Protein crystal growth in low gravity
NASA Technical Reports Server (NTRS)
Feigelson, Robert S.
1990-01-01
The effect of low gravity on the growth of protein crystals and those parameters which will affect growth and crystal quality was studied. The proper design of the flight hardware and experimental protocols are highly dependent on understanding the factors which influence the nucleation and growth of crystals of biological macromolecules. Thus, those factors are investigated and the body of knowledge which has been built up for small molecule crystallization. These data also provide a basis of comparison for the results obtained from low-g experiments. The flows around growing crystals are detailed. The preliminary study of the growth of isocitrate lyase, the crystal morphologies found and the preliminary x ray results are discussed. The design of two apparatus for protein crystal growth by temperature control are presented along with preliminary results.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gromova, T. Yu., E-mail: duk@img.ras.ru; Demidyuk, I. V.; Kostrov, S. V.
2008-09-15
A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.
Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.
2009-01-01
Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014
Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B
2009-10-01
Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi
2005-03-01
A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.
Paul, A.; Mishra, A.; Surolia, A.; Vijayan, M.
2013-01-01
The last enzyme in the arginine-biosynthesis pathway, argininosuccinate lyase, from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized, and preliminary X-ray studies have been carried out on the crystals. The His-tagged tetrameric enzyme with a subunit molecular weight of 50.9 kDa crystallized with two tetramers in the asymmetric unit of the orthorhombic unit cell, space group P212121. Molecular-replacement calculations and self-rotation calculations confirmed the space group and the tetrameric nature of the molecule. PMID:24316845
NASA Astrophysics Data System (ADS)
Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.
2017-11-01
The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lemke, Christopher T.; Hwang, Jiyoung; Xiong, Bing
2005-06-01
Two crystal forms of the antibiotic resistance enzyme APH(9)-Ia from L. pneumophila are reported. 9-Aminoglycoside phosphotransferase type Ia [APH(9)-Ia] is a resistance factor in Legionella pneuemophila, the causative agent of legionnaires’ disease. It is responsible for providing intrinsic resistance to the antibiotic spectinomycin. APH(9)-Ia phosphorylates one of the hydroxyl moieties of spectinomycin in an ATP-dependent manner, abolishing the antibiotic properties of this drug. Here, the crystallization and preliminary X-ray studies of this enzyme in two crystal forms is reported. One of the these crystal forms provides diffraction data to a resolution of 1.7 Å.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa
The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.
Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N
2009-03-01
Haemoglobin is a metalloprotein which plays a major role in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs. The present work reports the preliminary crystallographic study of low oxygen-affinity haemoglobin from cat in different crystal forms. Cat blood was collected, purified by anion-exchange chromatography and crystallized in two different conditions by the hanging-drop vapour-diffusion method under unbuffered low-salt and buffered high-salt concentrations using PEG 3350 as a precipitant. Intensity data were collected using MAR345 and MAR345dtb image-plate detector systems. Cat haemoglobin crystallizes in monoclinic and orthorhombic crystal forms with one and two whole biological molecules (alpha(2)beta(2)), respectively, in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi
2006-04-01
Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Feifei; Gao, Feng; Li, Honglin
The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.
Protein crystal growth in microgravity
NASA Technical Reports Server (NTRS)
Rosenblum, William M.; Delucas, Lawrence J.; Wilson, William W.
1989-01-01
Major advances have been made in several of the experimental aspects of protein crystallography, leaving protein crystallization as one of the few remaining bottlenecks. As a result, it has become important that the science of protein crystal growth is better understood and that improved methods for protein crystallization are developed. Preliminary experiments with both small molecules and proteins indicate that microgravity may beneficially affect crystal growth. For this reason, a series of protein crystal growth experiments using the Space Shuttle was initiated. The preliminary space experiments were used to evolve prototype hardware that will form the basis for a more advanced system that can be used to evaluate effects of gravity on protein crystal growth. Various optical techniques are being utilized to monitor the crystal growth process from the incipient or nucleation stage and throughout the growth phase. The eventual goal of these studies is to develop a system which utilizes optical monitoring for dynamic control of the crystallization process.
Extracellular overproduction and preliminary crystallographic analysis of a family I.3 lipase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Angkawidjaja, Clement; You, Dong-Ju; Matsumura, Hiroyoshi
2007-03-01
A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. The crystal was grown at 277 K by the hanging-drop vapour-diffusion method. Native X-ray diffraction data were collected to 1.7 Å resolution using synchrotron radiation at station BL38B1, SPring-8. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 48.79, b = 84.06,more » c = 87.04 Å. Assuming the presence of one molecule per asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.73 Å{sup 3} Da{sup −1} and the solvent content was 55%.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman
2007-02-01
DHNA synthetase from G. kaustophilus has been cloned, expressed, purified and crystallized. The aerobic Gram-positive bacterium Geobacillus kaustophilus is a bacillus species that was isolated from deep-sea sediment from the Mariana Trench. 1,4-Dihydroxy-2-naphthoate (DHNA) synthetase plays a vital role in the biosynthesis of menaquinone (vitamin K{sub 2}) in this bacterium. DHNA synthetase from Geobacillus kaustophilus was crystallized in the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 77.01, b = 130.66, c = 131.69 Å. The crystal diffracted to a resolution of 2.2 Å. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetricmore » unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arreola, Rodrigo; Vega-Miranda, Anita; Gómez-Puyou, Armando
The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2{sub 1} with unit-cell parameters a = 59.7, b = 87.4, c =more » 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22{sub 1}2{sub 1} with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms.« less
NASA Astrophysics Data System (ADS)
Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.
2017-11-01
The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.
Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S
2014-11-01
Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.
2008-08-01
Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jagadeesan, G.; Malathy, P.; Gunasekaran, K.
2014-10-25
The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
DiMattia, Michael; Govindasamy, Lakshmanan; Levy, Hazel C.
2005-10-01
The production, purification, crystallization and preliminary crystallographic analysis of empty adeno-associated virus serotype 5 capsids are reported. Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Å resolution using synchrotron radiation and belong to the orthorhombicmore » space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c = 629.7 Å. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less
NASA Technical Reports Server (NTRS)
Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.
1992-01-01
Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lane, Michael Douglas; Nam, Hyun-Joo; Padron, Eric
2005-06-01
The production, purification, crystallization and preliminary X-ray crystallographic analysis of adeno-associated virus serotype 8 is reported. Adeno-associated viruses (AAVs) are actively being developed for clinical gene-therapy applications and the efficiencies of the vectors could be significantly improved by a detailed understanding of their viral capsid structures and the structural determinants of their tissue-transduction interactions. AAV8 is ∼80% identical to the more widely studied AAV2, but its liver-transduction efficiency is significantly greater than that of AAV2 and other serotypes. The production, purification, crystallization and preliminary X-ray crystallographic analysis of AAV8 viral capsids are reported. The crystals diffract X-rays to 3.0 Åmore » resolution using synchrotron radiation and belong to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = 257.5, c = 443.5 Å. The unit cell contains two viral particles, with ten capsid viral protein monomers per crystallographic asymmetric unit.« less
Ni, Dongchun; Yang, Kun; Huang, Yihua
2014-03-01
In Gram-negative bacteria, the assembly of outer membrane proteins (OMPs) requires a five-protein β-barrel assembly machinery (BAM) complex, of which BamA is an essential and evolutionarily conserved integral outer membrane protein. Here, the refolding, crystallization and preliminary X-ray crystallographic characterization of the β-barrel domain of BamA from Escherichia coli (EcBamA) are reported. Native and selenomethionine-substituted EcBamA proteins were crystallized at 16°C and X-ray diffraction data were collected to 2.6 and 3.7 Å resolution, respectively. The native crystals belonged to space group P21212, with unit-cell parameters a = 118.492, b = 159.883, c = 56.000 Å and two molecules in one asymmetric unit; selenomethionine-substituted protein crystals belonged to space group P4322, with unit-cell parameters a = b = 163.162, c = 46.388 Å and one molecule in one asymmetric unit. Initial phases for EcBamA β-barrel domain were obtained from a SeMet SAD data set. These preliminary X-ray crystallographic studies paved the way for further structural determination of the β-barrel domain of EcBamA.
Preliminary crystallographic examination of a novel fungal lysozyme from Chalaropsis
NASA Technical Reports Server (NTRS)
Carter, Daniel C.; He, Xiao-Min; Lyne, James E.; Stubbs, Gerald; Hash, John H.
1990-01-01
The lysozyme from the fungus of the Chalaropsis species has been crystallized. This lysozyme displays no sequence homology with avian, phage, or mammalian lysozymes, however, preliminary studies indicate significant sequence homology with the bacterial lysozyme from Streptomyces. Both enzymes are unusual in possessing beta-1,4-N-acetylmuramidase and beta-1,4-N,6-O-diacetylmuramidase activity. The crystals grow from solutions of ammonium sulfate during growth periods from several months to a year. The space group is P2(1)2(1)2(1) with a = 34.0 A, b = 42.6 A, c = 122.1 A. Preliminary data indicate that there is 1 molecule/asymmetric unit.
NASA Technical Reports Server (NTRS)
Struk, Peter; Tsao, Jen-Ching; Bartkus, Tadas
2017-01-01
This paper describes plans and preliminary results for using the NASA Propulsion Systems Lab (PSL) to experimentally study the fundamental physics of ice-crystal ice accretion. NASA is evaluating whether this facility, in addition to full-engine and motor-driven-rig tests, can be used for more fundamental ice-accretion studies that simulate the different mixed-phase icing conditions along the core flow passage of a turbo-fan engine compressor. The data from such fundamental accretion tests will be used to help develop and validate models of the accretion process. This paper presents data from some preliminary testing performed in May 2015 which examined how a mixed-phase cloud could be generated at PSL using evaporative cooling in a warmer-than-freezing environment.
NASA Technical Reports Server (NTRS)
Struk, Peter; Tsao, Jen-Ching; Bartkus, Tadas
2016-01-01
This presentation accompanies the paper titled Plans and Preliminary Results of Fundamental Studies of Ice Crystal Icing Physics in the NASA Propulsion Systems Laboratory. NASA is evaluating whether PSL, in addition to full-engine and motor-driven-rig tests, can be used for more fundamental ice-accretion studies that simulate the different mixed-phase icing conditions along the core flow passage of a turbo-fan engine compressor. The data from such fundamental accretion tests will be used to help develop and validate models of the accretion process. This presentation (and accompanying paper) presents data from some preliminary testing performed in May 2015 which examined how a mixed-phase cloud could be generated at PSL using evaporative cooling in a warmer-than-freezing environment.
Alsarraf, Husam M. A. B.; Laroche, Fabrice; Spaink, Herman; Thirup, Søren; Blaise, Mickael
2011-01-01
Cell metabolic processes are constantly producing reactive oxygen species (ROS), which have deleterious effects by triggering, for example, DNA damage. Numerous enzymes such as catalase, and small compounds such as vitamin C, provide protection against ROS. The TLDc domain of the human oxidation resistance protein has been shown to be able to protect DNA from oxidative stress; however, its mechanism of action is still not understood and no structural information is available on this domain. Structural information on the TLDc domain may therefore help in understanding exactly how it works. Here, the purification, crystallization and preliminary crystallographic studies of the TLDc domain from zebrafish are reported. Crystals belonging to the orthorhombic space group P21212 were obtained and diffracted to 0.97 Å resolution. Selenomethionine-substituted protein could also be crystallized; these crystals diffracted to 1.1 Å resolution and the structure could be solved by SAD/MAD methods. PMID:22102041
Mohamed Abubakkar, M; Saraboji, K; Ponnuswamy, M N
2013-02-01
Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony
2006-03-01
A cytotoxin from Indian Russell’s viper (D. russelli russelli) venom having multifunctional activity has been crystallized in space group P4{sub 1}. Larger crystals diffracted to 1.5 Å but were found to be twinned; preliminary data were therefore collected (2.93 Å) from a smaller crystal. A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P4{sub 1}, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, weremore » found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V{sub M} value.« less
Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase
Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo
2006-01-01
Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269
NASA Technical Reports Server (NTRS)
1983-01-01
A preliminary assessment of the feasibility of accommodating the on-orbit R&D requirements for electroepitaxial crystal growth using the Orbiter middeck, the Materials Experiment Assembly or the Get-Away Special cans was performed. The study is based on the proposed electroepitaxial growth of single crystals of gallium arsenide (GaAs). Baseline R&D requirements, synthesizing furnace and facility conceptual design requirements, accommodation requirements, preliminary compatibility assessments are established. The systems engineering approach employed for the individual assessments is outlined.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika
2007-08-01
The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less
Preliminary investigations of protein crystal growth using the Space Shuttle
NASA Technical Reports Server (NTRS)
Delucas, L. J.; Suddath, F. L.; Snyder, R.; Naumann, R.; Broom, M. B.; Pusey, M.; Yost, V.; Herren, B .; Carter, D.
1986-01-01
Four preliminary Shuttle experiments are described which have been used to develop prototype hardware for a more advanced system that will evaluate effects of gravity on protein crystal growth. The first phase of these experiments has centered on the development of micromethods for protein crystal growth by vapor-diffusion techniques (using a space version of the hanging-drop method) and on dialysis using microdialysis cells. Results suggest that the elimination of density-driven sedimentation can effect crystal morphology. In the dialysis experiment, space-grown crystals of concanavalin B were three times longer and 1/3 the thickness of earth-grown crystals.
Effects of Gravity on Processing Heavy Metal Fluoride Fibers
NASA Technical Reports Server (NTRS)
Tucker, Dennis S.; Workman, Gary L.; Smith, Guy A.
1997-01-01
The effects of gravity on the crystal nucleation of heavy metal fluoride fibers have been studied in preliminary experiments utilizing NASA's KC-135 reduced gravity aircraft and a microgravity sounding rocket flight. Commercially produced fibers were heated to the crystallization temperature in normal and reduced gravity. The fibers processed in normal gravity showed complete crystallization while the fibers processed in reduced gravity did not show signs of crystallization.
Vyas, Rajan; Kumar, Vijay; Panjikar, Santosh; Karthikeyan, Subramanian; Kishan, K. V. Radha; Tewari, Rupinder; Weiss, Manfred S.
2008-01-01
Aspartate semialdehyde dehydrogenase from Mycobacterium tuberculosis (Asd, ASADH, Rv3708c), which is the second enzyme in the lysine/homoserine-biosynthetic pathways, has been expressed heterologously in Escherichia coli. The enzyme was purified using affinity and gel-filtration chromatographic techniques and crystallized in two different crystal forms. Preliminary diffraction data analysis suggested the presence of up to four monomers in the asymmetric unit of the orthorhombic crystal form A and of one or two monomers in the cubic crystal form B. PMID:18323599
2010-05-18
strong radiation hardness of ZnO. Positron annihilation studies have revealed the presence of Zn vacancies under high energy electron irradiation, as...SUPPLEMENTARY NOTES 14. ABSTRACT CL study of ammonothermal GaN crystals. Preliminary results on ammonothermal AlGaN crystals show a clear...prevalence of deep level luminescence Study of the luminescence spectral characteristics. Optimization of the excitonic emission vs deep level emission
Lu, Y; Zheng, Q; Lu, D; Ma, P; Chen, Y
1995-06-01
Crystal structures of two compounds from Tripterygium wilfordii Hook f. have been determined by X-ray diffraction method. Structure factors influencing melting point of solid state have been analysed. Crystal class (or space group), recrystallization solvent, force between molecules and fine changes of molecular structures will all cause melting point changes of crystal substance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brüx, Christian; Niefind, Karsten; Ben-David, Alon
2005-12-01
The crystallization and preliminary X-ray analysis of a β-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P2{sub 1}2{sub 1}2 and tetragonal P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2 Å. β-d-Xylosidases (EC 3.2.1.37) are hemicellulases that cleave single xylose units from the nonreducing end of xylooligomers. In this study, the crystallization and preliminary X-ray analysis of a β-d-xylosidase from Geobacillus stearothermophilus T-6more » (XynB3), a family 43 glycoside hydrolase, is described. XynB3 is a 535-amino-acid protein with a calculated molecular weight of 61 891 Da. Purified recombinant native and catalytic inactive mutant proteins were crystallized and cocrystallized with xylobiose in two different space groups, P2{sub 1}2{sub 1}2 (unit-cell parameters a = 98.32, b = 99.36, c = 258.64 Å) and P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2; unit-cell parameters a = b = 140.15, c = 233.11 Å), depending on the detergent. Transferring crystals to cryoconditions required a very careful protocol. Orthorhombic crystals diffract to 2.5 Å and tetragonal crystals to 2.2 Å.« less
Mohamed Abubakkar, M.; Saraboji, K.; Ponnuswamy, M. N.
2013-01-01
Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively. PMID:23385751
Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction.
Hughes, Ronny C; Coates, Leighton; Blakeley, Matthew P; Tomanicek, Steve J; Langan, Paul; Kovalevsky, Andrey Y; García-Ruiz, Juan M; Ng, Joseph D
2012-12-01
Inorganic pyrophosphatase (IPPase) from the archaeon Thermococcus thioreducens was cloned, overexpressed in Escherichia coli, purified and crystallized in restricted geometry, resulting in large crystal volumes exceeding 5 mm3. IPPase is thermally stable and is able to resist denaturation at temperatures above 348 K. Owing to the high temperature tolerance of the enzyme, the protein was amenable to room-temperature manipulation at the level of protein preparation, crystallization and X-ray and neutron diffraction analyses. A complete synchrotron X-ray diffraction data set to 1.85 Å resolution was collected at room temperature from a single crystal of IPPase (monoclinic space group C2, unit-cell parameters a=106.11, b=95.46, c=113.68 Å, α=γ=90.0, β=98.12°). As large-volume crystals of IPPase can be obtained, preliminary neutron diffraction tests were undertaken. Consequently, Laue diffraction images were obtained, with reflections observed to 2.1 Å resolution with I/σ(I) greater than 2.5. The preliminary crystallographic results reported here set in place future structure-function and mechanism studies of IPPase.
Preliminary crystallographic studies of four crystal forms of serum albumin
NASA Technical Reports Server (NTRS)
Carter, D. C.; Chang, B.; Ho, J. X.; Keeling, K.; Krishnasami, Z.
1994-01-01
Several crystal forms of serum albumin suitable for three-dimensional structure determination have been grown. These forms include crystals of recombinant and wild-type human serum albumin, baboon serum albumin, and canine serum albumin. The intrinsic limits of X-ray diffraction for these crystals are in the range 0.28-0.22 nm. Two of the crystal forms produced from human and canine albumin include incorporated long-chain fatty acids. Molecular replacement experiments have been successfully conducted on each crystal form using the previously determined atomic coordinates of human serum albumin illustrating the conserved tertiary structure.
Preliminary observations of the effect of solutal convection on crystal morphology
NASA Technical Reports Server (NTRS)
Broom, M. Beth H.; Witherow, William K.; Snyder, Robert S.; Carter, Daniel C.
1988-01-01
Studies to examine the effect of solutal convection on crystal morphology using sucrose as a model system were initiated. Aspect ratios, defined as the width of the 100-plane-oriented face over the width of the 001-plane-oriented face, were determined for oriented crystals which were grown with either the 001-oriented or the 100-oriented face perpendicular to the convective flow. The dependence of the crystal morphology on orientation is much greater for crystals grown with one face occluded than for crystals grown suspended in solution. Many factors appear to interact in a complex fashion to influence crystal morphology.
Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi
2008-01-01
Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution. PMID:18931441
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in
The purification, identification, crystallization and preliminary crystallographic studies of an allergy-related protein, Pru du amandin, from P. dulcis nuts are reported. Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presencemore » of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 150.7, c = 164.9 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gowda, Giri; Sagurthi, Someswar Rao; Savithri, H. S.
2008-02-01
The cloning, expression, purification, crystallization and preliminary X-ray crystallographic studies of mannose 6-phosphate isomerase from S. typhimurium are reported. Mannose 6-phosphate isomerase (MPI; EC 5.3.1.8) catalyzes the reversible isomerization of d-mannose 6-phosphate (M6P) and d-fructose 6-phosphate (F6P). In the eukaryotes and prokaryotes investigated to date, the enzyme has been reported to play a crucial role in d-mannose metabolism and supply of the activated mannose donor guanosine diphosphate d-mannose (GDP-d-mannose). In the present study, MPI was cloned from Salmonella typhimurium, overexpressed in Escherichia coli and purified using Ni–NTA affinity column chromatography. Purified MPI crystallized in space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 36.03, b = 92.2, c = 111.01 Å. A data set extending to 1.66 Å resolution was collected with 98.8% completeness using an image-plate detector system mounted on a rotating-anode X-ray generator. The asymmetric unit of the crystal cell was compatible with the presence of a monomer of MPI. A preliminary structure solution of the enzyme has been obtained by molecular replacement using Candida albicans MPI as the phasing model and the program Phaser. Further refinement and model building are in progress.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mitchell, M.; Nam, H; Carter, A
2009-01-01
Adeno-associated virus (AAV) serotype 9, which is under development for gene-delivery applications, shows significantly enhanced capsid-associated transduction efficiency in muscle compared with other AAV serotypes. With the aim of characterizing the structural determinants of this property, the purification, crystallization and preliminary X-ray crystallographic analyses of the AAV9 viral capsid are reported. The crystals diffracted X-rays to 2.8 A resolution using synchrotron radiation and belonged to the trigonal space group P32, with unit-cell parameters a = b = 251.0, c = 640.0 A. There are three complete viral capsids in the crystal unit cell. The orientation and position of the asymmetricmore » unit capsid have been determined by molecular-replacement methods and structure determination is in progress.« less
Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.
Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping
2012-08-01
Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.
Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4
Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping
2012-01-01
Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Zhijie; Chakraborty, Sayan; Xu, Guozhou
Does not respond to nucleotides 1 (DORN1) has recently been identified as the first membrane-integral plant ATP receptor, which is required for ATP-induced calcium response, mitogen-activated protein kinase activation and defense responses inArabidopsis thaliana. In order to understand DORN1-mediated ATP sensing and signal transduction, crystallization and preliminary X-ray studies were conducted on the extracellular domain of DORN1 (atDORN1-ECD) and that of an orthologous protein,Camelina sativalectin receptor kinase I.9 (csLecRK-I.9-ECD or csI.9-ECD). A variety of deglycosylation strategies were employed to optimize the glycosylated recombinant atDORN1-ECD for crystallization. In addition, the glycosylated csI.9-ECD protein was crystallized at 291 K. X-ray diffraction datamore » were collected at 4.6 Å resolution from a single crystal. The crystal belonged to space groupC222 orC222 1, with unit-cell parametersa= 94.7,b= 191.5,c= 302.8 Å. These preliminary studies have laid the foundation for structural determination of the DORN1 and I.9 receptor proteins, which will lead to a better understanding of the perception and function of extracellular ATP in plants.« less
Chandra, P. Manish; Brannigan, James A.; Prabhune, Asmita; Pundle, Archana; Turkenburg, Johan P.; Dodson, G. Guy; Suresh, C. G.
2005-01-01
The crystallization of three catalytically inactive mutants of penicillin V acylase (PVA) from Bacillus sphaericus in precursor and processed forms is reported. The mutant proteins crystallize in different primitive monoclinic space groups that are distinct from the crystal forms for the native enzyme. Directed mutants and clone constructs were designed to study the post-translational autoproteolytic processing of PVA. The catalytically inactive mutants will provide three-dimensional structures of precursor PVA forms, plus open a route to the study of enzyme–substrate complexes for this industrially important enzyme. PMID:16508111
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
The purpose of the work on this contract is to study the suitability of Zn/sub 3/P/sub 2/ as a photovoltaic material for large scale terrestrial use. Zn/sub 3/P/sub 2/ was chosen for study because those of its physical parameters which could be gleaned from a rather sparse literature match fairly well the criteria for optimum terrestrial photovoltaic materials. The main emphasis in the quarter has been on material preparation. Materials synthesis has been successful, with a fair number of useable single crystals produced with the bulk material. In addition, thin films have been produced in a preliminary way on variousmore » substrates. Initial electrical and optical studies have been carried out in both single crystals and films, but the results of these studies are of a preliminary nature only.« less
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-04-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-01-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo
2006-05-01
The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Y Zhang; X Gao; G Buchko
2011-12-31
Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Y.; Robinson, H.; Gao, X.
2010-12-01
Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balotra, Sahil; Newman, Janet; French, Nigel G.
2014-02-19
The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee
2007-08-01
The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less
Protein crystal growth in low gravity
NASA Technical Reports Server (NTRS)
Feigelson, Robert S.
1988-01-01
The solubility and growth of the protein canavalin, and the application of the schlieren technique to study fluid flow in protein crystal growth systems were investigated. These studies have resulted in the proposal of a model to describe protein crystal growth and the preliminary plans for a long-term space flight experiment. Canavalin, which may be crystallized from a basic solution by the addition of hydrogen (H+) ions, was shown to have normal solubility characteristics over the range of temperatures (5 to 25 C) and pH (5 to 7.5) studies. The solubility data combined with growth rate data gathered from the seeded growth of canavalin crystals indicated that the growth rate limiting step is a screw dislocation mechanism. A schlieren apparatus was constructed and flow patterns were observed in Rochelle salt (sodium potassium tartrate), lysozyme, and canavalin. The critical parameters were identified as the change in density with concentration (dp/dc) and the change in index of refraction with concentration (dn/dc). Some of these values were measured for the materials listed. The data for lyrozyme showed non-linearities in plots of optical properties and density vs. concentration. In conjunction with with W. A. Tiller, a model based on colloid stability theory was proposed to describe protein crystallization. The model was used to explain observations made by ourselves and others. The results of this research has lead to the development for a preliminary design for a long-term, low-g experiment. The proposed apparatus is univeral and capable of operation under microprocessor control.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp
2007-09-01
A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less
NASA Technical Reports Server (NTRS)
Gorti, Sridhar; Forsythe, Elizabeth L.; Pusey, Marc L.
2004-01-01
We examined particulars of crystal growth from measurements obtained at both microscopic and molecular levels. The crystal growth measurements performed at the microscopic level are well characterized by a model that balances the flux of macromolecules towards the crystal surface with the flux of the crystal surface. Numerical evaluation of model with measurements of crystal growth, in time, provided accurate estimates for the average growth velocities. Growth velocities thus obtained were also interpreted using well-established phenomenological theories. Moreover, we find that microscopic measurements of growth velocity measurements obtained as a function of temperature best characterizes changes in crystal growth modes, when present. We also examined the possibility of detecting a change in crystal growth modes at the molecular level using atomic force microscopy, AFM. From preliminary AFM measurements performed at various supersaturations, we find that magnitude of surface height fluctuations, h(x), increases with supersaturation. Further examination of surface height fluctuations using methods established for fluctuation spectroscopy also enabled the discovery of the existence of a characteristic length, c, which may possibly determine the mode of crystal growth. Although the results are preliminary, we establish the non- critical divergence of 5 and the root-mean-square (rms) magnitude of height-height fluctuations as the kinetic roughening transition temperatures are approached. Moreover, we also examine approximate models for interpreting the non-critical behavior of both 6 and rms magnitude of height-height fluctuations, as the solution supersaturation is increased towards the kinetic roughening supersaturation.
THF water hydrate crystallization: an experimental investigation
NASA Astrophysics Data System (ADS)
Devarakonda, Surya; Groysman, Alexander; Myerson, Allan S.
1999-08-01
Supersaturated solutions of THF-water hydrate system were experimentally studied before and during crystallization, to examine the system's behavior in the metastable zone and observe any anomalies suggesting cluster formation. Nucleation induction time measurements, with and without additives, were performed to screen potential growth inhibitors. Shifts in the onset points of crystallization for water and THF-water mixtures with additives were measured using differential scanning calorimetry (DSC). Aspartame was among one of the few successfully screened inhibitors. Preliminary on-line crystal size distribution (CSD) measurements were performed on this system to monitor the crystal size during crystallization. The CSD data was also used to compute the hydrate crystal growth rates, which were found to be in the order of 145 μm/h.
DOE Office of Scientific and Technical Information (OSTI.GOV)
DiMattia,M.; Govindasamy, L.; Levy, H.
2005-01-01
Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Angstroms resolution using synchrotron radiation and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c =more » 629.7 Angstroms. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less
Brownian Dynamics of Colloidal Particles in Lyotropic Chromonic Liquid Crystals
NASA Astrophysics Data System (ADS)
Martinez, Angel; Collings, Peter J.; Yodh, Arjun G.
We employ video microscopy to study the Brownian dynamics of colloidal particles in the nematic phase of lyotropic chromonic liquid crystals (LCLCs). These LCLCs (in this case, DSCG) are water soluble, and their nematic phases are characterized by an unusually large elastic anisotropy. Our preliminary measurements of particle mean-square displacement for polystyrene colloidal particles (~5 micron-diameter) show diffusive and sub-diffusive behaviors moving parallel and perpendicular to the nematic director, respectively. In order to understand these motions, we are developing models that incorporate the relaxation of elastic distortions of the surrounding nematic field. Further experiments to confirm these preliminary results and to determine the origin of these deviations compared to simple diffusion theory are ongoing; our results will also be compared to previous diffusion experiments in nematic liquid crystals. We gratefully acknowledge financial support through NSF DMR12-05463, MRSEC DMR11-20901, and NASA NNX08AO0G.
Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel
2014-09-01
TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.
Ji, Chao-Neng; Cai, Zai-Long; Cao, Gen-Tao; Yin, Gang; Jiao, Bing-Hua; Jiang, Tao; Shu, Guang; Mao, Ji-Fang; Xie, Yi; Mao, Yu-Min
2002-12-01
Human augmenter of liver regeneration has been expressed in Escherichia coli, purified and crystallized. The crystals belong to space group C222, with unit-cell parameters a=51.7 A, b=78.8 A, c=63.7 A. Diffraction data were collected to 2.80 A with a completeness of 99.9% (99.9% for the last shell), a R(sym) value of 0.092(0.236) and an I/sigma(I) value of 6.2(2.7).
Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.
2006-10-01
The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccasemore » structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hou, Jing; Li, Ming; Chen, Jiashu
Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gourinath, S., E-mail: sgourinath@mail.jnu.ac.in; Padhan, Narendra; Alam, Neelima
2005-04-01
Calcium-binding protein-2 (EhCaBP2) crystals were grown using MPD as a precipitant. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. Calcium plays a pivotal role in the pathogenesis of amoebiasis, a major disease caused by Entamoeba histolytica. Two domains with four canonical EF-hand-containing calcium-binding proteins (CaBPs) have been identified from E. histolytica. Even though they have very high sequence similarity, these bind to different target proteins in a Ca{sup 2+}-dependent manner, leading to different functional pathways. Calcium-binding protein-2 (EhCaBP2) crystals were grown usingmore » MPD as a precipitant. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 111.74, b = 68.83, c = 113.25 Å, β = 116.7°. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 69.18, b = 112.03, c = 93.42 Å, β = 92.8°. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. This complex was crystallized with MPD and ethanol as precipitating agents. These crystals belong to space group P2{sub 1}, with unit-cell parameters a = 60.5, b = 69.86, c = 86.5 Å, β = 97.9°.« less
Crystallization and preliminary X-ray diffraction analysis of West Nile virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.
2010-05-25
West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Gufeng; Departments of Molecular and Cell Biology, School of Life Sciences, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026; Huang, Qingqiu
2005-01-01
The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. Crystals of agkicetin-C suitable for structure determination were obtained from 1.8 M ammonium sulfate, 40 mM MES pH 6.5 with 2%(v/v) PEG 400. Interestingly, low buffer concentrations of MES seem to be necessary for crystal growth. The crystals of agkicetin-C belong tomore » space group C2, with unit-cell parameters a = 177.5, b = 97.7, c = 106.8 Å, β = 118.5°, and diffract to 2.4 Å resolution. Solution of the phase problem by the molecular-replacement method shows that there are four agkicetin-C molecules in the asymmetric unit, with a V{sub M} value of 3.4 Å{sup 3} Da{sup −1}, which corresponds to a high solvent content of approximately 64%. Self-rotation function calculations show a single well defined non-crystallographic twofold axis with features that may represent additional elements of non-crystallographic symmetry.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walanj, Rupa; Young, Paul; Baker, Heather M.
2005-04-01
APH(2′′)-Ib is an enzyme responsible for high-level gentamicin resistance in E. faecium isolates. Native crystals of this enzyme have been prepared and preliminary X-ray diffraction experiments have been undertaken. Bacterial resistance to the aminoglycoside antibiotics is primarily the result of deactivation of the drugs. Three families of enzymes are responsible for this activity, with one such family being the aminoglycoside phosphotransferases (APHs). The gene encoding one of these enzymes, APH(2′′)-Ib, has been cloned and the protein (comprising 299 amino-acid residues) expressed in Escherichia coli, purified and crystallized in the presence of 16%(w/v) PEG 3350 and gentamicin. The crystals belong tomore » the monoclinic space group P2{sub 1}, with approximate unit-cell parameters a = 79.7, b = 58.8, c = 81.4 Å, β = 98.4°, and preliminary X-ray diffraction analysis is consistent with the presence of two molecules in the asymmetric unit. Synchrotron diffraction data to approximately 2.65 Å resolution were collected from a native APH(2′′)-Ib crystal at beamline BL9-2 at SSRL (Stanford, CA, USA). Selenium-substituted crystals have also been produced and structure determination is proceeding.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yanfeng; Gao, Xiaoli; Qin, Lin
2010-12-01
Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and can cause neuroparalytic disease botulism. Due to the limitations of production and manipulation of holoenzymes, expressing non-toxic heavy chain receptor binding domains (HCR) has become a common strategy for vaccine and antibody development. Meanwhile, large quantities and highly purified soluble proteins are required for research areas such as antibody maturation and structural biology. We present high level expression and purification of the BoNT serotype D HCR in E. coli using a codon-optimized cDNA. By varying expression conditions, especially at low temperature, the protein was expressed at a high level withmore » high solubility. About 150-200 mg protein was purified to >90% purity from 1 L cell culture. The recombinant D_HCR was crystallized and the crystals diffracted to 1.65 Å resolution. The crystals belong to space group P212121 with unit cell dimensions a = 60.8 Å, b = 89.7 Å, c = 93.9 Å. Preliminary crystallographic data analysis revealed one molecule in asymmetric unit.« less
NASA Astrophysics Data System (ADS)
Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.
2015-11-01
HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.
NASA Technical Reports Server (NTRS)
Snell, Edward; vanderWoerd, Mark
2003-01-01
Thermally imaging the cryocooling processes of crystals has been demonstrated showing the progression of a cold wave through a crystal from the face closest to the origin of the coldstream ending at the point furthest away. During these studies large volume crystals were clearly distinguished from the loop holding them. Large volume crystals, used for neutron studies, were chosen deliberately to enhance the imaging. The different infrared transmission and reflectance properties of the crystal in comparison to the cryo-protectant are thought to be the parameter that produces the contrast making the crystal visible. As an application of the technology to locating crystals, more small crystals of lysozyme and a bFGF/dna complex were cryo-protected and imaged in large loops. The crystals were clearly distinguished from the vitrified solution. In the case of the bFGF/dna complex the illumination had to be carefully manipulated to enable the crystal to be seen in the visible spectrum. These preliminary results will be presented along with advantages and disadvantages of the technique and a discussion of how it might be applied.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mastrangelo, Eloise; Bollati, Michela; Milani, Mario
2006-08-01
Two methyltransferases from flaviviruses (Meaban and Yokose viruses) have been overexpressed and crystallized. Diffraction data and characterization of the two crystal forms are presented, together with a preliminary molecular-replacement solution for both enzymes. Viral methyltranferases (MTase) are involved in the third step of the mRNA-capping process, transferring a methyl group from S-adenosyl-l-methionine (SAM) to the capped mRNA. MTases are classified into two groups: (guanine-N7)-methyltransferases (N7MTases), which add a methyl group onto the N7 atom of guanine, and (nucleoside-2′-O-)-methyltransferases (2′OMTases), which add a methyl group to a ribose hydroxyl. The MTases of two flaviviruses, Meaban and Yokose viruses, have been overexpressed,more » purified and crystallized in complex with SAM. Characterization of the crystals together with details of preliminary X-ray diffraction data collection (at 2.8 and 2.7 Å resolution, respectively) are reported here. The sequence homology relative to Dengue virus 2′OMTase and the structural conservation of specific residues in the putative active sites suggest that both enzymes belong to the 2′OMTase subgroup.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Olchowy, Jaroslaw; Jedrzejczak, Robert; Milewski, Slawomir
2005-11-01
The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to spacemore » group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers.« less
Boer, D. Roeland; Müller, Axel; Fetzner, Susanne; Lowe, David J.; Romão, Maria João
2005-01-01
Isoquinoline 1-oxidoreductase (IOR) from Brevundimonas diminuta is a mononuclear molybdoenzyme of the xanthine-dehydrogenase family of proteins and catalyzes the conversion of isoquinoline to isoquinoline-1-one. Its primary sequence and behaviour, specifically in its substrate specificity and lipophilicity, differ from other members of the family. A crystal structure of the enzyme is expected to provide an explanation for these differences. This paper describes the crystallization and preliminary X-ray diffraction experiments as well as an optimized purification protocol for IOR. Crystallization of IOR was achieved using two different crystallization buffers. Streak-seeding and cross-linking were essential to obtain well diffracting crystals. Suitable cryo-conditions were found and a structure solution was obtained by molecular replacement. However, phases need to be improved in order to obtain a more interpretable electron-density map. PMID:16508115
Characteristics of a promising new thermoelectric material - Ruthenium silicide
NASA Technical Reports Server (NTRS)
Ohta, Toshitaka; Vining, Cronin B.; Allevato, Camillo E.
1991-01-01
A preliminary study on arc-melted samples has indicated that ruthenium silicide has the potential to obtain figure-of-merit values four times higher than that of conventional silicon-germanium material. In order to realize the high figure-of-merit values, high-quality crystal from the melt is needed. A Bridgman-like method has been employed and has realized much better crystals than arc-melted ones.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harris, Paul T.; Raghunathan, Kannan; Spurbeck, Rachel R.
2010-09-02
Recombinant Lactobacillus jensenii enolase fused to a C-terminal noncleavable His tag was expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 3.25 {angstrom} resolution. The crystals belonged to space group I4, with unit-cell parameters a = b = 145.31, c = 99.79 {angstrom}. There were two protein subunits in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.8 {angstrom}{sup 3} Da{sup -1}, corresponding to 55.2% solvent content.
New crystal forms of Diocleinae lectins in the presence of different dimannosides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moreno, Frederico Bruno Mendes Batista; Bezerra, Gustavo Arruda; Oliveira, Taianá Maia de
2006-11-01
The crystallization and preliminary X-ray data of Canavalia gladiata lectin (CGL) and C. maritima lectin (CML) complexed with Man(α1-2)Man(α1)OMe, Man(α1-3)Man(α1)OMe and Man(α1-4)Man(α1)OMe in two crystal forms [the complexes with Man(α1-3)Man(α1)OMe and Man(α1-4)Man(α1)OMe crystallized in space group P3{sub 2} and those with Man(α1-2)Man(α1)OMe crystallized in space group I222], which differed from those of the native proteins (P2{sub 1}2{sub 1}2 for CML and C222 for CGL), are reported. Studying the interactions between lectins and sugars is important in order to explain the differences observed in the biological activities presented by the highly similar proteins of the Diocleinae subtribe. Here, the crystallization andmore » preliminary X-ray data of Canavalia gladiata lectin (CGL) and C. maritima lectin (CML) complexed with Man(α1-2)Man(α1)OMe, Man(α1-3)Man(α1)OMe and Man(α1-4)Man(α1)OMe in two crystal forms [the complexes with Man(α1-3)Man(α1)OMe and Man(α1-4)Man(α1)OMe crystallized in space group P3{sub 2} and those with Man(α1-2)Man(α1)OMe crystallized in space group I222], which differed from those of the native proteins (P2{sub 1}2{sub 1}2 for CML and C222 for CGL), are reported. The crystal complexes of ConA-like lectins with Man(α1-4)Man(α1)OMe are reported here for the first time.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chandra, P. Manish; Brannigan, James A., E-mail: jab@ysbl.york.ac.uk; Prabhune, Asmita
The production, crystallization and characterization of three inactive mutants of penicillin V acylase from B. sphaericus in their respective precursor and processed forms are reported. The space groups are different for the native enzyme and the mutants. The crystallization of three catalytically inactive mutants of penicillin V acylase (PVA) from Bacillus sphaericus in precursor and processed forms is reported. The mutant proteins crystallize in different primitive monoclinic space groups that are distinct from the crystal forms for the native enzyme. Directed mutants and clone constructs were designed to study the post-translational autoproteolytic processing of PVA. The catalytically inactive mutants willmore » provide three-dimensional structures of precursor PVA forms, plus open a route to the study of enzyme–substrate complexes for this industrially important enzyme.« less
A preliminary neutron crystallographic study of thaumatin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Teixeira, Susana C. M.; Institut Laue Langevin, 6 Rue Jules Horowitz, 38042 Grenoble; EPSAM and ISTM, Keele University, Staffordshire ST5 5BG
2008-05-01
Preliminary neutron crystallographic data from the sweet protein thaumatin have been recorded using the LADI-III diffractometer at the Institut Laue Langevin (ILL). The results illustrate the feasibility of a full neutron structural analysis aimed at further understanding the molecular basis of the perception of sweet taste. Such an analysis will exploit the use of perdeuterated thaumatin. A preliminary neutron crystallographic study of the sweet protein thaumatin is presented. Large hydrogenated crystals were prepared in deuterated crystallization buffer using the gel-acupuncture method. Data were collected to a resolution of 2 Å on the LADI-III diffractometer at the Institut Laue Langevin (ILL).more » The results demonstrate the feasibility of a full neutron crystallographic analysis of this structure aimed at providing relevant information on the location of H atoms, the distribution of charge on the protein surface and localized water in the structure. This information will be of interest for understanding the specificity of thaumatin–receptor interactions and will contribute to further understanding of the molecular mechanisms underlying the perception of taste.« less
Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N
1993-12-20
gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.
