is to explore students' preferences for formative feedback and its relationship with their self-regulated learning skills. The study used a mixed methods approach in which quantitative data collection and analysis was followed by qualitative data collection and analysis. "Preferences toward Formative Feedback"…

Comparing University Students and Community College Students Learning Styles and Myers-Briggs Type Indicator (MBTI) Preferences.

ERIC Educational Resources Information Center

Herbster, Douglas L.; And Others

This document reports on a study to determine if there is a pattern between specific learning styles and Myers-Briggs Type Indicator preferences. The learning style inventory used for the study, "The Teaching and Learning Styles Survey for Adolescents (TLC)," is based on Jungian style preferences--thinker, feeler, sensor, and…

Terminally Ill Taiwanese Cancer Patients' and Family Caregivers' Agreement on Patterns of Life-Sustaining Treatment Preferences Is Poor to Fair and Declines Over a Decade: Results From Two Independent Cross-Sectional Studies.

PubMed

Liu, Tsang-Wu; Wen, Fur-Hsing; Wang, Cheng-Hsu; Hong, Ruey-Long; Chow, Jyh-Ming; Chen, Jen-Shi; Chiu, Chang-Fang; Tang, Siew Tzuh

2017-07-01

Temporal changes have not been examined in patient-caregiver agreement on life-sustaining treatment (LST) preferences at end of life (EOL). We explored the extent of and changes in patient-caregiver agreement on LST-preference patterns for two independent cohorts of Taiwanese cancer patient-family caregiver dyads recruited a decade apart. We surveyed preferences for cardiopulmonary resuscitation, intensive care unit care, cardiac massage, intubation with mechanical ventilation, intravenous nutritional support, tube feeding, and dialysis among 1049 and 1901 dyads in 2003-2004 and 2011-2012, respectively. LST-preference patterns were examined by multi-group latent class analysis. Extent of patient-caregiver agreement on LST-preference patterns was determined by percentage agreement and kappa coefficients. For both patients and family caregivers, we identified seven distinct LST-preference classes. Patient-caregiver agreement on LST-preference patterns was poor to fair across both study cohorts, indicated by 24.4%-43.5% agreement and kappa values of 0.06 (95% CI: 0.04, 0.09) to 0.27 (0.23, 0.30), and declined significantly over time. Agreement on LST-preference patterns was most likely when both patients and caregivers uniformly rejected LSTs. When patients disagreed with caregivers on LST-preference patterns, discrepancies were most likely when patients totally rejected LSTs but caregivers uniformly preferred LSTs or preferred nutritional support but rejected other treatments. Patients and family caregivers had poor-to-fair agreement on LST-preference patterns, and agreement declined significantly over a decade. Encouraging an open dialogue between patients and their family caregivers about desired EOL care would facilitate patient-caregiver agreement on LST-preference patterns, thus honoring terminally ill cancer patients' wishes when they cannot make EOL-care decisions. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

Understanding breast cancer patients' preference for two types of exercise training during chemotherapy in an unblinded randomized controlled trial

PubMed Central

Courneya, Kerry S; Reid, Robert D; Friedenreich, Christine M; Gelmon, Karen; Proulx, Caroline; Vallance, Jeffrey K; McKenzie, Donald C; Segal, Roanne J

2008-01-01

Background Patient preference for group assignment may affect outcomes in unblinded trials but few studies have attempted to understand such preferences. The purpose of the present study was to examine factors associated with breast cancer patients' preference for two types of exercise training during chemotherapy. Methods Breast cancer patients (N = 242) completed a battery of tests including a questionnaire that assessed patient preference and the theory of planned behavior (TPB) prior to being randomized to usual care, resistance exercise training (RET), or aerobic exercise training (AET). Results 99 (40.9%) participants preferred RET, 88 (36.4%) preferred AET, and 55 (22.7%) reported no preference. Past exercisers (p = 0.023), smokers (p = 0.004), and aerobically fitter participants (p = 0.005) were more likely to prefer RET. As hypothesized, participants that preferred AET had more favorable TPB beliefs about AET whereas participants that preferred RET had more favorable TPB beliefs about RET. In multivariate modeling, patient preference for RET versus AET was explained (R2 = .46; p < 0.001) by the difference in motivation for RET versus AET (β = .56; p < 0.001), smoking status (β = .13; p = 0.007), and aerobic fitness (β = .12; p = 0.018). Motivational difference between RET versus AET, in turn, was explained (R2 = .48; p < 0.001) by differences in instrumental attitude (β = .27; p < 0.001), affective attitude (β = .25; p < 0.001), and perceived behavioral control (β = .24; p < 0.001). Conclusion Breast cancer patients' preference for RET versus AET during chemotherapy was predicted largely by a difference in motivation for each type of exercise which, in turn, was based on differences in their beliefs about the anticipated benefits, enjoyment, and difficulty of performing each type of exercise during chemotherapy. These findings may help explain patient preference effects in unblinded behavioral trials. Trial Registration ClinicalTrials.gov Identifier NCT00115713. PMID:18954442

The relationship between leg preference and knee mechanics during sidestepping in collegiate female footballers.

PubMed

Brown, Scott R; Wang, Henry; Dickin, D Clark; Weiss, Kaitlyn J

2014-11-01

This study examined the relationship between leg preference and knee mechanics in females during sidestepping. Three-dimensional data were recorded on 16 female collegiate footballers during a planned 45° sidestep manoeuvre with their preferred and non-preferred kicking leg. Knee kinematics and kinetics during initial contact, weight acceptance, peak push-off, and final push-off phases of sidestepping were analysed in both legs. The preferred leg showed trivial to small increases (ES = 0.19-0.36) in knee flexion angle at initial contact, weight acceptance, and peak push-off, and small increases (ES = 0.21-0.34) in peak power production and peak knee extension velocity. The non-preferred leg showed a trivial increase (ES = 0.10) in knee abduction angle during weight acceptance; small to moderate increases (ES = 0.22-0.64) in knee internal rotation angle at weight acceptance, peak push-off, and final push-off; a small increase (ES = 0.22) in knee abductor moment; and trivial increases (ES = 0.09-0.14) in peak power absorption and peak knee flexion velocity. The results of this study show that differences do exist between the preferred and non-preferred leg in females. The findings of this study will increase the knowledge base of anterior cruciate ligament injury in females and can aid in the design of more appropriate neuromuscular, plyometric, and strength training protocols for injury prevention.

Assessing public aesthetic preferences towards some urban landscape patterns: the case study of two different geographic groups.

PubMed

Chen, Ziyue; Xu, Bing; Devereux, Bernard

2016-01-01

Landscape aesthetics is closely linked to people's daily life, and a large body of studies has been conducted to understand the public's landscape preferences. These studies commonly focused on comprehensive landscape configuration, yet limited emphasis was placed on the patterns of individual landscape features. This research explored people's preferences towards the composition and patterns of some specific urban features. Questionnaire-based survey was conducted in two cities: Cambridge, UK and Nanjing, China and more than 180 responses were collected, respectively. Respondents from both sites showed similar preferences towards freely growing trees, individual houses, gable roofs and mixed design of green spaces. On the other hand, respondents from Cambridge and Nanjing have different preferences towards the height of trees, the size of green spaces, and the height diversity of buildings. This survey also proved that the factors of age, education, status and length of living have larger influences on landscape preferences than the factors of gender, and major. Furthermore, strong correlations were found between people's aesthetic preferences towards comparative landscape patterns, building types, tree shapes and roof structures. The existence of generally shared landscape preferences makes it feasible to conduct international and standardized projects for acquiring comparable and transferable criteria. The methodology and findings of this research provides landscape planners and decision makers with useful reference to compare, evaluate and improve urban landscape configurations to meet people's needs.