Schieferstein, Jeremy M.; Pawate, Ashtamurthy S.; Wan, Frank; Sheraden, Paige N.; Broecker, Jana; Ernst, Oliver P.; Gennis, Robert B.
2017-01-01
Elucidating and clarifying the function of membrane proteins ultimately requires atomic resolution structures as determined most commonly by X-ray crystallography. Many high impact membrane protein structures have resulted from advanced techniques such as in meso crystallization that present technical difficulties for the set-up and scale-out of high-throughput crystallization experiments. In prior work, we designed a novel, low-throughput X-ray transparent microfluidic device that automated the mixing of protein and lipid by diffusion for in meso crystallization trials. Here, we report X-ray transparent microfluidic devices for high-throughput crystallization screening and optimization that overcome the limitations of scale and demonstrate their application to the crystallization of several membrane proteins. Two complementary chips are presented: (1) a high-throughput screening chip to test 192 crystallization conditions in parallel using as little as 8 nl of membrane protein per well and (2) a crystallization optimization chip to rapidly optimize preliminary crystallization hits through fine-gradient re-screening. We screened three membrane proteins for new in meso crystallization conditions, identifying several preliminary hits that we tested for X-ray diffraction quality. Further, we identified and optimized the crystallization condition for a photosynthetic reaction center mutant and solved its structure to a resolution of 3.5 Å. PMID:28469762
Preliminary Evaluation of Altitude Scaling for Turbofan Engine Ice Crystal Icing
NASA Technical Reports Server (NTRS)
Tsao, Jen-Ching
2017-01-01
Preliminary evaluation of altitude scaling for turbofan engine ice crystal icing simulation was conducted during the 2015 LF11 engine icing test campaign in PSL.The results showed that a simplified approach for altitude scaling to simulate the key reference engine ice growth feature and associated icing effects to the engine is possible. But special considerations are needed to address the facility operation limitation for lower altitude engine icing simulation.
Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony; Dattagupta, Jiban K.; Sen, Udayaditya
2006-01-01
A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P41, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, were found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V M value. PMID:16511326
Linear and nonlinear properties of photonic crystal fibers filled with nematic liquid crystals
NASA Astrophysics Data System (ADS)
Brzdąkiewicz, K. A.; Laudyn, U. A.; Karpierz, M. A.; Woliński, T. R.; Wójcik, J.
2006-12-01
We investigate linear and nonlinear light propagation in the photonic crystal fibers infiltrated with nematic liquid crystals. Such a photonic structure, with periodic modulation of refractive index, which could be additionally controlled by the temperature and by the optical power, allows for the study of discrete optical phenomena. Our theoretical investigations, carried out with the near infrared wavelength of 830 nm, for both focusing and defocusing Kerr-type nonlinearity, show the possibility of the transverse light localization, which can result in the discrete soliton generation. In addition, we present the preliminary experimental results on the linear light propagation in the photonic crystal fiber with the glycerin-water solution and 6CHBT nematics, as the guest materials.
Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N
2009-08-01
Haemoglobin is a prototypical allosteric protein that is mainly involved in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs in an intrinsically coordinated manner to maintain the viability of cells. Haemoglobin from Camelus dromedarius provides an interesting case study of adaptation to life in deserts at extremely high temperatures. An ambition to unravel the integrated structural and functional aspects of the casual survival of this animal at high temperatures led us to specifically work on this problem. The present work reports the preliminary crystallographic study of camel haemoglobin. Camel blood was collected and the haemoglobin was purified by anion-exchange chromatography and crystallized using the hanging-drop vapour-diffusion method under buffered high salt concentration using PEG 3350 as a precipitant. Intensity data were collected using a MAR 345 dtb image-plate detector system. Camel haemoglobin crystallized in the monoclinic space group P2(1), with one whole biological molecule (alpha(2)beta(2)) in the asymmetric unit and unit-cell parameters a = 52.759, b = 116.782, c = 52.807 A, beta = 120.07 degrees .
New Directions in Biotechnology
NASA Technical Reports Server (NTRS)
2003-01-01
The macromolecule crystallization program within NASA is undergoing considerable pressure, particularly budgetary pressure. While it has shown some successes, they have not lived up to the expectations of others, and technological advances may rapidly overtake the natural advantages offered by crystallization in microgravity. Concomitant with the microgravity effort has been a research program to study the macromolecule crystallization process. It was believed that a better understanding of the process would lead to growth of improved crystals for X-ray diffraction studies. The results of the various research efforts have been impressive in improving our understanding of macromolecule crystallization, but have not led to any improved structures. Macromolecule crystallization for structure determination is "one of", the job being unique for every protein and finished once a structure is obtained. However, the knowledge gained is not lost, but instead lays the foundation for developments in new areas of biotechnology and nanotechnology. In this it is highly analogous to studies into small molecule crystallization, the results of which have led to our present day microelectronics-based society. We are conducting preliminary experiments into areas such as designed macromolecule crystals, macromolecule-inorganic hybrid structures, and macromolecule-based nanotechnology. In addition, our protein crystallization studies are now being directed more towards industrial and new approaches to membrane protein crystallization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rathinaswamy, Priya; Pundle, Archana V.; Prabhune, Asmita A.
An unannotated protein reported from B. subtilis has been expressed in E. coli and identified as possessing penicillin V acylase activity. The crystallization and preliminary crystallographic analysis of this penicillin V acylase is presented. Penicillin acylase proteins are amidohydrolase enzymes that cleave penicillins at the amide bond connecting the side chain to their β-lactam nucleus. An unannotated protein from Bacillus subtilis has been expressed in Escherichia coli, purified and confirmed to possess penicillin V acylase activity. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 4 M sodium formate in 100 mM Tris–HCl buffer pH 8.2.more » Diffraction data were collected under cryogenic conditions to a spacing of 2.5 Å. The crystals belonged to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 111.0, b = 308.0, c = 56.0 Å. The estimated Matthews coefficient was 3.23 Å{sup 3} Da{sup −1}, corresponding to 62% solvent content. The structure has been solved using molecular-replacement methods with B. sphaericus penicillin V acylase (PDB code 2pva) as the search model.« less
High-Temperature Controlled Redox Crystallization Studies
NASA Technical Reports Server (NTRS)
Williams, R. J.
1985-01-01
The crystallization of silicates containing redox sensitive ions (e.g., Fe, Ti, Ce) must be performed under controlled and known redox conditions in order to obtain the maximum scientific benefit from experimental study. Furthermore, many compositions crystallize dense phases which settle during ground-based experiments. This settling influences the texture and chemical evolution of the crystallizing system. The purpose of this investigation is to develop a test system in which controlled redox experiments can be performed in the microgravity environment. The system will use solid ceramic oxygen electrolyte cells for control, measurements, and production of the required redox conditions. A preliminary design for a prototype is developed, the electrolyte and furnace tested, and a tentative protocol for experiment developed. The control parameter is to be established and a laboratory prototype built.
NASA Technical Reports Server (NTRS)
Kelton, K. F.; Croat, T. K.; Gangopadhyay, A.; Holland-Moritz, D.; Hyers, Robert W.; Rathz, Thomas J.; Robinson, Michael B.; Rogers, Jan R.
2001-01-01
Undercooling experiments and thermal physical property measurements of metallic alloys on the International Space Station (ISS) are planned. This recently-funded research focuses on fundamental issues of the formation and structure of highly-ordered non-crystallographic phases (quasicrystals) and related crystal phases (crystal approximants), and the connections between the atomic structures of these phases and those of liquids and glasses. It extends studies made previously by us of the composition dependence of crystal nucleation processes in silicate and metallic glasses, to the case of nucleation from the liquid phase. Motivating results from rf-levitation and drop-tube measurements of the undercooling of Ti/Zr-based liquids that form quasicrystals and crystal approximants are discussed. Preliminary measurements by electrostatic levitation (ESL) are presented.
NASA Technical Reports Server (NTRS)
Lal, R. B.
1992-01-01
Preliminary evaluation of the data was made during the hologram processing procedure. A few representative holograms were selected and reconstructed in the HGS; photographs of sample particle images were made to illustrate the resolution of all three particle sizes. Based on these evaluations slight modifications were requested in the hologram processing procedure to optimize the hologram exposure in the vicinity of the crystal. Preliminary looks at the data showed that we are able to see and track all three sizes of particles throughout the chamber. Because of the vast amount of data available in the holograms, it was recommended that we produce a detailed data reduction plan with prioritization on the different types of data which can be extracted from the holograms.
A preliminary design study for a cosmic X-ray spectrometer
NASA Technical Reports Server (NTRS)
1972-01-01
The results are described of theoretical and experimental investigations aimed at the development of a curved crystal cosmic X-ray spectrometer to be used at the focal plane of the large orbiting X-ray telescope on the third High Energy Astronomical Observatory. The effort was concentrated on the development of spectrometer concepts and their evaluation by theoretical analysis, computer simulation, and laboratory testing with breadboard arrangements of crystals and detectors. In addition, a computer-controlled facility for precision testing and evaluation of crystals in air and vacuum was constructed. A summary of research objectives and results is included.
NASA Technical Reports Server (NTRS)
Feigelson, R. S. (Editor)
1986-01-01
Papers are presented on mechanisms of nucleation and growth of protein crystals, the role of purification in the crystallization of proteins and nucleic acids, and the effect of chemical impurities in polyethylene glycol on macromolecular crystallization. Also considered are growth kinetics of tetragonal lysozyme crystals, thermodynamic and kinetic considerations for crystal growth of complex molecules from solution, protein single-crystal growth under microgravity, and growth of organic crystals in a microgravity environment. Papers are also presented on preliminary investigations of protein crystal growth using the Space Shuttle, convective diffusion in protein crystal growth, and the growth and characterization of membrane protein crystals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cupp-Vickery, Jill R., E-mail: jvickery@uci.edu; Igarashi, Robert Y.; Meyer, Christopher R.
2005-03-01
Crystallization and X-ray diffraction methods for native A. tumefaciens ADP-glucose pyrophosphorylase and its selenomethionyl derivative are described. Two crystal forms are identified, both of which diffract to 2 Å.
Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy
2014-10-01
Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.
Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy
2014-01-01
Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abramchik, Yu. A., E-mail: inna@ns.crys.ras.ru; Timofeev, V. I., E-mail: espiov@ibch.ru; Zhukhlistova, N. E., E-mail: tostars@mail.ru
2015-07-15
Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamermore » is the biological active form of E. coli. purine nucleoside phosphorylase.« less
Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta
2011-02-01
Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Budayova-Spano, Monika, E-mail: spano@embl-grenoble.fr; Institut Laue-Langevin, 6 Rue Jules Horowitz, BP 156, 38042 Grenoble; Bonneté, Françoise
2006-03-01
Neutron diffraction data of hydrogenated recombinant urate oxidase enzyme (Rasburicase), complexed with a purine-type inhibitor 8-azaxanthin, was collected to 2.1 Å resolution from a crystal grown in D{sub 2}O by careful control and optimization of crystallization conditions via knowledge of the phase diagram. Deuterium atoms were clearly seen in the neutron-scattering density map. Crystallization and preliminary neutron diffraction measurements of rasburicase, a recombinant urate oxidase enzyme expressed by a genetically modified Saccharomyces cerevisiae strain, complexed with a purine-type inhibitor (8-azaxanthin) are reported. Neutron Laue diffraction data were collected to 2.1 Å resolution using the LADI instrument from a crystal (grownmore » in D{sub 2}O) with volume 1.8 mm{sup 3}. The aim of this neutron diffraction study is to determine the protonation states of the inhibitor and residues within the active site. This will lead to improved comprehension of the enzymatic mechanism of this important enzyme, which is used as a protein drug to reduce toxic uric acid accumulation during chemotherapy. This paper illustrates the high quality of the neutron diffraction data collected, which are suitable for high-resolution structural analysis. In comparison with other neutron protein crystallography studies to date in which a hydrogenated protein has been used, the volume of the crystal was relatively small and yet the data still extend to high resolution. Furthermore, urate oxidase has one of the largest primitive unit-cell volumes (space group I222, unit-cell parameters a = 80, b = 96, c = 106 Å) and molecular weights (135 kDa for the homotetramer) so far successfully studied with neutrons.« less
Olivine Weathering: Abiotic Versus Biotic Processes as Possible Biosignatures
NASA Technical Reports Server (NTRS)
Longazo, T. G.; Wentworth, S. J.; McKay, D. S.; Southam, G.; Clemett, S. J.
2001-01-01
A preliminary study to determine how abiotic versus biotic processes affect the weathering of olivine crystals. Perhaps the differences between these weathering processes could be used as biosignatures. Additional information is contained in the original extended abstract.
The Nucleation and Growth of Protein Crystals
NASA Technical Reports Server (NTRS)
Pusey, Marc
2004-01-01
Obtaining crystals of suitable size and high quality continues to be a major bottleneck in macromolecular crystallography. Currently, structural genomics efforts are achieving on average about a 10% success rate in going from purified protein to a deposited crystal structure. Growth of crystals in microgravity was proposed as a means of overcoming size and quality problems, which subsequently led to a major NASA effort in microgravity crystal growth, with the agency also funding research into understanding the process. Studies of the macromolecule crystal nucleation and growth process were carried out in a number of labs in an effort to understand what affected the resultant crystal quality on Earth, and how microgravity improved the process. Based upon experimental evidence, as well as simple starting assumptions, we have proposed that crystal nucleation occurs by a series of discrete self assembly steps, which 'set' the underlying crystal symmetry. This talk will review the model developed, and its origins, in our laboratory for how crystals nucleate and grow, and will then present, along with preliminary data, how we propose to use this model to improve the success rate for obtaining crystals from a given protein.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kawano, Shin; Yasutake, Yoshiaki; Tajima, Kenji
2005-02-01
The cellulose biosynthesis-related protein CMCax from A. xylinum has been purified and crystallized. The crystals of CMCax belong to the primitive hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 89.1, c = 94.2 Å.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta, Vibha; Gupta, Rakesh K.; Ram Lal Anand College, University of Delhi, Benito Juarez Road, New Delhi 110021
2008-05-01
The cloning, purification and crystallization of a bacterioferritin from M. tuberculosis together with preliminary X-ray characterization of its crystals are reported. Bacterioferritins (Bfrs) comprise a subfamily of the ferritin superfamily of proteins that play an important role in bacterial iron storage and homeostasis. Bacterioferritins differ from ferritins in that they have additional noncovalently bound haem groups. To assess the physiological role of this subfamily of ferritins, a greater understanding of the structural details of bacterioferritins from various sources is required. The gene encoding bacterioferritin A (BfrA) from Mycobacterium tuberculosis was cloned and expressed in Escherichia coli. The recombinant protein productmore » was purified by affinity chromatography on a Strep-Tactin column and crystallized with sodium chloride as a precipitant at pH 8.0 using the vapour-diffusion technique. The crystals diffracted to 2.1 Å resolution and belonged to space group P4{sub 2}, with unit-cell parameters a = 123.0, b = 123.0, c = 174.6 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano
The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less
Zhang, Youshang; Whittingham, Jean L; Turkenburg, Johan P; Dodson, Eleanor J; Brange, Jens; Dodson, G Guy
2002-01-01
Insulin naturally aggregates as dimers and hexamers, whose structures have been extensively analysed by X-ray crystallography. Structural determination of the physiologically relevant insulin monomer, however, is an unusual challenge owing to the difficulty in finding solution conditions in which the concentration of insulin is high enough for crystallization yet the molecule remains monomeric. By utilizing solution conditions known to inhibit insulin assembly, namely 20% acetic acid, crystals of insulin in the monomeric state have been obtained. The crystals are strongly diffracting and a data set extending to 1.6 A has recently been collected. The crystals nominally belong to the space group I422, with unit-cell parameters a = b = 57.80, c = 54.61 A, giving rise to one molecule in the asymmetric unit. Preliminary electron-density maps show that whilst most of the insulin monomer is well ordered and similar in conformation to other insulin structures, parts of the B-chain C-terminus main chain adopt more than one conformation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grujic, Ognjen; Grigg, Michael E.; Boulanger, Martin J., E-mail: mboulang@uvic.ca
2008-05-01
Preliminary X-ray diffraction studies of the bradyzoite-specific surface antigen BSR4 from T. gondii are described. Toxoplasma gondii is an important global pathogen that infects nearly one third of the world’s adult population. A family of developmentally expressed structurally related surface-glycoprotein adhesins (SRSs) mediate attachment to and are utilized for entry into host cells. The latent bradyzoite form of T. gondii persists for the life of the host and expresses a distinct family of SRS proteins, of which the bradyzoite-specific antigen BSR4 is a prototypical member. Structural studies of BSR4 were initiated by first recombinantly expressing BSR4 in insect cells, whichmore » was followed by crystallization and preliminary X-ray data collection to 1.95 Å resolution. Data processing showed that BSR4 crystallized with one molecule in the asymmetric unit of the P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2 space group, with a solvent content of 60% and a corresponding Matthews coefficient of 2.98 Å{sup 3} Da{sup −1}.« less
Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro
2007-02-01
D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.
NASA Technical Reports Server (NTRS)
Weimer, D.; Howes, W. L.
1984-01-01
Barium titanate single crystals are discussed in the context of: the procedure for polarizing a crystal; a test for phase conjugation; transients in the production of phase conjugation; real time readout by a separate laser of a hologram induced within the crystal, including conjugation response times to on-off switching of each beam; and a demonstration of a Twyman-Green interferometer utilizing phase conjugation.
Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A
2014-02-01
Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.
2007-07-01
P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan
2006-06-01
Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.
Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less
NASA Astrophysics Data System (ADS)
Sugahara, Mitsuaki; Sekino-Suzuki, Naoko; Ohno-Iwashita, Yoshiko; Miki, Kunio
1996-10-01
θ-Toxin (perfringolysin O), a cholesterol-binding, pore-forming cytolysin of Clostridium perfringens type A was crystallized by the vapor diffusion procedure using polyethyleneglycol 4000 and sodium chloride as precipitants in 2-(cyclohexylamino)ethanesulfonic acid (CHES) buffer at pH 9.5. The diffraction patterns of precession photographs indicated that the crystals belong to the orthorhombic system and the space group C222 1 with unit-cell dimensions of a = 47.7 Å, b = 182.0 Å and c = 175.8 Å. Assuming that the asymmetric unit contains one or two molecules (Mw 52 700), the Vm value is calculated as 3.6 or 1.8 Å 3/dalton, respectively. The crystals diffract X-rays to at least 3 Å resolution and are suitable for high resolution X-ray crystal structure determination.
NASA Astrophysics Data System (ADS)
Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.
2016-11-01
Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.
Pietrzyk, Agnieszka J; Bujacz, Anna; Łochyńska, Małgorzata; Jaskólski, Mariusz; Bujacz, Grzegorz
2011-03-01
Juvenile hormone-binding protein (JHBP) and the low-molecular-mass lipoprotein PBMHP-12 belong to a group of 30 kDa proteins that comprise the major protein component of the haemolymph specific to the fifth-instar larvae stage of the mulberry silkworm Bombyx mori L. Proteins from this group are often essential for the development of the insect. In a project aimed at crystallographic characterization of B. mori JHBP (BmJHBP), it was copurified together with PBMHP-12. Eventually, the two proteins were isolated and crystallized separately. The BmJHBP crystals were orthorhombic (space group C222(1)) and the PBMHP-12 crystals were triclinic. The crystals diffracted X-rays to 2.9 Å (BmJHBP) and 1.3 Å (PBMHP-12) resolution.
Investigation of terbium in the ferroelectric crystal, gadolinium molybdate, as a potential laser
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crouch, J.E.
A preliminary non-stimulated study of the laser host combination Gd(2 - x)Tb(x)(MoO4)3 is made. The host material, gadolinium molybdate (GMO), is a ferroelectric/ferroelastic crystal. An investigation of temperature and external electric field affects on the absorption and fluorescence of the crystal did not produce any unusual results. The terbium ion, Tb(3+), peak cross section in GMO for the 5D sub 4 to 7F sub 5 transition is 10 x 10 to the minus twenty first power sq. cm. at 300K. The wavelength of this four level laser transition is 543 nm. (GRA)
Maximizing Macromolecule Crystal Size for Neutron Diffraction Experiments
NASA Technical Reports Server (NTRS)
Judge, R. A.; Kephart, R.; Leardi, R.; Myles, D. A.; Snell, E. H.; vanderWoerd, M.; Curreri, Peter A. (Technical Monitor)
2002-01-01
A challenge in neutron diffraction experiments is growing large (greater than 1 cu mm) macromolecule crystals. In taking up this challenge we have used statistical experiment design techniques to quickly identify crystallization conditions under which the largest crystals grow. These techniques provide the maximum information for minimal experimental effort, allowing optimal screening of crystallization variables in a simple experimental matrix, using the minimum amount of sample. Analysis of the results quickly tells the investigator what conditions are the most important for the crystallization. These can then be used to maximize the crystallization results in terms of reducing crystal numbers and providing large crystals of suitable habit. We have used these techniques to grow large crystals of Glucose isomerase. Glucose isomerase is an industrial enzyme used extensively in the food industry for the conversion of glucose to fructose. The aim of this study is the elucidation of the enzymatic mechanism at the molecular level. The accurate determination of hydrogen positions, which is critical for this, is a requirement that neutron diffraction is uniquely suited for. Preliminary neutron diffraction experiments with these crystals conducted at the Institute Laue-Langevin (Grenoble, France) reveal diffraction to beyond 2.5 angstrom. Macromolecular crystal growth is a process involving many parameters, and statistical experimental design is naturally suited to this field. These techniques are sample independent and provide an experimental strategy to maximize crystal volume and habit for neutron diffraction studies.
Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude
2010-12-01
This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.
NASA Astrophysics Data System (ADS)
Drobychev, Gleb Yu.; Borisevich, Andrei E.; Korjik, Mikhail V.; Lecoq, Paul; Moroz, Valeri I.; Peigneux, Jean-Pierre
2002-06-01
The distribution of about 5000 mass-produced PWO crystals by their light yield and radiation hardness is analysed. The correlation between results of radiation hardness measurements at low and saturating dose rates is refined. A method for the evaluation of the energy resolution of the electromagnetic calorimeter accounting for a distribution of individual PWO crystal characteristics is proposed. A preliminary analysis of the PWO crystal recovery kinetics is also performed.
Singh, D D; Saikrishnan, K; Kumar, Prashant; Dauter, Z; Sekar, K; Surolia, A; Vijayan, M
2004-11-01
The banana lectin from Musa paradisiaca, MW 29.4 kDa, has been isolated, purified and crystallized. The trigonal crystals contain one dimeric molecule in the asymmetric unit. The structure has been solved using molecular replacement to a resolution of 3 A. The structure of the subunit is similar to that of jacalin-like lectins.
Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio
2010-12-01
Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.
Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio
2010-01-01
Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta, Pankaj; Gaur, Vineet; Salunke, Dinakar M., E-mail: dinakar@nii.res.in
2008-08-01
A 2S albumin from L. culinaris was purified and crystallized and preliminary crystallographic studies were carried out. Lens culinaris (lentil) is a widely consumed high-protein-content leguminous crop. A 2S albumin protein (26.5 kDa) has been identified using NH{sub 2}-terminal sequencing from a 90% ammonium sulfate saturation fraction of total L. culinaris seed protein extract. The NH{sub 2}-terminal sequence shows very high homology to PA2, an allergy-related protein from Pisum sativum. The 2S albumin protein was purified using a combination of size-exclusion and ion-exchange chromatography. Crystals of the 2S seed albumin obtained using the hanging-drop vapour-diffusion method diffracted to 2.5 Åmore » resolution and were indexed in space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 78.6, c = 135.2 Å.« less
Single Crystal Synthesis and STM Studies of High Temperature Superconductors
NASA Technical Reports Server (NTRS)
Barrientos, Alfonso
1997-01-01
This is a final report for the work initiated in September of 1994 under the grant NAG8-1085 - NASA/OMU, on the fabrication of bulk and single crystal synthesis, specific heat measuring and STM studies of high temperature superconductors. Efforts were made to fabricate bulk and single crystals of mercury based superconducting material. A systematic thermal analysis on the precursors for the corresponding oxides and carbonates were carried out to synthesized bulk samples. Bulk material was used as seed in an attempt to grow single crystals by a two-step self flux process. On the other hand bulk samples were characterized by x-ray diffraction, electrical resistivity and magnetic susceptibility, We studied the specific heat behavior in the range from 80 to 300 K. Some preliminary attempts were made to study the atomic morphology of our samples. As part of our efforts we built an ac susceptibility apparatus for measuring the transition temperature of our sintered samples.
Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro
2007-01-01
d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-psicose has not been reported with epimerases other than P. cichorii D-TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456
Zhang, Liang; Chen, Ruyi; Dong, Zhe; Li, Xin
2013-01-01
Organophosphates (OPs) are extremely toxic compounds that are used as insecticides or even as chemical warfare agents. Phosphotriesterases (PHPs) are responsible for the detoxification of OPs by catalysing their degradation. Almost 100 PHP structures have been solved to date, yet the crystal structure of the phosphotriesterase from Mycobacterium tuberculosis (mPHP) remains unavailable. This study reports the first crystallization of mPHP. The crystal belonged to space group C222(1), with unit-cell parameters a = 68.03, b = 149.60, c = 74.23 Å, α = β = γ = 90°. An analytical ultracentrifugation experiment suggested that mPHP exists as a dimer in solution, even though one molecule is calculated to be present in the asymmetric unit according to the structural data.
Zhang, Liang; Chen, Ruyi; Dong, Zhe; Li, Xin
2013-01-01
Organophosphates (OPs) are extremely toxic compounds that are used as insecticides or even as chemical warfare agents. Phosphotriesterases (PHPs) are responsible for the detoxification of OPs by catalysing their degradation. Almost 100 PHP structures have been solved to date, yet the crystal structure of the phosphotriesterase from Mycobacterium tuberculosis (mPHP) remains unavailable. This study reports the first crystallization of mPHP. The crystal belonged to space group C2221, with unit-cell parameters a = 68.03, b = 149.60, c = 74.23 Å, α = β = γ = 90°. An analytical ultracentrifugation experiment suggested that mPHP exists as a dimer in solution, even though one molecule is calculated to be present in the asymmetric unit according to the structural data. PMID:23295488
Simulation Studies of the X-Ray Free-Electron Laser Oscillator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lindberg, R. R.; Shyd'ko, Y.; Kim, K.-J
Simulations of the x-ray free-electron laser (FEL) oscillator are presented that include transverse effects and realistic Bragg crystal properties with the two-dimensional code GINGER. In the present cases considered the radiation divergence is much narrower than the crystal acceptance, and the numerical algorithm can be simplified by ignoring the finite angular bandwidth of the crystal. In this regime GINGER shows that the saturated x-ray pulses have 109 photons and are nearly Fourier-limited with peak powers in excess of 1 MW. Wealso include preliminary results for a four-mirror cavity that can be tuned in wavelength over a few percent, with futuremore » plans to incorporate the full transverse response of the Bragg crystals into GINGER to more accurately model this tunable source.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX
2006-10-01
Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less
Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki
2006-01-01
Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489
Verma, Anil Kumar; Goyal, Arun; Freire, Filipe; Bule, Pedro; Venditto, Immacolata; Brás, Joana L. A.; Santos, Helena; Cardoso, Vânia; Bonifácio, Cecília; Thompson, Andrew; Romão, Maria João; Prates, José A. M.; Ferreira, Luís M. A.; Fontes, Carlos M. G. A.; Najmudin, Shabir
2013-01-01
The modular carbohydrate-active enzyme belonging to glycoside hydrolase family 30 (GH30) from Clostridium thermocellum (CtXynGH30) is a cellulosomal protein which plays an important role in plant cell-wall degradation. The full-length CtXynGH30 contains an N-terminal catalytic module (Xyn30A) followed by a family 6 carbohydrate-binding module (CBM6) and a dockerin at the C-terminus. The recombinant protein has a molecular mass of 45 kDa. Preliminary structural characterization was carried out on Xyn30A crystallized in different conditions. All tested crystals belonged to space group P1 with one molecule in the asymmetric unit. Molecular replacement has been used to solve the Xyn30A structure. PMID:24316849
NASA Technical Reports Server (NTRS)
Flegel, Ashlie B.; Oliver, Michael J.
2016-01-01
Preliminary results from the Heavily Instrumented ALF503R-5 Engine test conducted in the NASA Glenn Research Center Propulsion Systems Laboratory will be discussed. The effects of ice crystal icing on a full scale engine is examined and documented. This model engine, serial number LF01, was used during the inaugural icing test in the PSL facility. The reduction of thrust (rollback) events experienced by this engine in flight were replicated in the facility. Limited instrumentation was used to detect icing. Metal temperature on the exit guide vanes and outer shroud and the load measurement were the only indicators of ice formation. The current study features a similar engine, serial number LF11, which is instrumented to characterize the cloud entering the engine, detect characterize ice accretion, and visualize the ice accretion in the region of interest.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya
2007-11-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi
2006-12-01
UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyazawa, Masayuki; Kitadokoro, Kengo; Kamitani, Shigeki
2006-09-01
The C-terminal catalytic domain of P. multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. The C-terminal catalytic domain of Pasteurella multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. Native diffraction data to 1.9 Å resolution were obtained at the BL44XU beamline of SPring-8 from a flash-frozen crystal at 100 K. The crystals belong to space group C2, with unit-cell parameters a = 111.0, b = 150.4,more » c = 77.1 Å, β = 105.5°, and are likely to contain one C-PMT (726 residues) per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.
2016-11-15
Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko
2007-10-01
Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less
NASA Astrophysics Data System (ADS)
Heger, Michal; Mordon, Serge R.; Leroy, Gérard; Fleurisse, Laurence; Creusy, Collette
2006-03-01
Laser-assisted cartilage reshaping (LACR) is a relatively novel technique designed to noninvasively and permanently restructure cartilaginous tissue. It is believed that heat-induced stress relaxation, in which a temperature-mediated disruption of H2O binding is associated with conformational alterations in the proteoglycan and collagen-rich matrix, constitutes the underlying mechanism of LACR. Several reports have suggested that laser-mediated cartilage mineralization may contribute to the permanent shape change of laser-reshaped cartilage. In an effort to validate these results in the context of Er:glass LACR, we performed a preliminary Raman microspectrometric study to characterize the crystal deposits in laser-irradiated chondrocytes and extracellular matrix. For the first time, we identified intracellular calcium sulfate deposits and extracellular calcium phosphate (apatite) crystals in laser-reshaped rabbit auricular cartilage. Calcium carbonate deposits are localized in both irradiated and nonirradiated samples, suggesting that this mineral plays no role in conformational retention. In our discussion, we elaborate on the possible molecular and cellular mechanisms responsible for intra- and extracellular crystallization, and propose a novel hypothesis on the formation of apatite, inasmuch as the biological function of this mineral (providing structure and rigidity in bones and dental enamel) may be extrapolated to the permanent shape change of laser-irradiated cartilage.
Ishak, Siti Nor Hasmah; Aris, Sayangku Nor Ariati Mohamad; Halim, Khairul Bariyyah Abd; Ali, Mohd Shukuri Mohamad; Leow, Thean Chor; Kamarudin, Nor Hafizah Ahmad; Masomian, Malihe; Rahman, Raja Noor Zaliha Raja Abd
2017-09-25
Less sedimentation and convection in a microgravity environment has become a well-suited condition for growing high quality protein crystals. Thermostable T1 lipase derived from bacterium Geobacillus zalihae has been crystallized using the counter diffusion method under space and earth conditions. Preliminary study using YASARA molecular modeling structure program for both structures showed differences in number of hydrogen bond, ionic interaction, and conformation. The space-grown crystal structure contains more hydrogen bonds as compared with the earth-grown crystal structure. A molecular dynamics simulation study was used to provide insight on the fluctuations and conformational changes of both T1 lipase structures. The analysis of root mean square deviation (RMSD), radius of gyration, and root mean square fluctuation (RMSF) showed that space-grown structure is more stable than the earth-grown structure. Space-structure also showed more hydrogen bonds and ion interactions compared to the earth-grown structure. Further analysis also revealed that the space-grown structure has long-lived interactions, hence it is considered as the more stable structure. This study provides the conformational dynamics of T1 lipase crystal structure grown in space and earth condition.
Matsuno, Asuka; Gai, Zuoqi; Tanaka, Miyuki; Kato, Koji; Kato, Sanae; Katoh, Tsuyoshi; Shimizu, Takeshi; Yoshioka, Takeya; Kishimura, Hideki; Tanaka, Yoshikazu; Yao, Min
2015-06-01
Many molluscs transport oxygen using a very large cylindrical multimeric copper-containing protein named hemocyanin. The molluscan hemocyanin forms a decamer (cephalopods) or multidecamer (gastropods) of approximately 330-450kDa subunits, resulting in a molecular mass >3.3MDa. Therefore, molluscan hemocyanin is one of the largest proteins. The reason why these organisms use such a large supermolecule for oxygen transport remains unclear. Atomic-resolution X-ray crystallographic analysis is necessary to unveil the detailed molecular structure of this mysterious large molecule. However, its propensity to dissociate in solution has hampered the crystallization of its intact form. In the present study, we successfully obtained the first crystals of an intact decameric molluscan hemocyanin. The diffraction dataset at 3.0-Å resolution was collected by merging the datasets of two isomorphic crystals. Electron microscopy analysis of the dissolved crystals revealed cylindrical particles. Furthermore, self-rotation function analysis clearly showed the presence of a fivefold symmetry with several twofold symmetries perpendicular to the fivefold axis. The absorption spectrum of the crystals showed an absorption peak around 345nm. These results indicated that the crystals contain intact hemocyanin decamers in the oxygen-bound form. Copyright © 2015 Elsevier Inc. All rights reserved.
Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jens, Jason; Raghunathan, Kannan; Vago, Frank
2010-01-12
EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.
Dal Palù, Alessandro; Dovier, Agostino; Pontelli, Enrico
2010-01-01
Crystal lattices are discrete models of the three-dimensional space that have been effectively employed to facilitate the task of determining proteins' natural conformation. This paper investigates alternative global constraints that can be introduced in a constraint solver over discrete crystal lattices. The objective is to enhance the efficiency of lattice solvers in dealing with the construction of approximate solutions of the protein structure determination problem. Some of them (e.g., self-avoiding-walk) have been explicitly or implicitly already used in previous approaches, while others (e.g., the density constraint) are new. The intrinsic complexities of all of them are studied and preliminary experimental results are discussed.
Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.
2005-01-01
This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108
Dimasi, Nazzareno; Moretta, Lorenzo; Biassoni, Roberto; Mariuzza, Roy A
2003-10-01
p75/AIRM1 (Siglec-7) is a sialic acid-binding Ig-like lectin recently identified as an inhibitory receptor on natural killer cells. The expression, in vitro folding, circular-dichroism spectroscopy, crystallization and preliminary X-ray characterization of the Ig-V like domain of p75/AIRM1 are reported. X-ray data were collected from a single crystal at 100 K, with a maximum useful diffraction pattern extending to 1.45 A resolution on a synchrotron source. The crystal belongs to a primitive monoclinic space group, with unit-cell parameters a = 32.65, b = 49.72, c = 39.79 A, alpha = gamma = 90, beta = 113 degrees. The systematic absences indicate that the space group is P2(1). Assuming one molecule per asymmetric unit, V(M) (the Matthews coefficient) was calculated to be 1.879 A(3) Da(-1) and the solvent content was estimated to be 32.01%.
Protein crystal growth in low gravity
NASA Technical Reports Server (NTRS)
Feigelson, Robert S.
1993-01-01
This Final Technical Report for NASA Grant NAG8-774 covers the period from April 27, 1989 through December 31, 1992. It covers five main topics: fluid flow studies, the influence of growth conditions on the morphology of isocitrate lyase crystals, control of nucleation, the growth of lysozyme by the temperature gradient method and graphoepitaxy of protein crystals. The section on fluid flow discusses the limits of detectability in the Schlieren imaging of fluid flows around protein crystals. The isocitrate lyase study compares crystals grown terrestrially under a variety of conditions with those grown in space. The controlling factor governing the morphology of the crystals is the supersaturation. The lack of flow in the interface between the drop and the atmosphere in microgravity causes protein precipitation in the boundary layer and a lowering of the supersaturation in the drop. This lowered supersaturation leads to improved crystal morphology. Preliminary experiments with lysozyme indicated that localized temperature gradients could be used to nucleate crystals in a controlled manner. An apparatus (thermonucleator) was designed to study the controlled nucleation of protein crystals. This apparatus has been used to nucleate crystals of materials with both normal (ice-water, Rochelle salt and lysozyme) and retrograde (horse serum albumin and alpha chymotrypsinogen A) solubility. These studies have lead to the design of an new apparatus that small and more compatible with use in microgravity. Lysozyme crystals were grown by transporting nutrient from a source (lysozyme powder) to the crystal in a temperature gradient. The influence of path length and cross section on the growth rate was demonstrated. This technique can be combined with the thermonucleator to control both nucleation and growth. Graphoepitaxy utilizes a patterned substrate to orient growing crystals. In this study, silicon substrates with 10 micron grooves were used to grow crystals of catalase, lysozyme and canavalin. In all cases, the crystals grew oriented to the substrate. The supersaturation needed for nucleation and growth was lower on the patterned substrates. In some cases, isolated, large crystals were grown.
Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G
2013-08-01
Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schoepe, Jan, E-mail: jschoepe@smail.uni-koeln.de; Niefind, Karsten; Chatterjee, Shivani
2006-07-01
The crystallization and preliminary X-ray characterization of a shikimate dehydrogenase from C. glutamicum is presented. The shikimate dehydrogenase from Corynebacterium glutamicum has been cloned into an Escherichia coli expression vector, overexpressed and purified. Native crystals were obtained by the vapour-diffusion technique using 2-methyl-2,4-pentanediol as a precipitant. The crystals belong to the centred monoclinic space group C2, with unit-cell parameters a = 118.77, b = 63.17, c = 35.67 Å, β = 92.26° (at 100 K), and diffract to 1.64 Å on a synchrotron X-ray source. The asymmetric unit is likely to contain one molecule, corresponding to a packing density ofmore » 2.08 Å{sup 3} Da{sup −1} and a solvent content of about 41%.« less
Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui
2013-01-01
(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567
Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui
2013-10-01
(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.
NASA Astrophysics Data System (ADS)
Wiggins, Brenden; Tupitsyn, Eugene; Bhattacharya, Pijush; Rowe, Emmanuel; Lukosi, Eric; Chvala, Ondrej; Burger, Arnold; Stowe, Ashley
2013-09-01
Impurity analysis and compositional distribution studies have been conducted on a crystal of LiInSe2, a compound semiconductor which recently has been shown to respond to ionizing radiation. IR microscopy and laser induced breakdown spectroscopy (LIBS) revealed the presence of inclusions within the crystal lattice. These precipitates were revealed to be alkali and alkaline earth elemental impurities with non-uniform spatial distribution in the crystal. LIBS compositional maps correlate the presence of these impurities with visual color differences in the crystal as well as a significant shift of the band gap. Further, LIBS revealed variation in the ratio of I-III-VI2 elemental constituents throughout the crystal. Analysis of compositional variation and impurities will aid in discerning optimal synthesis and crystal growth parameters to maximize the mobility-lifetime product and charge collection efficiency in the LiInSe2 crystal. Preliminary charge trapping calculations have also been conducted with the Monte Carlo N-particle eXtended (MCNPx) package indicating preferential trapping of holes during irradiation with thermal neutrons.
Jaiswal, Rahul; Singh, Samarendra K; Bastia, Deepak; Escalante, Carlos R
2015-04-01
The Reb1 protein from Schizosaccharomyces pombe is a member of a family of proteins that control programmed replication termination and/or transcription termination in eukaryotic cells. These events occur at naturally occurring replication fork barriers (RFBs), where Reb1 binds to termination (Ter) DNA sites and coordinates the polar arrest of replication forks and transcription approaching in opposite directions. The Reb1 DNA-binding and replication-termination domain was expressed in Escherichia coli, purified and crystallized in complex with a 26-mer DNA Ter site. Batch crystallization under oil was required to produce crystals of good quality for data collection. Crystals grew in space group P2₁, with unit-cell parameters a = 68.9, b = 162.9, c = 71.1 Å, β = 94.7°. The crystals diffracted to a resolution of 3.0 Å. The crystals were mosaic and required two or three cycles of annealing. This study is the first to yield structural information about this important family of proteins and will provide insights into the mechanism of replication and transcription termination.
Tsutsumi, Shunichirou; Iida, Motoo; Tada, Norio; Kojima, Takashi; Ikeda, Yukihiro; Moriwaki, Toshiya; Higashi, Kenjirou; Moribe, Kunikazu; Yamamoto, Keiji
2011-12-15
Miconazole salts and cocrystals were studied to improve the physicochemical properties of miconazole. Maleate, hemifumarate, and hemisuccinate were prepared and characterized by powder X-ray diffractometry, differential scanning calorimetry, and single crystal X-ray diffractometry. The intrinsic dissolution rate and stability of each miconazole crystal form were compared to those of freebase and nitrate to evaluate the optimal crystal form. Crystal structure analysis indicated that maleate was a salt formed by proton transfer from the acid to the imidazole group of miconazole. Hemifumarate and hemisuccinate were determined to be cocrystals formed by hydrogen bonding between the acids and the base in their crystal lattices. Intrinsic dissolution tests showed that the formation of salts and cocrystals improved the dissolution rate of miconazole. Stability tests of preliminary formulations prepared with each crystal form indicated that maleate and hemifumarate were unstable at 80°C and generated a specific degraded product, i.e., a Michael adduct, between miconazole and the acids. Hemisuccinate had a superior intrinsic dissolution rate and stability, and is thus considered a promising crystal form of miconazole. Copyright © 2011 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Qin, E-mail: yang@crystal.harvard.edu; Brüschweiler, Sven; Chou, James J., E-mail: yang@crystal.harvard.edu
2013-12-24
The N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1 was crystallized in the presence of Ca{sup 2+}. X-ray diffraction data were collected to 2.9 Å resolution from crystals which belonged to space group P6{sub 2}22.
NASA Astrophysics Data System (ADS)
Nishimaru, Momoko; Nakasa, Miku; Kudo, Shoji; Takiyama, Hiroshi
2017-07-01
Crystallization operation of cocrystal production has deposition risk of undesired crystals. Simultaneously, continuous manufacturing processes are focused on. In this study, conditions for continuous cocrystallization considering risk reduction of undesired crystals deposition were investigated on the view point of thermodynamics and kinetics. The anti-solvent cocrystallization was carried out in four-component system of carbamazepine, saccharin, methanol and water. From the preliminary batch experiment, the relationships among undesired crystal deposition, solution composition decided by mixing ratio of solutions, and residence time for the crystals were considered, and then the conditions of continuous experiment were decided. Under these conditions, the continuous experiment was carried out. The XRD patterns of obtained crystals in the continuous experiment showed that desired cocrystals were obtained without undesired crystals. This experimental result was evaluated by using multi-component phase diagrams from the view point of the operation point's movement. From the evaluation, it was found that there is a certain operation condition which the operation point is fixed with time in the specific domain without the deposition risk of undesired single component crystals. It means the possibility of continuous production of cocrystals without deposition risk of undesired crystals was confirmed by using multi-component phase diagrams.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.
2007-10-01
S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding themore » catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Egerer-Sieber, Claudia; Herl, Vanessa; Müller-Uri, Frieder
2006-03-01
Progesterone 5β-reductase is the first stereospecific enzyme in the pathway for the synthesis of cardenolides. To elucidate the structural mechanism of this reaction, we crystallized the selenomethionine-labelled enzyme from D. lanata and report the preliminary analysis of a MAD data set collected from these crystals. Progesterone 5β-reductase (5β-POR) catalyzes the reduction of progesterone to 5β-pregnane-3,20-dione and is the first stereospecific enzyme in the putative biosynthetic pathway of Digitalis cardenolides. Selenomethionine-derivatized 5β-POR from D. lanata was successfully overproduced and crystallized. The crystals belong to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 71.73, c = 186.64 Å. A MADmore » data set collected at 2.7 Å resolution allowed the identification of six out of eight possible Se-atom positions. A first inspection of the MAD-phased electron-density map shows that 5β-POR is a Rossmann-type reductase and the quality of the map is such that it is anticipated that a complete atomic model of 5β-POR will readily be built.« less
Shi, Dashuang; Caldovic, Ljubica; Jin, Zhongmin; Yu, Xiaolin; Qu, Qiuhao; Roth, Lauren; Morizono, Hiroki; Hathout, Yetrib; Allewell, Norma M.; Tuchman, Mendel
2006-01-01
A novel N-acetylglutamate synthase/kinase bifunctional enzyme of arginine biosynthesis that was homologous to vertebrate N-acetylglutamate synthases was identified in Xanthomonas campestris. The protein was overexpressed, purified and crystallized. The crystals belong to the hexagonal space group P6222, with unit-cell parameters a = b = 134.60, c = 192.11 Å, and diffract to about 3.0 Å resolution. Selenomethionine-substituted recombinant protein was produced and selenomethionine substitution was verified by mass spectroscopy. Multiple anomalous dispersion (MAD) data were collected at three wavelengths at SER-CAT, Advanced Photon Source, Argonne National Laboratory. Structure determination is under way using the MAD phasing method. PMID:17142901
Crystallization and preliminary X-ray analysis of eukaryotic initiation factor 4E from Pisum sativum
Ashby, Jamie A.; Stevenson, Clare E. M.; Maule, Andrew J.; Lawson, David M.
2009-01-01
Crystals of an N-terminally truncated 20 kDa fragment of Pisum sativum eIF4E (ΔN-eIF4E) were grown by vapour diffusion. X-ray data were recorded to a resolution of 2.2 Å from a single crystal in-house. Indexing was consistent with primitive monoclinic symmetry and solvent-content estimations suggested that between four and nine copies of the eIF4E fragment were possible per crystallographic asymmetric unit. eIF4E is an essential component of the eukaryotic translation machinery and recent studies have shown that point mutations of plant eIF4Es can confer resistance to potyvirus infection. PMID:19652353
Im, Dong-Won; Kim, Tae-O; Jung, Ha Yun; Oh, Ji Eun; Lee, Se Jin; Heo, Yong-Seok
2012-01-01
Primase is the enzyme that synthesizes RNA primers on single-stranded DNA during normal DNA replication. In this study, the catalytic core domain of primase from Streptococcus mutans UA159 was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 1.60 Å resolution using a synchrotron-radiation source. The crystal belonged to space group P41 or P43, with unit-cell parameters a = b = 52.63, c = 110.31 Å. The asymmetric unit is likely to contain one molecule, with a corresponding V M of 1.77 Å3 Da−1 and a solvent content of 30.7%. PMID:22232183
DOE Office of Scientific and Technical Information (OSTI.GOV)
Raghunathan, Kannan; Vago, Frank S.; Ball, Terry
2010-01-12
EpsH is a minor pseudopilin protein of the Vibrio cholerae type II secretion system. A truncated form of EpsH with a C-terminal noncleavable His tag was constructed and expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 1.71 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.39, b = 71.11, c = 84.64 {angstrom}. There were two protein molecules in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.1 {angstrom}{sup 3} Da{sup -1}, corresponding to 41.5% solvent content.
Gavel, Olga Yu.; Kladova, Anna V.; Bursakov, Sergey A.; Dias, João M.; Texeira, Susana; Shnyrov, Valery L.; Moura, José J. G.; Moura, Isabel; Romão, Maria J.; Trincão, José
2008-01-01
Native zinc/cobalt-containing ATP sulfurylase (ATPS; EC 2.7.7.4; MgATP:sulfate adenylyltransferase) from Desulfovibrio desulfuricans ATCC 27774 was purified to homogeneity and crystallized. The orthorhombic crystals diffracted to beyond 2.5 Å resolution and the X-ray data collected should allow the determination of the structure of the zinc-bound form of this ATPS. Although previous biochemical studies of this protein indicated the presence of a homotrimer in solution, a dimer was found in the asymmetric unit. Elucidation of this structure will permit a better understanding of the role of the metal in the activity and stability of this family of enzymes. PMID:18607083
Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG
Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis
2009-01-01
EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 Å and belonged to space group P21, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 Å. PMID:19478449
NASA Technical Reports Server (NTRS)
Shearer, Charles K.; Bell, Aaron S.; Burger, Paul V.; Papike, James J.; Jones, John; Le, Loan
2016-01-01
Angrites represent some of the earliest stages of planetesimal differentiation. Not surprisingly, there is no simple petrogenetic model for their origin. Petrogenesis has been linked to both magmatic and impact processes. Studies demonstrated that melting of chondritic material (e.g. CM, CV) at redox conditions where pure iron metal is unstable (e.g., IW+1 to IW+2) produced angrite-like melts. Alternatively, angrites were produced at more reducing conditions (
Green Fluorescent Protein as a Model for Protein Crystal Growth Studies
NASA Technical Reports Server (NTRS)
Agena, Sabine; Smith, Lori; Karr, Laurel; Pusey, Marc
1998-01-01
Green fluorescent protein (GFP) from jellyfish Aequorea Victoria has become a popular marker for e.g. mutagenesis work. Its fluorescent property, which originates from a chromophore located in the center of the molecule, makes it widely applicable as a research too]. GFP clones have been produced with a variety of spectral properties, such as blue and yellow emitting species. The protein is a single chain of molecular weight 27 kDa and its structure has been determined at 1.9 Angstrom resolution. The combination of GFP's fluorescent property, the knowledge of its several crystallization conditions, and its increasing use in biophysical and biochemical studies, all led us to consider it as a model material for macromolecular crystal growth studies. Initial preparations of GFP were from E.coli with yields of approximately 5 mg/L of culture media. Current yields are now in the 50 - 120 mg/L range, and we hope to further increase this by expression of the GFP gene in the Pichia system. The results of these efforts and of preliminary crystal growth studies will be presented.
Preliminary market analysis for large zeolite crystals. B.S. Thesis
NASA Technical Reports Server (NTRS)
Doblmaier, Thomas; Grafing, Paul; Knight, Kim
1987-01-01
Zeolite crystals are used in the manufacture of countless products today, which utilize their properties of absorption, ion exchange, and catalysis. It was determined that zeolites grown in space could be much larger in size than any of those currently available on Earth. The objective was to identify and examine some of the potential uses for these larger crystals. Of the several industries examined, the medical and nuclear industries offer the greatest potential.
Astigmatic Herriott cell for optical refrigeration
NASA Astrophysics Data System (ADS)
Gragossian, Aram; Meng, Junwei; Ghasemkhani, Mohammadreza; Albrecht, Alexander R.; Sheik-Bahae, Mansoor
2017-01-01
Cooling rare-earth-doped crystals to the lowest temperature possible requires enhanced resonant absorption and high-purity crystals. Since resonant absorption decreases as the crystal is cooled, the only path forward is to increase the number of roundtrips that the laser makes inside the crystal. To achieve even lower temperatures than previously reported, we have employed an astigmatic Herriott cell to improve laser absorption at low temperatures. Preliminary results indicate improvement over previous designs. This cavity potentially enables us to use unpolarized high-power fiber lasers, and to achieve much higher cooling power for practical applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fox, K. M.; Johnson, F. C.
Increased loading of high level waste in glass can lead to crystallization within the glass. Some crystalline species, such as spinel, have no practical impact on the chemical durability of the glass, and therefore may be acceptable from both a processing and a product performance standpoint. In order to operate a melter with a controlled amount of crystallization, options must be developed for remediating an unacceptable accumulation of crystals. This report describes preliminary experiments designed to evaluate the ability to dissolve spinel crystals in simulated waste glass melts via the addition of glass forming chemicals (GFCs).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Struble, E. B., E-mail: evi.struble@nist.gov; Department of Biochemistry and Molecular Biology, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD 21205; Center for Advanced Research in Biotechnology/NIST, 9600 Gudelsky Drive, Rockville, MD 20850
2007-06-01
Crystallization and preliminary diffraction data of the N-terminal 19–139 fragment of the origin-binding domain of bacteriophage λ O replication initiator are reported. The bacteriophage λ O protein binds to the λ replication origin (oriλ) and serves as the primary replication initiator for the viral genome. The binding energy derived from the binding of O to oriλ is thought to help drive DNA opening to facilitate initiation of DNA replication. Detailed understanding of this process is severely limited by the lack of high-resolution structures of O protein or of any lambdoid phage-encoded paralogs either with or without DNA. The production ofmore » crystals of the origin-binding domain of λ O that diffract to 2.5 Å is reported. Anomalous dispersion methods will be used to solve this structure.« less
Crystallization and preliminary X-ray analysis of Leishmania major glyoxalase I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ariza, Antonio; Vickers, Tim J.; Greig, Neil
2005-08-01
The detoxification enzyme glyoxalase I from L. major has been crystallized. Preliminary molecular-replacement calculations indicate the presence of three glyoxalase I dimers in the asymmetric unit. Glyoxalase I (GLO1) is a putative drug target for trypanosomatids, which are pathogenic protozoa that include the causative agents of leishmaniasis. Significant sequence and functional differences between Leishmania major and human GLO1 suggest that it may make a suitable template for rational inhibitor design. L. major GLO1 was crystallized in two forms: the first is extremely disordered and does not diffract, while the second, an orthorhombic form, produces diffraction to 2.0 Å. Molecular-replacement calculationsmore » indicate that there are three GLO1 dimers in the asymmetric unit, which take up a helical arrangement with their molecular dyads arranged approximately perpendicular to the c axis. Further analysis of these data are under way.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin
2006-02-01
Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br
2006-10-01
Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less
Park, Sun Hee; Piao, Shunfu; Kwon, Hyun-Mi; Kim, Eun-Hye; Lee, Bok Luel; Ha, Nam-Chul
2010-01-01
The Toll signalling pathway, which is crucial for innate immunity, is transduced in insect haemolymph via a proteolytic cascade consisting of three serine proteases. The proteolytic cascade is downregulated by a specific serine protease inhibitor (serpin). Recently, the serpin SPN48 was found to show an unusual specific reactivity towards the terminal serine protease, Spätzle-processing enzyme, in the beetle Tenebrio molitor. In this study, the mature form of SPN48 was overexpressed in Escherichia coli and purified. The purified SPN48 protein was crystallized using 14% polyethylene glycol 8000 and 0.1 M 2-(N-morpholino)ethanesulfonic acid pH 6.0 as the precipitant. The crystals diffracted X-rays to 2.1 Å resolution and were suitable for structure determination. The crystals belonged to space group P21. The crystal structure will provide information regarding how SPN48 achieves its unusual specificity for its target protease. PMID:20124722
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng
2008-01-01
SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less
X-ray diffraction studies of enkephalins. Crystal structure of [(4'-bromo) Phe4,Leu5]enkephalin.
Ishida, T; Kenmotsu, M; Mino, Y; Inoue, M; Fujiwara, T; Tomita, K; Kimura, T; Sakakibara, S
1984-01-01
In order to investigate the structure-activity relationship of [Leu5]- and [Met5]enkephalins, [(4'-bromo)Phe4, Leu5]-, [(4'-bromo)Phe4, Met5]- and [Met5] enkephalins were synthesized and crystallized. The crystal structure of [(4'-bromo) Phe4, Leu5]- enkephalin was determined by X-ray diffraction method using the heavy atom method and refined to R = 0.092 by the least-squares method. The molecule in this crystal took essentially the same type I' beta-turn conformation found in [Leu5]enkephalin [Smith & Griffin (1978) Science 199, 1214-1216). On the other hand, the preliminary three-dimensional Patterson analyses showed that the most probable conformations of [(4'-bromo)Phe4,Met5]- and [Met5]enkephalins are both the dimeric extended forms. Based on these insights, the biologically active conformation of enkephalin was discussed in relation to the mu- and delta-receptors. PMID:6721829
Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi
2009-01-01
RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733
Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi
2009-11-01
RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.
Mikhailov, A M; Smirnova, E A; Tsuprun, V L; Tagunova, I V; Vainshtein, B K; Linkova, E V; Komissarov, A A; Siprashvili, Z Z; Mironov, A S
1992-03-01
Uridine phosphorylase (UPH) from Escherichia coli K-12 has been purified to near homogeneity from a strain harbouring the udp gene, encoding UPH, on a multicopy plasmid. UPH was purified to electrophoretic homogeneity with the specific activity 230 units/mg with a recovery of 80%, yielding 120 mg of enzyme from 3g cells. Crystals of enzyme suitable for X-ray diffraction analysis were obtained in a preparative ultracentrifuge. The packing of the molecules in the crystals may be described by the space group P2(1)2(1)2(1) with the unit cell constants a = 90.4; b = 128.8; c = 136.8 A. There is one molecule per asymmetric unit, Vm = 2.4. These crystals diffract to at least 2.5-2.7 A resolution. The hexameric structure of UPH was directly demonstrated by electron microscopy study and image processing.
Using Magnetic Field Gradients to Simulate Variable Gravity in Fluids and Materials Experiments
NASA Technical Reports Server (NTRS)
Ramachandran, Narayanan
2006-01-01
Fluid flow due to a gravitational field is caused by sedimentation, thermal buoyancy, or solutal buoyancy induced convection. During crystal growth, for example, these flows are undesirable and can lead to crystal imperfections. While crystallization in microgravity can approach diffusion limited growth conditions (no convection), terrestrially strong magnetic fields can be used to control fluid flow and sedimentation effects. In this work, a theory is presented on the stability of solutal convection of a magnetized fluid(weak1y paramagnetic) in the presence of a magnetic field. The requirements for stability are developed and compared to experiments performed within the bore of a superconducting magnet. The theoretical predictions are in good agreement with the experiments. Extension of the technique can also be applied to study artificial gravity requirements for long duration exploration missions. Discussion of this application with preliminary experiments and application of the technique to crystal growth will be provided.
Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla
2009-09-01
Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.
NASA Technical Reports Server (NTRS)
Roeber, Dana; Achari, Aniruddha; Takai, Toshiro; Okumura, Yasushi; Scott, David L.
2003-01-01
Although a number of allergens have been identified and isolated, the underlying molecular basis for the potent immune response is poorly understood. House dust mites (Dermatophagoides sp.) are ubiquitous contributors to atopy in developed countries. The rhinitis, dermatitis and asthma associated with allergic reactions to these arthropods are frequently caused by relatively small (125-129 amino acids) mite proteins of unknown biological function. Der f 2, a major allergen from the mite D. farinae, has been recombinantly expressed, characterized and crystallized. The crystals belong to the tetragonal space group I4(1)22, with unit-cell parameters a = b = 95.2, c = 103.3 A. An essentially complete (97.2%) data set has been collected to 2.4 A at a synchrotron source. Attempts to solve the crystal structure of Der f 2 by molecular replacement using the NMR coordinates for either Der f 2 or Der p 2 (the homologous protein from D. pteronyssinus) failed, but preliminary searches using the crystalline Der p 2 atomic coordinates appear to be promising.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei, E-mail: xlyang@scripps.edu
2006-12-01
Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4{sub 3}2{sub 1}2 or its enantiomorphic space group P4{sub 1}2{sub 1}2, with unit-cell parameters a =more » b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%.« less
Development of a 10 MHz oscillator working with an LGT crystal resonator: preliminary results.
Imbaud, Joël; Galliou, Serge; Romand, Jean Pierre; Abbe, Philippe; Bourquin, Roger
2008-09-01
Presently, to our knowledge, measurement of the noise of langatate (LGT) crystal oscillators has not previously been reported. First results of such a measurement are given in this paper. They have been obtained from 10 MHz resonator prototypes tested with a dedicated electronics. The main steps of the resonator manufacturing are described in this paper. Good quality factors, close to 1.4 10(6), have already been achieved on the 5th overtone of the thickness shear mode of LGT Y cuts, even if the energy trapping should still be optimized. The motional parameters of these resonator prototypes are quite different from those of usual quartz crystal resonators. As a consequence, dedicated sustaining electronics have been designed. The explored options are reported to justify the implemented one. Moreover, the high thermal sensitivity of LGT crystal resonators (parabolic f-T curve) requires that particular attention be paid to the oven thermal stability. This important feature is also pointed out in the paper. The preliminary version of the resulting system exhibits a relative frequency stability of 6 10(-12).
Preliminary Examination of Sahara 99555: Mineralogy and Experimental Studies of a New Angrite
NASA Technical Reports Server (NTRS)
Mikouchi, T.; McKay, G.; Le, L.; Mittlefehldt, D. W.
2000-01-01
A 2710 g meteorite, Sahara 99555 (Sah99), was recently recovered from the Sahara and reported to be the 5th angrite. It is the largest angrite ever found and may offer useful information to better understand the unusual petrogeneses of this rare achondrite group. It may also allow us to examine the chronological record of igneous activity in the very early solar system. We obtained a 2.6 g chip of Sah99 and here present a preliminary report of its petrology and mineralogy in conjunction with a crystallization experiment on an analogue composition.
Protein crystal growth aboard the U.S. Space Shuttle flights STS-31 and STS-32
NASA Technical Reports Server (NTRS)
Delucas, Lawrence J.; Smith, Craig D.; Carter, Daniel C.; Twigg, Pam; He, Xiao-Min; Snyder, Robert S.; Weber, Patricia C.; Schloss, J. V.; Einspahr, H. M.; Clancy, L. L.
1992-01-01
Results obtained from the Shuttle flight STS-32 flown in January 1990, and preliminary results from the most recent Shuttle flight, STS-31, flown in April 1990, are presented. Crystals grown in microgravity environment include Canavalin, isocitrate lyase, human serum albumin, and Anti-HPr Fab. It is concluded that about 20 percent of proteins flown exhibit better morphologies or better quality data than their earth-grown counterparts. About 40 percent do not yield crystals at all and the remaining 40 percent yield crystals that are either too small for X-ray analysis or produce data of poorer quality than the best earth-grown crystals.
NASA Technical Reports Server (NTRS)
Miller, T. L.
1984-01-01
Calculations were performed with computer models using three types of finite difference methods of thermosolutal convection: horizontal heating of a container filled with a stably stratified solution, finger convection in a container, and finger convection in a horizontally infinite channel. The importance of including thermosolutal convection in models of crystal growth is emphasized, and the difficulties in doing so are demonstrated. It is pointed out that these difficulties, due primarily to the fine structure of the convection, may be partly overcome by the use of fine grids and implicit time stepping methods.
Purification, Crystallization, and Preliminary X-ray Analysis of Native Canavalin
NASA Technical Reports Server (NTRS)
Pusey, Marc; Dowell, Jennifer; Ng, Joseph; Gavira, Jose A.
2003-01-01
The protein canavalin is a 7S vicilin, from the Jack Bean, Canavalis ensfomis. Canavalin is described as a seed storage protein, an energy source for a developing seed, as no other known activity or function has been found. The protein was first isolated and crystallized by Sumner and Howell (J. Biol. Chem. 113, 607-610, 1936). Canavalin spontaneously crystallizes after proteolytic cleavage at neutral pH, which removes residues 1-46, 224-245, and 325-330 and produces peptides of approximately 25, 13, and 12 kDa. Preliminary gel filtration experiments indicated the presence of nucleic acid with the uncleaved protein. We developed a dual column procedure, ion exchange followed by hydroxy apatite chromatography, that effectively removes the nucleic acid and yields an essentially pure uncut canavalin preparation with an OD 280/260 ratio of approximately 1.9-2.0. Standard crystallization screens using this material gave a number of positive results having a common requirement for alcohols and Mg(2+) ion, with crystals typically appearing within a day or less. Optimization experiments to date have shown that we can obtain crystals from pH 6.5 to pH 8.2, using MPD from 5 to 20% and 0.05 to 0.2M Mg(2+) (sulfate or acetate). The crystals are of space group P2(sub 1)2(sub 1)2(sub 1), unit cell dimensions, and a complete data set to 1.5 Angstroms, resolution has now been collected at a synchrotron source. Most importantly, the crystals are not twinned, a persistent problem with the most commonly obtained rhombohedral form of proteolytically cleaved canavalin.
Dewetting During the Crystal Growth of (Cd,Zn)Te:In Under Microgravity
NASA Astrophysics Data System (ADS)
Sylla, Lamine; Fauler, Alex; Fiederle, Michael; Duffar, Thierry; Dieguez, Ernesto; Zanotti, Lucio; Zappettini, Andrea; Roosen, GÉrald
2009-08-01
The phenomenon of ldquodewettingrdquo associated with the Vertical Bridgman (VB) crystal growth technique leads to the growth of a crystal without contact with the crucible. One dramatic consequence of this modified VB process is the reduction of structural defects within the crystal. It has been observed in several microgravity experiments for different semiconductor crystals. This work is concentrated on the growth of high resistivity (Cd,Zn)Te:In (CZT) crystals by achieving the phenomenon of dewetting under microgravity condition and its application in the processing of CZT detectors. Two Cd0.9Zn0.1Te:In crystals were grown in space on the Russian FOTON satellite in the POLIZON-M facility in September 2007 (mission M3). At the end of the preliminary melting phase of one crystal, a Rotating Magnetic Field (RMF) was applied in order to reduce the typical tellurium clusters within the melt before the pulling. The other crystal was superheated with 20 K above the melting point before the pulling. A third reference crystal has been grown on the ground in similar thermal conditions. Profiles measurements of the space grown crystals surface gave the evidence of a successful dewetting during the crystal growth. Characterization methods such as IR microscopy and CoReMa have been performed on the three crystals. CZT detectors have been processed from the grown part of the different crystals. The influence of the dewetting on the material quality and the detector properties completes the study.
Formation of co-crystals: Kinetic and thermodynamic aspects
NASA Astrophysics Data System (ADS)
Gagnière, E.; Mangin, D.; Puel, F.; Rivoire, A.; Monnier, O.; Garcia, E.; Klein, J. P.
2009-04-01
Co-crystallisation is a recent method of great interest for the pharmaceutical industry, since pharmaceutical co-crystals represent useful materials for drug products. In this study, an active pharmaceutical ingredient (carbamazepine (CBZ)) co-crystallized with a vitamin (nicotinamide (NCT)) was chosen as a model substance. This work was focused on the construction of a phase diagram for the system CBZ/NCT, split in six domains for kinetic reasons (the different solid phases which might appear during the crystallisation) and in four domains according to thermodynamic aspects (the stable final phase obtained). Although co-crystals are not ionic compounds, the supersaturation of co-crystals can be evaluated by considering the solubility product. Batch crystallisation operations were carried out in a stirred vessel equipped with an in situ video probe. This latter device was a powerful analysis tool to monitor the CBZ/NCT co-crystals and single CBZ crystals since these two crystalline phases grown in ethanol exhibited needle and platelet habits. As concerns kinetics, the different solid phases which might appear during the experiments were observed and competed against each others. In accordance with thermodynamics, the stable solid form was obtained at the end of the operation. Finally some preliminary results indicate that the nucleation of co-crystals may be favoured by the presence of CBZ crystals. Epitaxial relationships between CBZ/NCT co-crystals and CBZ crystals were suspected.
Preliminary pharmacognostic screening of Achyranthes coynei stem.
Upadhya, Vinayak; Ankad, Gireesh M; Pai, Sandeep R; Hegde, Shruti V; Hegde, Harsha V
2015-01-01
Achyranthes coynei is a rare, endemic perennial shrub reported from Karnataka and Maharashtra states of India. The plant is used to treat various disorders by folk healers and was proven to have antimicrobial and antioxidant properties. The present study was undertaken to evaluate microscopic and macroscopic characters of A. coynei stem, along with its physicochemical parameters. ProgRes(®) CapturePro and Microsoft Excel were used for statistical analysis. Perennial, shrubby nature and woody stem were the distinguishing morphological characters observed. Transverse section (TS) illustrated quadrangular outline of the stem and showed the presence of two types of trichomes on the thick-walled epidermis. TS also showed number of rosette calcium oxalates crystals; prismatic and microsphenoid crystals; conjoint, collateral open secondary vascular bundles; and two amphixylic medullary bundles in the pith. Ash and extractive values, micro and macro elements and nutritive factors were estimated in the present study. The presence of alkaloids, saponins and triterpenoids were observed in preliminary phytochemical screening. High-performance thin layer chromatographic analysis yielded different bands and also indicated the presence of oleanolic acid. The studied parameters for A. coynei stem will be useful for identification and authentication of the plant material.
Detergent-Specific Membrane Protein Crystallization Screens
NASA Technical Reports Server (NTRS)
Wiener, Michael
2007-01-01
A suite of reagents has been developed for three-dimensional crystallization of integral membranes present in solution as protein-detergent complexes (PDCs). The compositions of these reagents have been determined in part by proximity to the phase boundaries (lower consolute boundaries) of the detergents present in the PDCs. The acquisition of some of the requisite phase-boundary data and the preliminary design of several of the detergent- specific screens was supported by a NASA contract. At the time of expiration of the contract, a partial set of preliminary screens had been developed. This work has since been extended under non-NASA sponsorship, leading to near completion of a set of 20 to 30 different and unique detergent- specific 96-condition screens.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui
2007-06-01
The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less
Thermal oxidation of single-crystal silicon carbide - Kinetic, electrical, and chemical studies
NASA Technical Reports Server (NTRS)
Petit, J. B.; Neudeck, P. G.; Matus, L. G.; Powell, J. A.
1992-01-01
This paper presents kinetic data from oxidation studies of the polar faces for 3C and 6H SiC in wet and dry oxidizing ambients. Values for the linear and parabolic rate constants were obtained, as well as preliminary results for the activation energies of the rate constants. Examples are presented describing how thermal oxidation can be used to map polytypes and characterize defects in epitaxial layers grown on low tilt angle 6H SiC substrates. Interface widths were measured using Auger electron spectroscopy (AES) with Ar ion beam depth profiling and variable angle spectroscopic ellipsometry (VASE) with effective medium approximation (EMA) models. Preliminary electrical measurements of MOS capacitors are also presented.
Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho
2008-02-01
6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 A resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 A , and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 A , and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement.
Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho
2008-01-01
6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 Å resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 Å, and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 Å, and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement. PMID:18271114
Kort, Anne-Kathleen; Lorenz, Heike; Seidel-Morgenstern, Andreas
2016-06-01
Thermodynamic and kinetic parameters are of prime importance for designing crystallization processes. In this article, Preferential Crystallization, as a special approach to carry out enantioselective crystallization, is described to resolve the enantiomers of the chiral fungicide fenamidone. In preliminary investigations the melting behavior and solid-liquid equilibria in the presence of solvents were quantified. The analyses revealed a stable solid phase behavior of fenamidone in the applied solvents. Based on the results obtained, a two-step crystallization route was designed and realized capable of providing highly pure enantiomers. An initial Preferential Crystallization of the racemate was performed prior to crystallizing the target enantiomer preferentially out of the enriched mother liquor. Chirality 28:514-520, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi
2010-01-01
The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288
Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi
2010-07-01
The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.
A preliminary study of flat-panel displays
NASA Technical Reports Server (NTRS)
Yancey, K. E.
1986-01-01
Six display technologies that might be of future value in a spacelab workstation are discussed. Some have been developed to the point where they could be used as a computer display while others have not. The display technologies studied are electroluminescents, light-emitting didodes, gas plasma, liquid crystal, electrochromic, and electrophoretic. An explanation of each mechanism is provided along with the state-of-the-art development.
Tylichová, Martina; Briozzo, Pierre; Kopečný, David; Ferrero, Julien; Moréra, Solange; Joly, Nathalie; Snégaroff, Jacques; Šebela, Marek
2008-01-01
Aminoaldehydes are products of polyamine degradation and are known to be reactive metabolites that are toxic to living cells at high concentrations. These compounds are catabolized by aminoaldehyde dehydrogenases, which are enzymes that contain a nicotinamide adenine dinucleotide coenzyme. Aminoaldehyde dehydrogenase from Pisum sativum was overexpressed in Escherichia coli, purified and crystallized using the hanging-drop method. A complete data set was collected to 2.8 Å resolution at 100 K. Crystals belong to the monoclinic space group P21, with unit-cell parameters a = 86.4, b = 216.6, c = 205.4 Å, β = 98.1°. Molecular replacement was performed and led to the identification of six dimers per asymmetric unit. PMID:18259056
Kawai, Akito; Higuchi, Shigesada; Tsunoda, Masaru; Nakamura, Kazuo T.; Miyamoto, Shuichi
2012-01-01
Uracil-DNA glycosylase (UDG) specifically removes uracil from DNA by catalyzing hydrolysis of the N-glycosidic bond, thereby initiating the base-excision repair pathway. Although a number of UDG structures have been determined, the structure of archaeal UDG remains unknown. In this study, a deletion mutant of UDG isolated from Sulfolobus tokodaii strain 7 (stoUDGΔ) and stoUDGΔ complexed with uracil were crystallized and analyzed by X-ray crystallography. The crystals were found to belong to the orthorhombic space group P212121, with unit-cell parameters a = 52.2, b = 52.3, c = 74.7 Å and a = 52.1, b = 52.2, c = 74.1 Å for apo stoUDGΔ and stoUDGΔ complexed with uracil, respectively. PMID:22949205
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, G.J.; Garen, C.R.; Cherney, M.M.
2009-06-03
The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less
Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki
2008-01-01
Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094
Fitzgerald, P M; Duax, W L; Punzi, J S; Orr, J C
1984-05-15
3 alpha, 20 beta-Hydroxysteroid dehydrogenase, an NADH-dependent oxidoreductase isolated from Streptomyces hydrogenans , is a tetramer containing four subunits each of Mr 25,000. The enzyme has been crystallized by the vapor diffusion technique using either phosphate or borate buffered ammonium sulfate (pH between 6.0 and 8.7) as the precipitant. The crystals are hexagonal bipyramids ; they have the symmetry of space group P6(4)22 (or P6(2)22), with unit cell dimensions a = 127.3 A, c = 112.2 A. Volume and density considerations imply that the crystallographic asymmetric unit contains two monomers, and therefore that the tetramer possesses a 2-fold axis of symmetry that is coincident with a crystallographic 2-fold symmetry element.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamasaki, Masayuki; Ogura, Kohei; Moriwaki, Satoko
The crystallization and preliminary characterization of the family PL-7 alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1 are presented. Alginate lyases depolymerize alginate, a heteropolysaccharide consisting of α-l-guluronate and β-d-mannuronate, through a β-elimination reaction. The alginate lyases A1-II (25 kDa) and A1-II′ (25 kDa) from Sphingomonas sp. A1, which belong to polysaccharide lyase family PL-7, exhibit 68% homology in primary structure but have different substrate specificities. To determine clearly the structural basis for substrate recognition in the depolymerization mechanism by alginate lyases, both proteins were crystallized at 293 K using the vapour-diffusion method. A crystal of A1-II belonged tomore » space group P2{sub 1} and diffracted to 2.2 Å resolution, with unit-cell parameters a = 51.3, b = 30.1, c = 101.6 Å, β = 100.2°, while a crystal of A1-II′ belonged to space group P2{sub 1}2{sub 1}2{sub 1} and diffracted to 1.0 Å resolution, with unit-cell parameters a = 34.6, b = 68.5, c = 80.3 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jackson, Michael R.; Selby, Thomas L.
2012-10-30
A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.
Delta L: An Apparatus for Measuring Macromolecular Crystal Growth Rates in Microgravity
NASA Technical Reports Server (NTRS)
Judge, Russell A.; Whitaker, Ann F. (Technical Monitor)
2001-01-01
In order to determine how macromolecule crystal quality improvement in microgravity is related to crystal growth characteristics, is was necessary to develop new hardware that could measure the crystal growth rates of a population of crystals growing under the same solution conditions. As crystal growth rate is defined as the change or delta in a defined dimension or length (L) of a crystal over time, the hardware was named Delta L. Delta L consists of fluids, optics, and data acquisition, sub-assemblies. Temperature control is provided for the crystal growth chamber. Delta L will be used in connection with the Glovebox Integrated Microgravity Isolation Technology (g-LIMIT) inside the Microgravity Science Glovebox (MSG), onboard the International Space Station (ISS). Delta L prototype hardware has been assembled. This paper will describe an overview of the design of Delta L and present preliminary crystal growth rate data.
A preliminary review of organic materials single crystal growth by the Czochralski technique
NASA Astrophysics Data System (ADS)
Penn, B. G.; Shields, A. W.; Frazier, D. O.
1988-09-01
The growth of single crystals of organic compounds by the Czochralski method is reviewed. From the literature it is found that single crystals of benzil, a nonlinear optical material with a d sub 11 value of 11.2 + or - 1.5 x d sub 11 value of alpha quartz, has fewer dislocations than generally contained in Bridgman crystals. More perfect crystals were grown by repeated Czochralski growth. This consists of etching away the defect-containing portion of a Czochralski grown crystal and using it as a seed for further growth. Other compounds used to grow single crystals are benzophenone, 12-tricosanone (laurone), and salol. The physical properties, growth apparatus, and processing conditions presented in the literature are discussed. Moreover, some of the possible advantages of growing single crystals of organic compounds in microgravity to obtain more perfect crystals than on Earth are reviewed.
A preliminary review of organic materials single crystal growth by the Czochralski technique
NASA Technical Reports Server (NTRS)
Penn, B. G.; Shields, A. W.; Frazier, D. O.
1988-01-01
The growth of single crystals of organic compounds by the Czochralski method is reviewed. From the literature it is found that single crystals of benzil, a nonlinear optical material with a d sub 11 value of 11.2 + or - 1.5 x d sub 11 value of alpha quartz, has fewer dislocations than generally contained in Bridgman crystals. More perfect crystals were grown by repeated Czochralski growth. This consists of etching away the defect-containing portion of a Czochralski grown crystal and using it as a seed for further growth. Other compounds used to grow single crystals are benzophenone, 12-tricosanone (laurone), and salol. The physical properties, growth apparatus, and processing conditions presented in the literature are discussed. Moreover, some of the possible advantages of growing single crystals of organic compounds in microgravity to obtain more perfect crystals than on Earth are reviewed.
Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim
2004-10-01
Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.
Highly efficient continuous-wave laser operation of LD-pumped Nd,Gd:CaF2 and Nd,Y:CaF2 crystals
NASA Astrophysics Data System (ADS)
Pang, Siyuan; Ma, Fengkai; Yu, Hao; Qian, Xiaobo; Jiang, Dapeng; Wu, Yongjing; Zhang, Feng; Liu, Jie; Xu, Jiayue; Su, Liangbi
2018-05-01
Spectroscopic properties of Nd:CaF2 crystals are investigated. The photoluminescence intensity in the near infrared region is drastically enhanced by co-doping Gd3+ ions and Y3+ in Nd:CaF2 crystals. Preliminary laser experiments are carried out with 0.3%Nd,5%Gd:CaF2 and 0.3%Nd,5%Y:CaF2 crystals under laser diode pumping; true continuous wave laser operation is achieved with slope efficiencies of 42% and 39%, respectively, and the maximum output power reaches 1.188 W.
Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi
2006-01-01
The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559
Asteroseismology of White Dwarf Stars
NASA Technical Reports Server (NTRS)
Hansen, Carl J.
1997-01-01
The primary purpose of this investigation has been to study various aspects of multimode pulsations in variable white dwarfs. In particular, nonlinear interactions among pulsation modes in white dwarfs (and, to some extent, in other variable stars), analysis of recent observations where such interactions are important, and preliminary work on the effects of crystallization in cool white dwarfs are reported.
Morphological and electro optic studies of polymer dispersed liquid crystal in reverse mode
NASA Astrophysics Data System (ADS)
Sharma, Vandna; Kumar, Pankaj; Chinky, Malik, Praveen; Raina, K. K.