Fructose- and glucose-conditioned preferences in FVB mice: strain differences in post-oral sugar appetition

PubMed Central

Zukerman, Steven; Ackroff, Karen

2014-01-01

Recent studies indicate that, unlike glucose, fructose has little or no post-oral preference conditioning actions in C57BL/6J (B6) mice. The present study determined whether this is also the case for FVB mice, which overconsume fructose relative to B6 mice. In experiment 1, FVB mice strongly preferred a noncaloric 0.1% sucralose + 0.1% saccharin (S+S) solution to 8% fructose in a 2-day choice test but switched their preference to fructose after separate experience with the two sweeteners. Other FVB mice displayed a stronger preference for 8% glucose over S+S. In a second experiment, ad libitum-fed FVB mice trained 24 h/day acquired a significant preference for a flavor (CS+) paired with intragastric (IG) self-infusions of 16% fructose over a different flavor (CS−) paired with IG water infusions. IG fructose infusions also conditioned flavor preferences in food-restricted FVB mice trained 1 h/day. IG infusions of 16% glucose conditioned stronger preferences in FVB mice trained 24- or 1 h/day. Thus, fructose has post-oral flavor conditioning effects in FVB mice, but these effects are less pronounced than those produced by glucose. Further studies of the differential post-oral conditioning effects of fructose and glucose in B6 and FVB mice should enhance our understanding of the physiological processes involved in sugar reward. PMID:25320345

Using a multidimensional unfolding approach to assess multiple sclerosis patient preferences for disease-modifying therapy: a pilot study

PubMed Central

Sempere, Angel Perez; Vera-Lopez, Vanesa; Gimenez-Martinez, Juana; Ruiz-Beato, Elena; Cuervo, Jesús; Maurino, Jorge

2017-01-01

Purpose Multidimensional unfolding is a multivariate method to assess preferences using a small sample size, a geometric model locating individuals and alternatives as points in a joint space. The objective was to evaluate relapsing–remitting multiple sclerosis (RRMS) patient preferences toward key disease-modifying therapy (DMT) attributes using multidimensional unfolding. Patients and methods A cross-sectional pilot study in RRMS patients was conducted. Drug attributes included relapse prevention, disease progression prevention, side-effect risk and route and schedule of administration. Assessment of preferences was performed through a five-card game. Patients were asked to value attributes from 1 (most preferred) to 5 (least preferred). Results A total of 37 patients were included; the mean age was 38.6 years, and 78.4% were female. Disease progression prevention was the most important factor (51.4%), followed by relapse prevention (40.5%). The frequency of administration had the lowest preference rating for 56.8% of patients. Finally, 19.6% valued the side-effect risk attribute as having low/very low importance. Conclusion Patients’ perspective for DMT attributes may provide valuable information to facilitate shared decision-making. Efficacy attributes were the most important drug characteristics for RRMS patients. Multidimensional unfolding seems to be a feasible approach to assess preferences in multiple sclerosis patients. Further elicitation studies using multidimensional unfolding with other stated choice methods are necessary to confirm these findings. PMID:28615928

The learning style preferences of chiropractic students: A cross-sectional study

PubMed Central

Whillier, Stephney; Lystad, Reidar P.; Abi-Arrage, David; McPhie, Christopher; Johnston, Samara; Williams, Christopher; Rice, Mark

2014-01-01

Objective The aims of our study were to measure the learning style preferences of chiropractic students and to assess whether they differ across the 5 years of chiropractic study. Methods A total of 407 (41.4% females) full-degree, undergraduate, and postgraduate students enrolled in an Australian chiropractic program agreed to participate in a cross-sectional survey comprised of basic demographic information and the Visual, Aural, Read/Write, Kinesthetic (VARK) questionnaire, which identifies learning preferences on four different subscales: visual, aural, reading/writing, and kinesthetic. Multivariate analysis of variance and the χ2 test were used to check for differences in continuous (VARK scores) and categorical (VARK category preference) outcome variables. Results The majority of chiropractic students (56.0%) were found to be multimodal learners. Compared to the other learning styles preferences, kinesthetic learning was preferred by a significantly greater proportion of students (65.4%, p < .001) and received a significantly greater mean VARK score (5.66 ± 2.47, p < .001). Conclusions To the best of our knowledge, this is the first time chiropractic students have been shown to be largely multimodal learners with a preference for kinesthetic learning. While this knowledge may be beneficial in the structuring of future curricula, more thorough research must be conducted to show any beneficial relationship between learning style preferences and teaching methods. PMID:24350945

Fructose- and glucose-conditioned preferences in FVB mice: strain differences in post-oral sugar appetition.

PubMed

Sclafani, Anthony; Zukerman, Steven; Ackroff, Karen

2014-12-15

Recent studies indicate that, unlike glucose, fructose has little or no post-oral preference conditioning actions in C57BL/6J (B6) mice. The present study determined whether this is also the case for FVB mice, which overconsume fructose relative to B6 mice. In experiment 1, FVB mice strongly preferred a noncaloric 0.1% sucralose + 0.1% saccharin (S+S) solution to 8% fructose in a 2-day choice test but switched their preference to fructose after separate experience with the two sweeteners. Other FVB mice displayed a stronger preference for 8% glucose over S+S. In a second experiment, ad libitum-fed FVB mice trained 24 h/day acquired a significant preference for a flavor (CS+) paired with intragastric (IG) self-infusions of 16% fructose over a different flavor (CS-) paired with IG water infusions. IG fructose infusions also conditioned flavor preferences in food-restricted FVB mice trained 1 h/day. IG infusions of 16% glucose conditioned stronger preferences in FVB mice trained 24- or 1 h/day. Thus, fructose has post-oral flavor conditioning effects in FVB mice, but these effects are less pronounced than those produced by glucose. Further studies of the differential post-oral conditioning effects of fructose and glucose in B6 and FVB mice should enhance our understanding of the physiological processes involved in sugar reward. Copyright © 2014 the American Physiological Society.

Let your preference be your guide? Preferences and choices are more tightly linked for North Americans than for Indians.

PubMed

Savani, Krishna; Markus, Hazel Rose; Conner, Alana L

2008-10-01

Using experimental paradigms from economics and social psychology, the authors examined the cross-cultural applicability of 3 widely held assumptions about preference and choice: People (a) recruit or construct preferences to make choices; (b) choose according to their preferences; and (c) are motivated to express their preferences in their choices. In 6 studies, they compared how middle-class North American and Indian participants choose among consumer products. Participants in both contexts construct nonrandom preferences at similar speeds. Those in Indian contexts, however, are slower to make choices, less likely to choose according to their personal preferences, and less motivated to express their preferences in their choices. The authors infer that the strong link between preferences and choices observed among North Americans is not a universal feature of human nature. Instead, this link reflects the disjoint model of agency, which prescribes that people should choose freely on the basis of their preferences. In contrast, Indian contexts reflect and promote a conjoint model of agency, according to which agency is responsive to the desires and expectations of important others and may require restraining one's preferences.