2018-05-01
Present work deals with reverse mode polymer dispersed liquid crystals (PDLCs) sensitive to electric field. Contrary to the conventional PDLCs operate from opaque (OFF state) to transparent state (ON state) with the application of field, reverse mode PDLCs work in transparent to opaque state. Reverse mode PDLC composed of nematic LC and UV curable optical adhesive polymer were prepared by the polymerization induced phase separation. The polarizing optical microscope study shows the vertical alignment of LCs within droplets with initial dark state under cross polarizers and confirms preliminary natural transparent state. The electro optic (EO) results show that the reverse mode PDLC lowered the threshold and operating voltages significantly compared with reported values. The contrast ratio of the film was also studied.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chu, Fuliang; Graduate School, Chinese Academy of Sciences, Beijing; Lou, Zhiyong
2005-06-01
Crystallization of the first rhesus macaque MHC class I complex. Simian immunodeficiency virus (SIV) infection in rhesus macaques has been used as the best model for the study of human immunodeficiency virus (HIV) infection in humans, especially in the cytotoxic T-lymphocyte (CTL) response. However, the structure of rhesus macaque (or any other monkey model) major histocompatibility complex class I (MHC I) presenting a specific peptide (the ligand for CTL) has not yet been elucidated. Here, using in vitro refolding, the preparation of the complex of the rhesus macaque MHC I allele (Mamu-A*01) with human β{sub 2}m and an immunodominant peptide,more » CTPYDINQM (Gag-CM9), derived from SIV Gag protein is reported. The complex (45 kDa) was crystallized; the crystal belongs to space group I422, with unit-cell parameters a = b = 183.8, c = 155.2 Å. The crystal contains two molecules in the asymmetric unit and diffracts X-rays to 2.8 Å resolution. The structure is being solved by molecular replacement and this is the first attempt to determined the crystal structure of a peptide–nonhuman primate MHC complex.« less
The 2D Selfassembly of Benzimidazole and its Co-crystallization
NASA Astrophysics Data System (ADS)
Costa, Paulo; Teeter, Jacob; Kunkel, Donna; Sinitskii, Alexander; Enders, Axel
Benzimidazoles (BI) are organic molecules that form ferroelectric crystals. Key to their ferroelectric behavior are the switchable N . . . HN type bonds and how they couple to the electron system of the molecules. We attempted to crystallize BI on various metal surfaces and studied them using STM. We observed that on Au and Ag, BI joins into zipper chains characteristic of its bulk structure that can pack into a continuous 2D layer. Because the dipole of BI lies in the direction of its switchable hydrogen bond, these zippers should in principle have reversible polarizations that point along the direction they run. BI's crystallization is reminiscent to how croconic acid (CA) crystallizes in 2D using O . . . HO bonding, suggesting that these molecules may be able to co-crystallize through OH . . . N bonds. This would present the opportunity to modify BI's properties, such as the energy needed to switch a hydrogen from a donor to acceptor site. When co-deposited, CA and BI successfully combine into a co-crystal formed by building blocks consisting of 2 CA and 2 BI molecules. These findings demonstrate the usefulness of using STM as a preliminary check to verify if two molecules are compatible with each other without having to attempt crystallization with multiple solvents and mixing methods.
Development and melt growth of novel scintillating halide crystals
NASA Astrophysics Data System (ADS)
Yoshikawa, Akira; Yokota, Yuui; Shoji, Yasuhiro; Kral, Robert; Kamada, Kei; Kurosawa, Shunsuke; Ohashi, Yuji; Arakawa, Mototaka; Chani, Valery I.; Kochurikhin, Vladimir V.; Yamaji, Akihiro; Andrey, Medvedev; Nikl, Martin
2017-12-01
Melt growth of scintillating halide crystals is reviewed. The vertical Bridgman growth technique is still considered as very popular method that enables production of relatively large and commercially attractive crystals. On the other hand, the micro-pulling-down method is preferable when fabrication of small samples, sufficient for preliminary characterization of their optical and/or scintillation performance, is required. Moreover, bulk crystal growth is also available using the micro-pulling-down furnace. The examples of growths of various halide crystals by industrially friendly melt growth techniques including Czochralski and edge-defined film-fed growth methods are also discussed. Finally, traveling molten zone growth that in some degree corresponds to horizontal zone melting is briefly overviewed.
Preliminary design of a supersonic cruise aircraft high-pressure turbine
NASA Technical Reports Server (NTRS)
Aceto, L. D.; Calderbank, J. C.
1983-01-01
Development of the supersonic cruise aircraft engine continued in this National Aeronautics and Space Administration (NASA) sponsored Pratt and Whitney program for the Preliminary Design of an Advanced High-Pressure Turbine. Airfoil cooling concepts and the technology required to implement these concepts received particular emphasis. Previous supersonic cruise aircraft mission studies were reviewed and the Variable Stream Control Engine (VSCE) was chosen as the candidate or the preliminary turbine design. The design was evaluated for the supersonic cruise mission. The advanced technology to be generated from these designs showed benefits in the supersonic cruise application and subsonic cruise application. The preliminary design incorporates advanced single crystal materials, thermal barrier coatings, and oxidation resistant coatings for both the vane and blade. The 1990 technology vane and blade designs have cooled turbine efficiency of 92.3 percent, 8.05 percent Wae cooling and a 10,000 hour life. An alternate design with 1986 technology has 91.9 percent efficiency and 12.43 percent Wae cooling at the same life. To achieve these performance and life results, technology programs must be pursued to provide the 1990's technology assumed for this study.
Protein crystal growth in a microgravity environment
NASA Technical Reports Server (NTRS)
Bugg, Charles E.
1988-01-01
Protein crystal growth is a major experimental problem and is the bottleneck in widespread applications of protein crystallography. Research efforts now being pursued and sponsored by NASA are making fundamental contributions to the understanding of the science of protein crystal growth. Microgravity environments offer the possibility of performing new types of experiments that may produce a better understanding of protein crystal growth processes and may permit growth environments that are more favorable for obtaining high quality protein crystals. A series of protein crystal growth experiments using the space shuttle was initiated. The first phase of these experiments was focused on the development of micro-methods for protein crystal growth by vapor diffusion techniques, using a space version of the hanging drop method. The preliminary space experiments were used to evolve prototype hardware that will form the basis for a more advanced system that can be used to evaluate effects of gravity on protein crystal growth.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus
2006-06-01
SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alber, Orly; Noach, Ilit; Lamed, Raphael
2008-02-01
The cloning, expression, purification, crystallization and preliminary X-ray characterization of a novel class of cohesin module (type III) from the R. flavefaciens ScaE anchoring scaffoldin are described. Ruminococcus flavefaciens is an anaerobic bacterium that resides in the gastrointestinal tract of ruminants. It produces a highly organized multi-enzyme cellulosome complex that plays a key role in the degradation of plant cell walls. ScaE is one of the critical structural components of its cellulosome that serves to anchor the complex to the cell wall. The seleno-l-methionine-labelled derivative of the ScaE cohesin module has been cloned, expressed, purified and crystallized. The crystals belongmore » to space group C2, with unit-cell parameters a = 155.6, b = 69.3, c = 93.0 Å, β = 123.4°, and contain four molecules in the asymmetric unit. Diffraction data were phased to 1.95 Å using the anomalous signal from the Se atoms.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Scott, Stacy A.; Holloway, Gavan; Coulson, Barbara S.
2005-06-01
The sialic acid-binding domain (VP8*) component of the porcine CRW-8 rotavirus spike protein has been overexpressed in E. coli, purified and co-crystallized with an N-acetylneuraminic acid derivative. X-ray diffraction data have been collected to 2.3 Å, which has enabled determination of the structure by molecular replacement. Rotavirus recognition and attachment to host cells involves interaction with the spike protein VP4 that projects outwards from the surface of the virus particle. An integral component of these spikes is the VP8* domain, which is implicated in the direct recognition and binding of sialic acid-containing cell-surface carbohydrates and facilitates subsequent invasion by themore » virus. The expression, purification, crystallization and preliminary X-ray diffraction analysis of VP8* from porcine CRW-8 rotavirus is reported. Diffraction data have been collected to 2.3 Å resolution, enabling the determination of the VP8* structure by molecular replacement.« less
The preparation and characterization of a lithium borate glass prepared by the gel technique
NASA Technical Reports Server (NTRS)
Weinberg, M. C.; Neilson, G. F.; Smith, G. L.; Dunn, B.; Moore, G. S.; Mackenzie, J. D.
1985-01-01
The preparation of an amorphous lithium borate gel by the metal organic procedure is described. In addition, a preliminary evaluation of the behavior of the gel upon heating is given. In particular the crystallization tendency of the gel is studied with the aid of DTA and X-ray diffraction, and the structural changes in the gel are monitored with the aid of IR spectroscopy. The glass produced from the lithium borate gel is compared to both the gel precursor material and a glass of similar composition prepared by conventional techniques. Specifically, the relevant water contents, crystallization behavior, and structural features are contrasted.
Campos, Bruna Medeia; Alvarez, Thabata Maria; Liberato, Marcelo Vizona; Polikarpov, Igor; Gilbert, Harry J; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio
2014-09-01
In recent years, owing to the growing global demand for energy, dependence on fossil fuels, limited natural resources and environmental pollution, biofuels have attracted great interest as a source of renewable energy. However, the production of biofuels from plant biomass is still considered to be an expensive technology. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases for polysaccharide degradation, is attracting growing attention. Aiming at the identification of new CBMs, a sugarcane soil metagenomic library was analyzed and an uncharacterized CBM (CBM_E1) was identified. In this study, CBM_E1 was expressed, purified and crystallized. X-ray diffraction data were collected to 1.95 Å resolution. The crystals, which were obtained by the sitting-drop vapour-diffusion method, belonged to space group I23, with unit-cell parameters a = b = c = 88.07 Å.
Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy
2005-08-01
Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Igarashi, Tomoko; Oishi, Yuko; Araki, Satohiko
Vascular apoptosis-inducing protein 1 (VAP1) and VAP2 from C. atrox venom were crystallized in variety of different crystal forms. Diffraction data sets were obtained to 2.5 and 2.15 Å resolution for VAP1 and VAP2, respectively. VAPs are haemorrhagic snake-venom toxins belonging to the reprolysin family of zinc metalloproteinases. In vitro, VAPs induce apoptosis specifically in cultured vascular endothelial cells. VAPs have a modular structure that bears structural homology to mammalian ADAMs (a disintegrin and metalloproteinases). VAP1 is a homodimer with a MW of 110 kDa in which the monomers are connected by a single disulfide bridge. VAP2 is homologous tomore » VAP1 and exists as a monomer with a MW of 55 kDa. In the current study, several crystal forms of VAP1 and VAP2 were obtained using the vapour-diffusion method and diffraction data sets were collected using SPring-8 beamlines. The best crystals of VAP1 and VAP2 generated data sets to 2.5 and 2.15 Å resolution, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Molina, Rafael; González, Ana; Moscoso, Miriam
2007-09-01
The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-qualitymore » orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.« less
Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Balasubramanian, Moovarkumudalvan; Ponnuswamy, Mondikalipudur Nanjappa Gounder
2009-01-01
Hemoglobin is a vital protein present in almost all higher species. It is a transport protein involved in carrying oxygen from lungs to tissues and carbon dioxide back to lungs by an intrinsically coordinated manner. Even though a good amount of work has been carried out in this direction there exists scarcity of structural insight on low oxygen affinity species. Attempts are being made to unravel the structural insight of this low oxygen affinity species. Goat blood plasma was collected, treated with EDTA to avoid blood clotting and purification was accomplished using DEAE-anion chromatographic column. The goat hemoglobin was crystallized using 50mM of phosphate buffer at pH 6.7 with 1M NaCl and PEG 3350 as precipitant by hanging drop vapor diffusion method. Crystals obtained are screened and suitable crystals are taken for data collection using mar345dtb as image plate detector system. Goat hemoglobin crystal diffracted up to 2.61 A resolution. Goat hemoglobin crystallizes in orthorhombic space group P212(1)2(1) as a whole biological molecule in the asymmetric unit with cell dimensions a=53.568A, b=67.365A, c=154.183A.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qureshi, Insaf A.; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in
2006-09-01
A 24 kDa protein was purified from the seeds of L. sativus by ammonium sulfate fractionation and ion-exchange chromatography. Crystals were obtained by the hanging-drop vapour-diffusion method. A 24 kDa protein was purified from the seeds of Lathyrus sativus by ammonium sulfate fractionation and ion-exchange chromatography. The N-terminal amino-acid sequence showed significant homology with the 2S albumin class of seed storage proteins. The protein showed 85% sequence homology with the seed albumin of Pisum sativum within the 40 N-terminal residues. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cellmore » parameters a = 43.5, b = 82.7, c = 153.4 Å.« less
Edwards, Marcus J.; Flatman, Ruth H.; Mitchenall, Lesley A.; Stevenson, Clare E. M.; Maxwell, Anthony; Lawson, David M.
2009-01-01
Crystals of a complex formed between the 59 kDa N-terminal fragment of the Escherichia coli DNA gyrase A subunit (also known as the breakage–reunion domain) and the antibiotic simocyclinone D8 were grown by vapour diffusion. The complex crystallized with I-centred orthorhombic symmetry and X-ray data were recorded to a resolution of 2.75 Å from a single crystal at the synchrotron. DNA gyrase is an essential bacterial enzyme and thus represents an attractive target for drug development. PMID:19652356
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fernandes, Humberto; Konieczna, Malgorzata; Kolodziejczyk, Robert
2008-05-01
The Hyp-1 protein suggested to be a phenolic oxidative-coupling enzyme involved in the biosynthesis of hypericin, a medicinally important natural compound found in St John’s wort (H. perforatum), has been expressed, purified and prepared in single-crystal form. According to a debated hypothesis, the biosynthesis from emodin of the medicinally important natural compound hypericin is catalyzed in St John’s wort (Hypericum perforatum) by the phenolic oxidative-coupling protein Hyp-1. Recombinant St John’s wort Hyp-1 has been overexpressed in Escherichia coli and obtained in single-crystal form. The crystals belong to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters amore » = 37.5, b = 76.7, c = 119.8 Å, contain two protein molecules in the asymmetric unit and diffract X-rays to 1.73 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruggiero, Alessia; Tizzano, Barbara; Geerlof, Arie
2007-10-01
The first crystallization of a resuscitation-promoting factor has been performed. Multiwavelength anomalous dispersion experiments have been carried out to obtain experimental phases using data at 2.9 Å resolution from a selenomethionine derivative. The resuscitation-promoting factor RpfB, the most complex of the five resuscitation-promoting factors produced by M. tuberculosis, is devoted to bacterial reactivation from the dormant state. RpfB consists of 362 residues predicted to form five domains. An RpfB fragment containing the protein catalytic domain and a G5 domain has been successfully crystallized using vapour-diffusion methods. This is the first crystallographic study of a resuscitation-promoting factor. Crystals of this proteinmore » belong to space group I422, with unit-cell parameters a = 97.63, b = 97.63, c = 114.87 Å. Diffraction data have also been collected from a selenomethionine derivative at 2.9 Å resolution. Model building using the phases derived from the multiwavelength anomalous dispersion experiment is in progress.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, George J.; Garen, Craig R.; Cherney, Maia M.
2007-11-01
The C-terminal portion of the arginine repressor protein from M. tuberculosis H37Rv has been crystallized. The complete transcriptional factor regulates arginine biosynthesis by binding operator DNA when arginine is bound at the C-terminal domain. The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 Å. The crystals belong to space group P1 and themore » Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of six molecules per unit cell.« less
Crystallization and preliminary X-ray analysis of membrane-bound pyrophosphatases.
Kellosalo, Juho; Kajander, Tommi; Honkanen, Riina; Goldman, Adrian
2013-02-01
Membrane-bound pyrophosphatases (M-PPases) are enzymes that enhance the survival of plants, protozoans and prokaryotes in energy constraining stress conditions. These proteins use pyrophosphate, a waste product of cellular metabolism, as an energy source for sodium or proton pumping. To study the structure and function of these enzymes we have crystallized two membrane-bound pyrophosphatases recombinantly produced in Saccharomyces cerevisae: the sodium pumping enzyme of Thermotoga maritima (TmPPase) and the proton pumping enzyme of Pyrobaculum aerophilum (PaPPase). Extensive crystal optimization has allowed us to grow crystals of TmPPase that diffract to a resolution of 2.6 Å. The decisive step in this optimization was in-column detergent exchange during the two-step purification procedure. Dodecyl maltoside was used for high temperature solubilization of TmPPase and then exchanged to a series of different detergents. After extensive screening, the new detergent, octyl glucose neopentyl glycol, was found to be the optimal for TmPPase but not PaPPase.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bacik, John-Paul; Brigley, Angela M.; Channon, Lisa D.
2005-06-01
Ectromelia virus glutaredoxin has been crystallized in the presence of the reducing agent DTT. A diffraction data set has been collected and processed to 1.8 Å resolution. Ectromelia, vaccinia, smallpox and other closely related viruses of the orthopoxvirus genus encode a glutaredoxin gene that is not present in poxviruses outside of this genus. The vaccinia glutaredoxin O2L has been implicated as the reducing agent for ribonucleotide reductase and may thus play an important role in viral deoxyribonucleotide synthesis. As part of an effort to understand nucleotide metabolism by poxviruses, EVM053, the O2L ortholog of the ectromelia virus, has been crystallized.more » EVM053 crystallizes in space group C222{sub 1}, with unit-cell parameters a = 61.98, b = 67.57, c = 108.55 Å. Diffraction data have been processed to 1.8 Å resolution and a self-rotation function indicates that there are two molecules per asymmetric unit.« less
Intermediate phases in [111]- and [001]-oriented PbMg1/3Nb2/3O3-29PbTiO3 single crystals
NASA Astrophysics Data System (ADS)
Kamzina, L. S.
2017-09-01
Phase transformations in [111]- and [001]-oriented PbMg1/3Nb2/3O3-29PbTiO3 single crystals have been studied using dielectric and optical measurements before and after applying an electric field. It is shown that the subsequence of phase transitions rhombohedral ( R)—tetragonal ( T)—cubic ( C) phases is observed in nonpolarized samples of both orientations as temperature increases. In the [111]-oriented crystal, an additional intermediate monoclinic phase (it is possible, M a ) is induced after preliminary polarization at room temperature and the R- M a - T- C phase transitions are observed on heating. In the [001]-oriented crystal, after its polarization, the monoclinic phase forms instead of the rhombohedral phase even at room temperature and the M a - T- C transitions occur on heating. The results are discussed from the point of view of the existence polar nanoregions with different local symmetries in a glasslike matrix.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghosh, Raka; Chakrabarti, Chandana, E-mail: chandana.chakrabarti@saha.ac.in
2005-08-01
A thaumatin-like antifungal protein, NP24-I, has been isolated from ripe tomato fruits. It was crystallized by the vapour-diffusion method and data were collected to 2.45 Å. The structure was solved by molecular replacement. NP24 is a 24 kDa (207-amino-acid) antifungal thaumatin-like protein (TLP) found in tomato fruits. An isoform of the protein, NP24-I, is reported to play a possible role in ripening of the fruit in addition to its antifungal properties. The protein has been isolated and purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the tetragonal space group P4{sub 3}, with unit-cell parameters a =more » b = 61.01, c = 62.90 Å and one molecule per asymmetric unit. X-ray diffraction data were processed to a resolution of 2.45 Å and the structure was solved by molecular replacement.« less
Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim
2005-06-01
Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.
Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru
2006-01-01
A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abrescia, Nicola G. A.; Kivelä, Hanna M.; Grimes, Jonathan M.
2005-08-01
The viral capsid protein P2 of bacteriophage PM2 has been crystallized. Preliminary X-ray analysis demonstrates the position and orientation of the two trimers in the asymmetric unit. PM2 (Corticoviridae) is a dsDNA bacteriophage which contains a lipid membrane beneath its icosahedral capsid. In this respect it resembles bacteriophage PRD1 (Tectiviridae), although it is not known whether the similarity extends to the detailed molecular architecture of the virus, for instance the fold of the major coat protein P2. Structural analysis of PM2 has been initiated and virus-derived P2 has been crystallized by sitting-nanodrop vapour diffusion. Crystals of P2 have been obtainedmore » in space group P2{sub 1}2{sub 1}2, with two trimers in the asymmetric unit and unit-cell parameters a = 171.1, b = 78.7, c = 130.1 Å. The crystals diffract to 4 Å resolution at the ESRF BM14 beamline (Grenoble, France) and the orientation of the non-crystallographic threefold axes, the spatial relationship between the two trimers and the packing of the trimers within the unit cell have been determined. The trimers form tightly packed layers consistent with the crystal morphology, possibly recapitulating aspects of the arrangement of subunits in the virus.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taguchi, Chiho; Quantum Beam Science Directorate, Japan Atomic Energy Agency; Taura, Futoshi
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b =more » 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bäuerle, Bettina; Sandalova, Tatyana; Schneider, Gunter
2006-08-01
This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH{sub 4}){sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space groupmore » P2{sub 1}, with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na{sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 8.5.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yanfeng; Gao, Xiaoli
2012-08-31
L-Lactate dehydrogenase (LDH) is an important enzyme involved in the last step of glycolysis that catalyzes the reversible conversion of pyruvate to L-lactate with the simultaneous oxidation of NADH to NAD{sup +}. In this study, wild-type LDH from Bacillus subtilis (BsLDH-WT) and the H171C mutant (BsLDH-H171C) were expressed in Escherichia coli and purified to near-homogeneity. BsLDH-WT was crystallized in the presence of fructose 1,6-bisphosphate (FBP) and NAD{sup +} and the crystal diffracted to 2.38 {angstrom} resolution. The crystal belonged to space group P3, with unit-cell parameters a = b = 171.04, c = 96.27 {angstrom}. BsLDH-H171C was also crystallized asmore » the apoenzyme and in complex with NAD{sup +}, and data sets were collected to 2.20 and 2.49 {angstrom} resolution, respectively. Both BsLDH-H171C crystals belonged to space group P3, with unit-cell parameters a = b = 133.41, c = 99.34 {angstrom} and a = b = 133.43, c = 99.09 {angstrom}, respectively. Tetramers were observed in the asymmetric units of all three crystals.« less
Balasubramanian, Moovarkumudalvan; Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Ponnuswamy, Mondikalipudur Nanjappa Gounder
2009-01-01
Hemoglobin is a tetrameric, iron-containing metalloprotein, which plays a vital role in the transportation of oxygen from lungs to tissues and carbon dioxide back to lungs. Though good amount of work has already been done on hemoglobins, the scarcity of data on three dimensional structures pertaining to low oxygen affinity hemoglobins from mammalian species, motivated our group to work on this problem specifically. Herein, we report the preliminary crystallographic analysis of buffalo hemoglobin, which belongs to low oxygen affinity species. The buffalo blood was collected, purified by anion exchange chromatography and crystallized with PEG 3350 using 50mM phosphate buffer at pH 6.7 as a precipitant by hanging drop vapor diffusion method. Data collection was carried out using mar345dtb image plate detector system. Buffalo hemoglobin crystallizes in orthorhombic space group P2(1)2(1)2(1) with one whole biological molecule (alpha2beta2) in the asymmetric unit with cell dimensions a=63.064A, b=74.677A, c=110.224A.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao
Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.
Horsham, Matt; Saxby, Harriet; Blake, James; Isaacs, Neil W.; Mitchell, Tim J.; Riboldi-Tunnicliffe, Alan
2010-01-01
The enzyme transketolase from the lactic acid bacterium Lactobacillus salivarius (subsp. salivarius UCC118) has been recombinantly expressed and purified using an Escherichia coli expression system. Purified transketolase from L. salivarius has been crystallized using the vapour-diffusion technique. The crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 75.43, c = 184.11 Å, and showed diffraction to 2.3 Å resolution. PMID:20693662
Passivation on High Q Acoustic Strain Sensor for Accelerometer.
1984-11-01
selection of passivation layers. Preliminary results indicated that V203 , (yttrium oxide ) and AIN (aluminum nitride) were the best materials for...thickness selection of passivation layers. Preliminary results indicated that Y203 (yttrium oxide ) and AIN (aluminum nitride) were the best materials...crystal, in this case a parabolic temperature characteristic. Several circuits were designed using varactor diode phase shifting networks. FOjcTl Ta tor
Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song
2013-11-01
Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.
Fernández, Carlos E; Mancera, Manuel; Holler, Eggehard; Bou, Jordi J; Galbis, Juan A; Muñoz-Guerra, Sebastián
2005-02-23
Low-molecular-weight poly(alpha-methyl beta,L-malate) made of approximately 25-30 units was prepared from microbial poly(beta,L-malic acid) by treatment with diazomethane. The thermal characterization of the polymalate methyl ester was carried out and its crystalline structure was preliminary examined. Its ability to crystallize both from solution and from the melt was comparatively evaluated.
About vortex-like atomic motion in a loaded single crystal
NASA Astrophysics Data System (ADS)
Dmitriev, A. I.; Nikonov, A. Yu.
2017-12-01
The paper presents a molecular dynamics study of internal stress and atomic displacement redistributions in a preliminary loaded solid. The study demonstrates the possibility of self-organized vortices as dynamic defects of typical size 1-5 nm due to atomic motion in the elastic region at the stage of relaxation. The simulation results agree well with experimental data on strain localization in elastic distortion regions which gives rise to nanodipoles of partial disclinations.
Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki
2007-09-01
Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sayer, Christopher; Isupov, Michail N.; Littlechild, Jennifer A., E-mail: j.a.littlechild@exeter.ac.uk
2007-02-01
An ω-amino acid:pyruvate transaminase from C. violaceum has been purified and crystallized in two crystal forms. The structure has been solved using molecular replacement. The enzyme ω-transaminase catalyses the conversion of chiral ω-amines to ketones. The recombinant enzyme from Chromobacterium violaceum has been purified to homogeneity. The enzyme was crystallized from PEG 4000 using the microbatch method. Data were collected to 1.7 Å resolution from a crystal belonging to the triclinic space group P1, with unit-cell parameters a = 58.9, b = 61.9, c = 63.9 Å, α = 71.9, β = 87.0, γ = 74.6°. Data were also collectedmore » to 1.95 Å from a second triclinic crystal form. The structure has been solved using the molecular-replacement method.« less
NASA Astrophysics Data System (ADS)
Yang, Jinkyu; Silvestro, Claudio; Sangiorgio, Sophia N.; Borkowski, Sean L.; Ebramzadeh, Edward; De Nardo, Luigi; Daraio, Chiara
2012-01-01
We propose a new biomedical sensing technique based on highly nonlinear solitary waves to assess orthopaedic implant stability in a nondestructive and efficient manner. We assemble a granular crystal actuator consisting of a one-dimensional tightly packed array of spherical particles, to generate acoustic solitary waves. Via direct contact with the specimen, we inject acoustic solitary waves into a biomedical prosthesis, and we nondestructively evaluate the mechanical integrity of the bone-prosthesis interface, studying the properties of the waves reflected from the contact zone between the granular crystal and the implant. The granular crystal contains a piezoelectric sensor to measure the travelling solitary waves, which allows it to function also as a sensor. We perform a feasibility study using total hip arthroplasty (THA) samples made of metallic stems implanted in artificial composite femurs using polymethylmethacrylate for fixation. We first evaluate the sensitivity of the proposed granular crystal sensor to various levels of prosthesis insertion into the composite femur. Then, we impose a sequence of harsh mechanical loading on the THA samples to degrade the mechanical integrity at the stem-cement interfaces, using a femoral load simulator that simulates aggressive, accelerated physiological loading. We investigate the implant stability via the granular crystal sensor-actuator during testing. Preliminary results suggest that the reflected waves respond sensitively to the degree of implant fixation. In particular, the granular crystal sensor-actuator successfully detects implant loosening at the stem-cement interface following violent cyclic loading. This study suggests that the granular crystal sensor and actuator has the potential to detect metal-cement defects in a nondestructive manner for orthopaedic applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra
2008-07-01
Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less
OSL studies of alkali fluoroperovskite single crystals for radiation dosimetry
NASA Astrophysics Data System (ADS)
Daniel, D. Joseph; Raja, A.; Madhusoodanan, U.; Annalakshmi, O.; Ramasamy, P.
2016-08-01
This paper presents a preliminary investigation of the optically stimulated luminescence (OSL) of alkali fluoroperovskite single crystals for radiation dosimetry. The perovskite-like KMgF3, NaMgF3 and LiBaF3 polycrystalline compounds doped with rare earths (Eu2+ and Ce3+) were synthesized by standard solid state reaction technique. Phase purity of the synthesized compounds was analyzed by powder X-ray diffraction technique. Single crystals of these compounds have been grown from melt by using vertical Bridgman-Stockbarger method. The Linearly Modulated OSL and Continuous Wave OSL measurements were performed in these alkali fluorides using blue light stimulation. Thermal bleaching experiments have shown that OSL signals originate from traps which are unstable near 200 °C, thus proving the suitability of the signals for dosimetric purposes. Optical bleaching measurements were also performed for these fluoride samples. OSL dose response was studied as a function of dose which was found to increase with beta dose.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita
2008-04-01
Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)
Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yin, Lei; Zhu, De-Yu; Yang, Na
2005-04-01
The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
1981-07-01
C. McGill and J. 0. McCaldin ..... ............. .. 160 Diffusional Instability of p /n Heterojunctions J. J. Gilman...Preliminary Ideas on a Ductile-Brittle Transition in Fe-Si Single Crystals R. Thomson and J. P . Hirth. . . . . . . . . . . . . . . . 199 Comment on a...Baltimore, MD 21218 Professor Alan J. Heeger Department of Physics/El University of Pennsylvania Philadelphia, PA 19104 Professor John P . Hirth
Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya
2010-01-01
A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161
DOE Office of Scientific and Technical Information (OSTI.GOV)
Quesada, Odayme; Gurda, Brittney; Govindasamy, Lakshmanan
2007-12-01
Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids have been produced which diffract X-rays to ∼3.0 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids diffract X-rays to ∼3.0 Å resolution. The crystals belong to the rhombohedral space group R3, with unit-cell parameters a = 252.4, c = 591.2 Å in the hexagonal setting. The diffraction data were processed and reduced to an overall completeness of 79.0% and an R{sub merge} of 12.0%. There are three viral capsids in the unit cell. The icosahedral threefold axis is coincident with the crystallographic threefold axis, resulting in one third of amore » capsid (20 monomers) per crystallographic asymmetric unit. The orientation of the viral capsid has been determined by rotation-function searches and is positioned at (0, 0, 0) by packing considerations.« less
Hu, Wenxin; Wang, Qihai; Bi, Ruchang
2005-12-01
Diadenosine tetraphosphate (Ap4A) hydrolase (EC 3.6.1.41) hydrolyzes Ap4A symmetrically in prokaryotes. It plays a potential role in organisms by regulating the concentration of Ap4A in vivo. To date, no three-dimensional structures of proteins with significant sequence homology to this protein have been determined. The 31.3 kDa Ap4A hydrolase from Shigella flexneri 2a has been cloned, expressed and purified using an Escherichia coli expression system. Crystals of Ap4A hydrolase have been obtained by the hanging-drop technique at 291 K using PEG 550 MME as precipitant. Ap4A hydrolase crystals diffract X-rays to 3.26 A and belong to space group P2(1), with unit-cell parameters a = 118.9, b = 54.6, c = 128.5 A, beta = 95.7 degrees.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6
2007-12-01
The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.
The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less
NASA Astrophysics Data System (ADS)
Petersen, D.; Bailey, M.; Hallett, J.; Beasley, W.
2007-12-01
The initiation of lightning remains an open question, due in large part to a deficit of in-situ observational evidence. Recent theoretical descriptions of lightning initiation have focused on runaway breakdown and related secondary processes, but have not convincingly explained the details of onset of the embryonic lightning leader channel. Among possible mechanisms contributing to the initial leader formation are positive streamer discharges from ice hydrometeors, themselves once favored as the primary explanation of lightning initiation. We present preliminary results from a new laboratory study of positive streamer discharges on simulated ice hydrometeors. Emphasis is given to precisely defining the minimum electric field strength required for onset of positive streamer generation, with variables of interest being ice crystal size, habit and environmental temperature.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marchi-Salvador, D. P.; Fernandes, C. A. H.; Amui, S. F.
2006-06-01
A non-catalytic and myotoxic Lys49-PLA{sub 2} from B. jararacussu venom was crystallized with BPB inhibitor and X-ray diffraction data were collected. Preliminary analysis indicates that the ligand is bound to the His48 residue. Structure determination may provide insights into the myotoxic and cytotoxic mechanisms of Lys49-PLA{sub 2}s. For the first time, a non-catalytic and myotoxic Lys49-PLA{sub 2} (BthTX-I from Bothrops jararacussu venom) has been crystallized with BPB inhibitor. X-ray diffraction data were collected and electron-density calculations showed that the ligand is bound to the His48 residue. BthTX-I with His48 chemically modified by BPB shows strongly reduced myotoxic and cytotoxic activities.more » This suggests a biological correlation between the modification of His48, which is associated with catalytic activity of PLA{sub 2}s, and other toxicological activities of Lys49-PLA{sub 2}s.« less
Joseph, Raji E; Ginder, Nathaniel D; Hoy, Julie A; Nix, Jay C; Honzatko, Richard B; Andreotti, Amy H
2011-02-01
Proline is a unique amino acid owing to the relatively small energy difference between the cis and trans conformations of its peptide bond. The X-Pro imide bond readily undergoes cis-trans isomerization in the context of short peptides as well as some proteins. However, the direct detection of cis-trans proline isomerization in folded proteins is technically challenging. NMR spectroscopy is well suited to the direct detection of proline isomerization in folded proteins. It is less clear how well X-ray crystallography can reveal this conformational exchange event in folded proteins. Conformational heterogeneity owing to cis-trans proline isomerization in the Src homology 2 (SH2) domain of the IL-2-inducible T-cell kinase (ITK) has been extensively characterized by NMR. Using the ITK SH2 domain as a test system, an attempt was made to determine whether proline isomerization could be detected in a crystal structure of the ITK SH2 domain. As a first step towards this goal, the purification, crystallization and preliminary characterization of the ITK SH2 domain are described.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
This report contains viewgraphs on the following topics. The advanced light source U8 undulator beamline, 20--300 eV; gas-phase actinide studies with synchrotron radiation; atomic structure calculations for heavy atoms; flux growth of single crystal uranium intermetallics: Extension to transuranics; x-ray absorption near-edge structure studies of actinide compounds; surface as a new stage for studying actinides: Theoretical study of the surface electronic structure of uranium; magnetic x-ray scattering experiments at resonant energies; beamline instruments for radioactive materials; the search for x-ray absorption magnetic circular dichroism in actinide materials: preliminary experiments using UFe[sub 2] and U-S; the laser plasma laboratory light source:more » a source of preliminary transuranic data; electron spectroscopy of heavy fermion actinide materials; study of thin layers of actinides. Present status and future use of synchrotron radiation; electronic structure and correlated-electron theory for actinide materials; and heavy fermion and kondo phenomena in actinide materials.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
This report contains viewgraphs on the following topics. The advanced light source U8 undulator beamline, 20--300 eV; gas-phase actinide studies with synchrotron radiation; atomic structure calculations for heavy atoms; flux growth of single crystal uranium intermetallics: Extension to transuranics; x-ray absorption near-edge structure studies of actinide compounds; surface as a new stage for studying actinides: Theoretical study of the surface electronic structure of uranium; magnetic x-ray scattering experiments at resonant energies; beamline instruments for radioactive materials; the search for x-ray absorption magnetic circular dichroism in actinide materials: preliminary experiments using UFe{sub 2} and U-S; the laser plasma laboratory light source:more » a source of preliminary transuranic data; electron spectroscopy of heavy fermion actinide materials; study of thin layers of actinides. Present status and future use of synchrotron radiation; electronic structure and correlated-electron theory for actinide materials; and heavy fermion and kondo phenomena in actinide materials.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika
A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less
Crystallization and preliminary crystallographic analysis of the Clostridium perfringens enterotoxin
Briggs, David C.; Smedley, James G.; McClane, Bruce A.; Basak, Ajit K.
2010-01-01
Clostridium perfringens is a Gram-positive anaerobic species of bacterium that is notable for its ability to produce a plethora of toxins, including membrane-active toxins (α-toxins), pore-forming toxins (∊-toxins) and binary toxins (ι-toxins). Here, the crystallization of the full-length wild-type C. perfringens enterotoxin is reported, which is the causative agent of the second most prevalent food-borne illness in the United States and has been implicated in many other gastrointestinal pathologies. Several crystal forms were obtained. However, only two of these optimized crystal forms (I and II) were useable for X-ray diffraction data collection. The form I crystals diffracted to d min = 2.7 Å and belonged to space group C2, while the form II crystals diffracted to d min = 4 Å and belonged to space group P213. PMID:20606275
Lu, Shuangshuang; Yao, Shugang; Chen, Rong; Zhang, Nianzhi; Chen, Jianmin; Gao, Feng; Xia, Chun
2012-04-01
β(2)-Microglobulin (β(2)m) is an essential subunit of the major histocompatibility complex (MHC) class I molecule that helps to stabilize the structure of peptide-MHC I (pMHC I). It is also one of the typical immunoglobulin superfamily (IgSF) molecules in the adaptive immune system (AIS). Sharks belong to the cartilaginous fish, which are the oldest jawed vertebrate ancestors with an AIS to exist in the world. Thus, the study of cartilaginous fish β(2)m would help in understanding the evolution of IgSF molecules. In order to demonstrate this, β(2)m from a cartilaginous fish, nurse shark (Ginglymostoma cirratum), was expressed, refolded, purified and crystallized. Diffraction data were collected to a resolution of 2.3 Å. The crystal belonged to space group P3(2)21, with unit-cell parameters a = b = 88.230, c = 67.146 Å. The crystal structure contained two molecules in the asymmetric unit. The results will provide structural information for study of the evolution of β(2)m and IgSF in the AIS. © 2012 International Union of Crystallography. All rights reserved.
Dwivedi, Shweta; Kruparani, Shobha P; Sankaranarayanan, Rajan
2004-09-01
Threonyl-tRNA synthetase (ThrRS) faces a crucial double-discrimination problem during the translation of genetic code. Most ThrRSs from the archaeal kingdom possess a unique editing domain that differs from those of eubacteria and eukaryotes. In order to understand the structural basis of the editing mechanism in archaea, the editing module of ThrRS from Pyrococcus abyssi comprising of the first 183 amino-acid residues was cloned, expressed, purified and crystallized. The crystals belong to the trigonal space group P3(1(2))21, with one molecule in the asymmetric unit.
Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.
2010-11-12
Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.
Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J
2008-06-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.
Triest, Sarah; Wohlkönig, Alexandre; Pardon, Els; Steyaert, Jan
2014-11-01
GPCR-G-protein complexes are one of the most important components of cell-signalling cascades. Extracellular signals are sensed by membrane-associated G-protein-coupled receptors (GPCRs) and transduced via G proteins towards intracellular effector molecules. Structural studies of these transient complexes are crucial to understand the molecular details of these interactions. Although a nucleotide-free GPCR-G-protein complex is stable, it is not an ideal sample for crystallization owing to the intrinsic mobility of the Gαs α-helical domain (AHD). To stabilize GPCR-G-protein complexes in a nucleotide-free form, nanobodies were selected that target the flexible GαsAHD. One of these nanobodies, CA9177, was co-crystallized with the GαsAHD. Initial crystals were obtained using the sitting-drop method in a sparse-matrix screen and further optimized. The crystals diffracted to 1.59 Å resolution and belonged to the monoclinic space group P2₁, with unit-cell parameters a=44.07, b=52.55, c=52.66 Å, α=90.00, β=107.89, γ=90.00°. The structure of this specific nanobody reveals its binding epitope on GαsAHD and will help to determine whether this nanobody could be used as crystallization chaperone for GPCR-G-protein complexes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fuentes-Silva, D.; Mendoza-Hernández, G.; Stojanoff, V.
2007-09-01
Crystallization of important glycoenzymes involved in IgE-mediated latex allergy. Latex from Hevea brasiliensis contains several allergenic proteins that are involved in type I allergy. One of them is Hev b 2, which is a β-1,3-glucanase enzyme that exists in different isoforms with variable glycosylation content. Two glucanase isoforms were isolated from trees of the GV-42 clone by gel filtration, affinity and ion-exchange chromatography. Isoform I had a carbohydrate content of about 20%, with N-linked N-acetyl-glucosamine, N-acetyl-galactosamine, fucose and galactose residues as the main sugars, while isoform II showed 6% carbohydrate content constisting of N-acetyl-glucosamine, fucose, mannose and xylose. Both isoformsmore » were crystallized by the hanging-drop vapour-diffusion method. Isoform I crystals were grown using 0.2 M trisodium citrate dihydrate, 0.1 M Na HEPES pH 7.5 and 20%(v/v) 2-propanol, but these crystals were not appropriate for data collection. Isoform II crystals were obtained under two conditions and X-ray diffraction data were collected from both. In the first condition (0.2 M trisodium citrate, 0.1 M sodium cacodylate pH 6.5, 30% 2-propanol), crystals belonging to the tetragonal space group P4{sub 1} with unit-cell parameters a = b = 150.17, c = 77.41 Å were obtained. In the second condition [0.2 M ammonium acetate, 0.1 M trisodium citrate dihydrate pH 5.6, 30%(w/v) polyethylene glycol 4000] the isoform II crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 85.08, b = 89.67, c = 101.80 Å, β = 113.6°. Preliminary analysis suggests that there are four molecules of isoform II in both asymmetric units.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Yong-Zhi; Sheng, Yu; Li, Lan-Fen
2007-09-01
A potential target for antibiotic drug design, d-alanine-d-alanine ligase from S. mutans, was expressed in E. coli, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. d-Alanine-d-alanine ligase is encoded by the gene ddl (SMU-599) in Streptococcus mutans. This ligase plays a very important role in cell-wall biosynthesis and may be a potential target for drug design. To study the structure and function of this ligase, the gene ddl was amplified from S. mutans genomic DNA and cloned into the expression vector pET28a. The protein was expressed in soluble form in Escherichia coli strain BL21 (DE3). Homogeneous proteinmore » was obtained using a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Purified protein was crystallized and the cube-shaped crystal diffracted to 2.4 Å. The crystal belongs to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 79.50, c = 108.97 Å. There is one molecule per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fernández, Israel S.; Ständker, Ludger; Hannover Medical School, Center of Pharmacology, 30625 Hannover
2007-08-01
The cloning, expression, purification and crystallization of recombinant human kallikrein 7, directly synthesized in the active form in E. coli, is described. Diffraction data were collected to 2.8 Å resolution from native crystals. Human kallikreins are a group of serine proteases of high sequence homology whose genes are grouped as a single cluster at chromosome 19. Although the physiological roles of kallikreins are generally still unknown, members of the kallikrein family have been clearly implicated in pathological situations such as cancer and psoriasis. Human kallikrein 7 (hK7) has been shown to be involved in pathological keratinization, psoriasis and ovarian cancer.more » In order to gain insight into the molecular structure of this protein, hK7 was crystallized after recombinant production in its folded and active form using a periplasmic secretion vector in Escherichia coli. The crystals belonged to the rhombohedral space group H32 and diffracted to 2.8 Å. The phase problem was solved by molecular replacement using the mouse kallikrein-related protein neuropsin. Completion of the model and structure refinement are under way.« less
Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian Peter
2014-05-01
Ergothioneine is an amino-acid betaine derivative of histidine that was discovered more than one century ago. Despite significant research pointing to a function in oxidative stress defence, the exact mechanisms of action of ergothioneine remain elusive. Although both humans and bacterial pathogens such as Mycobacterium tuberculosis seem to depend on ergothioneine, humans are devoid of the corresponding biosynthetic enzymes. Therefore, its biosynthesis may emerge as potential drug target in the development of novel therapeutics against tuberculosis. The recent identification of ergothioneine-biosynthetic genes in M. smegmatis enables a more systematic study of its biology. The pathway is initiated by EgtD, a SAM-dependent methyltransferase that catalyzes a trimethylation reaction of histidine to give N(α),N(α),N(α)-trimethylhistidine. Here, the recombinant production, purification and crystallization of EgtD are reported. Crystals of native EgtD diffracted to 2.35 Å resolution at a synchrotron beamline, whereas crystals of seleno-L-methionine-labelled protein diffracted to 1.75 Å resolution and produced a significant anomalous signal to 2.77 Å resolution at the K edge. All of the crystals belonged to space group P212121, with two EgtD monomers in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing
2005-09-01
Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less
Skylab 3 and 4 science demonstrations: Preliminary report
NASA Technical Reports Server (NTRS)
Bannister, T. C.
1974-01-01
Twelve science demonstrations were accomplished on the Skylab 3 and 4 missions. These were defined in response to crew requests for time-gap fillers and were designed to be accomplished using onboard equipment. The following 12 are described and the preliminary results are given: liquid floating zone; diffusion in liquids; ice melting; immiscible liquids; liquid films; gyroscope; Rochelle salt growth; deposition of silver crystals; fluid mechanics series; neutron environment; orbital mechanics; and charged particle mobility.
A preliminary evaluation of a dual crystal positron camera
NASA Astrophysics Data System (ADS)
Holte, S.; Ostertag, H.; Kesselberg, M.
1987-03-01
A dual crystal whole body camera based on Bi4Ge3O12 and Gd2SiO5 was built. Spatial transaxial resolution is better than 5 mm FWH1, with maintained high sensitivity. The system can be equipped with up to four rings to give sufficient coverage of the organs under study. It can perform true dynamic function studies with frame rates of the order of 1 sec or less and can handle high data acquisition rates, encountered in cerebral blood flow studies and in perfusion studies of the heart, with low dead time losses. High sampling redundancy is achieved by wobbling over two detector channels. Fast image reconstructions is achieved by an array processor. Tilting and rotating capabilities of the gantry facilitate the anatomical alignment of the image plane. A rotating line source is used for accurate transmission images with a low scatter level.
Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII
NASA Technical Reports Server (NTRS)
Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.
1999-01-01
Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.
Kim, Keon Young; Kim, Sunmin; Park, Jeong Kuk; Song, HyoJin; Park, SangYoun
2014-01-01
Full-length SigR from Streptomyces coelicolor A3(2) was overexpressed in Escherichia coli, purified and submitted to crystallization trials using either polyethylene glycol 3350 or 4000 as a precipitant. X-ray diffraction data were collected to 2.60 Å resolution under cryoconditions using synchrotron X-rays. The crystal packs in space group P43212, with unit-cell parameters a = b = 42.14, c = 102.02 Å. According to the Matthews coefficient, the crystal asymmetric unit cannot contain the full-length protein. Molecular replacement with the known structures of region 2 and region 4 as independent search models indicates that the crystal contains only the −35 element-binding carboxyl-terminal region 4 of full-length SigR. Mass-spectrometric analysis of the harvested crystal confirms this, suggesting a crystal volume per protein weight (V M) of 2.24 Å3 Da−1 and 45.1% solvent content. PMID:24915084
Jang, Tae-ho; Park, Hyun Ho
2009-06-03
Caspase-2 activation by formation of PIDDosome is critical for genotoxic stress induced apoptosis. PIDDosome is composed of three proteins, RAIDD, PIDD, and Caspase-2. RAIDD is an adaptor protein containing an N-terminal Caspase-Recruiting-Domain (CARD) and a C-terminal Death-Domain (DD). Its interactions with Caspase-2 and PIDD through CARD and DD respectively and formation of PIDDosome are important for the activation of Caspase-2. RAIDD DD cloned into pET26b vector was expressed in E. coli cells and purified by nickel affinity chromatography and gel filtration. Although it has been known that the most DDs are not soluble in physiological condition, RAIDD DD was soluble and interacts tightly with PIDD DD in physiological condition. The purified RAIDD DD alone has been crystallized. Crystals are trigonal and belong to space group P3(1)21 (or its enantiomorph P3(2)21) with unit-cell parameters a = 56.3, b = 56.3, c = 64.9 A and gamma = 120 degrees . The crystals were obtained at room temperature and diffracted to 2.0 A resolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru
2015-09-15
Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp.more » gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.« less
Preliminary crystallographic analysis of avian infectious bronchitis virus main protease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jun; Shen, Wei; Liao, Ming, E-mail: mliao@scau.edu.cn
The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed inmore » Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago
2006-02-01
D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke
2007-08-01
Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke
2007-01-01
Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368
Crystallization and preliminary X-ray analysis of copper amine oxidase from Escherichia coli K-12.
Roh, J H; Suzuki, H; Kumagai, H; Yamashita, M; Azakami, H; Murooka, Y; Mikami, B
1994-05-13
Copper-containing monoamine oxidase (MAO) from Escherichia coli was overproduced in the periplasmic space by expression of the cloned gene. The purified MAO has been crystallized by means of the hanging drop technique using sodium citrate as a precipitant. The crystals belong to the orthorhombic system, space group P2(1)2(1)2(1), with unit cell dimensions of a = 136.1 A, b = 168.4 A and c = 81.6 A. The asymmetric unit contains one molecule of MAO, with a crystal volume per protein mass (Vm) of 2.88 A3/Da and a solvent content of 58% by volume. The crystals diffract X-rays to a resolution limit of at least 2.7 A and are resistant to X-ray radiation damage. They appear to be suitable for X-ray structure analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garcia-Pino, Abel; Loris, Remy; Wyns, Lode
2005-10-01
The lectin from the Nigerian legume B. mildbraedii was crystallized in complex with Man(α1-2)Man and data were collected to a resolution of 1.90 Å using synchrotron radiation. The lectin from Bowringia mildbraedii seeds crystallizes in the presence of the disaccharide Man(α1-2)Man. The best crystals grow at 293 K within four weeks after a pre-incubation at 277 K to induce nucleation. A complete data set was collected to a resolution of 1.90 Å using synchrotron radiation. The crystals belong to space group I222, with unit-cell parameters a = 66.06, b = 86.35, c = 91.76 Å, and contain one lectin monomermore » in the asymmetric unit.« less
Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin
2013-04-01
Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.
High-resolution electron microscopy and its applications.
Li, F H
1987-12-01
A review of research on high-resolution electron microscopy (HREM) carried out at the Institute of Physics, the Chinese Academy of Sciences, is presented. Apart from the direct observation of crystal and quasicrystal defects for some alloys, oxides, minerals, etc., and the structure determination for some minute crystals, an approximate image-contrast theory named pseudo-weak-phase object approximation (PWPOA), which shows the image contrast change with crystal thickness, is described. Within the framework of PWPOA, the image contrast of lithium ions in the crystal of R-Li2Ti3O7 has been observed. The usefulness of diffraction analysis techniques such as the direct method and Patterson method in HREM is discussed. Image deconvolution and resolution enhancement for weak-phase objects by use of the direct method are illustrated. In addition, preliminary results of image restoration for thick crystals are given.
Performance of the x-ray free-electron laser oscillator with crystal cavity
NASA Astrophysics Data System (ADS)
Lindberg, R. R.; Kim, K.-J.; Shvyd'Ko, Yu.; Fawley, W. M.
2011-01-01
Simulations of the x-ray free-electron laser (FEL) oscillator are presented that include the frequency-dependent Bragg crystal reflectivity and the transverse diffraction and focusing using the two-dimensional FEL code GINGER. A review of the physics of Bragg crystal reflectors and the x-ray FEL oscillator is made, followed by a discussion of its numerical implementation in GINGER. The simulation results for a two-crystal cavity and realistic FEL parameters indicate ˜109 photons in a nearly Fourier-limited, ps pulse. Compressing the electron beam to 100 A and 100 fs results in comparable x-ray characteristics for relaxed beam emittance, energy spread, and/or undulator parameters, albeit in a larger radiation bandwidth. Finally, preliminary simulation results indicate that the four-crystal FEL cavity can be tuned in energy over a range of a few percent.
Balasubramanian, Anuradha; Ponnuraj, Karthe
2008-07-01
Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 A resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 A.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ni, Shuisong; McAteer, Kathleen; Bussiere, Dirksen E.
2004-06-01
CylR2 is one of the two regulatory proteins associated with the quorum-sensing-dependent synthesis of cytolysin for the common pathogen Enterococcus faecalis. The protein was expressed with a C-terminal 6-histidine tag and purified to homogeneity with a cobalt affinity column followed by another size exclusion column. Both native and SeMet proteins were crystallized. A complete X-ray diffraction data set from the native crystal was collected to 2.3 resolution. The crystal was tetragonal, belonging to space group P41/43, with unit-cell dimensions a=b=66.2 , c=40.9 and a=b=g=90. The asymmetric unit contained two molecules of CylR2.
Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.; ...
2017-03-29
Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.
Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less
Exploring a Physically Based Tool for Lightning Cessation: A Preliminary Study
NASA Technical Reports Server (NTRS)
Schultz, Elise V.; Petersen, Walter a.; Carey, Lawrence D.; Deierling, Wiebke
2010-01-01
The University of Alabama in Huntsville (UA Huntsville) and NASA's Marshall Space Flight Center are collaborating with the 45th Weather Squadron (45WS) at Cape Canaveral Air Force Station (CCAFS) to enable improved nowcasting of lightning cessation. The project centers on use of dual-polarimetric radar capabilities, and in particular, the new C-band dual-polarimetric weather radar acquired by the 45WS. Special emphasis is placed on the development of a physically based operational algorithm to predict lightning cessation. While previous studies have developed statistically based lightning cessation algorithms, we believe that dual-polarimetric radar variables offer the possibility to improve existing algorithms through the inclusion of physically meaningful trends reflecting interactions between in-cloud electric fields and microphysics. Specifically, decades of polarimetric radar research using propagation differential phase has demonstrated the presence of distinct phase and ice crystal alignment signatures in the presence of strong electric fields associated with lightning. One question yet to be addressed is: To what extent can these ice-crystal alignment signatures be used to nowcast the cessation of lightning activity in a given storm? Accordingly, data from the UA Huntsville Advanced Radar for Meteorological and Operational Research (ARMOR) along with the North Alabama Lightning Mapping Array are used in this study to investigate the radar signatures present before and after lightning cessation. A summary of preliminary results will be presented.
Melt Stirring by Horizontal Crucible Vibration
NASA Technical Reports Server (NTRS)
Wolf, M. F.; Elwell, D.; Feigelson, R. S.
1985-01-01
Horizontal vibration suggested as technique for more effective stirring of melts in crystal-growth apparatus. Vibrational technique may replace accelerated crucible rotation. Potential superiority of vibrational technique shown by preliminary experiments in which ink stirred into water.
Characterization of a bent Laue double-crystal beam-expanding monochromator
Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo; ...
2017-10-19
A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less
Characterization of a bent Laue double-crystal beam-expanding monochromator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo
A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less
Development of high repetition rate nitric oxide planar laser induced fluorescence imaging
NASA Astrophysics Data System (ADS)
Jiang, Naibo
This thesis has documented the development of a MHz repitition rate pulse burst laser system. Second harmonic and third harmonic efficiencies are improved by adding a Phase Conjugate Mirror to the system. Some high energy fundamental, second harmonic, and third harmonic burst sequences consisting of 1--12 pulses separated in time by between 4 and 12 microseconds are now routinely obtained. The reported burst envelopes are quite uniform. We have also demonstrated the ability to generate ultra-high frequency sequences of broadly wavelength tunable, high intensity laser pulses using a home built injection seeded Optical Parametric Oscillator (OPO), pumped by the second and third harmonic output of the pulse burst laser. Typical OPO output burst sequences consist of 6--10 pulses, separated in time by between 6 and 10 microseconds. With third harmonic pumping of the OPO system, we studied four conditions, two-crystal Singly Resonant OPO (SRO) cavity, three-crystal OPO cavity, single pass two-crystal Doubly Resonant OPO (DRO) cavity and double pass two-crystal OPO cavity. The double pass two-crystal OPO cavity gives the best operation in burst mode. For single pass OPO, the average total OPO conversion efficiency is approximately 25%. For double pass OPO, the average total OPO conversion efficiency is approximately 35%. As a preliminary work, we studied 532nm pumping of a single crystal OPO cavity. With single pulse pumping, the conversion efficiency can reach 30%. For both 355nm and 532nm pumping OPO, we have demonstrated injection seeding. The OPO output light linewidth is significantly narrowed. Some preliminary etalon traces are also reported. By mixing the OPO signal output at 622nm with residual third harmonic at 355nm, we obtained 226nm burst sequences with average pulse energy of ˜0.2 mJ. Injection seeding of the OPO increases the energy achieved by a factor of ˜2. 226nm burst sequences with reasonably uniform burst envelopes are reported. Using the system we have obtained, for the first time by any known optical method, Planar Laser Induced Fluorescence (PLIF) image sequences at ultrahigh (≥100kHz) frame rates, in particular NO PLIF image sequences, have been obtained in a Mach 2 jet. We also studied the possibility of utilizing a 250 kHz pulsed Nd:YVO 4 laser as the master oscillator. 10-pulse-10-mus spacing burst sequences with reasonably uniform burst envelope have been obtained. The total energy of the burst sequence is ˜2.5J.
Low Temperature Flux Growth of 2H-SiC and Beta-Gallium Oxide
NASA Technical Reports Server (NTRS)
Singh, N. B.; Choa, Fow-Sen; Su, Ching-Hua; Arnold, Bradley; Kelly, Lisa
2016-01-01
We present brief overview of our study on the low temperature flux growth of two very important novel wide bandgap materials 2H-SiC and Beta-gallium oxide (Beta-Ga2O3). We have synthesized and grown 5 millimeter to 1 centimeter size single crystals of Beta-gallium oxide (Beta-Ga2O3). We used a flux and semi wet method to grow transparent good quality crystals. In the semi-wet method Ga2O3 was synthesized with starting gallium nitrate solution and urea as a nucleation agent. In the flux method we used tin and other metallic flux. This crystal was placed in an alumina crucible and temperature was raised above 1050 degrees Centigrade. After a time period of thirty hours, we observed prismatic and needle shaped crystals of gallium oxide. Scanning electron microscopic studies showed step growth morphology. Crystal was polished to measure the properties. Bandgap was measured 4.7electronvolts using the optical absorption curve. Another wide bandgap hexagonal 2H-SiC was grown by using Si-Al eutectic flux in the graphite crucible. We used slight AlN also as the impurity in the flux. The temperature was raised up to 1050 degrees Centigrade and slowly cooled to 850 degrees Centigrade. Preliminary characterization results of this material are also reported.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan
2008-05-01
A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less
STS study on single crystal of noncentrosymmetric superconductor PbTaSe2
NASA Astrophysics Data System (ADS)
Ye, Zhiyang; Wu, Rui; Wang, Jihui; Liang, Xuejin; Mao, Hanqing; Zhao, Lingxiao; Chen, Genfu; Pan, Shuheng
2015-03-01
We report our low temperature scanning tunneling spectroscopic study on single crystals of noncentrosymmetric superconductor PbTaSe2. On the background of the normal state tunneling spectrum, a superconducting energy gap opens at a temperature below the bulk Tc = 3.7K. At t = 1.4K, the gap magnitude is estimated to be about 1meV. This energy gap is particle-hole symmetry and is homogeneous in space. Extrapolating the low energy part of the spectrum, we find that the low energy part of the gap spectrum is linear like ``V'' shape. We will present the results of the numerical fit with various gap functions of proposed possible pairing symmetry. We will also present our preliminary results of the magnetic field dependence measurement and discuss the implications of these observations.
Offermann, Lesa R; He, John Z; Mank, Nicholas J; Booth, William T; Chruszcz, Maksymilian
2014-03-01
The production of macromolecular crystals suitable for structural analysis is one of the most important and limiting steps in the structure determination process. Often, preliminary crystallization trials are performed using hundreds of empirically selected conditions. Carboxylic acids and/or their salts are one of the most popular components of these empirically derived crystallization conditions. Our findings indicate that almost 40 % of entries deposited to the Protein Data Bank (PDB) reporting crystallization conditions contain at least one carboxylic acid. In order to analyze the role of carboxylic acids in macromolecular crystallization, a large-scale analysis of the successful crystallization experiments reported to the PDB was performed. The PDB is currently the largest source of crystallization data, however it is not easily searchable. These complications are due to a combination of a free text format, which is used to capture information on the crystallization experiments, and the inconsistent naming of chemicals used in crystallization experiments. Despite these difficulties, our approach allows for the extraction of over 47,000 crystallization conditions from the PDB. Initially, the selected conditions were investigated to determine which carboxylic acids or their salts are most often present in crystallization solutions. From this group, selected sets of crystallization conditions were analyzed in detail, assessing parameters such as concentration, pH, and precipitant used. Our findings will lead to the design of new crystallization screens focused around carboxylic acids.
Schellenberger, Pascale; Demangeat, Gérard; Lemaire, Olivier; Ritzenthaler, Christophe; Bergdoll, Marc; Oliéric, Vincent; Sauter, Claude; Lorber, Bernard
2011-05-01
The small icosahedral plant RNA nepovirus Grapevine fanleaf virus (GFLV) is specifically transmitted by a nematode and causes major damage to vineyards worldwide. To elucidate the molecular mechanisms underlying the recognition between the surface of its protein capsid and cellular components of its vector, host and viral proteins synthesized upon infection, the wild type GFLV strain F13 and a natural mutant (GFLV-TD) carrying a Gly₂₉₇Asp mutation were purified, characterized and crystallized. Subsequently, the geometry and volume of their crystals was optimized by establishing phase diagrams. GFLV-TD was twice as soluble as the parent virus in the crystallization solution and its crystals diffracted X-rays to a resolution of 2.7 Å. The diffraction limit of GFLV-F13 crystals was extended from 5.5 to 3 Å by growth in agarose gel. Preliminary crystallographic analyses indicate that both types of crystals are suitable for structure determination. Keys for the successful production of GFLV crystals include the rigorous quality control of virus preparations, crystal quality improvement using phase diagrams, and crystal lattice reinforcement by growth in agarose gel. These strategies are applicable to the production of well-diffracting crystals of other viruses and macromolecular assemblies. Copyright © 2011 Elsevier Inc. All rights reserved.
Preliminary Results from Pyroelectric Crystal Accelerator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Tom; Edwards, Ronald; Bright, Kevin
The Nuclear Science and Engineering Research Center (NSERC), a Defense Threat Reduction Agency (DTRA) office located at the United States Military Academy (USMA), sponsors and manages cadet and faculty research in support of DTRA objectives. Cadets in the Department of Physics and Nuclear Engineering at USMA are using pyroelectric crystals to ionize and accelerate residual gas trapped inside a vacuum system. A system using two lithium tantalate crystals with associated diagnostics was designed and is now operational. X-ray energies of approximately 150 keV have been achieved. Future work will focus on developing a portable neutron generator using the D-D nuclearmore » fusion process.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajaj,M.; Moriyama, H.
2007-01-01
The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.
Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim
2006-03-01
Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.
Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.
2008-01-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065
Preliminary laboratory testing on the sound absorption of coupled cavity sonic crystal
NASA Astrophysics Data System (ADS)
Kristiani, R.; Yahya, I.; Harjana; Suparmi
2016-11-01
This paper focuses on the sound absorption performance of coupled cavity sonic crystal. It constructed by a pair of a cylindrical tube with different values in diameters. A laboratory test procedure after ASTM E1050 has been conducted to measure the sound absorption of the sonic crystal elements. The test procedures were implemented to a single coupled scatterer and also to a pair of similar structure. The results showed that using the paired structure bring a better possibility for increase the sound absorption to a wider absorption range. It also bring a practical advantage for setting the local Helmholtz resonant frequency to certain intended frequency.
Crystallization and preliminary X-ray diffraction data of β-galactosidase from Aspergillus niger.
Rico-Díaz, Agustín; Vizoso Vázquez, Ángel; Cerdán, M Esperanza; Becerra, Manuel; Sanz-Aparicio, Julia
2014-11-01
β-Galactosidase from Aspergillus niger (An-β-Gal), belonging to the family 35 glycoside hydrolases, hydrolyzes the β-galactosidase linkages in lactose and other galactosides. It is extensively used in industry owing to its high hydrolytic activity and safety. The enzyme has been expressed in yeasts and purified by immobilized metal-ion affinity chromatography for crystallization experiments. The recombinant An-β-Gal, deglycosylated to avoid heterogeneity of the sample, has a molecular mass of 109 kDa. Rod-shaped crystals grew using PEG 3350 as the main precipitant agent. A diffraction data set was collected to 1.8 Å resolution.
Timing properties of phosphor-coated polished LSO crystals.
Schmall, Jeffrey P; Roncali, Emilie; Berg, Eric; Viswanath, Varsha; Du, Junwei; Cherry, Simon R
2014-08-07
This study investigates a time-of-flight (TOF)-depth-of-interaction (DOI) detector design for positron emission tomography (PET), based on phosphor-coated lutetium oxyorthosilicate (LSO) scintillator crystals coupled to fast single channel photomultiplier tubes. Interaction of the scintillation light with the phosphor coating changes the pulse shape in a depth-dependent manner. 3 × 3 × 10 mm(3) LSO scintillation crystals with polished surfaces were characterized, with and without phosphor coating, to assess DOI capability and timing properties. Two different phosphor coating geometries were studied: coating of the top surface of the crystal, and the top plus half of the crystal sides. There was negligible depth dependency in the decay time when coating only the top surface, however there was a ∼10 ns difference in end-to-end decay time when coating the top plus half of the crystal sides, sufficient to support the use of three DOI bins (3.3 mm DOI bin width). The rise time of the half-coated phosphor crystal was slightly faster at all depths, compared to uncoated crystals, however the signal amplitude was lower. Phosphor coating resulted in depth-dependent photopeak positions with an energy resolution of 13.7%, at a depth of 1 mm, and 15.3%, at a depth of 9 mm, for the half-coated crystal. Uncoated LSO crystals showed no change in photopeak position as a function of depth, with an energy resolution of 10.4%. The head-on coincidence timing resolution (CTR) of two uncoated LSO crystals was 287 ps using constant fraction discrimination for time pick-off. With phosphor coating, the CTR of the top-coated crystal was 314 ps, compared to 384 ps for the half-coated crystal. We demonstrate that the trade-off between timing resolution and DOI resolution can be controlled by the phosphor coating geometry. Here we present preliminary results demonstrating that good DOI resolution can be achieved with only a modest 26% degradation in CTR.
Förster, Charlotte; Oberthuer, Dominik; Gao, Jiang; Eichert, André; Quast, Frederick G.; Betzel, Christian; Nitsche, Andreas; Erdmann, Volker A.; Fürste, Jens P.
2009-01-01
Locked nucleic acids (LNAs) are modified nucleic acids which contain a modified sugar such as β-d-2′-O,4′-C methylene-bridged ribofuranose or other sugar derivatives in LNA analogues. The β-d-2′-O,4′-C methylene ribofuranose LNAs in particular possess high stability and melting temperatures, which makes them of interest for stabilizing the structure of different nucleic acids. Aptamers, which are DNAs or RNAs targeted against specific ligands, are candidates for substitution with LNAs in order to increase their stability. A 7-mer helix derived from the terminal part of an aptamer that was targeted against ricin was chosen. The ricin aptamer originally consisted of natural RNA building blocks and showed high affinity in ricin binding. For future stabilization of the aptamer, the terminal helix has been constructed as an ‘all-locked’ LNA and was successfully crystallized in order to investigate its structural properties. Optimization of crystal growth succeeded by the use of different metal salts as additives, such as CuCl2, MgCl2, MnCl2, CaCl2, CoCl2 and ZnSO4. Preliminary X-ray diffraction data were collected and processed to 2.8 Å resolution. The LNA crystallized in space group P65, with unit-cell parameters a = 50.11, b = 50.11, c = 40.72 Å. The crystals contained one LNA helix per asymmetric unit with a Matthews coefficient of 3.17 Å3 Da−1, which implies a solvent content of 70.15%. PMID:19724123
The Effects of Impurities on Protein Crystal Growth and Nucleation: A Preliminary Study
NASA Technical Reports Server (NTRS)
Schall, Constance A.
1998-01-01
Kubota and Mullin (1995) devised a simple model to account for the effects of impurities on crystal growth of small inorganic and organic molecules in aqueous solutions. Experimentally, the relative step velocity and crystal growth of these molecules asymptotically approach zero or non-zero values with increasing concentrations of impurities. Alternatively, the step velocity and crystal growth can linearly approach zero as the impurity concentration increases. The Kubota-Mullin model assumes that the impurity exhibits Langmuirian adsorption onto the crystal surface. Decreases in step velocities and subsequent growth rates are related to the fractional coverage (theta) of the crystal surface by adsorbed impurities; theta = Kx / (I +Kx), x = mole fraction of impurity in solution. In the presence of impurities, the relative step velocity, V/Vo, and the relative growth rate of a crystal face, G/Go, are proposed to conform to the following equations: V/Vo approx. = G/Go = 1 - (alpha)(theta). The adsorption of impurity is assumed to be rapid and in quasi-equilibrium with the crystal surface sites available. When the value of alpha, an effectiveness factor, is one the growth will asymptotically approach zero with increasing concentrations of impurity. At values less than one, growth approaches a non-zero value asymptotically. When alpha is much greater than one, there will be a linear relationship between impurity concentration and growth rates. Kubota and Mullin expect alpha to decrease with increasing supersaturation and shrinking size of a two dimensional nucleus. It is expected that impurity effects on protein crystal growth will exhibit behavior similar to that of impurities in small molecule growth. A number of proteins were added to purified chicken egg white lysozyme, the effect on crystal nucleation and growth assessed.
Chao, E.C.T.; Minkin, J.A.; Thompson, C.L.
1974-01-01
Preliminary petrographic description and mineral composition of four hand samples (77135, 77115, 77075 and 77215) are presented. 77135, 77115, and 77075 all crystallized from fragment-laden melts; they are similar in textures but differ in grain size. 77135 and 77115 are pigeonite feldspathic basalts. On the basis of geologic and petrographic evidence, 77115 and 77075 are related; they formed, cooled, and consolidated before being engulfed in the vesicular 77135. The impact or igneous origin of the melts from which these rocks crystallized cannot be determined. 77215 is a shocked, strongly sheared and granulated microbreccia consisting of three major lithologies dominated by mineral clasts of orthopyroxene and calcic plagioclase. The orthopyroxene clasts contain coarse exsolved blebs of augite, suggesting a deep-seated origin. The major, minor, and trace element compositions of 77135, 77115, and 77075 are in general similar. They represent a major highland rock type, perhaps more important than anorthosites. ?? 1974.
DOE Office of Scientific and Technical Information (OSTI.GOV)
W Vallen Graham; A Magis; K Bailey
2011-12-31
Myosin light-chain kinase-dependent tight junction regulation is a critical event in inflammatory cytokine-induced increases in epithelial paracellular permeability. MLCK is expressed in human intestinal epithelium as two isoforms, long MLCK1 and long MLCK2, and MLCK1 is specifically localized to the tight junction, where it regulates paracellular permeability. The sole difference between these long MLCK splice variants is the presence of an immunoglobulin-like cell-adhesion molecule domain, IgCAM3, in MLCK1. To gain insight into the structure of the IgCAM3 domain, the IgCAM3 domain of MLCK1 has been expressed, purified and crystallized. Preliminary X-ray diffraction data were collected to 2.0 {angstrom} resolution andmore » were consistent with the primitive trigonal space group P2{sub 1}2{sub 1}2{sub 1}.« less
Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru
2009-01-01
Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737
Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru
2009-11-01
Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun
2008-08-01
Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less
Use of anomolous thermal imaging effects for multi-mode systems control during crystal growth
NASA Technical Reports Server (NTRS)
Wargo, Michael J.
1989-01-01
Real time image processing techniques, combined with multitasking computational capabilities are used to establish thermal imaging as a multimode sensor for systems control during crystal growth. Whereas certain regions of the high temperature scene are presently unusable for quantitative determination of temperature, the anomalous information thus obtained is found to serve as a potentially low noise source of other important systems control output. Using this approach, the light emission/reflection characteristics of the crystal, meniscus and melt system are used to infer the crystal diameter and a linear regression algorithm is employed to determine the local diameter trend. This data is utilized as input for closed loop control of crystal shape. No performance penalty in thermal imaging speed is paid for this added functionality. Approach to secondary (diameter) sensor design and systems control structure is discussed. Preliminary experimental results are presented.
Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin
2013-01-01
Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol
2006-10-01
CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balasubramanian, Anuradha; Ponnuraj, Karthe, E-mail: pkarthe@hotmail.com
Urease from pigeon pea was purified and crystallized and X-ray diffraction data were collected at 2.5 Å resolution. Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized andmore » the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å.« less
Ultrasonic/Sonic Drill for High Temperature Application
NASA Technical Reports Server (NTRS)
Bao, Xiaoqi; Bar-Cohen, Yoseph; Scott, James; Sherrit, Stewart; Widholm, Scott; Badescu, Mircea; Shrout, Tom; Jones, Beth
2010-01-01
Venus is one of the many significant scientific targets for NASA. New rock sampling tools with the ability to be operated at high temperatures of the order of 460 deg C are required for surface in-situ sampling/analysis missions. Piezoelectric materials such as LiNbO? crystals and Bismuth Titanate are potentially operational at the temperature range found on the surface of Venus. A study of the feasibility of producing piezoelectric drills for a temperature up to 500 deg C was conducted. The study includes investigation of the high temperature properties of piezoelectric crystals and ceramics with different formulas and doping. Several prototypes of Ultrasonic/Sonic Drill/Corers (USDC) driven by transducers using the high temperate piezoelectric ceramics and single LiNbO? crystal were fabricated. The transducers were analyzed by scanning the impedance at room temperature and 500 deg C under both low and high voltages. The drilling performances were tested at temperature up to 500 deg C. Preliminary results were previously reported [Bao et al, 2009]. In this paper, the progress is presented and the future works for performance improvements are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dharkar, Poorva D.; Anuradha, P.; Gaikwad, Sushama M.
2006-03-01
A lectin from Trichosanthes dioica seeds has been purified and crystallized using 25%(w/v) PEG 2K MME, 0.2 M ammonium acetate, 0.1 M Tris–HCl pH 8.5 and 50 µl 0.5%(w/v) n-octyl β-d-glucopyranoside as thick needles belonging to hexagonal space group P6{sub 4}. A lectin from Trichosanthes dioica seeds has been purified and crystallized using 25%(w/v) PEG 2K MME, 0.2 M ammonium acetate, 0.1 M Tris–HCl pH 8.5 and 50 µl 0.5%(w/v) n-octyl β-d-glucopyranoside as thick needles belonging to hexagonal space group P6{sub 4}. Unit-cell parameters were a = b = 167.54, c = 77.42 Å. The crystals diffracted to a Braggmore » spacing of 2.8 Å. Both the structures of abrin-a and T. kirilowii lectin could be used as a model in structure determination using the molecular-replacement method; however, T. kirilowii lectin coordinates gave better values of reliability and correlation parameters. The thermal, chemical and pH stability of this lectin have also been studied. When heated, its haemagglutination activity remained unaffected up to 363 K. Other stability studies show that 4 M guanidinium hydrochloride (Gdn–HCl) initiates unfolding and that the protein is completely unfolded at 6 M Gdn–HCl. Treatment with urea resulted in a total loss of activity at higher concentrations of denaturant with no major structural changes. The protein remained stable over a wide pH range, from pH 6 to pH 12, except for partial unfolding at extremely alkaline pH. The role of disulfide bonds in the protein stability was found to be insignificant. Rayleigh light-scattering studies showed no molecular aggregation in any of the extreme treated conditions. The unusual stability of this lectin resembles that of type II ribosome-inactivating proteins (type II RIPs), which is also supported by structure determination. The structural features observed in a preliminary electron-density map were compared with the other two available Trichosanthes lectin structures.« less
NASA Astrophysics Data System (ADS)
Munoz, M.; Farges, F.; Andreani, M.; Ulrich, M.; Marcaillou, C.; Mathon, O.
2014-12-01
The understanding of the crystal chemistry of serpentine minerals (incl. antigorite, lizardite and chrysotile) is fundamental since serpentinization processes concern very large scientific domains: e.g., natural abiotic hydrogen production (Marcaillou et al., 2011), origins of life (Russell et al., 2010), fluid properties and mobility of metals in subduction zones (Kelley and Cottrell, 2009). This study aims at characterizing relations between the micro-, and nano-structures of the most abundant serpentine polytypes in the oceanic crust. Serpentine theoretical formula is Mg3Si2O5(OH)4 but several natural substitutions are possible and the formula may be written such as: (Mg,Fe2+,Fe3+,Al)3(Si,Al,Fe3+)2O5(OH)4; showing that Fe and Al may play an important role in the crystallization of serpentines. Preliminary crystal chemistry studies, suggest that, 1) the Al content alone cannot be directly correlated to serpentine polytypes (Andreani et al., 2008), 2) the amounts of tetrahedral iron can be significant in the presence of ferric iron (Marcaillou et al., 2011). Because magnetite is usually associated to serpentine, the Fe-speciation characterization of serpentine is delicate. Here, we provide the study of 33 magnetite-free serpentines containing various amounts of Fe and Al. The samples were characterized by SEM, Raman, XRF, as well as XANES, pre-edge, and EXAFS spectroscopy at the Fe K-edge. XANES experimental data were crosschecked and interpreted thanks to ab initio calculations and EXAFS shell-fitting. Also, preliminary 27Al-RMN data is presented. Results suggest relationships between the type and amount of substitution of trivalent cations in minerals, and the microstructures observed. Chrysotile incorporates less trivalent cations than other varieties, which tends to preserve the so-called misfit between the TO layers, and therefore the tubular structure of the mineral. Lizardites mainly involve Fe/Al Tschermak-type substitutions, while M-site vacancy charge-compensation mechanisms could be favored for antigorite crystals. ReferencesAndréani et al., 2008, European Journal of Mineralogy, 20, 159-171. Kelley and Cottrell, 2009, Science, 325, 605-607. Marcaillou et al., 2011, Earth And Planetary Science Letters, 303, 281-290. Russell et al., 2010, Geobiology, 8, 355-371.
Development of a High Precision Axial 3-D PET for Brain Imaging
NASA Astrophysics Data System (ADS)
Bolle, E.; Braem, A.; Casella, C.; Chesi, E.; Clinthorne, N.; Cochran, E.; De Leo, R.; Dissertori, G.; Djambazov, L.; Honscheid, K.; Huh, S.; Johnson, I.; Joram, C.; Kagan, H.; Lacasta, C.; Lustermann, W.; Meddi, F.; Nappi, E.; Nessi-Tedaldi, F.; Oliver, J. F.; Pauss, F.; Rafecas, M.; Renker, D.; Rudge, A.; Schinzel, D.; Schneider, T.; Séguinot, J.; Smith, S.; Solevi, P.; Stapnes, S.; Vilardi, I.; Weilhammer, P.
2009-12-01
We describe a PET device based on a novel method to extract the coordinates of the interaction point of the 511keV γ rays from 100 mm long and thin LYSO (Lutetium Yttrium OxyorthoSilicate) scintillator bars, positioned axially in the tomograph. The coordinate along the hit crystal is measured by using a hodoscope of Wave Length Shifting (WLS) plastic strips mounted perpendicularly to each plane of scintillators. As photodetectors, new Geiger mode Avalanche PhotoDetectors (G-APDs) with integrated electronics are being used to detect both the hit crystal in a block (x and y coordinates) and the interaction point in the crystal (z coordinate) through the light escaping from the crystal and transmitted to the WLS strips. In this way, the γ interaction point can be determined with a spatial resolution of few cubic millimeters down to a minimum deposited energy of about 50 keV, resulting in a volumetric precision very close to the limits imposed by the physics of the positron annihilation. The method allows to increase the detection efficiency without affecting the spatial resolution by adding scintillator planes in the radial direction. A demonstrator scanner, based on two matrices of 8 × 6 LYS crystals and 312 WLS strips, slotted in between the crystals, is under construction. Preliminary results from the feasibility studies of the various components will be presented.
Ding, L; Zhang, Y; Deacon, A M; Ealick, S E; Ni, Y; Sun, P; Coleman, W G
1999-03-01
ADP-L-glycero-D-mannoheptose 6-epimerase is a 240 kDa NAD-dependent nucleotide diphosphosugar epimerase from Escherichia coli K12 which catalyzes the interconversion of ADP-D-glycero-D-mannoheptose and ADP-L-glycero-D-mannoheptose. ADP-L-glycero-D-mannoheptose is a required intermediate for lipopolysaccharide inner-core and outer-membrane biosynthesis in several genera of pathogenic and non-pathogenic Gram-negative bacteria. ADP-L-glycero-D-mannoheptose 6-epimerase was overexpressed in E. coli and purified to apparent homogeneity by chromatographic methods. Three crystal forms of the epimerase were obtained by a hanging-drop vapor-diffusion method. A native data set for crystal form III was collected in-house on a Rigaku R-AXIS-IIC image plate at 3.0 A resolution. The form III crystals belong to the monoclinic space group P21. The unit-cell parameters are a = 98.94, b = 110.53, c = 180.68 A and beta = 90.94 degrees. Our recent results show that these crystals diffract to 2.0 A resolution at the Cornell High Energy Synchrotron Source. The crystal probably contains six 40 kDa monomers per asymmetric unit, with a corresponding volume per protein mass (Vm) of 4.11 A3 Da-1 and a solvent fraction of 70%.
Balasubramanian, Anuradha; Ponnuraj, Karthe
2008-01-01
Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å. PMID:18607103
Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi
2009-01-01
2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007
Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki
2007-01-01
BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725
Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit
2011-03-01
Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.