Factors Associated with Congruence Between Preferred and Actual Place of Death

PubMed Central

Bell, Christina L.; Somogyi-Zalud, Emese; Masaki, Kamal H.

2009-01-01

Congruence between preferred and actual place of death may be an essential component in terminal care. Most patients prefer a home death, but many patients do not die in their preferred location. Specialized (physician, hospice and palliative) home care visits may increase home deaths, but factors associated with congruence have not been systematically reviewed. This study sought to review the extent of congruence reported in the literature, and examine factors that may influence congruence. In July 2009, a comprehensive literature search was performed using MEDLINE, Psych Info, CINAHL, and Web of Science. Reference lists, related articles, and the past five years of six palliative care journals were also searched. Overall congruence rates (percentage of met preferences for all locations of death) were calculated for each study using reported data to allow cross-study comparison. Eighteen articles described 30% to 91% congruence. Eight specialized home care studies reported 59% to 91% congruence. A physician-led home care program reported 91% congruence. Of the 10 studies without specialized home care for all patients, seven reported 56% to 71% congruence and most reported unique care programs. Of the remaining three studies without specialized home care for all patients, two reported 43% to 46% congruence among hospital inpatients, and one elicited patient preference “if everything were possible,” with 30% congruence. Physician support, hospice enrollment, and family support improved congruence in multiple studies. Research in this important area must consider potential sources of bias, the method of eliciting patient preference, and the absence of a single ideal place of death. PMID:20116205

Factors associated with congruence between preferred and actual place of death.

PubMed

Bell, Christina L; Somogyi-Zalud, Emese; Masaki, Kamal H

2010-03-01

Congruence between preferred and actual place of death may be an essential component in terminal care. Most patients prefer a home death, but many patients do not die in their preferred location. Specialized (physician, hospice, and palliative) home care visits may increase home deaths, but factors associated with congruence have not been systematically reviewed. This study sought to review the extent of congruence reported in the literature and examine factors that may influence congruence. In July 2009, a comprehensive literature search was performed using MEDLINE, PsychInfo, CINAHL, and Web of Science. Reference lists, related articles, and the past five years of six palliative care journals were also searched. Overall congruence rates (percentage of met preferences for all locations of death) were calculated for each study using reported data to allow cross-study comparison. Eighteen articles described 30%-91% congruence. Eight specialized home care studies reported 59%-91% congruence. A physician-led home care program reported 91% congruence. Of the 10 studies without specialized home care for all patients, seven reported 56%-71% congruence and most reported unique care programs. Of the remaining three studies without specialized home care for all patients, two reported 43%-46% congruence among hospital inpatients, and one elicited patient preference "if everything were possible," with 30% congruence. Physician support, hospice enrollment, and family support improved congruence in multiple studies. Research in this important area must consider potential sources of bias, the method of eliciting patient preference, and the absence of a single ideal place of death. (c) 2010 U.S. Cancer Pain Relief Committee. Published by Elsevier Inc. All rights reserved.

Taste preferences in association with dietary habits and weight status in European children: results from the IDEFICS study.

PubMed

Lanfer, A; Knof, K; Barba, G; Veidebaum, T; Papoutsou, S; de Henauw, S; Soós, T; Moreno, L A; Ahrens, W; Lissner, L

2012-01-01

Increased preference for fat and sugar may have a role in overweight and obesity development. However, this effect is likely to vary across different food cultures. To date, few studies on this topic have been conducted in children and none have employed an international, multi-centre design. To document taste preferences for fat and sweet in children from eight European countries and to investigate their association with weight status and dietary habits. A total of 1696 children aged 6-9 years from survey centres in Italy, Estonia, Cyprus, Belgium, Sweden, Germany, Hungary and Spain tasted and subsequently chose between a high- versus a low-fat cracker and a natural versus a sugar-sweetened apple juice. Children's consumption frequency of fatty and sweet foods and demographic variables were obtained from parental-reported questionnaires. Weight and height of the children were measured. Fat and sweet taste preferences varied substantially across survey centres. Independent of survey centre, age, sex, parental education and parental BMI, overweight including obesity was positively associated with fat preference and sweet preference. Fat preference associations were stronger in girls. Girls, but not boys, with a combined preference for fat and sweet had an especially high probability of being overweight or obese. Adjusted models with BMI z-score as the dependent variable were consistent with results of the analyses with BMI categories, but with significant results only for fat preference in girls. Frequent consumption of fatty foods was related to fat preference in bivariate analyses; however, adjusting for survey centre attenuated the association. Sweet preference was not related to consumption of sweet foods, either in crude or in adjusted analyses. Fat and sweet taste preferences are related to weight status in European children across regions with varying food cultures.

A Neural Mechanism of Preference Shifting Under Zero Price Condition

PubMed Central

Votinov, Mikhail; Aso, Toshihiko; Fukuyama, Hidenao; Mima, Tatsuya

2016-01-01

In everyday life, free products have a strong appeal to us, even if we do not need them. Behavioral studies demonstrated that people have a tendency to switch their preference from preferred more expensive products to less preferable, cheaper alternatives, when the cheaper option becomes free. However, the neural representation of this behavioral anomaly called “Zero price” is still unclear. Using fMRI, we studied subjects while they performed binary preference choice task for items with different prices. We found that zero-related change of preference was associated with activation of the choice network, which includes inferior parietal lobule (IPL), posterior cingulate cortex and medial prefrontal cortex. Moreover, the amount of activation in medial prefrontal cortex was positively correlated with the subjective happiness score of getting free products. Our findings suggest that the Zero-price effect is driven by affective evaluations during decision-making. PMID:27148024

Recreational preferences of urban teenagers: the influence of cultural and environmental attributes

Treesearch

George L. Peterson

1977-01-01

The study tests the hypothesis that the recreational preferences of urban teenagers differ with age, sex, ethnicity, and measurable attributes of activity and environment. Photos of activities are used to measure preferences, and the photos are scaled for content by a detailed appraisal. The results show that sex and ethnicity modify the preference process, and that...

Reproducibility of the measurement of sweet taste preferences.

PubMed

Asao, Keiko; Luo, Wendy; Herman, William H

2012-12-01

Developing interventions to prevent and treat obesity are medical and public health imperatives. Taste is a major determinant of food intake and reliable methods to measure taste preferences need to be established. This study aimed to establish the short-term reproducibility of sweet taste preference measurements using 5-level sucrose concentrations in healthy adult volunteers. We defined sweet taste preference as the geometric mean of the preferred sucrose concentration determined from two series of two-alternative, forced-choice staircase procedures administered 10min apart on a single day. We repeated the same procedures at a second visit 3-7days later. Twenty-six adults (13 men and 13 women, age 33.2±12.2years) completed the measurements. The median number of pairs presented for each series was three (25th and 75th percentiles: 3, 4). The intraclass correlation coefficients between the measurements was 0.82 (95% confidence interval [CI]: 0.63-0.92) within a few days. This study showed high short-term reproducibility of a simple, 5-level procedure for measuring sweet taste preferences. This method may be useful for assessing sweet taste preferences and the risks resulting from those preferences. Copyright © 2012 Elsevier Ltd. All rights reserved.

Seasonal Changes in Color Preferences Are Linked to Variations in Environmental Colors: A Longitudinal Study of Fall.

PubMed

Schloss, Karen B; Heck, Isobel A

2017-01-01

People form associations between colors and entities, which influence their evaluations of the world. These evaluations are dynamic, as specific associations become more or less active in people's minds over time. We investigated how evaluations of colors (color preferences) changed over the course of fall, as color-associated fall entities became more prevalent in the environment. Participants judged their preferences for the same set of colors during nine testing sessions over 11 weeks during fall. We categorized the colors as Leaf and Non-Leaf Colors by matching them to leaves collected during the same period. Changes in preferences for Leaf Colors followed a quadratic pattern, peaking around when the leaves were most colorful and declining as winter approached. Preferences for Non-Leaf Colors did not significantly change. Individual differences in these changes could be explained by preferences for seasonal entities, as predicted by the differential activation hypothesis within the Ecological Valence Theory. The more a given individual liked fall-associated entities, the more their preference for Leaf Colors increased during fall. No analogous relations existed with winter-associated entities or Non-Leaf Colors. These results demonstrate the importance of studying temporal and individual differences for understanding preferences.

Women's Contraceptive Preference-Use Mismatch

PubMed Central

He, Katherine; Dalton, Vanessa K.; Zochowski, Melissa K.

2017-01-01

Abstract Background: Family planning research has not adequately addressed women's preferences for different contraceptive methods and whether women's contraceptive experiences match their preferences. Methods: Data were drawn from the Women's Healthcare Experiences and Preferences Study, an Internet survey of 1,078 women aged 18–55 randomly sampled from a national probability panel. Survey items assessed women's preferences for contraceptive methods, match between methods preferred and used, and perceived reasons for mismatch. We estimated predictors of contraceptive preference with multinomial logistic regression models. Results: Among women at risk for pregnancy who responded with their preferred method (n = 363), hormonal methods (non-LARC [long-acting reversible contraception]) were the most preferred method (34%), followed by no method (23%) and LARC (18%). Sociodemographic differences in contraception method preferences were noted (p-values <0.05), generally with minority, married, and older women having higher rates of preferring less effective methods, compared to their counterparts. Thirty-six percent of women reported preference-use mismatch, with the majority preferring more effective methods than those they were using. Rates of match between preferred and usual methods were highest for LARC (76%), hormonal (non-LARC) (65%), and no method (65%). The most common reasons for mismatch were cost/insurance (41%), lack of perceived/actual need (34%), and method-specific preference concerns (19%). Conclusion: While preference for effective contraception was common among this sample of women, we found substantial mismatch between preferred and usual methods, notably among women of lower socioeconomic status and women using less effective methods. Findings may have implications for patient-centered contraceptive interventions. PMID:27710196

Preferences for Depression Treatment Including Internet-Based Interventions: Results From a Large Sample of Primary Care Patients

PubMed Central

Dorow, Marie; Löbner, Margrit; Pabst, Alexander; Stein, Janine; Riedel-Heller, Steffi G.

2018-01-01

Background: To date, little is known about treatment preferences for depression concerning new media. This study aims to (1) investigate treatment preferences for depression including internet-based interventions and (2) examine subgroup differences concerning age, gender and severity of depression as well as patient-related factors associated with treatment preferences. Methods: Data were derived from the baseline assessment of the @ktiv-trial. Depression treatment preferences were assessed from n = 641 primary care patients with mild to moderate depression regarding the following treatments: medication, psychotherapy, combined treatment, alternative treatment, talking to friends and family, exercise, self-help literature, and internet-based interventions. Depression severity was specified by GPs according to ICD-10 criteria. Ordinal logistic regression models were conducted to identify associated factors of treatment preferences. Results: Patients had a mean age of 43.9 years (SD = 13.8) and more than two thirds (68.6%) were female. About 43% of patients had mild depression while 57% were diagnosed with moderate depression. The majority of patients reported strong preferences for psychotherapy, talking to friends and family, and exercise. About one in five patients was very likely to consider internet-based interventions in case of depression. Younger patients expressed significantly stronger treatment preferences for psychotherapy and internet-based interventions than older patients. The most salient factors associated with treatment preferences were the patients' education and perceived self-efficacy. Conclusions: Patients with depression report individually different treatment preferences.Our results underline the importance of shared decision-making within primary care. Future studies should investigate treatment preferences for different types of internet-based interventions. PMID:29867605

Rodent-Mediated Interactions Among Seed Species of Differing Quality in a Shrubsteppe Ecosystem

USGS Publications Warehouse

Beard, Karen H.; Faulhaber, Craig A.; Howe, Frank P.; Edwards, Thomas C.

2013-01-01

Interactions among seeds, mediated by granivorous rodents, are likely to play a strong role in shrubsteppe ecosystem restoration. Past studies typically consider only pairwise interactions between preferred and less preferred seed species, whereas rangeland seedings are likely to contain more than 2 seed species, potentially leading to complex interactions. We examined how the relative proportion of seeds in a 3-species polyculture changes rodent seed selectivity (i.e., removal) and indirect interactions among seeds. We presented 2 rodent species, Peromyscus maniculatus (deer mice) and Perognathus parvus (pocket mice), in arenas with 3-species seed mixtures that varied in the proportion of a highly preferred, moderately preferred, and least preferred seed species, based on preferences determined in this study. We then conducted a field experiment in a pocket mouse—dominated ecosystem with the same 3-species seed mixtures in both “treated” (reduced shrub and increased forb cover) and “untreated” shrubsteppe. In the arena experiment, we found that rodents removed more of the highly preferred seed when the proportions of all 3 seeds were equal. Moderately preferred seeds experienced increased removal when the least preferred seed was in highest proportion. Removal of the least preferred seed increased when the highly preferred seed was in highest proportion. In the field experiment, results were similar to those from the arena experiment and did not differ between treated and untreated shrubsteppe areas. Though our results suggest that 3-species mixtures induce complex interactions among seeds, managers applying these results to restoration efforts should carefully consider the rodent community present and the potential fate of removed seeds.

Sex preference and fertility in Peninsular Malaysia.

PubMed

Pong, S L

1994-01-01

This study uses data from the Second Malaysian Family Life Survey, conducted in 1988, to examine parents' preferences for the sex of their children within each of Malaysia's three ethnic groups. While Malay and Indian parents do not show a consistent sex preference, Chinese parents prefer to have all sons, or a combination of sons and daughters, with more sons than daughters, or at least an equal number of them. Son preference among the Chinese does not seem to be a constraint to fertility decline among that population. Since 1970, Chinese fertility has dropped rapidly; at the same time, Chinese son preference has become more pronounced. Evidence indicates that further reductions in Chinese fertility, through the reduction in sex preference, would be small.

Comparing the health state preferences of older persons, informal caregivers and healthcare professionals: a vignette study.