Lartigue, Audrey; Gruez, Arnaud; Briand, Loïc; Pernollet, Jean-Claude; Spinelli, Silvia; Tegoni, Mariella; Cambillau, Christian
2003-05-01
Pheromone-binding proteins (PBPs) are small helical proteins ( approximately 13-17 kDa) present in various sensory organs from moths and other insect species. They are involved in the transport of pheromones from the sensillar lymph to the olfactory receptors. Here, crystals of a PBP (Amel-ASP1) originating from honeybee (Apis mellifera L.) antennae and expressed as recombinant protein using the yeast Pichia pastoris are reported. Crystals of Amel-ASP1 have been obtained by the sitting-drop vapour-diffusion method using a nanodrop-dispensing robot under the following conditions: 200 nl of 40 mg ml(-1) protein solution in 10 mM Tris, 25 mM NaCl pH 8.0 was mixed with 100 nl of well solution containing 0.15 M sodium citrate, 1.5 M ammonium sulfate pH 5.5. The protein crystallizes in space group C222(1), with unit-cell parameters a = 74.8, b = 85.8, c = 50.2 A. With one molecule in the asymmetric unit, V(M) is 3.05 A(3) Da(-1) and the solvent content is 60%. A complete data set has been collected at 1.6 A resolution on beamline ID14-2 (ESRF, Grenoble). The nanodrop crystallization technique used with a novel optimization procedure made it possible to consume small amounts of protein and to obtain a unique crystal per nanodrop, suitable directly for data collection in-house or at a synchrotron-radiation source.
NASA Astrophysics Data System (ADS)
Narayanan, A.; Titus, J.; Rajagopalan, H.; Vippa, P.; Thakur, M.
2006-03-01
Single-crystal film of DAST (4'-dimethylamino-N-methyl-4-stilbazolium tosylate) has been shown [1] to have exceptionally large electro-optic coefficients (r11 ˜ 770 pm/V at 633 nm). In this report, single crystal film of a combination of materials (co-crystal) involving DAST and a dye molecule IR-125 will be discussed. Modified shear method was used to prepare the co-crystal films. The film has been characterized using polarized optical microscopy, optical absorption spectroscopy and x-ray diffraction. The optical absorption spectrum has two major bands: one at about 350--600 nm corresponding to DAST and the other at about 600-900 nm corresponding to IR-125. The x-ray diffraction results show peaks involving the presence of DAST and IR-125 within the co-crystal film. Since the co-crystal has strong absorption at longer wavelengths it is expected to show higher electro-optic coefficients at longer wavelengths. Preliminary measurements at 1.55 μm indicate a high electro-optic coefficient of the co-crystal film. [1] Swamy, Kutty, Titus, Khatavkar, Thakur, Appl. Phys. Lett. 2004, 85, 4025; Kutty, Thakur, Appl. Phys. Lett. 2005, 87, 191111.
Fluorescence Approaches to Growing Macromolecule Crystals
NASA Technical Reports Server (NTRS)
Pusey, Marc; Forsythe, Elizabeth; Achari, Aniruddha
2006-01-01
Trace fluorescent labeling, typically < 1%, can be a powerful aid in macromolecule crystallization. Precipitation concentrates a solute, and crystals are the most densely packed solid form. The more densely packed the fluorescing material, the more brightly the emission from it, and thus fluorescence intensity of a solid phase is a good indication of whether one has crystals or not. The more brightly fluorescing crystalline phase is easily distinguishable, even when embedded in an amorphous precipitate. This approach conveys several distinct advantages: one can see what the protein is doing in response to the imposed conditions, and distinguishing between amorphous and microcrystalline precipitated phases are considerably simpler. The higher fluorescence intensity of the crystalline phase led us to test if we could derive crystallization conditions from screen outcomes which had no obvious crystalline material, but simply "bright spots" in the precipitated phase. Preliminary results show that the presence of these bright spots, not observable under white light, is indeed a good indicator of potential crystallization conditions.
Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kondou, Youhei; Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, Toyama; Kitazawa, Daisuke
2005-01-01
Bacteriophage Mu baseplate protein gene product 44 was crystallized. The crystal belongs to space group R3, with unit-cell parameters a = b = 126.6, c = 64.2 Å. Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-rays to at least 2.1 Å resolution andmore » are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ku, Min-Je; Lee, Won-Ho; Biotechnology and Genetic Engineering, Korea University, Seoul 136-701
2005-04-01
The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn{sup 2+} ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. Themore » asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V{sub M}) of 3.3 Å{sup 3} Da{sup −1} and a solvent content of 62.7%.« less
Campos, Bruna Medeia; Liberato, Marcelo Vizona; Polikarpov, Igor; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio
2015-03-01
In recent years, biofuels have attracted great interest as a source of renewable energy owing to the growing global demand for energy, the dependence on fossil fuels, limited natural resources and environmental pollution. However, the cost-effective production of biofuels from plant biomass is still a challenge. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases to polysaccharides, is crucial for enzyme development. Aiming at the structural and functional characterization of novel CBMs involved in plant polysaccharide deconstruction, an analysis of the CAZy database was performed and CBM family 64 was chosen owing to its capacity to bind with high specificity to microcrystalline cellulose and to the fact that is found in thermophilic microorganisms. In this communication, the CBM-encoding module named StX was expressed, purified and crystallized, and X-ray diffraction data were collected from native and derivatized crystals to 1.8 and 2.0 Å resolution, respectively. The crystals, which were obtained by the hanging-drop vapour-diffusion method, belonged to space group P3121, with unit-cell parameters a = b = 43.42, c = 100.96 Å for the native form. The phases were found using the single-wavelength anomalous diffraction method.
Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus
Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko
2013-01-01
Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P212121, with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å. PMID:23295485
Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus.
Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko
2013-01-01
Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å.
A new promising nonlinear optical (NLO) crystal for visible and ultraviolet (UV) regions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gheorghe, L.; Achim, A.; Voicu, F.
Different La{sub 1−x}Gd{sub x}Sc{sub 3}(BO{sub 3}){sub 4} compounds with 0 ≤ x ≤ 0.5 were synthesized by solid-state reaction method. The X-ray diffraction studies revealed that the compounds containing more than 30 at.% Gd{sup 3+} ions have non-centrosymmetric trigonal structure (space group R32) and, consequently they are optically nonlinear. A crystal of La{sub x}Gd{sub y}Sc{sub z}(BO{sub 3}){sub 4} (x+y+z = 4) – LGSB with La{sub 0.75}Gd{sub 0.5}Sc{sub 2.75}(BO{sub 3}){sub 4} starting melt composition and relatively small dimensions (about 10 mm in diameter and 25 mm in length) was grown by the Czochralski method. In order to confirm the NLO property, the as-grownmore » crystal was subjected to second-harmonic generation (SHG) test. The nonlinear coefficient d{sub 11} of LGSB crystal has been preliminary estimated to be about 1.9 pm/V, which is larger than that of YAl{sub 3}(BO{sub 3}){sub 4} (YAB) crystal. This article has been formally retracted, please refer to the article PDF for the full retraction notice.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Foucault, M.; Watzlawick, H.; Mattes, R.
2006-02-01
The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution, respectively. α-Galactosidases from thermophilic organisms have gained interest owing to their applications in the sugar industry. The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution,more » respectively. Crystals of AgaB belong to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 87.5, b = 113.3, c = 161.6 Å. Crystals of AgaA A355E belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 150.1, c = 233.2 Å.« less
Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian Peter
2014-01-01
Ergothioneine is an amino-acid betaine derivative of histidine that was discovered more than one century ago. Despite significant research pointing to a function in oxidative stress defence, the exact mechanisms of action of ergothioneine remain elusive. Although both humans and bacterial pathogens such as Mycobacterium tuberculosis seem to depend on ergothioneine, humans are devoid of the corresponding biosynthetic enzymes. Therefore, its biosynthesis may emerge as potential drug target in the development of novel therapeutics against tuberculosis. The recent identification of ergothioneine-biosynthetic genes in M. smegmatis enables a more systematic study of its biology. The pathway is initiated by EgtD, a SAM-dependent methyltransferase that catalyzes a trimethylation reaction of histidine to give N(α),N(α),N(α)-trimethylhistidine. Here, the recombinant production, purification and crystallization of EgtD are reported. Crystals of native EgtD diffracted to 2.35 Å resolution at a synchrotron beamline, whereas crystals of seleno-l-methionine-labelled protein diffracted to 1.75 Å resolution and produced a significant anomalous signal to 2.77 Å resolution at the K edge. All of the crystals belonged to space group P212121, with two EgtD monomers in the asymmetric unit. PMID:24817736
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Hyun Ho; Tookes, Hansel Emory; Wu, Hao, E-mail: haowu@med.cornell.edu
2006-06-01
The D. melanogaster Drep-3 protein has been crystallized. Crystals were obtained at 293 K that diffracted to 2.8 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}. During apoptosis, DNA fragmentation is mainly mediated by the caspase-activated DFF40 nuclease. DFF40 exists as a heterodimeric complex with its inhibitor DFF45. Upon apoptosis induction, DFF45 is cleaved by caspases to allow DFF40 activation. Drep-3 is a recently identified regulator of the DFF40 system in Drosophila melanogaster. Here, Drep-3 was expressed with a C-terminal His tag in Escherichia coli and the protein was purified to homogeneity. Multi-angle light-scattering analysis showed thatmore » Drep-3 is a homotetramer in solution. Native and selenomethionine-substituted Drep-3 proteins were crystallized at 293 K and X-ray diffraction data were collected to 2.8 and 3.0 Å resolution, respectively. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 56.9, b = 125.4, c = 168.7 Å. The asymmetric unit is estimated to contain one homotetramer.« less
The inhibition of tetrahydrofuran clathrate-hydrate formation with antifreeze protein
NASA Astrophysics Data System (ADS)
Zeng, H.; Wilson, L. D.; Walker, V. K.; Ripmeester, J. A.
2003-01-01
The effect of Type I fish antifreeze protein (AFP) from the winter flounder, Pleuronectes americanus (Walbaum), (WfAFP) on the formation of tetrahydrofuran (THF) clathrate hydrate was studied by observing changes in THF crystal morphology and determining the induction time for nucleation. AFP retarded THF clathrate-hydrate growth at the tested temperatures and modified the THF clathrate-hydrate crystal morphology from octahedral to plate-like. AFP appears to be even more effective than the kinetic inhibitor, polyvinylpyrrolidone (PVP). Recombinant AFP from an insect, a spruce budworm, Choristoneura fumiferana (Clem.), moth, (Cf) was also tested for inhibition activity by observation of the THF-hydrate-crystal-growth habit. Like WfAFP, CfAFP appeared to show adsorption on multiple THF-hydrate-crystal faces. A protein with no antifreeze activity, cytochrome C, was used as a control and it neither changed the morphology of the THF clathrate-hydrate crystals, nor retarded the formation of the hydrate. Preliminary experiments on the inhibition activity of WfAFP on a natural gas hydrate assessed induction time and the amount of propane gas consumed. Similar to the observations for THF, the data indicated that WfAFP inhibited propane-hydrate growth. Taken together, these results support our hypothesis that AFPs can inhibit clathrate-hydrate growth and as well, offer promise for the understanding of the inhibition mechanism.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hehemann, Jan-Hendrik; Redecke, Lars; Perbandt, Markus
2007-03-01
Two trypsins from the gastric fluid of the marine crab C. pagurus were purified and crystallized and X-ray data were collected to 0.97 and 3.2 Å resolution. The digestive fluid of the marine crab Cancer pagurus (Decapoda, Brachyura) contains highly stable proteases which display enhanced activity in aqueous mixtures of organic solvents. Three trypsins were isolated from the gastric fluid and two of them, C.p.TryII and C.p.TryIII, were purified to homogeneity by anion-exchange chromatography and crystallized by hanging-drop vapour diffusion. Diffraction data were collected at a synchrotron to 0.97 and 3.2 Å resolution, respectively. The crystal of C.p.TryII belongs tomore » the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.06, b = 62.00, c = 71.66 Å. Based on the Matthews coefficient, one protein molecule per asymmetric unit is suggested. In contrast, crystals of C.p.TryIII, which belong to the cubic space group P2{sub 1}3 with unit-cell parameters a = b = c = 215.4 Å, are assumed to contain 12 molecules per asymmetric unit.« less
Chang, Shaojie; Song, Xiaomin; Yan, Ming; Zhou, Zhaocai; Wu, Fang; Gong, Weimin
2004-01-01
The proteins Spe31 and Spe32, named after their respective molecular weights of about 31 and 32 kDa, were purified simultaneously from the seeds of Pachyrrhizus erosus. They cannot be separated from each other by column chromatography. N-terminal sequence analysis indicated that they belonged to the papain family of cysteine proteases. An in-gel activity assay revealed that Spe31 possesses proteolytic activity while Spe32 only displays very weak activity for protein degradation. Both of them are glycoproteins as detected by the periodic acid and Schiff's reagent method. Crystals were obtained from the protein mixture by the hanging-drop vapour-diffusion method; they diffracted to a resolution of 2.61 A on an in-house X-ray source. The crystals belong to space group P4(1(3))2(1)2, with unit-cell parameters a = b = 61.96, c = 145.61 A. Gel electrophoresis under non-denaturing conditions showed that the protein crystallized was Spe31.
Wang, Hongpeng; Zhang, Yan; Zhang, Zhenyi; Jin, Wei Lin; Wu, Geng
2014-01-01
Bin-Amphiphysin-Rvs (BAR) domain proteins play essential roles in diverse cellular processes by inducing membrane invaginations or membrane protrusions. Among the BAR superfamily, the `classical' BAR and Fes/CIP4 homology BAR (F-BAR) subfamilies of proteins usually promote membrane invaginations, whereas the inverse BAR (I-BAR) subfamily generally incur membrane protrusions. Despite possessing an N-terminal F-BAR domain, the srGAP2 protein regulates neurite outgrowth and neuronal migration by causing membrane protrusions reminiscent of the activity of I-BAR domain proteins. In this study, the inverse F-BAR (IF-BAR) domain of human srGAP2 was overexpressed, purified and crystallized. The crystals of the srGAP2 IF-BAR domain protein diffracted to 3.50 Å resolution and belonged to space group P2(1). These results will facilitate further structural determination of the srGAP2 IF-BAR domain and the ultimate elucidation of its peculiar behaviour of inducing membrane protrusions rather than membrane invaginations.
Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.
2006-01-01
The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P41212 or P43212, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°. PMID:16820689
Single Crystal Fibers of Yttria-Stabilized Cubic Zirconia with Ternary Oxide Additions
NASA Technical Reports Server (NTRS)
Ritzert, F. J.; Yun, H. M.; Miner, R. V.
1997-01-01
Single crystal fibers of yttria (Y2O3)-stabilized cubic zirconia, (ZrO2) with ternary oxide additions were grown using the laser float zone fiber processing technique. Ternary additions to the ZrO2-Y2O3 binary system were studied aimed at increasing strength while maintaining the high coefficient of thermal expansion of the binary system. Statistical methods aided in identifying the most promising ternary oxide candidate (Ta2O5, Sc2O3, and HfO2) and optimum composition. The yttria, range investigated was 14 to 24 mol % and the ternary oxide component ranged from 1 to 5 mol %. Hafnium oxide was the most promising ternary oxide component based on 816 C tensile strength results and ease of fabrication. The optimum composition for development was 81 ZrO2-14 Y203-5 HfO2 based upon the same elevated temperature strength tests. Preliminary results indicate process improvements could improve the fiber performance. We also investigated the effect of crystal orientation on strength.
Rodríguez Guilbe, María M.; Alfaro Malavé, Elisa C.; Akerboom, Jasper; Marvin, Jonathan S.; Looger, Loren L.; Schreiter, Eric R.
2008-01-01
Fluorescent proteins and their engineered variants have played an important role in the study of biology. The genetically encoded calcium-indicator protein GCaMP2 comprises a circularly permuted fluorescent protein coupled to the calcium-binding protein calmodulin and a calmodulin target peptide, M13, derived from the intracellular calmodulin target myosin light-chain kinase and has been used to image calcium transients in vivo. To aid rational efforts to engineer improved variants of GCaMP2, this protein was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 126.1, b = 47.1, c = 68.8 Å, β = 100.5° and one GCaMP2 molecule in the asymmetric unit. The structure was phased by molecular replacement and refinement is currently under way. PMID:18607093
Use of Traveling Magnetic Fields to Control Melt Convection
NASA Technical Reports Server (NTRS)
Ramachandran, Narayanan; Mazuruk, Konstantin; Volz, Martin P.
2000-01-01
An axially traveling magnetic wave induces a meridional base flow in an electrically conducting molten cylindrical zone. This flow can be beneficial for crystal growth applications. In particular, it can be effectively used to stir the melt in long cylindrical columns. It can also be tailored to modify the thermal and species concentration fields in the melt and to control the interface shape of the growing crystal. The basic theory of such an application is developed and data from a preliminary mercury column experiment are presented.
Electronic excitations and chemistry in Nitromethane and HMX
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reed, E J; Manaa, M R; Joannopoulos, J D
2001-06-19
The nature of electronic excitations in crystalline solid nitromethane under conditions of shock loading and static compression are examined. Density functional theory calculations are used to determine the crystal bandgap under hydrostatic stress, uniaxial strain, and shear strain. Bandgap lowering under uniaxial strain due to molecular defects and vacancies is considered. In all cases, the bandgap is not lowered enough to produce a significant population of excited states in the crystal. Preliminary simulations on the formation of detonation product molecules from HMX are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mauracher, Stephan Gerhard; Molitor, Christian; Al-Oweini, Rami
Polyphenol oxidase 4 (PPO4) from the natural source A. bisporus was crystallized in its latent precursor form (pro-tyrosinase; Ser2–Thr565) using the 6-tungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}]·22H{sub 2}O as a crystallization additive. Tyrosinase exhibits catalytic activity for the ortho-hydroxylation of monophenols to diphenols as well as their subsequent oxidation to quinones. Owing to polymerization of these quinones, brown-coloured high-molecular-weight compounds called melanins are generated. The latent precursor form of polyphenol oxidase 4, one of the six tyrosinase isoforms from Agaricus bisporus, was purified to homogeneity and crystallized. The obtained crystals belonged to space group C121 (two molecules per asymmetric unit)more » and diffracted to 2.78 Å resolution. The protein only formed crystals under low-salt conditions using the 6-tungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}]·22H{sub 2}O as a co-crystallization agent.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Rongzhen; Xu, Yan, E-mail: biosean@yahoo.com.cn; Sun, Ying
2008-04-01
A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. Two distinct but related crystal forms of SCR were obtained using the hanging-drop vapour-diffusion method and a reservoir solution consisting of 18%(w/v) polyethylene glycol 2000 monomethyl ether and 8%(v/v) 2-propanol as the precipitant. The crystals were rhomboid in shape with average dimensions of 0.3 × 0.3 × 0.4 mm and diffracted to a resolution of 2.7–3.0 Å. The crystal forms both belong to space group P2{sub 1}2{sub 1}2{sub 1} and have unit-cell parameters a = 104.7, b = 142.8, cmore » = 151.8 Å and a = 101.1, b = 146.0, c = 159.8 Å. The calculated values of V{sub M}, rotation-function and translation-function solutions and consideration of potential crystal packing suggest that there are eight protein subunits per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid
2006-12-01
The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less
NASA Astrophysics Data System (ADS)
Bennati, P.; Dasu, A.; Colarieti-Tosti, M.; Lönn, G.; Larsson, D.; Fabbri, A.; Galasso, M.; Cinti, M. N.; Pellegrini, R.; Pani, R.
2017-05-01
We designed and tested new concept imaging devices, based on a thin scintillating crystal, aimed at the online monitoring of the range of protons in tissue during proton radiotherapy. The proposed crystal can guarantee better spatial resolution and lower sensitivity with respect to a thicker one, at the cost of a coarser energy resolution. Two different samples of thin crystals were coupled to a position sensitive photo multiplier tube read out by 64 independent channels electronics. The detector was equipped with a knife-edge Lead collimator that defined a reasonable field of view of about 10 cm in the target. Geant4 Monte Carlo simulations were used to optimize the design of the experimental setup and assess the accuracy of the results. Experimental measurements were carried out at the Skandion Clinic, the recently opened proton beam facility in Uppsala, Sweden. PMMA and water phantoms studies were performed with a first prototype based on a round 6.0 mm thick Cry019 crystal and with a second detector based on a thinner 5 × 5 cm2, 2.0 mm thick LFS crystal. Phantoms were irradiated with mono-energetic proton beams whose energy was in the range between 110 and 160 MeV. According with the simulations and the experimental data, the detector based on LFS crystal seems able to identify the peak of prompt-gamma radiation and its results are in fair agreement with the expected shift of the proton range as a function of energy. The count rate remains one of the most critical limitations of our system, which was able to cope with only about 20% of the clinical dose rate. Nevertheless, we are confident that our study might provide the basis for developing a new full-functional system.
The stability of a crystal with diamond structure for patchy particles with tetrahedral symmetry.
Noya, Eva G; Vega, Carlos; Doye, Jonathan P K; Louis, Ard A
2010-06-21
The phase diagram of model anisotropic particles with four attractive patches in a tetrahedral arrangement has been computed at two different values of the range of the potential, with the aim of investigating the conditions under which a diamond crystal can be formed. We find that the diamond phase is never stable for our longer-ranged potential. At low temperatures and pressures, the fluid freezes into a body-centered-cubic solid that can be viewed as two interpenetrating diamond lattices with a weak interaction between the two sublattices. Upon compression, an orientationally ordered face-centered-cubic crystal becomes more stable than the body-centered-cubic crystal, and at higher temperatures, a plastic face-centered-cubic phase is stabilized by the increased entropy due to orientational disorder. A similar phase diagram is found for the shorter-ranged potential, but at low temperatures and pressures, we also find a region over which the diamond phase is thermodynamically favored over the body-centered-cubic phase. The higher vibrational entropy of the diamond structure with respect to the body-centered-cubic solid explains why it is stable even though the enthalpy of the latter phase is lower. Some preliminary studies on the growth of the diamond structure starting from a crystal seed were performed. Even though the diamond phase is never thermodynamically stable for the longer-ranged model, direct coexistence simulations of the interface between the fluid and the body-centered-cubic crystal and between the fluid and the diamond crystal show that at sufficiently low pressures, it is quite probable that in both cases the solid grows into a diamond crystal, albeit involving some defects. These results highlight the importance of kinetic effects in the formation of diamond crystals in systems of patchy particles.
Exploring a Physically Based Tool for Lightning Cessation: Preliminary Results
NASA Technical Reports Server (NTRS)
Schultz, Elsie V.; Petersen, Walter A.; Carey, Lawrence D.; Buechler, Dennis E.; Gatlin, Patrick N.
2010-01-01
The University of Alabama in Huntsville (UAHuntsville) and NASA s Marshall Space Flight Center are collaborating with the 45th Weather Squadron (45WS) at Cape Canaveral Air Force Station (CCAFS) to enable improved nowcasting of lightning cessation. The project centers on use of dual-polarimetric radar capabilities, and in particular, the new C-band dual-polarimetric weather radar acquired by the 45WS. Special emphasis is placed on the development of a physically based operational algorithm to predict lightning cessation. While previous studies have developed statistically based lightning cessation algorithms, we believe that dual-polarimetric radar variables offer the possibility to improve existing algorithms through the inclusion of physically meaningful trends reflecting interactions between in-cloud electric fields and microphysics. Specifically, decades of polarimetric radar research using propagation differential phase has demonstrated the presence of distinct phase and ice crystal alignment signatures in the presence of strong electric fields associated with lightning. One question yet to be addressed is: To what extent can these ice-crystal alignment signatures be used to nowcast the cessation of lightning activity in a given storm? Accordingly, data from the UAHuntsville Advanced Radar for Meteorological and Operational Research (ARMOR) along with the North Alabama Lightning Mapping Array are used in this study to investigate the radar signatures present before and after lightning cessation. A summary of preliminary results will be presented.
Gaur, Vineet; Sethi, Dhruv K; Salunke, Dinakar M
2008-01-01
Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4(1) (or P4(3)), with unit-cell parameters a = b = 150.7, c = 164.9 A.
Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M.
2008-01-01
Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P41 (or P43), with unit-cell parameters a = b = 150.7, c = 164.9 Å. PMID:18097098
NASA Astrophysics Data System (ADS)
Knights, A. P.; Bradley, J. D. B.; Hulko, O.; Stevanovic, D. V.; Edwards, C. J.; Kallis, A.; Coleman, P. G.; Crowe, I. F.; Halsall, M. P.; Gwilliam, R. M.
2011-01-01
We describe preliminary results from studies of the formation of silicon nano-crystals (Si-ncs) embedded in stoichiometric, thermally grown SiO2 using Variable Energy Positron Annihilation Spectroscopy (VEPAS). We show that the VEPAS technique is able to monitor the introduction of structural damage. In SiO2 through the high dose Si+ ion implantation required to introduce excess silicon as a precursor to Si-nc formation. VEPAS is also able to characterize the rate of the removal of this damage with high temperature annealing, showing strong correlation with photoluminescence. Finally, VEPAS is shown to be able to selectively probe the interface between Si-ncs and the host oxide. Introduction of hydrogen at these interfaces suppresses the trapping of positrons at the interfaces.
CZT Detector Development for New Generation Hard-X Astronomical Instruments
NASA Astrophysics Data System (ADS)
Uslenghi, Michela; Conti, Giancarlo; D'Angelo, Sergio; Fiorini, Mauro; Quadrini, Egidio M.; Natalucci, Lorenzo; Ubertini, Pietro
2006-04-01
In the context of the definition of a future European gamma-ray mission, following the now on-orbit INTEGRAL observatory, we are carrying out a feasibility study on a Gamma Ray Wide Field Camera (5-500 KeV) for transient event detection. Recent achievements in high energy astronomy have validated the CZT detectors performances in terms of good spatial resolution, detection efficiency, energy resolution and low noise at room temperature. We started a development program aimed to explore the possibilities to improve and optimize the performance of this kind of detectors, acting at the level of both the readout system and crystal quality. Preliminary results of characterization of pixelated crystals provided by IMARAD (now Orbotech) are presented, along with their analysis and interpretation based on an analytical model of signal formation.
Iyaguchi, Daisuke; Yao, Min; Tanaka, Isao; Toyota, Eiko
2009-01-01
Adenylate/uridylate-rich elements (AREs), which are found in the 3′-untranslated region (UTR) of many mRNAs, influence the stability of cytoplasmic mRNA. HuR (human antigen R) binds to AREs and regulates various genes. In order to reveal the RNA-recognition mechanism of HuR protein, an RNA-binding region of human HuR containing two N-terminal RNA-recognition motif domains bound to an 11-base RNA fragment has been crystallized. The crystals belonged to space group P212121, with unit-cell parameters a = 42.4, b = 44.9, c = 91.1 Å. X-ray diffraction data were collected to 1.8 Å resolution. PMID:19255485
Microscopic evaluation and physiochemical analysis of Dillenia indica leaf
Kumar, S; Kumar, V; Prakash, Om
2011-01-01
Objective To study detail microscopic evaluation and physiochemical analysis of Dillenia indica (D. indica) leaf. Methods Fresh leaf sample and dried power of the leaf were studied macroscopically and microscopically. Preliminary phytochemical investigation of plant material was done. Other WHO recommended parameters for standardizations were also performed. Results The detail microscopy revealed the presence of anomocytic stomata, unicellular trichome, xylem fibres, calcium oxalate crystals, vascular bundles, etc. Leaf constants such as stomatal number, stomatal index, vein-islet number and veinlet termination numbers were also measured. Physiochemical parameters such as ash values, loss on drying, extractive values, percentage of foreign matters, swelling index, etc. were also determined. Preliminary phytochemical screening showed the presence of steroids, terpenoids, glycosides, fatty acids, flavonoids, phenolic compounds and carbohydrates. Conclusions The microscopic and physiochemical analysis of the D. indica leaf is useful in standardization for quality, purity and sample identification. PMID:23569789
Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim
2006-01-01
Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316
Linke, Christian; Siemens, Nikolai; Middleditch, Martin J.; Kreikemeyer, Bernd; Baker, Edward N.
2012-01-01
The extracellular protein Epf from Streptococcus pyogenes is important for streptococcal adhesion to human epithelial cells. However, Epf has no sequence identity to any protein of known structure or function. Thus, several predicted domains of the 205 kDa protein Epf were cloned separately and expressed in Escherichia coli. The N-terminal domain of Epf was crystallized in space groups P21 and P212121 in the presence of the protease chymotrypsin. Mass spectrometry showed that the species crystallized corresponded to a fragment comprising residues 52–357 of Epf. Complete data sets were collected to 2.0 and 1.6 Å resolution, respectively, at the Australian Synchrotron. PMID:22750867
DOE Office of Scientific and Technical Information (OSTI.GOV)
Subburaman, P.; Austin, B.P.; Shaw, G.X.
2010-11-03
Francisella tularensis, a potential bioweapon, causes a rare infectious disease called tularemia in humans and animals. The macrophage growth locus A (MglA) protein from F. tularensis associates with RNA polymerase to positively regulate the expression of multiple virulence factors that are required for its survival and replication within macrophages. The MglA protein was overproduced in Escherichia coli, purified and crystallized. The crystals diffracted to 7.5 {angstrom} resolution at the Advanced Photon Source, Argonne National Laboratory and belonged to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 125, c = 54 {angstrom}.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marchi-Salvador, D. P.; Corrêa, L. C.; Salvador, G. H. M.
2007-12-01
Crotoxin B is a basic phospholipase A{sub 2} found in the venom of C. durissus terrificus and is one of the subunits that constitute crotoxin. Here, the crystallization, X-ray diffraction data collection and molecular-replacement solution of a novel tetrameric complex formed by two dimers of crotoxin B isoforms are presented. Crotoxin B is a basic phospholipase A{sub 2} found in the venom of Crotalus durissus terrificus and is one of the subunits that constitute crotoxin. This heterodimeric toxin, which is the main component of C. d. terrificus venom, is completed by an acidic, nontoxic and non-enzymatic component (crotoxin A) andmore » is involved in important envenomation effects, such as neurological disorders, myotoxicity and renal failure. Although crotoxin was first crystallized in 1938, no crystal structure is currently available for crotoxin, crotoxin A or crotoxin B. In this work, the crystallization, X-ray diffraction data collection to 2.28 Å resolution and molecular-replacement solution of a novel tetrameric complex formed by two dimers of crotoxin B isoforms (CB1 and CB2) is presented.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodríguez Guilbe, María M.; Protein Research and Development Center, University of Puerto Rico; Alfaro Malavé, Elisa C.
The genetically encoded fluorescent calcium-indicator protein GCaMP2 was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution and the structure was solved by molecular replacement. Fluorescent proteins and their engineered variants have played an important role in the study of biology. The genetically encoded calcium-indicator protein GCaMP2 comprises a circularly permuted fluorescent protein coupled to the calcium-binding protein calmodulin and a calmodulin target peptide, M13, derived from the intracellular calmodulin target myosin light-chain kinase and has been used to image calcium transients in vivo. To aid rational efforts to engineer improved variants of GCaMP2, thismore » protein was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 126.1, b = 47.1, c = 68.8 Å, β = 100.5° and one GCaMP2 molecule in the asymmetric unit. The structure was phased by molecular replacement and refinement is currently under way.« less
Convective flow effects on protein crystal growth
NASA Technical Reports Server (NTRS)
Rosenberger, Franz; Monaco, Lisa A.
1993-01-01
The experimental setup for the in-situ high resolution optical monitoring of protein crystal growth/dissolution morphologies was substantially improved. By augmenting the observation system with a temperature-controlled enclosure, laser illumination for the interferometric microscope, and software for pixel by pixel light intensity recording, a height resolution of about two unit cells for lysozyme can now be obtained. The repartitioning of Na(+) and Cl(-) ions between lysozyme solutions and crystals was studied. Quite unexpectedly, it was found that the longer crystals were in contact with their solution, the lower was their ion content. The development of a model for diffusive-convective transport and resulting distribution of the growth rate on facets was completed. Results obtained for a realistic growth cell geometry show interesting differences between 'growth runs' at 1g and 0g. The kinematic viscosity of lysozyme solutions of various supersaturations and salt concentrations was monitored over time. In contrast to the preliminary finding of other authors, no changes in viscosity were found over four days. The experimental setup for light scattering investigations of aggregation and nucleation in protein solutions was completed, and a computer program for the evaluation of multi-angle light scattering data was acquired.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobayashi, Kan; RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198; Suzuki, Takehiro
2014-08-27
E. coli YfcM was expressed, purified and crystallized. Crystals of YfcM were obtained by the in situ proteolysis crystallization method. Using these crystals, an X-ray diffraction data set was collected at 1.45 Å resolution. Elongation factor P (EF-P) plays an essential role in the translation of polyproline-containing proteins in bacteria. It becomes functional by the post-translational modification of its highly conserved lysine residue. It is first β-lysylated by PoxA and then hydroxylated by YfcM. In this work, the YfcM protein from Escherichia coli was overexpressed, purified and crystallized. The crystal of YfcM was obtained by the in situ proteolysis crystallizationmore » method and diffracted X-rays to 1.45 Å resolution. It belonged to space group C2, with unit-cell parameters a = 124.4, b = 37.0, c = 37.6 Å, β = 101.2°. The calculated Matthews coefficient (V{sub M}) of the crystal was 1.91 Å{sup 3} Da{sup −1}, indicating that one YfcM molecule is present in the asymmetric unit with a solvent content of 35.7%.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rantanen, Mika K.; Lehtiö, Lari; Rajagopal, Lakshmi
Two S. agalactiae proteins, the inorganic pyrophosphatase and the serine/threonine phosphatase, were crystallized and diffraction data were collected and processed from these crystals. The data from the two protein crystals extended to 2.80 and 2.65 Å, respectively. Streptococcus agalactiae, which infects human neonates and causes sepsis and meningitis, has recently been shown to possess a eukaryotic-like serine/threonine protein phosphorylation signalling cascade. Through their target proteins, the S. agalactiae Ser/Thr kinase and Ser/Thr phosphatase together control the growth as well as the morphology and virulence of this organism. One of the targets is the S. agalactiae family II inorganic pyrophosphatase. Themore » inorganic pyrophosphatase and the serine/threonine phosphatase have therefore been purified and crystallized and diffraction data have been collected from their crystals. The data were processed using XDS. The inorganic pyrosphosphatase crystals diffracted to 2.80 Å and the Ser/Thr phosphatase crystals to 2.65 Å. Initial structure-solution experiments indicate that structure solution will be successful in both cases. Solving the structure of the proteins involved in this cascade is the first step towards understanding this phenomenon in atomic detail.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko
2007-11-01
The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less
Rümbeli, R; Schirmer, T; Bode, W; Sidler, W; Zuber, H
1985-11-05
The light-harvesting protein phycoerythrocyanin from the cyanobacterium Mastigocladus laminosus Cohn has been crystallized in two different crystal forms by vapour diffusion. In 5% (w/v) polyethylene glycol at pH 8.5, hexagonal crystals of space group P63 with cell constants a = b = 158 A, c = 40.6 A were obtained, which turned out to be almost isomorphous with the hexagonal crystals of C-phycocyanin from the same organism. Consequently, the conformation of both phycobiliproteins must be very similar. From 1.5 M-ammonium sulfate (pH 8.5), orthorhombic crystals of space group P2221 with cell constants a = 60.5 A, b = 105 A, c = 188 A could be grown. Density measurements of these crystals indicate that the unit cell contains 18 (alpha beta)-units. A detailed packing scheme is proposed that is consistent with the observed pseudo-hexagonal X-ray intensity pattern and with the known size and shape of (alpha beta)3-trimers of C-phycocyanin. Accordingly, disc-like (alpha beta)3-trimers are associated face-to-face and stacked one upon another in rods with a period of 60.5 A, corresponding to the cell dimension a.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Galeša, Katja; Brzin, Jože; Sabotič, Jerica
2006-01-01
Clitocypin is a cysteine protease inhibitor from the mushroom Clitocybe nebularis. The protein has been purified from natural sources and crystallized in a variety of non-isomorphous forms belonging to monoclinic and triclinic space groups. Clitocypin is a cysteine protease inhibitor from the mushroom Clitocybe nebularis. The protein has been purified from natural sources and crystallized in a variety of non-isomorphous forms belonging to monoclinic and triclinic space groups. A diffraction data set to 1.55 Å resolution was obtained from a crystal belonging to space group P2, with unit-cell parameters a = 38.326, b = 33.597, c = 55.568 Å, βmore » = 104°. An inability to achieve isomorphism forced the use of MAD and SAD phasing methods. Phasing is in progress.« less
Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S
2003-10-01
Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.
Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J
2014-06-01
LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.
Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.
2014-01-01
LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099
Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu
Kondou, Youhei; Kitazawa, Daisuke; Takeda, Shigeki; Yamashita, Eiki; Mizuguchi, Mineyuki; Kawano, Keiichi; Tsukihara, Tomitake
2005-01-01
Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-rays to at least 2.1 Å resolution and are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan. PMID:16508104
NASA Astrophysics Data System (ADS)
Lee, J. H.; Sohn, S. G.; Jung, H. I.; An, Y. J.; Lee, S. H.
2013-07-01
OXA-17, an extended-spectrum β-lactamase (ESBL) conferring severe antibiotic resistance, hydrolytically inactivates β-lactam antibiotics, inducing a lack of eradication of pathogenic bacteria by oxyimino β-lactams and not helping hospital infection control. Thus, the enzyme is a potential target for developing antimicrobial agents against pathogens producing ESBLs. OXA-17 was purified and crystallized at 298 K. X-ray diffraction data from OXA-17 crystal have been collected to 1.85 Å resolution using synchrotron radiation. The crystal of OXA-17 belongs to space group P212121, with unit-cell parameters a = 48.37, b = 101.12, and c = 126.07 Å. Analysis of the packing density shows that the asymmetric unit probably contains two molecules with a solvent content of 54.6%.
Chen, Shang-ke; Wang, Kui; Liu, Yuhuan; Hu, Xiaopeng
2012-01-01
Feruloyl esterase cleaves the ester linkage formed between ferulic acid and polysaccharides in plant cell walls and thus has wide potential industrial applications. A novel feruloyl esterase (EstF27) identified from a soil metagenomic library was crystallized and a complete data set was collected from a single cooled crystal using an in-house X-ray source. The crystal diffracted to 2.9 Å resolution and belonged to space group P212121, with unit-cell parameters a = 94.35, b = 106.19, c = 188.51 Å, α = β = γ = 90.00°. A Matthews coefficient of 2.55 Å3 Da−1, with a corresponding solvent content of 51.84%, suggested the presence of ten protein subunits in the asymmetric unit. PMID:22750860
Center for Macromolecular Crystallography, University of Alabama in Birmingham
NASA Technical Reports Server (NTRS)
Navia, Manuel A.
1991-01-01
Porcine pancreatic elastase (PPE) crystals grown under microgravity conditions on mission STS-26 of the Space Shuttle Discovery were shown to diffract to considerably higher resolution than the best PPE crystals grown by us on the ground. We have now independently refined both the microgravity and ground-based data. Preliminary results of these refinements are summarized. These results show nearly a doubling of experimental diffraction data for this structure, exceeding 1.3 A resolution. Improved phase information derived from the refined structure of PPE based on this microgravity data has allowed us to interpret previously-uninterpretable electron density obtained from ground-based crystals of a complex of PPE with a chemically-reactive inhibitor. Intermediate stages in the enzyme-inhibitor reaction mechanism in the crystal can now be directly observed. Further refinement of PPE structures is in progress.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshida, Ayako; Tomita, Takeo; Kuzuyama, Tomohisa
2007-02-01
To elucidate the mechanism of regulation of aspartate kinase, the regulatory subunit (the β subunit of T. thermophilus aspartate kinase) was crystallized in the presence of the inhibitor threonine. Aspartate kinase (AK) from Thermus thermophilus, which catalyzes the first step of threonine and methionine biosynthesis, is regulated via feedback inhibition by the end product threonine. To elucidate the mechanism of regulation of AK, the regulatory subunit (the β subunit of T. thermophilus AK) was crystallized in the presence of the inhibitor threonine. Diffraction data were collected to 2.15 Å at a synchrotron source. The crystal belongs to the cubic spacemore » group P4{sub 3}32 or P4{sub 1}32, with unit-cell parameters a = b = c = 141.8 Å.« less
NASA Astrophysics Data System (ADS)
Elizabeth Green, M.; Kirkland, Natalie; Ng, Joseph D.
2001-11-01
The technique of site-directed mutagenesis was used to implement rational amino acid changes in the plant storage protein canavalin, the major seed storage protein of the jack bean ( Canavali ensiformis). The mutations were targeted to amino acids previously demonstrated to be involved in either the intra- or intermolecular salt bridges, thought to be responsible for maintaining the three-dimensional structure of the trimer. The amino acid changes were designed to disrupt the salt bridge interactions by substituting a neutral alanine for a negatively charged aspartate or glutamate, or by substituting a negatively charged glutamate for a positively charged arginine. The resulting recombinant mutants were subsequently expressed, purified, and crystallized. The crystals of the mutant versions of canavalin were compared to those of the wild-type canavalin by visual inspection and X-ray analysis. Of the crystals obtained for the mutants, those for the Arg301Glu mutation appeared to be more stable with fewer surface defects than any of the other mutants or the wild-type protein. The I/ σ ratio of reflections versus the resolution for the Arg301Glu mutation was approximately 30% greater over the entire resolution range than that obtained for any of the other mutations or for the wild-type. Additionally, the crystals of Arg301Glu mutations displayed lower mosaicity. Finally, the Arg301Glu mutation displayed a striking increase in the transition temperature when subjected to thermal denaturation. This paper describes the rationale and techniques behind the mutation of canavalin and suggests possible explanations for the observed and measured differences between the Arg301Glu mutant and the wild-type protein. We show the initial crystallographic structure analysis of this mutant and its preliminary implications.
Zhang, Yuxuan; Ramirez, Rocio A; Li, Hongdi; Liu, Shitao; An, Shaohui; Wang, Chao; Baghaei, Hossain; Wong, Wai-Hoi
2010-02-01
A lower-cost high-sensitivity high-resolution positron emission mammography (PEM) camera is developed. It consists of two detector modules with the planar detector bank of 20 × 12 cm(2). Each bank has 60 low-cost PMT-Quadrant-Sharing (PQS) LYSO blocks arranged in a 10 × 6 array with two types of geometries. One is the symmetric 19.36 × 19.36 mm(2) block made of 1.5 × 1.5 × 10 mm(3) crystals in a 12 × 12 array. The other is the 19.36 × 26.05 mm(2) asymmetric block made of 1.5 × 1.9 × 10 mm(3) crystals in 12 × 13 array. One row (10) of the elongated blocks are used along one side of the bank to reclaim the half empty PMT photocathode in the regular PQS design to reduce the dead area at the edge of the module. The bank has a high overall crystal packing fraction of 88%, which results in a very high sensitivity. Mechanical design and electronics have been developed for low-cost, compactness, and stability purposes. Each module has four Anger-HYPER decoding electronics that can handle a count-rate of 3 Mcps for single events. A simple two-module coincidence board with a hardware delay window for random coincidences has been developed with an adjustable window of 6 to 15 ns. Some of the performance parameters have been studied by preliminary tests and Monte Carlo simulations, including the crystal decoding map and the 17% energy resolution of the detectors, the point source sensitivity of 11.5% with 50 mm bank-to-bank distance, the 1.2 mm-spatial resolutions, 42 kcps peak Noise Equivalent Count Rate at 7.0-mCi total activity in human body, and the resolution phantom images. Those results show that the design goal of building a lower-cost, high-sensitivity, high-resolution PEM detector is achieved.
Navarro, Marcos Vicente de A. S.; Vierira, Débora F.; Nagem, Ronaldo A. P.; de Araújo, Ana Paula U.; Oliva, Maria Luiza V.; Garratt, Richard C.
2005-01-01
A Kunitz-type protease inhibitor (BbKI) found in Bauhinia bauhinioides seeds has been overexpressed in Escherichia coli and crystallized at 293 K using PEG 4000 as the precipitant. X-ray diffraction data have been collected to 1.87 Å resolution using an in-house X-ray generator. The crystals of the recombinant protein (rBbKI) belong to the orthorhombic space group P212121, with unit-cell parameters a = 46.70, b = 64.14, c = 59.24 Å. Calculation of the Matthews coefficient suggests the presence of one monomer of rBbKI in the asymmetric unit, with a corresponding solvent content of 51% (V M = 2.5 Å3 Da−1). Iodinated crystals were prepared and a derivative data set was also collected at 2.1 Å resolution. Crystals soaked for a few seconds in a cryogenic solution containing 0.5 M NaI were found to be reasonably isomorphous to the native crystals. Furthermore, the presence of iodide anions could be confirmed in the NaI-derivatized crystal. Data sets from native and derivative crystals are being evaluated for use in crystal structure determination by means of the SIRAS (single isomorphous replacement with anomalous scattering) method. PMID:16511193
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.
2017-01-15
Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less
NASA Astrophysics Data System (ADS)
Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.
2017-01-01
Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.
NASA Astrophysics Data System (ADS)
Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.
2017-07-01
Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).
Convective flow effects on protein crystal growth
NASA Technical Reports Server (NTRS)
Rosenberger, Franz; Monaco, Lisa A.
1994-01-01
The long-term stability of the interferometric setup for the monitoring of protein morphologies has been improved. Growth or dissolution of a crystal on a 100 A scale can now be clearly distinguished from dimensional changes occurring within the optical path of the interferometer. This capability of simultaneously monitoring the local interfacial displacement at several widely-spaced positions on the crystal surface with high local depth resolution, has already yielded novel results. We found with lysozyme that (1) the normal growth rate is oscillatory, and (2) the mean growth step density is greater at the periphery of a facet than in its center. The repartitioning of Na(+) and Cl(-) ions between lysozyme solutions and crystals was studied for a wide range of crystallization conditions. A nucleation-growth-repartitioning model was developed to interpret the large body of data in a unified way. The results strongly suggests that (1) the ion to lysozyme ratio in the crystal depends mostly on kinetic rather than crystallographic parameters, and (2) lysozyme crystals possess a salt-rich core with a diameter on the order of 10 microns. The computational model for diffusive-convective transport in protein crystallization (see the First Report) has been applied to a realistic growth cell geometry, taking into account the findings of the above repartitioning studies. These results show that some elements of a moving boundary problem must be incorporated into the model in order to obtain a more realistic description. Our experimental setup for light scattering investigations of aggregation and nucleation in protein solutions has been extensively tested. Scattering intensity measurements with a true Rayleigh scatterer produced systematically increased forward scattering, indicating problems with glare. These have been resolved. Preliminary measurements with supersaturated lysozyme solutions revealed that the scatterers grow with time. Work has begun on a computer program for the unified evaluation of simultaneously obtained, multi-angle static and dynamic light scattering data.
Forst, D; Schülein, K; Wacker, T; Diederichs, K; Kreutz, W; Benz, R; Welte, W
1993-01-05
The sucrose-specific outer membrane porin ScrY of Salmonella typhimurium was isolated from Escherichia coli K-12 strain KS 26 containing the plasmid pPSO112. The protein was purified to homogeneity by differential extraction of the cell envelope in the presence of the detergents sodium dodecyl sulfate and lauryl (dimethyl)-amine oxide (LDAO). The porin had apparent molecular weights of 58 kDa and 120 kDa for the monomer and for the trimer, respectively, on SDS/PAGE. The purified trimers were crystallized using poly(ethylene glycol) 2000 and the detergents octylglucoside (OG) and hexyl-(dimethyl)-amine oxide (C6DAO). X-ray diffraction of the crystals showed reflections to 2.3 A. The space group of the crystals was R3 and the lattice constants of the hexagonal axes were a = b = 112.85 A and c = 149.9 A. The crystal volume per unit of protein molecular weight was 3.47 A3/Da.
High-molecular-weight polymers for protein crystallization: poly-γ-glutamic acid-based precipitants
Hu, Ting-Chou; Korczyńska, Justyna; Smith, David K.; Brzozowski, Andrzej Marek
2008-01-01
Protein crystallization has been revolutionized by the introduction of high-throughput technologies, which have led to a speeding up of the process while simultaneously reducing the amount of protein sample necessary. Nonetheless, the chemistry dimension of protein crystallization has remained relatively undeveloped. Most crystallization screens are based on the same set of precipitants. To address this shortcoming, the development of new protein precipitants based on poly-γ-glutamic acid (PGA) polymers with different molecular-weight ranges is reported here: PGA-LM (low molecular weight) of ∼400 kDa and PGA-HM (high molecular weight) of >1000 kDa. It is also demonstrated that protein precipitants can be expanded further to polymers with much higher molecular weight than those that are currently in use. Furthermore, the modification of PGA-like polymers by covalent attachments of glucosamine substantially improved their solubility without affecting their crystallization properties. Some preliminary PGA-based screens are presented here. PMID:18703844
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.
2007-09-01
The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kapetaniou, Evangelia G.; Kotsifaki, Dina; Providaki, Mary
2007-01-01
The DNA methyltransferase M.BseCI from B. stearothermophilus was crystallized as a complex with its cognate DNA. Crystals belong to space group P6 and diffract to 2.5 Å resolution at a synchrotron source. The DNA methyltransferase M.BseCI from Bacillus stearothermophilus (EC 2.1.1.72), a 579-amino-acid enzyme, methylates the N6 atom of the 3′ adenine in the sequence 5′-ATCGAT-3′. M.BseCI was crystallized in complex with its cognate DNA. The crystals were found to belong to the hexagonal space group P6, with unit-cell parameters a = b = 87.0, c = 156.1 Å, β = 120.0° and one molecule in the asymmetric unit. Twomore » complete data sets were collected at wavelengths of 1.1 and 2.0 Å to 2.5 and 2.8 Å resolution, respectively, using synchrotron radiation at 100 K.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu
2008-07-01
The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan
2005-11-01
The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir
The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki
2006-02-01
PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less
Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko
2005-08-01
This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less
Development of liquid crystal based adaptive optical elements for space applications
NASA Astrophysics Data System (ADS)
Geday, M. A.; Quintana, X.; Otón, E.; Cerrolaza, B.; Lopez, D.; Garcia de Quiro, F.; Manolis, I.; Short, A.
2017-11-01
In this paper we present the results obtained within the context of the ESA-funded project Programmable Optoelectronic Adaptive Element (AO/1-5476/07/NL/EM). The objective of this project is the development of adaptive (reconfigurable) optical elements for use in space applications and the execution of preliminary qualification tests in the relevant environment. The different designs and materials that have been considered and manufactured for a 2D beam steerer based on passive matrix liquid crystal programmable blaze grating will described and discussed.
NASA Astrophysics Data System (ADS)
Klyashtorny, V. G.; Fufina, T. Yu.; Vasilieva, L. G.; Shuvalov, V. A.; Gabdulkhakov, A. G.
2014-07-01
Pigment-protein interactions are responsible for the high efficiency of the light-energy transfer and conversion in photosynthesis. The reaction center (RC) from the purple bacterium Rhodobacter sphaeroides is the most convenient model for studying the mechanisms of primary processes of photosynthesis. Site-directed mutagenesis can be used to study the effect of the protein environment of electron-transfer cofactors on the optical properties, stability, pigment composition, and functional activity of RC. The preliminary analysis of RC was performed by computer simulation of the amino acid substitutions L(M196)H + H(M202)L at the pigment-protein interface and by estimating the stability of the threedimensional structure of the mutant RC by the molecular dynamics method. The doubly mutated reaction center was overexpressed, purified, and crystallized. The three-dimensional structure of this mutant was determined by X-ray crystallography and compared with the molecular dynamics model.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Erickson, Anna I.; Sarsam, Reta D.; Fisher, Andrew J., E-mail: ajfisher@ucdavis.edu
The cysQ gene from Mycobacterium tuberculosis was cloned and the expressed protein, a 3′-phosphoadenosine-5′’-phosphatase, was purified and crystallized. X-ray diffraction data were collected to 1.7 Å resolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gurjar, Abhijit A.; Yennawar, Neela H.; Yennawar, Hemant P.
2007-06-01
The cloning, expression, purification and crystallization of recombinant Clostridium perfringens β2-toxin is described. The crystals diffracted to 2.9 Å resolution. Clostridium perfringens is a Gram-positive sporulating anaerobic bacterium that is responsible for a wide spectrum of diseases in animals, birds and humans. The virulence of C. perfringens is associated with the production of several enterotoxins and exotoxins. β2-toxin is a 28 kDa exotoxin produced by C. perfringens. It is implicated in necrotic enteritis in animals and humans, a disease characterized by a sudden acute onset with lethal hemorrhagic mucosal ulceration. The recombinant expression, purification and crystallization of β2-toxin using themore » batch-under-oil technique are reported here. Native X-ray diffraction data were obtained to 2.9 Å resolution on a synchrotron beamline at the F2 station at Cornell High Energy Synchrotron Source (CHESS) using an ADSC Quantum-210 CCD detector. The crystals belong to space group R3, with a dimer in the asymmetric unit; the unit-cell parameters are a = b = 103.71, c = 193.48 Å, α = β = 90, γ = 120° using the hexagonal axis setting. A self-rotation function shows that the two molecules are related by a noncrystallographic twofold axis with polar angles ω = 90.0, ϕ = 210.3°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz
2008-07-01
Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gohain, Neelakshi; Thomashow, Linda S.; USDA Agricultural Research Service, Root Disease and Biological Control Research Unit, Pullman, Washington 99164-6430
2006-10-01
PhzS, an FAD-dependent monooxygenase that catalyzes a reaction involved in the biosynthesis of the virulence factor pyocyanin in P. aeruginosa, was cloned, overexpressed and crystallized. Data collection from native and seleno-l-methionine-labelled crystals is reported. The blue chloroform-soluble bacterial metabolite pyocyanin (1-hydroxy-5-methyl-phenazine) contributes to the survival and virulence of Pseudomonas aeruginosa, an important Gram-negative opportunistic pathogen of humans and animals. Little is known about the two enzymes, designated PhzM and PhzS, that function in the synthesis of pyocyanin from phenazine-1-carboxylic acid. In this study, the FAD-dependent monooxygenase PhzS was purified and crystallized from lithium sulfate/ammonium sulfate/sodium citrate pH 5.5. Native crystalsmore » belong to space group C2, with unit-cell parameters a = 144.2, b = 96.2, c = 71.7 Å, α = γ = 90, β = 110.5°. They contain two monomers of PhzS in the asymmetric unit and diffract to a resolution of 2.4 Å. Seleno-l-methionine-labelled PhzS also crystallizes in space group C2, but the unit-cell parameters change to a = 70.6, b = 76.2, c = 80.2 Å, α = γ = 90, β = 110.5° and the diffraction limit is 2.7 Å.« less
Carrizo, Maria E; Irazoqui, Fernando J; Lardone, Ricardo D; Nores, Gustavo A; Curtino, Juan A; Capaldi, Stefano; Perduca, Massimiliano; Monaco, Hugo L
2004-04-01
The lectin from the common edible mushroom Agaricus bisporus (ABL) belongs to the group of proteins that have the property of binding the Thomsen-Friedenreich antigen (T-antigen) selectively and with high affinity, but does not show any sequence similarity to the other proteins that share this property. The ABL sequence is instead similar to those of members of the saline-soluble fungal lectins, a protein family with pesticidal properties. The presence of different isoforms has been reported. It has been found that in order to be able to grow diffraction-quality crystals of the lectin, it is essential to separate the isoforms, which was performed by preparative isoelectric focusing. Using standard procedures, it was possible to crystallize the most basic of the forms by either vapour diffusion or equilibrium dialysis, but attempts to grow crystals of the other more acidic forms were unsuccessful. The ABL crystals belong to the orthorhombic space group C222(1), with unit-cell parameters a = 93.06, b = 98.16, c = 76.38 A, and diffract to a resolution of 2.2 A on a conventional source at room temperature. It is expected that the solution of this structure will yield further valuable information on the differences in the T-antigen-binding folds and will perhaps help to clarify the details of the ligand binding to the protein.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chakraborty, Sibani; Biswas, Sampa; Chakrabarti, Chandana
2005-06-01
Ervatamin A is a papain-family cysteine protease with high activity and stability. It has been isolated and purified from the latex of the medicinal flowering plant E. coronaria and crystallized by the vapour-diffusion technique. Crystals diffracted to 2.1 Å and the structure was solved by molecular replacement. The ervatamins are highly stable cysteine proteases that are present in the latex of the medicinal plant Ervatamia coronaria and belong to the papain family, members of which share similar amino-acid sequences and also a similar fold comprising two domains. Ervatamin A from this family, a highly active protease compared with others frommore » the same source, has been purified to homogeneity by ion-exchange chromatography and crystallized by the vapour-diffusion method. Needle-shaped crystals of ervatamin A diffract to 2.1 Å resolution and belong to space group C222{sub 1}, with unit-cell parameters a = 31.10, b = 144.17, c = 108.61 Å. The solvent content using an ervatamin A molecular weight of 27.6 kDa is 43.9%, with a V{sub M} value of 2.19 Å{sup 3} Da{sup −1} assuming one protein molecule in the asymmetric unit. A molecular-replacement solution has been found using the structure of ervatamin C as a search model.« less
Simulations of solid-fluid coupling with application to crystal entrainment in vigorous convection
NASA Astrophysics Data System (ADS)
Suckale, J.; Elkins-Tanton, L. T.; Sethian, J.; Yu, J.
2009-12-01
Many problems in computational geophysics require the accurate coupling of a solid body to viscous flow. Examples range from understanding the role of highly crystalline magma for the dynamic of volcanic eruptions to crystal entrainment in magmatic flow and the emplacement of xenoliths. In this paper, we present and validate a numerical method for solid-fluid coupling. The algorithm relies on a two-step projection scheme: In the first step, we solve the multiple-phase Navier-Stokes or Stokes equation in both domains. In the second step, we project the velocity field in the solid domain onto a rigid-body motion by enforcing that the deformation tensor in the respective domain is zero. This procedure is also used to enforce the no-slip boundary condition on the solid-fluid interface. We perform several benchmark computations to validate our computations. More precisely, we investigate the formation of a wake behind both fixed and mobile cylinders and cuboids with and without imposed velocity fields in the fluid. These preliminary tests indicate that our code is able to simulate solid-fluid coupling for Reynolds numbers of up to 1000. Finally, we apply our method to the problem of crystal entrainment in vigorous convection. The interplay between sedimentation and re-entrainment of crystals in convective flow is of fundamental importance for understanding the compositional evolution of magmatic reservoirs of various sizes from small lava ponds to magma oceans at the planetary scale. Previous studies of this problem have focused primarily on laboratory experiments, often with conflicting conclusions. Our work is complementary to these prior studies as we model the competing processes of gravitational sedimentation and entrainment of crystals at the length scale of the size of the crystals.
Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.
2013-01-01
Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835
Linke, Christian; Siemens, Nikolai; Middleditch, Martin J; Kreikemeyer, Bernd; Baker, Edward N
2012-07-01
The extracellular protein Epf from Streptococcus pyogenes is important for streptococcal adhesion to human epithelial cells. However, Epf has no sequence identity to any protein of known structure or function. Thus, several predicted domains of the 205 kDa protein Epf were cloned separately and expressed in Escherichia coli. The N-terminal domain of Epf was crystallized in space groups P2(1) and P2(1)2(1)2(1) in the presence of the protease chymotrypsin. Mass spectrometry showed that the species crystallized corresponded to a fragment comprising residues 52-357 of Epf. Complete data sets were collected to 2.0 and 1.6 Å resolution, respectively, at the Australian Synchrotron.
Thin film solar cell design based on photonic crystal and diffractive grating structures.
Mutitu, James G; Shi, Shouyuan; Chen, Caihua; Creazzo, Timothy; Barnett, Allen; Honsberg, Christiana; Prather, Dennis W
2008-09-15
In this paper we present novel light trapping designs applied to multiple junction thin film solar cells. The new designs incorporate one dimensional photonic crystals as band pass filters that reflect short light wavelengths (400 - 867 nm) and transmit longer wavelengths(867 -1800 nm) at the interface between two adjacent cells. In addition, nano structured diffractive gratings that cut into the photonic crystal layers are incorporated to redirect incoming waves and hence increase the optical path length of light within the solar cells. Two designs based on the nano structured gratings that have been realized using the scattering matrix and particle swarm optimization methods are presented. We also show preliminary fabrication results of the proposed devices.
Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder
2006-01-01
Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268
dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor
2013-01-01
Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen
2006-10-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, SeungBum; Joo, Sangbum; Yoon, Hyun C.
2007-07-01
Est25, a ketoprofen-specific hormone-sensitive lipase from a metagenomic library, was crystallized and diffraction data were collected to 1.49 Å resolution. Ketoprofen, a nonsteroidal anti-inflammatory drug, inhibits the synthesis of prostaglandin. A novel hydrolase (Est25) with high ketoprofen specificity has previously been identified using a metagenomic library from environmental samples. Recombinant Est25 protein with a histidine tag at the N-terminus was expressed in Escherichia coli and purified in a homogenous form. Est25 was crystallized from 2.4 M sodium malonate pH 7.0 and X-ray diffraction data were collected to 1.49 Å using synchrotron radiation. The crystals belong to the monoclinic space groupmore » C2, with unit-cell parameters a = 197.8, b = 95.2, c = 99.4 Å, β = 97.1°.« less
Crystal growth from the vapor phase experiment MA-085
NASA Technical Reports Server (NTRS)
Wiedemeir, H.; Sadeek, H.; Klaessig, F. C.; Norek, M.
1976-01-01
Three vapor transport experiments on multicomponent systems were performed during the Apollo Soyuz mission to determine the effects of microgravity forces on crystal morphology and mass transport rates. The mixed systems used germanium selenide, tellurium, germanium tetraiodide (transport agent), germanium monosulfide, germanium tetrachloride (transport agent), and argon (inert atmosphere). The materials were enclosed in evacuated sealed ampoules of fused silica and were transported in a temperature gradient of the multipurpose electric furnace onboard the Apollo Soyuz spacecraft. Preliminary evaluation of 2 systems shows improved quality of space grown crystals in terms of growth morphology and bulk perfection. This conclusion is based on a direct comparison of space grown and ground based crystals by means of X-ray diffraction, microscopic, and chemical etching techniques. The observation of greater mass transport rates than predicted for a microgravity environment by existing vapor transport models indicates the existence of nongravity caused transport effects in a reactive solid/gas phase system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei
2007-07-01
An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168
2008-02-01
The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less
Squeglia, Flavia; Bachert, Beth; Romano, Maria; Lukomski, Slawomir; Berisio, Rita
2013-09-01
Streptococcal collagen-like proteins (Scls) are widely expressed by the well recognized human pathogen Streptococcus pyogenes. These surface proteins contain a signature central collagen-like region and an amino-terminal globular domain, termed the variable domain, which is protruded away from the cell surface by the collagen-like domain. Despite their recognized importance in bacterial pathogenicity, no structural information is presently available on proteins of the Scl class. The variable domain of Scl2 from invasive M3-type S. pyogenes has successfully been crystallized using vapour-diffusion methods. The crystals diffracted to 1.5 Å resolution and belonged to space group H32, with unit-cell parameters a = 44.23, b = 44.23, c = 227.83 Å. The crystal structure was solved by single-wavelength anomalous dispersion using anomalous signal from a europium chloride derivative.|
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seetharamappa, Jaldappagari; Department of Chemistry, Karnatak University, Pavate Nagar, Dharwad 580 003, Karnataka State; Oke, Muse
2007-05-01
As part of work on S. aureus, the crystallization of Sar2028, a protein that is upregulated in MRSA, is reported. Sar2028, an aspartate/tyrosine/phenylalanine pyridoxal-5′-phosphate-dependent aminotransferase with a molecular weight of 48 168 Da, was overexpressed in methicillin-resistant Staphylococcus aureus compared with a methicillin-sensitive strain. The protein was expressed in Escherichia coli, purified and crystallized. The protein crystallized in a primitive orthorhombic Laue group with unit-cell parameters a = 83.6, b = 91.3, c = 106.0 Å, α = β = γ = 90°. Analysis of the systematic absences along the three principal axes indicated the space group to be P2{submore » 1}2{sub 1}2{sub 1}. A complete data set was collected to 2.5 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny
2006-01-01
Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakamura, Toshio; Tonozuka, Takashi; Kotani, Mao
2007-12-01
HA3, a 70 kDa haemagglutinating protein, is a precursor form of HA3a and HA3b, the subcomponents of Clostridium botulinum type C 16S progenitor toxin. In this report, recombinant HA3 protein was overexpressed in Escherichia coli, purified and crystallized. HA3, a 70 kDa haemagglutinating protein, is a precursor form of HA3a and HA3b, the subcomponents of Clostridium botulinum type C 16S progenitor toxin. In this report, recombinant HA3 protein was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 2.6 Å resolution and the crystal belonged to the hexagonal space group P6{sub 3}. Matthews coefficient and self-rotation functionmore » calculations indicate that there is probably one molecule of HA3 in the asymmetric unit. A search for heavy-atom derivatives has been undertaken.« less
Crystallization of Chicken Egg White Lysozyme from Sulfate Salts
NASA Technical Reports Server (NTRS)
Forsythe, Elizabeth; Pusey, Marc
1998-01-01
It has been "known" that chicken egg white lysozyme does not crystallize from sulfate, particularly ammonium sulfate, salts, but instead gives amorphous precipitates. This has been the basis of several studies using lysozyme comparing macromolecule crystal nucleation and amorphous precipitation. Recently Ries-Kautt et al (Acta Cryst D50, (1994) 366) have shown that purified isoionic CEWL could be crystallized from low concentrations of sulfate at basic pH, and we subsequently showed that in fact CEWL could be purified in both the tetragonal and orthorhombic forms using ammonium sulfate over the pH range 4.0 to 7.8 (Acta Cryst D53, (1997) 795). We have now extended these observations to include a range of common sulfate salts, specifically sodium, potassium, rubidium, magnesium, and manganese sulfates. In all cases but the manganese sulfates both the familiar tetragonal and orthorhombic forms were obtained, with unit cell dimensions close to those known for the "classic" sodium chloride crystallized forms. Manganese sulfate has only yielded orthorhombic crystals to date. All crystallizations were carried out using low (typically less than or equal to 6 M) salt and high (greater than approximately 90 mg/ml) protein concentrations. As with ammonium sulfate, the tetragonal - orthorhombic phase shift appears to be a function of both the temperature and the protein concentration, with higher temperatures and concentrations favoring the orthorhombic and lower the tetragonal form. The phase change range is somewhat reduced for the sulfate salts, depending upon conditions being typically between approximately 15 - 20 C. Both the magnesium and manganese sulfates gave crystals at salt concentrations over 0.6 M as well, with magnesium sulfate giving a very slowly nucleating and growing hexagonal form. A triclinic crystal form, characterized by aggressively small crystals (typically 0.1 mm in size) has been occasionally obtained from ammonium sulfate. Finally, preliminary spot solubility determinations have suggested that in some cases the solubility increases with increasing salt concentrations.
The Growth of Protein Crystals Using McDUCK
NASA Technical Reports Server (NTRS)
Ewing, Felicia; Wilson, Lori; Nadarajah, Arunan; Pusey, Marc
1998-01-01
Most of the current microgravity crystal growth hardware is optimized to produce crystals within the limited time available on orbit. This often results in the actual nucleation and growth process being rushed or the system not coming to equilibrium within the limited time available. Longer duration hardware exists, but one cannot readily pick out crystals grown early versus those which nucleated and grew more slowly. We have devised a long duration apparatus, the Multi-chamber Dialysis Unit for Crystallization Kinetics, or McDUCK. This apparatus-is a series of protein chambers, stacked upon a precipitant reservoir chamber. All chambers are separated by a dialysis membrane, which serves to pass small molecules while retaining the protein. The volume of the Precipitant chamber is equal to the sum of the volumes of the protein chamber. In operation, the appropriate chambers are filled with precipitant solution or protein solution, and the McDUCK is placed standing upright, with the precipitant chamber on the bottom. The precipitant diffuses upwards over time, with the time to reach equilibration a function of the diffusivity of the precipitant and the overall length of the diffusion pathway. Typical equilibration times are approximately 2-4 months, and one can readily separate rapid from slow nucleation and growth crystals. An advantage on Earth is that the vertical precipitant concentration gradient dominates that of the solute, thus dampening out solute density gradient driven convective flows. However, large Earth-grown crystals have so far tended to be more two dimensional. Preliminary X-ray diffraction analysis of lysozyme crystals grown in McDUCK have indicated that the best, and largest, come from the middle chambers, suggesting that there is an optimal growth rate. Further, the improvements in diffraction resolution have been better signal to noise ratios in the low resolution data, not an increase in resolution overall. Due to the persistently large crystals grown we are currently proposing McDUCK for the growth of macromolecule crystals for use in neutron diffraction studies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pathuri, Puja; Nguyen, Emily Tam; Luecke, Hartmut, E-mail: hudel@uci.edu
2006-11-01
α-11 giardin from the intestinal protozoan parasite, G. lamblia has been cloned, expressed, purified and crystallized under two different conditions and in two different space groups. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group and crystals obtained in the second condition diffracted to 2.93 Å and belong to a primitive monoclinic space group. α-11 Giardin, a protein from the annexin superfamily, is a 35.0 kDa protein from the intestinal protozoan parasite Giardia lamblia which triggers a form of diarrhea called giardiasis. Here, the cloning, expression, purification and the crystallization of α-11more » giardin under two different conditions and in two different space groups is reported. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group, while crystals from the second condition, which included calcium in the crystallization solution, diffracted to 2.93 Å and belong to a primitive monoclinic space group. Determination of the detailed atomic structure of α-11 giardin will provide a better insight into its biological function and might establish whether this class of proteins is a potential drug target against giardiasis.« less
Improving the diffraction of apoA-IV crystals through extreme dehydration.
Deng, Xiaodi; Davidson, W Sean; Thompson, Thomas B
2012-01-01
Apolipoproteins are the protein component of high-density lipoproteins (HDL), which are necessary for mobilizing lipid-like molecules throughout the body. Apolipoproteins undergo self-association, especially at higher concentrations, making them difficult to crystallize. Here, the crystallization and diffraction of the core fragment of apolipoprotein A-IV (apoA-IV), consisting of residues 64-335, is presented. ApoA-IV(64-335) crystallized readily in a variety of hexagonal (P6) morphologies with similar unit-cell parameters, all containing a long axis of nearly 550 Å in length. Preliminary diffraction experiments with the different crystal morphologies all resulted in limited streaky diffraction to 3.5 Å resolution. Crystal dehydration was applied to the different morphologies with variable success and was also used as a quality indicator of crystal-growth conditions. The results show that the morphologies that withstood the most extreme dehydration conditions showed the greatest improvement in diffraction. One morphology in particular was able to withstand dehydration in 60% PEG 3350 for over 12 h, which resulted in well defined intensities to 2.7 Å resolution. These results suggest that the approach of integrating dehydration with variation in crystal-growth conditions might be a general technique to optimize diffraction. © 2012 International Union of Crystallography. All rights reserved.
Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier; Bernier-Villamor, Laura; Sevilla, Francisca; Lázaro, Juan José
2006-07-01
A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 angstroms from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 angstroms, alpha = 102.90, beta = 104.40, gamma = 99.07 degrees, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.
Purification and Crystallization of Murine Myostatin: A Negative Regulator of Muscle Mass
NASA Technical Reports Server (NTRS)
Hong, Young S.; Adamek, Daniel; Bridge, Kristi; Malone, Christine C.; Young, Ronald B.; Miller, Teresa; Karr, Laurel
2004-01-01
Myostatin (MSTN) has been crystallized and its preliminary X-ray diffraction data were collected. MSTN is a negative regulator of muscle growt/differentiation and suppressor of fat accumulation. It is a member of TGF-b family of proteins. Like other members of this family, the regulation of MSTN is critically tied to its process of maturation. This process involves the formation of a homodimer followed by two proteolytic steps. The first proteolytic cleavage produces a species where the n-terminal portion of the dimer is covalently separated from, but remains non-covalently bound to, the c-terminal, functional, portion of the protein. The protein is activated upon removal of the n-terminal "pro-segment" by a second n-terminal proteolytic cut by BMP-1 in vivo, or by acid treatment in vitro. Understanding the structural nature and physical interactions involved in these regulatory processes is the objective of our studies. Murine MSTN was purified from culture media of genetically engineered Chinese Hamster Ovary cells by multicolumn purification process and crystallized using the vapor diffusion method.
Crystalline ricin D, a toxic anti-tumor lectin from seeds of Ricinus communis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wei, C.H.; Koh, C.
1978-03-25
A toxic lectin, ricin D, present in the seeds of Ricinus communis has been purified and crystallized in a form suitable for high resolution crystallographic structure studies. This protein is different from a previously found form of ricin (also present in the same seeds), the only ricin for which a preliminary x-ray investigation has been reported so far. Ricin D crystallizes from an aqueous solution in an orthorhombic unit cell of symmetry P2/sub 1/2/sub 1/2/sub 1/ and a = 79.0, b = 114.7, and c = 72.8 A. The asymmetric unit contains one molecule with an average molecular weight ofmore » 62,400. The crystal is fairly stable to x-radiation and has a water content of approximately 54% by volume. It appears to comprise two closely related species of proteins, the major species corresponding to ricin D and the other presumably corresponding to a deamidation product of ricin D. The two species have nearly identical molecular size and amino acid compositions, but different charges.« less
Dolot, Rafał; Włodarczyk, Artur; Bujacz, Grzegorz D.; Nawrot, Barbara
2013-01-01
Histidine triad nucleotide-binding protein 2 (HINT2) is a mitochondrial adenosine phosphoramidase mainly expressed in the pancreas, liver and adrenal gland. HINT2 possibly plays a role in apoptosis, as well as being involved in steroid biosynthesis, hepatic lipid metabolism and regulation of hepatic mitochondria function. The expression level of HINT2 is significantly down-regulated in hepatocellular carcinoma patients. To date, endogenous substrates for this enzyme, as well as the three-dimensional structure of human HINT2, are unknown. In this study, human HINT2 was cloned, overexpressed in Escherichia coli and purified. Crystallization was performed at 278 K using PEG 4000 as the main precipitant; the crystals, which belonged to the tetragonal space group P41212 with unit-cell parameters a = b = 76.38, c = 133.25 Å, diffracted to 2.83 Å resolution. Assuming two molecules in the asymmetric unit, the Matthews coefficient and the solvent content were calculated to be 2.63 Å3 Da−1 and 53.27%, respectively. PMID:23832208
Liquid crystal interfaces: Experiments, simulations and biosensors
NASA Astrophysics Data System (ADS)
Popov, Piotr
Interfacial phenomena are ubiquitous and extremely important in various aspects of biological and industrial processes. For example, many liquid crystal applications start by alignment with a surface. The underlying mechanisms of the molecular organization of liquid crystals at an interface are still under intensive study and continue to be important to the display industry in order to develop better and/or new display technology. My dissertation research has been devoted to studying how complex liquid crystals can be guided to organize at an interface, and to using my findings to develop practical applications. Specifically, I have been working on developing biosensors using liquid-crystal/surfactant/lipid/protein interactions as well as the alignment of low-symmetry liquid crystals for potential new display and optomechanical applications. The biotechnology industry needs better ways of sensing biomaterials and identifying various nanoscale events at biological interfaces and in aqueous solutions. Sensors in which the recognition material is a liquid crystal naturally connects the existing knowledge and experience of the display and biotechnology industries together with surface and soft matter sciences. This dissertation thus mainly focuses on the delicate phenomena that happen at liquid interfaces. In the introduction, I start by defining the interface and discuss its structure and the relevant interfacial forces. I then introduce the general characteristics of biosensors and, in particular, describe the design of biosensors that employ liquid crystal/aqueous solution interfaces. I further describe the basic properties of liquid crystal materials that are relevant for liquid crystal-based biosensing applications. In CHAPTER 2, I describe the simulation methods and experimental techniques used in this dissertation. In CHAPTER 3 and CHAPTER 4, I present my computer simulation work. CHAPTER 3 presents insight of how liquid crystal molecules are aligned by hydrocarbon surfaces at the atomic level. I show that the vertical alignment of a rod-like liquid crystal molecule first requires its insertion into the alignment layer. In CHAPTER 4, I investigate the Brownian behavior of a tracer molecule at an oil/water interface and explain the experimentally-observed anomaly of its increased mobility. Following my molecular dynamics simulation studies of liquid interfaces, I continue my work in CHAPTER 5 with experimental research. I employ the high sensitivity of liquid crystal alignment to the presence of amphiphiles adsorbed to the liquid crystal surface from water for potential biosensor applications. I propose a more accurate method of sensing using circular polarization and spectrophotometry. In CHAPTER 6, I investigate if cholesteric and smectic liquid crystals can potentially offer new modes of biosensing. In CHAPTER 7, I describe preliminary results toward constructing a liquid crystal biosensor platform with capabilities of specific sensitivity using proteins and antibodies. Finally in CHAPTER 8, I summarize the findings of my studies and research and suggest possible future experiments to further advance our knowledge in interfacial science for future applications.
Characterization of Pr:LuAG scintillating crystals for X-ray spectroscopy
NASA Astrophysics Data System (ADS)
Bertoni, R.; Bonesini, M.; Cervi, T.; Clemenza, M.; De Bari, A.; Falcone, A.; Mazza, R.; Menegolli, A.; Nastasi, M.; Rossella, M.
2016-07-01
The main features of the Pr doped Lu3Al5O12 (Pr:LuAG) scintillating crystals for X-ray spectroscopy applications have been studied using different radioactive sources and photo-detectors. Pr:LuAG is cheaper, compared to a Germanium detector, but with remarkable properties which make it useful for many applications, from fundamental physics measurements to the PET imaging for medical purposes: high density, elevate light yield, fast response, high energy resolution, no hygroscopicity. A sample of Pr:LuAG crystals with 14 mm×14 mm surface area and 13 mm thickness and a NaI crystal of the same surface and 26 mm thickness used as a reference have been characterized with several radioactive sources, emitting photons in the range 100-1000keV. Different light detectors were adopted for the Pr:LuAG studies, sensitive to its UV emission (peak at 310 nm): a 3 in. PMT (Hamamatsu R11065) and new arrays of Hamamatsu SiPM S13361, with siliconic resin as a window. Preliminary results are presented on the performance of the Pr:LuAG crystals, to be mounted in a 2 × 2 array to be tested in the 2015 run of the FAMU experiment at RIKEN-RAL muon facility. The goal is the detection of the X-rays (around 130 keV) emitted during the de-excitation processes of the muonic hydrogen after the excitation with an IR laser with wavelength set at the resonance of the hyperfine splitting, to measure the muonic atom proton radius with unprecedented precision.
Direct numerical simulations of magmatic differentiation at the microscopic scale
NASA Astrophysics Data System (ADS)
Sethian, J.; Suckale, J.; Elkins-Tanton, L. T.
2010-12-01
A key question in the context of magmatic differentiation and fractional crystallization is the ability of crystals to decouple from the ambient fluid and sink or rise. Field data indicates a complex spectrum of behavior ranging from rapid sedimentation to continued entrainment. Theoretical and laboratory studies paint a similarly rich picture. The goal of this study is to provide a detailed numerical assessment of the competing effects of sedimentation and entrainment at the scale of individual crystals. The decision to simulate magmatic differentiation at the grain scale comes at the price of not being able to simultaneously solve for the convective velocity field at the macroscopic scale, but has the crucial advantage of enabling us to fully resolve the dynamics of the systems from first principles without requiring any simplifying assumptions. The numerical approach used in this study is a customized computational methodology developed specifically for simulations of solid-fluid coupling in geophysical systems. The algorithm relies on a two-step projection scheme: In the first step, we solve the multiple-phase Navier-Stokes or Stokes equation in both domains. In the second step, we project the velocity field in the solid domain onto a rigid-body motion by enforcing that the deformation tensor in the respective domain is zero. This procedure is also used to enforce the no-slip boundary-condition on the solid-fluid interface. We have extensively validated and benchmarked the method. Our preliminary results indicate that, not unexpectedly, the competing effects of sedimentation and entrainment depend sensitively on the size distribution of the crystals, the aspect ratio of individual crystals and the vigor of the ambient flow field. We provide a detailed scaling analysis and quantify our results in terms of the relevant non-dimensional numbers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Belokoneva, E. L., E-mail: elbel@geol.msu.ru; Derkach, I. K.; Dimitrova, O. V.
2013-05-15
Crystals of a new representative of ring-radical dodecaborates Pb{sub 6}(Li{sub 0.65}Na{sub 0.19})[B{sub 12}O{sub 24}]I{sub 0.84} {center_dot} 0.168H{sub 2}O, space group R3bar m , are obtained under hydrothermal conditions. The structure is determined with-out preliminary knowledge of the chemical formula. It is close to that of the Pb{sub 6}[B{sub 12}O{sub 24}] {center_dot} H{sub 2}O dodecaborate studied earlier, but unlike the latter structure it contains admixtures of iodide anion, lithium cation, and water molecule, which incompletely populate positions in channels. The formation of the second variety, which brings to light ion-exchange properties of the crystals, is due to mineralizing ions available inmore » the concen-trated solution in the course of crystallization. The new compound is compared with beryl and cordierite, which have close structures with channels capable of capturing various groups. Structures of synthetic Na and Ag dodecaborates with analogous but distorted ring dodecaborate radicals are discussed.« less
Sathya Moorthy, Pon; Neelagandan, K; Balasubramanian, M; Ponnuswamy, M N
2009-02-01
Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 A resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 A, alpha = 78.742, beta = 89.819, gamma = 65.320 degrees .