PubMed

Hofman, Cynthia S; Makai, Peter; Blom, Jeanet W; Boter, Han; Buurman, Bianca M; Olde Rikkert, Marcel G M; Donders, Rogier; Melis, René J F

2015-01-01

The Older Persons and Informal Caregivers Survey-Minimum Dataset (TOPICS-MDS) collects uniform information from research projects funded under the Dutch National Care for the Elderly Programme. To compare the effectiveness of these projects a preference-weighted outcome measure that combined multidimensional TOPICS-MDS outcomes into a composite endpoint (TOPICS-CEP) was developed based on the health state preferences of older persons and informal caregivers. To derive preference weights for TOPICS-CEP's components based on health state preferences of healthcare professionals and to investigate whether these weights differ between disciplines and differ from those of older persons and informal caregivers. Vignette studies were conducted. Participants assessed the general wellbeing of older persons described in vignettes on a scale (0-10). Mixed linear analyses were used to obtain and compare the preference weights of the eight TOPICS-CEP components: morbidities, functional limitations, emotional wellbeing, pain experience, cognitive problems, social functioning, self-perceived health, and self-perceived quality of life (QOL). Overall, 330 healthcare professionals, 124 older persons and 76 informal caregivers participated. The preference weights were not significantly different between disciplines. However, the professionals' preference weights differed significantly from those of older persons and informal caregivers. Morbidities and functional limitations were given more weight by older persons and informal caregivers than by healthcare professionals [difference between preference weights: 0.12 and 0.07] while the opposite was true for pain experience, social functioning, and self-perceived QOL [difference between preference weights: 0.13, 0.15 and 0.26]. It is important to recognize the discrepancies between the health state preferences of various stakeholders to (1) correctly interpret results when studying the effectiveness of interventions in elderly care and (2) establish appropriate healthcare policies. Furthermore, we should strive to include older persons in our decision making process through a shared decision making approach.

Patients' preferences for doctors' attire in Japan.

PubMed

Yamada, Yasuhiro; Takahashi, Osamu; Ohde, Sachiko; Deshpande, Gautam A; Fukui, Tsuguya

2010-01-01

Physicians' attire is one important factor to enhance the physician-patient relationship. However, there are few studies that examine patients' preferences for physicians' attire in Japan. We sought to assess patients' preference regarding doctors' attire and to assess the influence of doctors' attire on patients' confidence in their physician. Furthermore, we examined whether patients' preferences would change among various clinical situations. Employing a cross-sectional design, Japanese outpatients chosen over one week in October 2008 from waiting rooms in various outpatient departments at St. Luke's International Hospital, Tokyo, were given a 10-item questionnaire. A 5-point Likert scale was used to estimate patient preference for four types of attire in both male and female physicians, including semi-formal attire, white coat, surgical scrubs, and casual wear. In addition, a 4-point Likert Scale was used to measure the influence of doctors' attire on patient confidence. Japanese outpatients consecutively chosen from waiting rooms at St. Luke's International Hospital in Tokyo for one week in October 2008. Of 2,272 outpatients enrolled, 1483 (67.1%) of respondents were women. Mean age of subjects was 53.8 years (SD 16.2 years). Respondents most preferred the white coat (mean rank: 4.18, SD: 0.75) and preferred casual attire the least (mean rank: 2.32, SD: 0.81). For female physicians, 1.4% of respondents ranked the white coat little/least preferred while 64.7% of respondents ranked casual wear little/least preferred. Among respondents who most preferred the white coat for physician attire, perceived hygiene (62.7%) and inspiring confidence (59.3%) were important factors for doctor's attire. Around 70% of all respondents reported that physicians' attire has an influence on their confidence in their physician. This study confirms that Japanese outpatients prefer a white coat. Furthermore, this study strongly suggests that wearing a white coat could favorably influence patients' confidence in the relationship with their physician in all types of practice.

An open-label, multicenter, randomized, crossover study comparing sildenafil citrate and tadalafil for treating erectile dysfunction in Chinese men naïve to phosphodiesterase 5 inhibitor therapy

PubMed Central

Bai, Wen-Jun; Li, Hong-Jun; Dai, Yu-Tian; He, Xue-You; Huang, Yi-Ran; Liu, Ji-Hong; Sorsaburu, Sebastian; Ji, Chen; Jin, Jian-Jun; Wang, Xiao-Feng

2015-01-01

The study was to compare treatment preference, efficacy, and tolerability of sildenafil citrate (sildenafil) and tadalafil for treating erectile dysfunction (ED) in Chinese men naïve to phosphodiesterase 5 (PDE5) inhibitor therapies. This multicenter, randomized, open-label, crossover study evaluated whether Chinese men with ED preferred 20-mg tadalafil or 100-mg sildenafil. After a 4 weeks baseline assessment, 383 eligible patients were randomized to sequential 20-mg tadalafil per 100-mg sildenafil or vice versa for 8 weeks respectively and then chose which treatment they preferred to take during the 8 weeks extension. Primary efficacy was measured by Question 1 of the PDE5 Inhibitor Treatment Preference Questionnaire (PITPQ). Secondary efficacy was analyzed by PITPQ Question 2, the International Index of Erectile Function (IIEF) erectile function (EF) domain, sexual encounter profile (SEP) Questions 2 and 3, and the Drug Attributes Questionnaire. Three hundred and fifty men (91%) completed the randomized treatment phase. Two hundred and forty-two per 350 (69.1%) patients preferred 20-mg tadalafil, and 108/350 (30.9%) preferred 100-mg sildenafil (P < 0.001) as their treatment in the 8 weeks extension. Ninety-two per 242 (38%) patients strongly preferred tadalafil and 37/108 (34.3%) strongly the preferred sildenafil. The SEP2 (penetration), SEP3 (successful intercourse), and IIEF-EF domain scores were improved in both tadalafil and sildenafil treatment groups. For patients who preferred tadalafil, getting an erection long after taking the medication was the most reported reason for tadalafil preference. The only treatment-emergent adverse event reported by > 2% of men was headache. After tadalafil and sildenafil treatments, more Chinese men with ED naïve to PDE5 inhibitor preferred tadalafil. Both sildenafil and tadalafil treatments were effective and safe. PMID:25370206

An open-label, multicenter, randomized, crossover study comparing sildenafil citrate and tadalafil for treating erectile dysfunction in Chinese men naïve to phosphodiesterase 5 inhibitor therapy.

PubMed

Bai, Wen-Jun; Li, Hong-Jun; Dai, Yu-Tian; He, Xue-You; Huang, Yi-Ran; Liu, Ji-Hong; Sorsaburu, Sebastian; Ji, Chen; Jin, Jian-Jun; Wang, Xiao-Feng

2015-01-01

The study was to compare treatment preference, efficacy, and tolerability of sildenafil citrate (sildenafil) and tadalafil for treating erectile dysfunction (ED) in Chinese men naοve to phosphodiesterase 5 (PDE5) inhibitor therapies. This multicenter, randomized, open-label, crossover study evaluated whether Chinese men with ED preferred 20-mg tadalafil or 100-mg sildenafil. After a 4 weeks baseline assessment, 383 eligible patients were randomized to sequential 20-mg tadalafil per 100-mg sildenafil or vice versa for 8 weeks respectively and then chose which treatment they preferred to take during the 8 weeks extension. Primary efficacy was measured by Question 1 of the PDE5 Inhibitor Treatment Preference Questionnaire (PITPQ). Secondary efficacy was analyzed by PITPQ Question 2, the International Index of Erectile Function (IIEF) erectile function (EF) domain, sexual encounter profile (SEP) Questions 2 and 3, and the Drug Attributes Questionnaire. Three hundred and fifty men (91%) completed the randomized treatment phase. Two hundred and forty-two per 350 (69.1%) patients preferred 20-mg tadalafil, and 108/350 (30.9%) preferred 100-mg sildenafil (P < 0.001) as their treatment in the 8 weeks extension. Ninety-two per 242 (38%) patients strongly preferred tadalafil and 37/108 (34.3%) strongly the preferred sildenafil. The SEP2 (penetration), SEP3 (successful intercourse), and IIEF-EF domain scores were improved in both tadalafil and sildenafil treatment groups. For patients who preferred tadalafil, getting an erection long after taking the medication was the most reported reason for tadalafil preference. The only treatment-emergent adverse event reported by > 2% of men was headache. After tadalafil and sildenafil treatments, more Chinese men with ED naοve to PDE5 inhibitor preferred tadalafil. Both sildenafil and tadalafil treatments were effective and safe.

Patient Preferences and Shared Decision Making in the Treatment of Substance Use Disorders: A Systematic Review of the Literature

PubMed Central

Friedrichs, Anke; Spies, Maren; Härter, Martin; Buchholz, Angela

2016-01-01

Background Shared Decision Making (SDM) as means to the involvement of patients in medical decision making is increasingly demanded by treatment guidelines and legislation. Also, matching of patients’ preferences to treatments has been shown to be effective regarding symptom reduction. Despite promising results for patients with substance use disorders (SUD) no systematic evaluation of the literature has been provided. The aim is therefore to give a systematic overview of the literature of patient preferences and SDM in the treatment of patients with SUD. Methods An electronic literature search of the databases Medline, Embase, Psyndex and Clinical Trials Register was performed. Variations of the search terms substance use disorders, patient preferences and SDM were used. For data synthesis the populations, interventions and outcomes were summarized and described according to the PRISMA statement. Methodological quality of the included articles was assessed with the Mixed Methods Appraisal Tool. Results N = 25 trials were included in this review. These were conducted between 1986 and 2014 with altogether n = 8.729 patients. Two studies found that patients with SUD preferred to be actively involved in treatment decisions. Treatment preferences were assessed in n = 18 studies, where the majority of patients preferred outpatient compared with inpatient treatment. Matching patients to preferences resulted in a reduction on substance use (n = 3 studies), but the majority of studies found no significant effect. Interventions for SDM differed across patient populations and optional therapeutic techniques. Discussion Patients with substance use disorders should be involved in medical treatment decisions, as patients with other health conditions. A suitable approach is Shared Decision Making, emphasizing the patients’ preferences. However, due to the heterogeneity of the included studies, results should be interpreted with caution. Further research is needed regarding SDM interventions in patient populations with substance use disorders. PMID:26731679

Alcoholic Beverage Preference and Dietary Habits in Elderly across Europe: Analyses within the Consortium on Health and Ageing: Network of Cohorts in Europe and the United States (CHANCES) Project

PubMed Central

Sluik, Diewertje; Jankovic, Nicole; O’Doherty, Mark G.; Geelen, Anouk; Schöttker, Ben; Rolandsson, Olov; Kiefte-de Jong, Jessica C.; Ferrieres, Jean; Bamia, Christina; Fransen, Heidi P.; Boer, Jolanda M. A.; Eriksson, Sture; Martínez, Begoña; Huerta, José María; Kromhout, Daan; de Groot, Lisette C. P. G. M.; Franco, Oscar H.; Trichopoulou, Antonia; Boffetta, Paolo; Kee, Frank; Feskens, Edith J. M.

2016-01-01

Introduction The differential associations of beer, wine, and spirit consumption on cardiovascular risk found in observational studies may be confounded by diet. We described and compared dietary intake and diet quality according to alcoholic beverage preference in European elderly. Methods From the Consortium on Health and Ageing: Network of Cohorts in Europe and the United States (CHANCES), seven European cohorts were included, i.e. four sub-cohorts from EPIC-Elderly, the SENECA Study, the Zutphen Elderly Study, and the Rotterdam Study. Harmonized data of 29,423 elderly participants from 14 European countries were analyzed. Baseline data on consumption of beer, wine, and spirits, and dietary intake were collected with questionnaires. Diet quality was assessed using the Healthy Diet Indicator (HDI). Intakes and scores across categories of alcoholic beverage preference (beer, wine, spirit, no preference, non-consumers) were adjusted for age, sex, socio-economic status, self-reported prevalent diseases, and lifestyle factors. Cohort-specific mean intakes and scores were calculated as well as weighted means combining all cohorts. Results In 5 of 7 cohorts, persons with a wine preference formed the largest group. After multivariate adjustment, persons with a wine preference tended to have a higher HDI score and intake of healthy foods in most cohorts, but differences were small. The weighted estimates of all cohorts combined revealed that non-consumers had the highest fruit and vegetable intake, followed by wine consumers. Non-consumers and persons with no specific preference had a higher HDI score, spirit consumers the lowest. However, overall diet quality as measured by HDI did not differ greatly across alcoholic beverage preference categories. Discussion This study using harmonized data from ~30,000 elderly from 14 European countries showed that, after multivariate adjustment, dietary habits and diet quality did not differ greatly according to alcoholic beverage preference. PMID:27548323

Differential temperature preferences and thresholds among summer campers in Ontario's southern provincial parks: a Canadian case study in tourism climatology

NASA Astrophysics Data System (ADS)

Hewer, Micah J.; Scott, Daniel J.; Gough, William A.

2017-08-01

Weather and climate are important factors in relation to outdoor recreation and tourism. Camping and park visitation are weather sensitive activities very likely to be impacted by projected climate change. Temperature is the weather variable that has received the greatest attention within the tourism climatology literature and was the greatest predictor of park visitation within previous assessments. This study uses a stated climate preferences approach, relying on survey-based data, to explore differences for temperature preferences and thresholds among campers in Ontario parks. Statistically significant differences (at the 95% confidence level) in mean values for temperature preferences and thresholds were recorded based on various camper characteristics, such as the following: activity selection, age, gender, distance travelled, length of stay, life cycle stage, camping experience, and camping equipment. Swimmers preferred warmer day-time temperatures. Older campers preferred cooler temperatures and were more sensitive to heat stress, in the day and night time. Females preferred warmer temperatures and were less sensitive to heat stress during the night time. Campers who had travelled further distances to reach the park or planned to stay for longer periods were less sensitive to heat stress. Campers with children in their group preferred warmer temperatures and were less sensitive to heat stress, in the day and at night. Respondents with higher levels of camping experience preferred warmer temperatures at night. Tent campers were less sensitive to heat stress, in the day and at night. The results of this study have direct implications for previous and future climate change impact assessments on park visitation.

Heroin and saccharin demand and preference in rats.

PubMed

Schwartz, Lindsay P; Kim, Jung S; Silberberg, Alan; Kearns, David N

2017-09-01

Several recent studies have investigated the choice between heroin and a non-drug alternative reinforcer in rats. A common finding in these studies is that there are large individual differences in preference, with some rats preferring heroin and some preferring the non-drug alternative. The primary goal of the present study was to determine whether individual differences in how heroin or saccharin is valued, based on demand analysis, predicts choice. Rats lever-pressed for heroin infusions and saccharin reinforcers on fixed-ratio schedules. The essential value of each reinforcer was obtained from resulting demand curves. Rats were then trained on a mutually exclusive choice procedure where pressing one lever resulted in heroin and pressing another resulted in saccharin. After seven sessions of increased access to heroin or saccharin, rats were reexposed to the demand and choice procedures. Demand for heroin was more elastic than demand for saccharin (i.e., heroin had lower essential value than saccharin). When allowed to choose, most rats preferred saccharin. The essential value of heroin, but not saccharin, predicted preference. The essential value of both heroin and saccharin increased following a week of increased access to heroin, but similar saccharin exposure had no effect on essential value. Preference was unchanged after increased access to either reinforcer. Heroin-preferring rats differed from saccharin-preferring rats in how they valued heroin, but not saccharin. To the extent that choice models addiction-related behavior, these results suggest that overvaluation of opioids specifically, rather than undervaluation of non-drug alternatives, could identify susceptible individuals. Copyright © 2017 Elsevier B.V. All rights reserved.

Female preferences for spectral call properties in the western genetic lineage of Cope’s gray treefrog (Hyla chrysoscelis)

PubMed Central

Schrode, Katrina M.; Ward, Jessica L.; Vélez, Alejandro

2012-01-01

Female frogs discriminate among potential mates based on individual variation in male advertisement calls. While considerable data have accumulated allowing comparisons of female preference functions among species, we still lack fundamental knowledge about how and why the shapes of preference functions for particular call properties vary among populations within all but a few species. Here, we report results from a study aimed at describing female preference functions for spectral call properties in Cope’s gray treefrog (Hyla chrysoscelis). Widespread throughout the eastern half of North America, Cope’s gray treefrog is the diploid member of the cryptic diploid-tetraploid Hyla versicolor species complex, and its populations are divided into two distinct genetic lineages (eastern and western). In this study of a western lineage population, we recorded and analyzed the spectral properties of 1000 advertisement calls from 50 males and conducted two-choice phonotaxis experiments to estimate a population-level preference function. Females preferred calls with average frequencies over calls with frequencies that were 2 or 3 semitones (1.4 or 2.1 standard deviations, respectively) lower than the population mean. We observed no behavioral discrimination between calls with average and higher-than-average frequencies. Preferences discriminating against low-frequency calls were weak and were abolished by attenuating the preferred average call by 3 dB. We discuss these results in light of previous studies of eastern lineage populations, geographic variation in female preference functions, and the potential adaptive value of discriminating against calls with low frequencies. PMID:24496093

Avoiding Toxic Levels of Essential Minerals: A Forgotten Factor in Deer Diet Preferences

PubMed Central

Ceacero, Francisco; Landete-Castillejos, Tomás; Olguín, Augusto; Miranda, María; García, Andrés; Martínez, Alberto; Cassinello, Jorge; Miguel, Valentín; Gallego, Laureano

2015-01-01

Ungulates select diets with high energy, protein, and sodium contents. However, it is scarcely known the influence of essential minerals other than Na in diet preferences. Moreover, almost no information is available about the possible influence of toxic levels of essential minerals on avoidance of certain plant species. The aim of this research was to test the relative importance of mineral content of plants in diet selection by red deer (Cervus elaphus) in an annual basis. We determined mineral, protein and ash content in 35 common Mediterranean plant species (the most common ones in the study area). These plant species were previously classified as preferred and non-preferred. We found that deer preferred plants with low contents of Ca, Mg, K, P, S, Cu, Sr and Zn. The model obtained was greatly accurate identifying the preferred plant species (91.3% of correct assignments). After a detailed analysis of these minerals (considering deficiencies and toxicity levels both in preferred and non-preferred plants) we suggest that the avoidance of excessive sulphur in diet (i.e., selection for plants with low sulphur content) seems to override the maximization for other nutrients. Low sulphur content seems to be a forgotten factor with certain relevance for explaining diet selection in deer. Recent studies in livestock support this conclusion, which is highlighted here for the first time in diet selection by a wild large herbivore. Our results suggest that future studies should also take into account the toxicity levels of minerals as potential drivers of preferences. PMID:25615596

Drug specificity in drug versus food choice in male rats.

PubMed

Tunstall, Brendan J; Riley, Anthony L; Kearns, David N

2014-08-01

Although different classes of drug differ in their mechanisms of reinforcement and effects on behavior, little research has focused on differences in self-administration behaviors maintained by users of these drugs. Persistent drug choice despite available reinforcement alternatives has been proposed to model behavior relevant to addiction. The present study used a within-subjects procedure, where male rats (Long-Evans, N = 16) were given a choice between cocaine (1.0 mg/kg/infusion) and food (a single 45-mg grain pellet) or between heroin (0.02 mg/kg/infusion) and food in separate phases (drug order counterbalanced). All rats were initially trained to self-administer each drug, and the doses used were based on previous studies showing that small subsets of rats tend to prefer drug over food reinforcement. The goal of the present study was to determine whether rats that prefer cocaine would also prefer heroin. Choice sessions consisted of 2 forced-choice trials with each reinforcer, followed by 14 free-choice trials (all trials separated by 10-min intertrial interval). Replicating previous results, small subsets of rats preferred either cocaine (5 of the 16 rats) or heroin (2 of the 16 rats) to the food alternative. Although 1 of the 16 rats demonstrated a preference for both cocaine and heroin to the food alternative, there was no relationship between degree of cocaine and heroin preference in individual rats. The substance-specific pattern of drug preference observed suggests that at least in this animal model, the tendencies to prefer cocaine or heroin in preference to a nondrug alternative are distinct behavioral phenomena.

Focus Groups in Elderly Ophthalmologic Patients: Setting the Stage for Quantitative Preference Elicitation.

PubMed

Danner, Marion; Vennedey, Vera; Hiligsmann, Mickaël; Fauser, Sascha; Stock, Stephanie

2016-02-01

Patients suffering from age-related macular degeneration (AMD) are rarely actively involved in decision-making, despite facing preference-sensitive treatment decisions. This paper presents a qualitative study to prepare quantitative preference elicitation in AMD patients. The aims of this study were (1) to gain familiarity with and learn about the special requirements of the AMD patient population for quantitative data collection; and (2) to select/refine patient-relevant treatment attributes and levels, and gain insights into preference structures. Semi-structured focus group interviews were performed. An interview guide including preselected categories in the form of seven potentially patient-relevant treatment attributes was followed. To identify the most patient-relevant treatment attributes, a ranking exercise was performed. Deductive content analyses were done by two independent reviewers for each attribute to derive subcategories (potential levels of attributes) and depict preference trends. The focus group interviews included 21 patients. The interviews revealed that quantitative preference surveys in this population will have to be interviewer assisted to make the survey feasible for patients. The five most patient-relevant attributes were the effect on visual function [ranking score (RS): 139], injection frequency (RS: 101), approval status (RS: 83), side effects (RS: 79), and monitoring frequency (RS: 76). Attribute and level refinement was based on patients' statements. Preference trends and dependencies between attributes informed the quantitative instrument design. This study suggests that qualitative research is a very helpful step to prepare the design and administration of quantitative preference elicitation instruments. It especially facilitated familiarization with the target population and its preferences, and it supported attribute/level refinement.

Avoiding toxic levels of essential minerals: a forgotten factor in deer diet preferences.

PubMed

Ceacero, Francisco; Landete-Castillejos, Tomás; Olguín, Augusto; Miranda, María; García, Andrés; Martínez, Alberto; Cassinello, Jorge; Miguel, Valentín; Gallego, Laureano

2015-01-01

Ungulates select diets with high energy, protein, and sodium contents. However, it is scarcely known the influence of essential minerals other than Na in diet preferences. Moreover, almost no information is available about the possible influence of toxic levels of essential minerals on avoidance of certain plant species. The aim of this research was to test the relative importance of mineral content of plants in diet selection by red deer (Cervus elaphus) in an annual basis. We determined mineral, protein and ash content in 35 common Mediterranean plant species (the most common ones in the study area). These plant species were previously classified as preferred and non-preferred. We found that deer preferred plants with low contents of Ca, Mg, K, P, S, Cu, Sr and Zn. The model obtained was greatly accurate identifying the preferred plant species (91.3% of correct assignments). After a detailed analysis of these minerals (considering deficiencies and toxicity levels both in preferred and non-preferred plants) we suggest that the avoidance of excessive sulphur in diet (i.e., selection for plants with low sulphur content) seems to override the maximization for other nutrients. Low sulphur content seems to be a forgotten factor with certain relevance for explaining diet selection in deer. Recent studies in livestock support this conclusion, which is highlighted here for the first time in diet selection by a wild large herbivore. Our results suggest that future studies should also take into account the toxicity levels of minerals as potential drivers of preferences.

Most and Least Preferred Colours Differ According to Object Context: New Insights from an Unrestricted Colour Range

PubMed Central

Jonauskaite, Domicele; Mohr, Christine; Antonietti, Jean-Philippe; Spiers, Peter M.; Althaus, Betty; Anil, Selin; Dael, Nele

2016-01-01

Humans like some colours and dislike others, but which particular colours and why remains to be understood. Empirical studies on colour preferences generally targeted most preferred colours, but rarely least preferred (disliked) colours. In addition, findings are often based on general colour preferences leaving open the question whether results generalise to specific objects. Here, 88 participants selected the colours they preferred most and least for three context conditions (general, interior walls, t-shirt) using a high-precision colour picker. Participants also indicated whether they associated their colour choice to a valenced object or concept. The chosen colours varied widely between individuals and contexts and so did the reasons for their choices. Consistent patterns also emerged, as most preferred colours in general were more chromatic, while for walls they were lighter and for t-shirts they were darker and less chromatic compared to least preferred colours. This meant that general colour preferences could not explain object specific colour preferences. Measures of the selection process further revealed that, compared to most preferred colours, least preferred colours were chosen more quickly and were less often linked to valenced objects or concepts. The high intra- and inter-individual variability in this and previous reports furthers our understanding that colour preferences are determined by subjective experiences and that most and least preferred colours are not processed equally. PMID:27022909

Most and Least Preferred Colours Differ According to Object Context: New Insights from an Unrestricted Colour Range.

PubMed

Jonauskaite, Domicele; Mohr, Christine; Antonietti, Jean-Philippe; Spiers, Peter M; Althaus, Betty; Anil, Selin; Dael, Nele

2016-01-01

Humans like some colours and dislike others, but which particular colours and why remains to be understood. Empirical studies on colour preferences generally targeted most preferred colours, but rarely least preferred (disliked) colours. In addition, findings are often based on general colour preferences leaving open the question whether results generalise to specific objects. Here, 88 participants selected the colours they preferred most and least for three context conditions (general, interior walls, t-shirt) using a high-precision colour picker. Participants also indicated whether they associated their colour choice to a valenced object or concept. The chosen colours varied widely between individuals and contexts and so did the reasons for their choices. Consistent patterns also emerged, as most preferred colours in general were more chromatic, while for walls they were lighter and for t-shirts they were darker and less chromatic compared to least preferred colours. This meant that general colour preferences could not explain object specific colour preferences. Measures of the selection process further revealed that, compared to most preferred colours, least preferred colours were chosen more quickly and were less often linked to valenced objects or concepts. The high intra- and inter-individual variability in this and previous reports furthers our understanding that colour preferences are determined by subjective experiences and that most and least preferred colours are not processed equally.

An Investigation of Patient Preferences for Music Played Before Electroconvulsive Therapy.

PubMed

Graff, Veena; Wingfield, Peter; Adams, David; Rabinowitz, Terry

2016-09-01

Patients often feel anxious before electroconvulsive therapy (ECT), which can lead to avoidance of treatments. Music is a noninvasive safe option to reduce anxiety in the preoperative setting. Therefore, we examined patients' preferences of listening to music while receiving ECT by providing music-by way of headphones or speakers-to participants before treatment. Patients receiving ECT were recruited for this study. Patients served as their own controls in 3 separate music intervention sessions: 1) randomization to music via headphones or speakers, 2) no music, 3) the remaining music intervention. Patients completed a questionnaire related to satisfaction and preferences of music being played before ECT. Patients received a final questionnaire at the end of the study asking which intervention they preferred. Thirty patients completed the study. Ninety percent enjoyed listening to music through speakers. Eighty percent liked listening to music through headphones. Seventeen percent preferred not having any music. The difference in preference between speakers and headphones was not significant (P = 0.563; McNemar-Bowker test). There was no association between preference at the end of the study and the initial assignment of speakers or headphones (P = 0.542 and P = 0.752, respectively; Pearson χ tests). No adverse events were reported. Music is a low-cost intervention with virtually no side effects that could be offered as an adjunctive therapy for patients receiving ECT. A significant proportion of patients liked hearing music before treatment.

Facial Diversity and Infant Preferences for Attractive Faces.

ERIC Educational Resources Information Center

Langlois, Judith H.; And Others

1991-01-01

Three studies examined infant preferences for attractive faces of White males, White females, Black females, and infants. Infants viewed pairs of faces rated for attractiveness by adults. Preferences for attractive faces were found for all facial types. (BC)

Patient autonomy preferences among hypertensive outpatients in a primary care setting in Japan.

PubMed

Nomura, Kyoko; Ohno, Maiko; Fujinuma, Yasuki; Ishikawa, Hirono

2007-01-01

To investigate autonomy preferences and the factors to promote active patient participation in a primary care setting in Japan. Ninety-two hypertensive outpatients who consecutively visited a Japanese hospital between January and May of 2005 in Tokyo, Japan. This cross-sectional study was conducted by using a self-administered questionnaire. The main outcome measures were patient preferences for autonomy (i.e., decision-making and information-seeking preferences), measured by the Autonomy Preference Index (API). The variables studied were patient sociodemographic characteristics, physician characteristics based on patient preference (i.e., ability to communicate, extent of clinical experience, qualifications, educational background, gender, and age), and the Multidimensional Health Locus of Control. On the API scale from 0 to 100, the patients had an intermediate desire for decision-making (median: 51) and a greater desire for information (median: 95). A multivariate regression model indicated that decision-making preference increased when patients were woman and decreased as physician age increased, and information-seeking preference was positively associated with good communication skills, more extensive clinical experience, physicians of middle age, and patient beliefs that they were responsible for their own health, and was negatively associated with a preference for man physicians. Physicians may need to understand that patient autonomy preferences pertain to physician age and gender, physician communication ability and extent of clinical experience, and patient beliefs about self-responsibility toward health, and could use the information to promote reliable patient-physician relationships.