Al-Wabli, Reem I; Al-Ghamdi, Alwah R; Ghabbour, Hazem A; Al-Agamy, Mohamed H; Monicka, James Clemy; Joe, Issac Hubert; Attia, Mohamed I
2017-02-28
Mycoses are serious health problem, especially in immunocompromised individuals. A new imidazole-bearing compound containing an oxime functionality was synthesized and characterized with different spectroscopic techniques to be used for the preparation of new antifungal agents. The stereochemistry of the oxime double bond was unequivocally determined via the single crystal X-ray technique. The title compound 4 , C 13 H 13 N₃O₃·C₃H₈O, crystallizes in the monoclinic space group P 2₁with a = 9.0963(3) Å, b = 14.7244(6) Å, c = 10.7035(4) Å, β = 94.298 (3)°, V = 1429.57(9) ų, Z = 2. The molecules were packed in the crystal structure by eight intermolecular hydrogen bond interactions. A comprehensive spectral analysis of the title molecule 4 has been performed based on the scaled quantum mechanical (SQM) force field obtained by density-functional theory (DFT) calculations. A molecular docking study illustrated the binding mode of the title compound 4 into its target protein. The preliminary antifungal activity of the title compound 4 was determined using a broth microdilution assay.
Preliminary X-ray crystallographic studies of mouse UPR responsive protein P58(IPK) TPR fragment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tao, Jiahui; Wu, Yunkun; Ron, David
2008-02-01
To investigate the mechanism by which P58(IPK) functions to promote protein folding within the ER, a P58(IPK) TPR fragment without the C-terminal J-domain has been crystallized. Endoplasmic reticulum (ER) stress induces the unfolded protein response (UPR), which can promote protein folding and misfolded protein degradation and attenuate protein translation and protein translocation into the ER. P58(IPK) has been proposed to function as a molecular chaperone to maintain protein-folding homeostasis in the ER under normal and stressed conditions. P58(IPK) contains nine TPR motifs and a C-terminal J-domain within its primary sequence. To investigate the mechanism by which P58(IPK) functions to promotemore » protein folding within the ER, a P58(IPK) TPR fragment without the C-terminal J-domain was crystallized. The crystals diffract to 2.5 Å resolution using a synchrotron X-ray source. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 83.53, b = 92.75, c = 84.32 Å, α = 90.00, β = 119.36, γ = 90.00°. There are two P58(IPK) molecules in the asymmetric unit, which corresponds to a solvent content of approximately 60%. Structure determination by MAD methods is under way.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie
2005-01-01
The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier, E-mail: fjljara@ugr.es; Bernier-Villamor, Laura
2006-07-01
The isolation, purification, crystallization and molecular-replacement solution of mitochondrial type II peroxiredoxin from P. sativum is reported. A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 Å from a single crystal flash-cooledmore » at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 Å, α = 102.90, β = 104.40, γ = 99.07°, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.« less
Yasutake, Yoshiaki; Fujii, Yoshikazu; Cheon, Woo-Kwang; Arisawa, Akira; Tamura, Tomohiro
2009-01-01
Vitamin D3 hydroxylase (Vdh) is a novel cytochrome P450 monooxygenase isolated from the actinomycete Pseudonocardia autotrophica and consisting of 403 amino-acid residues. Vdh catalyzes the activation of vitamin D3 via sequential hydroxylation reactions: these reactions involve the conversion of vitamin D3 (cholecalciferol or VD3) to 25-hydroxyvitamin D3 [25(OH)VD3] and the subsequent conversion of 25(OH)VD3 to 1α,25-dihydroxyvitamin D3 [calciferol or 1α,25(OH)2VD3]. Overexpression of recombinant Vdh was carried out using a Rhodococcus erythropolis expression system and the protein was subsequently purified and crystallized. Two different crystal forms were obtained by the hanging-drop vapour-diffusion method at 293 K using polyethylene glycol as a precipitant. The form I crystal belonged to the trigonal space group P31, with unit-cell parameters a = b = 61.7, c = 98.8 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 47.6%. The form II crystal was grown in the presence of 25(OH)VD3 and belonged to the orthorhombic system P212121, with unit-cell parameters a = 63.4, b = 65.6 c = 102.2 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 46.7%. Native data sets were collected to resolutions of 1.75 and 3.05 Å for form I and form II crystals, respectively, using synchrotron radiation. The structure solution was obtained by the molecular-replacement method and model refinement is in progress for the form I crystal. PMID:19342783
NASA Astrophysics Data System (ADS)
Auffray, E.; Ben Mimoun Bel Hadj, F.; Cortinovis, D.; Doroud, K.; Garutti, E.; Lecoq, P.; Liu, Z.; Martinez, R.; Paganoni, M.; Pizzichemi, M.; Silenzi, A.; Xu, C.; Zvolský, M.
2015-06-01
This paper describes the characterization of crystal matrices and silicon photomultiplier arrays for a novel Positron Emission Tomography (PET) detector, namely the external plate of the EndoTOFPET-US system. The EndoTOFPET-US collaboration aims to integrate Time-Of-Flight PET with ultrasound endoscopy in a novel multimodal device, capable to support the development of new biomarkers for prostate and pancreatic tumors. The detector consists in two parts: a PET head mounted on an ultrasound probe and an external PET plate. The challenging goal of 1 mm spatial resolution for the PET image requires a detector with small crystal size, and therefore high channel density: 4096 LYSO crystals individually readout by Silicon Photomultipliers (SiPM) make up the external plate. The quality and properties of these components must be assessed before the assembly. The dark count rate, gain, breakdown voltage and correlated noise of the SiPMs are measured, while the LYSO crystals are evaluated in terms of light yield and energy resolution. In order to effectively reduce the noise in the PET image, high time resolution for the gamma detection is mandatory. The Coincidence Time Resolution (CTR) of all the SiPMs assembled with crystals is measured, and results show a value close to the demanding goal of 200 ps FWHM. The light output is evaluated for every channel for a preliminary detector calibration, showing an average of about 1800 pixels fired on the SiPM for a 511 keV interaction. Finally, the average energy resolution at 511 keV is about 13 %, enough for effective Compton rejection.
A novel laser-based method for controlled crystallization in dental prosthesis materials
NASA Astrophysics Data System (ADS)
Cam, Peter; Neuenschwander, Beat; Schwaller, Patrick; Köhli, Benjamin; Lüscher, Beat; Senn, Florian; Kounga, Alain; Appert, Christoph
2015-02-01
Glass-ceramic materials are increasingly becoming the material of choice in the field of dental prosthetics, as they can feature both high strength and very good aesthetics. It is believed that their color, microstructure and mechanical properties can be tuned such as to achieve an optimal lifelike performance. In order to reach that ultimate perfection a controlled arrangement of amorphous and crystalline phases in the material is required. A phase transformation from amorphous to crystalline is achieved by a heat treatment at defined temperature levels. The traditional approach is to perform the heat treatment in a furnace. This, however, only allows a homogeneous degree of crystallization over the whole volume of the parent glass material. Here a novel approach using a local heat treatment by laser irradiation is presented. To investigate the potential of this approach the crystallization process of SiO2-Li2O-Al2O3-based glass has been studied with laser systems (pulsed and continuous wave) operating at different wavelengths. Our results show the feasibility of gradual and partial crystallization of the base material using continuous laser irradiation. A dental prosthesis machined from an amorphous glassy state can be effectively treated with laser irradiation and crystallized within a confined region of a few millimeters starting from the body surface. Very good aesthetics have been achieved. Preliminary investigation with pulsed nanosecond lasers of a few hundreds nanoseconds pulse width has enabled more refinement of crystallization and possibility to place start of phase change within the material bulk.
Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Linhard, Verena; Fritzsch, Günter; Zhang, Bin; Michel, Hartmut; Stöckigt, Joachim
2004-09-01
Crystals of vinorine synthase (VS) from medicinal plant Rauvolfia serpentina expressed in Escherichia coli have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. The enzyme is involved in the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure of a member of this enzyme family is known. The crystals belong to the space group P2(1)2(1)2(1) with cell dimensions of a=82.3 A, b=89.6 A and c=136.2 A. Under cryoconditions (120 K), a complete data set up to 2.8 A was collected at a synchrotron source.
Xu, Zhen; Yang, Weili; Shi, Nuo; Gao, Yongxiang; Teng, Maikun; Niu, Liwen
2010-08-01
The histone chaperone SET encoded by the SET gene, which is also known as template-activating factor Iß (TAF-Iß), is a multifunctional molecule that is involved in many biological phenomena such as histone binding, nucleosome assembly, chromatin remodelling, replication, transcription and apoptosis. A truncated SET/TAF-Iß ΔN protein that lacked the first 22 residues of the N-terminus but contained the C-terminal acidic domain and an additional His6 tag at the C-terminus was overexpressed in Escherichia coli and crystallized by the hanging-drop vapour-diffusion method using sodium acetate as precipitant at 283 K. The crystals diffracted to 2.7 A resolution and belonged to space group P4(3)2(1)2.
King, Gordon; Hill, Justine M.; Martin, Jennifer L.; Mylne, Joshua S.
2009-01-01
VERNALIZATION1 (VRN1) is required in the model plant Arabidopsis thaliana for the epigenetic suppression of the floral repressor FLC by prolonged cold treatment. Stable suppression of FLC accelerates flowering, a physiological process known as vernalization. VRN1 is a 341-residue DNA-binding protein that contains two plant-specific B3 domains (B3a and B3b), a putative nuclear localization sequence (NLS) and two putative PEST domains. VRN1208–341 includes the second B3 domain and a region upstream that is highly conserved in the VRN1 orthologues of other dicotyledonous plants. VRN1208–341 was crystallized by the hanging-drop method in 0.05 M sodium acetate pH 6.0 containing 1.0 M NaCl and 18%(w/v) PEG 3350. Preliminary X-ray diffraction data analysis revealed that the VRN1208–341 crystal diffracted to 2.1 Å and belonged to space group C2, with unit-cell parameters a = 105.2, b = 47.9, c = 61.2 Å, α = 90.0, β = 115.4, γ = 90.0°. Assuming that two molecules occupy the asymmetric unit, a Matthews coefficient of 2.05 Å3 Da−1 and a solvent content of 40.1% were calculated. PMID:19255487
Liquid micro-lens array activated by selective electrowetting on lithium niobate substrates.
Grilli, S; Miccio, L; Vespini, V; Finizio, A; De Nicola, S; Ferraro, Pietro
2008-05-26
Lens effect was obtained in an open microfluidic system by using a thin layer of liquid on a polar electric crystal like LiNbO3. An array of liquid micro-lenses was generated by electrowetting effect in pyroelectric periodically poled crystals. Compared to conventional electrowetting devices, the pyroelectric effect allowed to have an electrode-less and circuit-less configuration. An interferometric technique was used to characterize the curvature of the micro-lenses and the corresponding results are presented and discussed. The preliminary results concerning the imaging capability of the micro-lens array are also reported.
NASA Astrophysics Data System (ADS)
Herbold, Eric
2005-07-01
Strongly nonlinear phononic crystals were assembled from chains of stainless steel spheres with diameter 4.78 mm. Propagation of solitary waves and splitting of initial pulse into train of solitary waves excited by the impact of piston was investigated in different viscous media in experiments and in numerical calculations. Oil of various grades was used to introduce controlled dissipation into the system. Preliminary results indicate that splitting of the initial pulse into the train of solitary waves was dramatically influenced by viscosity. This work was supported by NSF (Grant No. DCMS03013220).
Solution-Grown Rubrene Crystals as Radiation Detecting Devices
Carman, Leslie; Martinez, H. Paul; Voss, Lars; ...
2017-01-11
There has been increased interest in organic semiconductors over the last decade because of their unique properties. Of these, 5, 6, 11, 12-tetraphenylnaphthacene (rubrene) has generated the most interest because of its high charge carrier mobility. In this paper, large single crystals with a volume of ~1 cm 3 were grown from solution by a temperature reduction technique. The faceted crystals had flat surfaces and cm-scale, visually defect-free areas suitable for physical characterization. X-ray diffraction analysis indicates that solvent does not incorporate into the crystals and photoluminescence spectra are consistent with pristine, high-crystallinity rubrene. Furthermore, the response curve to pulsedmore » optical illumination indicates that the solution grown crystals are of similar quality to those grown by physical vapor transport, albeit larger. The good quality of these crystals in combination with the improvement of electrical contacts by application of conductive polymer on the graphite electrodes have led to the clear observation of alpha particles with these rubrene detectors. Finally, preliminary results with a 252Cf source generate a small signal with the rubrene detector and may demonstrate that rubrene can also be used for detecting high-energy neutrons.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji
Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less
Wu, Fang; Li, Yikun; Chang, Shaojie; Zhou, Zhaocai; Wang, Fang; Song, Xiaomin; Lin, Yujuan; Gong, Weimin
2002-12-01
A 16 kDa protein SPE16 was purified from the seeds of Pachyrrhizus erosus. Its N-terminal amino-acid sequence showed significant sequence homology to pathogenesis-related proteins from the PR-10 family. An activity assay indicated that SPE16 possesses ribonuclease activity as do some other PR-10 proteins. SPE16 crystals were obtained by the hanging-drop vapour-diffusion method. The space group is P2(1)2(1)2(1), with unit-cell parameters a = 53.36, b = 63.70, c = 72.96 A.
Voltage- and temperature- controlled LC:PDMS waveguide channels
NASA Astrophysics Data System (ADS)
Rutkowska, Katarzyna A.; Asquini, Rita; d'Alessandro, Antonio
2017-08-01
In this paper, we present our studies on electrical and thermal tuning of light propagation in waveguide channels, made for the scope from a polydimethylsiloxane (PDMS) substrate infiltrated with nematic liquid crystal (LC). We demonstrated, via numerical simulations, the changes of the waveguide optical parameters when solicited by temperature changes or electric fields. Moreover, the paper goes through the fabrication process of a waveguide channel sample and its characterization, as well as some preliminary experimental trials of sputtering indium tin oxide (ITO) and chromium layers on PDMS substrate to obtain flat electrodes.
NASA Astrophysics Data System (ADS)
Iyer, Ganesh Hariharan
The first part of this research involved a study of the nature and extent of nonbonded interactions at crystal and oligomer interfaces. A survey was compiled of several characteristics of intersubunit contacts in 58 different oligomeric proteins, and of the intermolecular contacts in 223 protein crystal structures. Routines written in "S" language were utilized for the generation of the observed and expected contacts. The information in the Protein Data Bank (PDB) was extracted using the database management system, Protein Knowledge Base (PKB). Potentials of mean force for atom-atom contacts and residue-residue contacts were derived by comparison of the number of observed interactions with the number expected by mass action. Preference association matrices and log-linear analyses were applied to determine the different factors that could contribute to the overall interactions at the interfaces of oligomers and crystals. Surface patches at oligomer and crystal interfaces were also studied to further investigate the origin of the differences in their stabilities. Total number of atoms in contact and the secondary structure elements involved are similar in the two types of interfaces. Crystal contacts result from more numerous interactions by polar residues, compared with a tendency toward nonpolar amino acid prominent in oligomer interfaces. Contact potentials indicate that hydrophobic interactions at oligomer interfaces favor aromatic amino acids and methionine over aliphatic amino acids; and that crystal contacts form in such a way as to avoid inclusion of hydrophobic interactions. The second part involved the development of a new class of biomaterials from two-dimensional arrays of ordered proteins. Point mutations were planned to introduce cysteine residues at appropriate locations to enable cross-linking at the molecular interface within given crystallographic planes. Crystallization and subsequent cross-linking of the modified protein would lead to the formation of arrays on subsequent dissociation of the crystal. Novel protein architectures can be generated from these cross-linked nanostructures. Experiments with model protein, maltose-binding protein (MBP) were performed to develop purification, cross-linking and crystallization techniques. The long-term goal of this project is to apply the experience gained with MBP to the fabrication of nanomaterials from other, application-specific proteins for ultrafiltration and microelectronic devices.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mise, Takeshi; Matsunami, Hideyuki; Samatey, Fadel A.
The periplasmic domain of the E. coli aspartate receptor Tar was cloned, expressed, purified and crystallized with and without bound ligand. The crystals obtained diffracted to resolutions of 1.58 and 1.95 Å, respectively. The cell-surface receptor Tar mediates bacterial chemotaxis toward an attractant, aspartate (Asp), and away from a repellent, Ni{sup 2+}. To understand the molecular mechanisms underlying the induction of Tar activity by its ligands, the Escherichia coli Tar periplasmic domain with and without bound aspartate (Asp-Tar and apo-Tar, respectively) were each crystallized in two different forms. Using ammonium sulfate as a precipitant, crystals of apo-Tar1 and Asp-Tar1 weremore » grown and diffracted to resolutions of 2.10 and 2.40 Å, respectively. Alternatively, using sodium chloride as a precipitant, crystals of apo-Tar2 and Asp-Tar2 were grown and diffracted to resolutions of 1.95 and 1.58 Å, respectively. Crystals of apo-Tar1 and Asp-Tar1 adopted space group P4{sub 1}2{sub 1}2, while those of apo-Tar2 and Asp-Tar2 adopted space groups P2{sub 1}2{sub 1}2{sub 1} and C2, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pyburn, Tasia M.; Yankovskaya, Victoria; Bensing, Barbara A.
2012-07-11
The carbohydrate-binding region of the bacterial adhesin GspB from Streptococcus gordonii strain M99 (GspB{sub BR}) was expressed in Escherichia coli and purified using affinity and size-exclusion chromatography. Separate sparse-matrix screening of GspB{sub BR} buffered in either 20 mM Tris pH 7.4 or 20 mM HEPES pH 7.5 resulted in different crystallographic behavior such that different precipitants, salts and additives supported crystallization of GspB{sub BR} in each buffer. While both sets of conditions supported crystal growth in space group P2{sub 1}2{sub 1}2{sub 1}, the crystals had distinct unit-cell parameters of a = 33.3, b = 86.7, c = 117.9 {angstrom} formore » crystal form 1 and a = 34.6, b = 98.3, c = 99.0 {angstrom} for crystal form 2. Additive screening improved the crystals grown in both conditions such that diffraction extended to beyond 2 {angstrom} resolution. A complete data set has been collected to 1.3 {angstrom} resolution with an overall R{sub merge} value of 0.04 and an R{sub merge} value of 0.33 in the highest resolution shell.« less
Hungler, Arnaud; Momin, Afaque; Diederichs, Kay; Arold, Stefan, T.
2016-01-01
Solving the phase problem in protein X-ray crystallography relies heavily on the identity of the crystallized protein, especially when molecular replacement (MR) methods are used. Yet, it is not uncommon that a contaminant crystallizes instead of the protein of interest. Such contaminants may be proteins from the expression host organism, protein fusion tags or proteins added during the purification steps. Many contaminants co-purify easily, crystallize and give good diffraction data. Identification of contaminant crystals may take time, since the presence of the contaminant is unexpected and its identity unknown. A webserver (ContaMiner) and a contaminant database (ContaBase) have been established, to allow fast MR-based screening of crystallographic data against currently 62 known contaminants. The web-based ContaMiner (available at http://strube.cbrc.kaust.edu.sa/contaminer/) currently produces results in 5 min to 4 h. The program is also available in a github repository and can be installed locally. ContaMiner enables screening of novel crystals at synchrotron beamlines, and it would be valuable as a routine safety check for ‘crystallization and preliminary X-ray analysis’ publications. Thus, in addition to potentially saving X-ray crystallographers much time and effort, ContaMiner might considerably lower the risk of publishing erroneous data. PMID:27980519
Ha, Jun Yong; Lee, Ji Hyun; Kim, Kyoung Hoon; Kim, Do Jin; Lee, Hyung Ho; Kim, Hye-Kyung; Yoon, Hye-Jin; Suh, Se Won
2006-02-01
The enzyme erythronate-4-phosphate dehydrogenase catalyses the conversion of erythronate-4-phosphate to 3-hydroxy-4-phospho-hydroxy-alpha-ketobutyrate. It belongs to the D-isomer-specific 2-hydroxyacid dehydrogenase family. It is essential for de novo biosynthesis of vitamin B6 (pyridoxine). Erythronate-4-phosphate dehydrogenase from Pseudomonas aeruginosa, a homodimeric enzyme consisting of two identical 380-residue subunits, has been overexpressed in Escherichia coli with a C-terminal purification tag and crystallized at 297 K using 0.7 M ammonium dihydrogen phosphate, 0.4 M ammonium tartrate, 0.1 M sodium citrate pH 5.6 and 10 mM cupric chloride. X-ray diffraction data were collected to 2.20 A from a crystal grown in the presence of NADH. The crystals belong to the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a = 84.77, b = 101.28, c = 142.58 A. A dimeric molecule is present in the asymmetric unit, giving a crystal volume per protein weight (VM) of 3.64 A3 Da(-1) and a solvent content of 66%.
Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.
2008-02-01
The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less
Expression, purification and crystallization of a lyssavirus matrix (M) protein
Assenberg, René; Delmas, Olivier; Graham, Stephen C.; Verma, Anil; Berrow, Nick; Stuart, David I.; Owens, Raymond J.; Bourhy, Hervé; Grimes, Jonathan M.
2008-01-01
The matrix (M) proteins of lyssaviruses (family Rhabdoviridae) are crucial to viral morphogenesis as well as in modulating replication and transcription of the viral genome. To date, no high-resolution structural information has been obtained for full-length rhabdovirus M. Here, the cloning, expression and purification of the matrix proteins from three lyssaviruses, Lagos bat virus (LAG), Mokola virus and Thailand dog virus, are described. Crystals have been obtained for the full-length M protein from Lagos bat virus (LAG M). Successful crystallization depended on a number of factors, in particular the addition of an N-terminal SUMO fusion tag to increase protein solubility. Diffraction data have been recorded from crystals of native and selenomethionine-labelled LAG M to 2.75 and 3.0 Å resolution, respectively. Preliminary analysis indicates that these crystals belong to space group P6122 or P6522, with unit-cell parameters a = b = 56.9–57.2, c = 187.9–188.6 Å, consistent with the presence of one molecule per asymmetric unit, and structure determination is currently in progress. PMID:18391421
Magnetic Resonance Characterization of Defects in Icosahedral and Cubic Boron Arsenide Bulk Crystals
NASA Astrophysics Data System (ADS)
Glaser, E. R.; Freitas, J. A., Jr.; Cress, C. D.; Perkins, F. K.; Prokes, S. M.; Ruppalt, L. B.; Culbertson, J. C.; Whiteley, C.; Edgar, J. H.; Tian, F.; Ren, Z.; Kim, J.; Shi, L.; Naval Research Lab Team; Kansas State U. Team; U. Houston Team; U. Texas Team
Low-temperature electron spin resonance (ESR) at 9.5 GHz and optically-detected magnetic resonance (ODMR) at 24 GHz were employed to investigate point defects in icosahedral and cubic Boron Arsenide bulk crystals. These semiconductors are of interest for use in high radiation and/or high temperature environments. ESR of the (001) B12As2 (Eg = 3.47 eV) mm-size platelets revealed two distinct features of unknown origin. The first signal is characterized by Zeeman splitting g-values of g|| = 2.017, g⊥ = 2.0183 while the second with g|| = 2.0182, g⊥ = 1.9997. Most notably, the second signal was also observed from ODMR on the broad 2.4 eV ``yellow/green'' photoluminescence band previously reported for these crystals and suggests its direct involvement in this likely defect-related radiative recombination process. Preliminary ESR obtained for the 100-300 micron-size cubic BAs crystals revealed a signal with g-value of 2.018 (very similar to that found for the B12As2 crystals) and broad FWHM value of 182 G. Possible origins of these defects will be discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kapetaniou, Evangelia G.; Braaz, Reinhard; Jendrossek, Dieter
2005-05-01
A novel thermoalkalophilic depolymerase, PhaZ7, from P. lemoignei was crystallized by the microdialysis technique. Crystals belong to space group C2 and diffract to 2.75 Å resolution at a synchrotron source. Polyhydroxyalkanoates (PHA) are biodegradable polyesters that have attracted commercial and academic interest as environmentally friendly materials. A number of enzymes are able to degrade polyhydroxyalkanoates to water-soluble products. PhaZ7 poly(3-hydroxybutyrate) (PHB) depolymerase (EC 3.1.1.75), a 342-amino-acid hydrolase from the PHA-degrading bacterium Paucimonas lemoignei, has been found to possess substrate specificity for amorphous PHA. PhaZ7 was crystallized by the microdialysis method. Thin rod-like crystals were grown in low ionic strength solutionmore » and found to belong to the monoclinic space group C2, with unit-cell parameters a = 225.8, b = 46.5, c = 171.3, β = 128.9°. A complete data set was collected to 2.75 Å resolution at 100 K using synchrotron radiation.« less
A Smoluchowski model of crystallization dynamics of small colloidal clusters
NASA Astrophysics Data System (ADS)
Beltran-Villegas, Daniel J.; Sehgal, Ray M.; Maroudas, Dimitrios; Ford, David M.; Bevan, Michael A.
2011-10-01
We investigate the dynamics of colloidal crystallization in a 32-particle system at a fixed value of interparticle depletion attraction that produces coexisting fluid and solid phases. Free energy landscapes (FELs) and diffusivity landscapes (DLs) are obtained as coefficients of 1D Smoluchowski equations using as order parameters either the radius of gyration or the average crystallinity. FELs and DLs are estimated by fitting the Smoluchowski equations to Brownian dynamics (BD) simulations using either linear fits to locally initiated trajectories or global fits to unbiased trajectories using Bayesian inference. The resulting FELs are compared to Monte Carlo Umbrella Sampling results. The accuracy of the FELs and DLs for modeling colloidal crystallization dynamics is evaluated by comparing mean first-passage times from BD simulations with analytical predictions using the FEL and DL models. While the 1D models accurately capture dynamics near the free energy minimum fluid and crystal configurations, predictions near the transition region are not quantitatively accurate. A preliminary investigation of ensemble averaged 2D order parameter trajectories suggests that 2D models are required to capture crystallization dynamics in the transition region.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Omi, Rie; Department of Chemistry, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585; Jitsumori, Keiji
A recombinant form of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1 has been expressed in E. coli, purified and crystallized. The crystal belongs to space group P6{sub 3}. Diffraction data have been collected to 1.75 Å resolution. dl-2-Haloacid dehalogenase from Methylobacterium sp. CPA1 (dl-DEX Mb) is a unique enzyme that catalyzes the dehalogenation reaction without the formation of an ester intermediate. A recombinant form of dl-DEX Mb has been expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 186.2, c =more » 114.4 Å. The crystals are likely to contain between four and eight monomers in the asymmetric unit, with a V{sub M} value of 4.20–2.10 Å{sup 3} Da{sup −1}. A self-rotation function revealed peaks on the χ = 180° section. X-ray data have been collected to 1.75 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mukhgalin, V. V.; Lad’yanov, V. I.
2015-08-17
The influence of the melt heat treatment on the structure and crystallization process of the rapidly quenched amorphous Fe{sub 78}B{sub 12}Si{sub 9}Ni{sub 1} alloys have been investigated by means of x-ray diffraction, DSC and TEM. Amorphous phase separation has been observed in the alloys quenched after the preliminary high temperature heat treatment of the liquid alloy (heating above 1400°C). Comparative analysis of the pair distribution functions demonstrates that this phase separation accompanied by a changes in the local atomic arrangement. It has been found that crystallization process at heating is strongly dependent on the initial amorphous phase structure - homogeneousmore » or phase separated. In the last case crystallization goes through the formation of a new metastable hexagonal phase [a=12.2849(9) Ǻ, c=7.6657(8) Ǻ]. At the same time the activation energy for crystallization (Ea) reduces from 555 to 475 kJ mole{sup −1}.« less
Lee, Hyung Ho; Jung, Sang Taek
2013-02-01
β-N-acetylglucosaminidase (NagA) protein hs a chitin-degrading activity and chitin is one of the most abundant polymers in nature. NagA contains a family 3 glycoside (GH3)-type N-terminal domain and a unique C-terminal domain. The structurally uncharacterized C-terminal domain of NagA may be involved in substrate specificity. To provide a structural basis for the substrate specificity of NagA, structural analysis of NagA from Thermotoga maritima encoded by the Tm0809 gene was initiated. NagA from T. maritima has been overexpressed in Escherichia coli and crystallized at 296 K using ammonium sulfate as a precipitant. Crystals of T. maritima NagA diffracted to 3.80 Å resolution and belonged to the monoclinic space group C2, with unit-cell parameters a = 231.15, b = 133.62, c = 140.88 Å, β = 89.97°. The crystallization of selenomethionyl-substituted protein is in progress to solve the crystal structure of T. maritima NagA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi
2014-09-25
A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less
Wang, Yung Lin; Lin, Yi Ting; Chen, Chia Lin; Shaw, Gwo Chyuan; Liaw, Shwu Huey
2014-10-01
Poly[(R)-3-hydroxybutyrate] (PHB) is a microbial biopolymer that has been commercialized as biodegradable plastics. The key enzyme for the degradation is PHB depolymerase (PhaZ). A new intracellular PhaZ from Bacillus thuringiensis (BtPhaZ) has been screened for potential applications in polymer biodegradation. Recombinant BtPhaZ was crystallized using 25% polyethylene glycol 3350, 0.2 M ammonium acetate, 0.1 M bis-tris pH 6.5 at 288 K. The crystals belonged to space group P1, with unit-cell parameters a = 42.97, b = 83.23, c = 85.50 Å, α = 73.45, β = 82.83, γ = 83.49°. An X-ray diffraction data set was collected to 1.42 Å resolution with an Rmerge of 6.4%. Unexpectedly, a molecular-replacement solution was obtained using the crystal structure of Streptomyces lividans chloroperoxidase as a template, which shares 24% sequence identity to BtPhaZ. This is the first crystal structure of an intracellular poly(3-hydroxybutyrate) depolymerase.
Crystal growth of ZnSe and related ternary compound semiconductors by physical vapor transport
NASA Technical Reports Server (NTRS)
Su, Ching-Hua
1993-01-01
The materials to be investigated are ZnSe and related ternary semiconducting alloys (e.g., ZnS(x)Se(1-x), ZnTe(x)Se(1-x), and Zn(1-x)Cd(x)Se). These materials are useful for opto-electronic applications such as high efficient light emitting diodes and low power threshold and high temperature lasers in the blue-green region of the visible spectrum. The recent demonstration of its optical bistable properties also makes ZnSe a possible candidate material for digital optical computers. The investigation consists of an extensive ground-based study followed by flight experimentation, and involves both experimental and theoretical work. The objectives of the ground-based work are to establish the characteristics of the crystals grown on Earth as a basis for subsequent comparative evaluations of the crystals grown in a low gravity environment and to obtain the experimental data and perform the analyses required to define the optimum parameters for the flight experiments. During the six months of the Preliminary Definition Phase, the research efforts were concentrated on the binary compound ZnSe - the purification of starting materials of Se by zone refining, the synthesis of ZnSe starting materials, the heat treatments of the starting materials, the vapor transport rate measurements, the vapor partial pressure measurements of ZnSe, the crystal growth of ZnSe by physical vapor transport, and various characterization on the grown ZnSe crystals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette, E-mail: annette.rompel@univie.ac.at
2015-05-22
Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and themore » latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)« less
Preliminary studies of PQS PET detector module for dose verification of carbon beam therapy
NASA Astrophysics Data System (ADS)
Kim, H.-I.; An, S. Jung; Lee, C. Y.; Jo, W. J.; Min, E.; Lee, K.; Kim, Y.; Joung, J.; Chung, Y. H.
2014-05-01
PET imaging can be used to verify dose distributions of therapeutic particle beams such as carbon ion beams. The purpose of this study was to develop a PET detector module which was designed for an in-beam PET scanner geometry integrated into a carbon beam therapy system, and to evaluate its feasibility as a monitoring system of patient dose distribution. A C-shaped PET geometry was proposed to avoid blockage of the carbon beam by the detector modules. The proposed PET system consisted of 14 detector modules forming a bore with 30.2 cm inner diameter for brain imaging. Each detector module is composed of a 9 × 9 array of 4.0 mm × 4.0 mm × 20.0 mm LYSO crystal module optically coupled with four 29 mm diameter PMTs using Photomultiplier-quadrant-sharing (PQS) technique. Because the crystal pixel was identified based upon the distribution of scintillation lights of four PMTs, the design of the reflector between crystal elements should be well optimized. The optical design of reflectors was optimized using DETECT2000, a Monte Carlo code for light photon transport. A laser-cut reflector set was developed using the Enhanced Specular Reflector (ESR, 3M Co.) mirror-film with a high reflectance of 98% and a thickness of 0.064 mm. All 81 crystal elements of detector module were identified. Our result demonstrates that the C-shaped PET system is under development and we present the first reconstructed image.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ten-i, Tomomi; Kumasaka, Takashi; Higuchi, Wataru
2007-11-01
The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. The covalent modification of the side chains of Trp95, Tyr218 and Met244 within the active site of Haloarcula marismortui catalase–peroxidase (KatG) appears to be common to all KatGs and has been demonstrated to be particularly significant formore » its bifunctionality [Smulevich et al. (2006 ▶), J. Inorg. Biochem.100, 568–585; Jakopitsch, Kolarich et al. (2003 ▶), FEBS Lett.552, 135–140; Jakopitsch, Auer et al. (2003 ▶), J. Biol. Chem.278, 20185–20191; Jakopitsch et al. (2004 ▶), J. Biol. Chem.279, 46082–46095; Regelsberger et al. (2001 ▶), Biochem. Soc. Trans.29, 99–105; Ghiladi, Knudsen et al. (2005 ▶), J. Biol. Chem.280, 22651–22663; Ghiladi, Medzihradzky et al. (2005 ▶), Biochemistry, 44, 15093–15105]. The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant showed a complete loss of catalase activity, whereas the peroxidase activity of this mutant was highly enhanced owing to an increase in its affinity for the peroxidatic substrate. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. A crystal frozen using lithium sulfate as the cryoprotectant diffracted to beyond 2.0 Å resolution. Preliminary X-ray analysis suggests the presence of a dimer in the asymmetric unit.« less
NASA Astrophysics Data System (ADS)
Munnikhuis, J.; Glazner, A. F.; Coleman, D. S.; Mills, R. D.
2015-12-01
Why megacrystic textures develop in silicic igneous rocks is still unknown. One hypothesis is that these crystals nucleate early in a magma chamber with a high liquid content. A supportive observation of this hypothesis is areas in plutons with high concentrations of megacrysts suggesting flow sorting. Another group of hypotheses suggest megacrystic textures form during protracted late-stage coarsening in a low-melt, interlocked matrix due to either thermal oscillations from incremental pluton emplacement, or Ostwald ripening. Isotopic analyses of large, euhedral K-feldspar megacrysts from the Cretaceous intrusive suites of the Sierra Nevada batholith (SNB) provide new insight into their origin. Megacrysts from the SNB reach the decimeter scale, are Or rich (85-90%), are perthitic, and host mineral inclusions of nearly all phases in the host rock. In-situ micro-drilling of transects, from core to rim, of the alkali feldspars provides material for Sr and Pb isotopic analyses by thermal ionization mass spectrometry (TIMS). Preliminary 87Sr/86Sr(i) isotopic data from samples from the Cathedral Peak Granodiorite, of the Tuolumne Intrusive Suite range from 0.706337 to 0.706452 (~1.6ɛSr) near the cores, whereas a sawtooth pattern with larger variability, 0.706179 to 0.706533 (~5ɛSr), occurs nears the rims. We interpret these preliminary data to indicate that the late portion of growth (i.e. crystal rim) was dominated by either cannibalism of small K-feldspar crystals with isotopic variability, or by addition of isotopically diverse late components to the magma. By comparing the Sr and Pb isotopic stratigraphy of megacrysts from a variety of rock matrices and different granitoids in the SNB isotopic trends can be evaluated to determine if crystals sizes are dependent on disequilibrium processes or grow at a steady state.
Salvador, Guilherme H. M.; Marchi-Salvador, Daniela P.; Silveira, Lucas B.; Soares, Andreimar M.; Fontes, Marcos R. M.
2011-01-01
Phospholipases A2 (PLA2s) are enzymes that cause the liberation of fatty acids and lysophospholipids by the hydrolysis of membrane phospholipids. In addition to their catalytic action, a wide variety of pharmacological activities have been described for snake-venom PLA2s. BmooPLA2-I is an acidic, nontoxic and catalytic PLA2 isolated from Bothrops moojeni snake venom which exhibits an inhibitory effect on platelet aggregation, an immediate decrease in blood pressure, inducing oedema at a low concentration, and an effective bactericidal effect. BmooPLA2-I has been crystallized and X-ray diffraction data have been collected to 1.6 Å resolution using a synchrotron-radiation source. The crystals belonged to space group C2221, with unit-cell parameters a = 39.7, b = 53.2, c = 89.2 Å. The molecular-replacement solution of BmooPLA2-I indicated a monomeric conformation, which is in agreement with nondenaturing electrophoresis and dynamic light-scattering experiments. A comparative study of this enzyme with the acidic PLA2 from B. jararacussu (BthA-I) and other toxic and nontoxic PLA2s may provide important insights into the functional aspects of this class of proteins. PMID:21821890
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tseng, Quincy; Orans, Jillian; Hast, Michael A.
2012-03-16
MutS{beta} is a eukaryotic mismatch repair protein that preferentially targets extrahelical unpaired nucleotides and shares partial functional redundancy with MutS{alpha} (MSH2-MSH6). Although mismatch recognition by MutS{alpha} has been shown to involve a conserved Phe-X-Glu motif, little is known about the lesion-binding mechanism of MutS{beta}. Combined MSH3/MSH6 deficiency triggers a strong predisposition to cancer in mice and defects in msh2 and msh6 account for roughly half of hereditary nonpolyposis colorectal cancer mutations. These three MutS homologs are also believed to play a role in trinucleotide repeat instability, which is a hallmark of many neurodegenerative disorders. The baculovirus overexpression and purification ofmore » recombinant human MutS{beta} and three truncation mutants are presented here. Binding assays with heteroduplex DNA were carried out for biochemical characterization. Crystallization and preliminary X-ray diffraction analysis of the protein bound to a heteroduplex DNA substrate are also reported.« less
Effects of organic matter on crystallization of struvite in biologically treated swine wastewater.
Capdevielle, Aurélie; Sýkorová, Eva; Béline, Fabrice; Daumer, Marie-Line
2016-01-01
A sustainable way to recover phosphorus (P) in swine wastewater involves a preliminary step of P dissolution followed by the separation of particulate organic matter (OM). The next two steps are firstly the precipitation of struvite crystals done by adding a crystallization reagent (magnesia) and secondly the filtration of the crystals. To develop the process successfully at an industrial scale, the control of the mechanisms of precipitation is the key point in order to obtain high value-added products, that is, big struvite crystals easy to harvest and handle. Experiments with process parameters optimized previously in a synthetic swine wastewater were performed on real swine wastewater to assess the role of the OM on struvite crystallization. After 24 h, with a pH increase to 6.8 only, 90% of the initial P was precipitated and 60% was precipitated as struvite. 80% of the solid recovered was in the fraction > 100 µm. The other forms recovered were brushite, amorphous calcium phosphate, NaCl, KCl and OM. The influence of OM on struvite precipitation in acidified swine wastewater was negative on the reaction kinetics but positive on the size of the struvite crystals. The presence of colloidal particles increased the size of the struvite crystals but slowed down the kinetics due to the viscosity induced by the repulsive force of the colloids. The maximum size of single struvite crystals (200 µm) was observed with the presence of particulate OM.
NASA Astrophysics Data System (ADS)
Lassoued, Mohamed Saber; Abdelbaky, Mohammed S. M.; Lassoued, Abdelmajid; Gadri, Abdellatif; Ammar, Salah; Ben Salah, Abdelhamid; García-Granda, Santiago
2017-08-01
The present paper reports the synthesis of a single crystal of a new organic-inorganic hybrid compound, with the formula (C6H14N2) CdCl4·H2O, by slow evaporation method at room temperature. It was characterized by single crystal X-ray diffraction (SCXRD), powder X-ray diffraction (PXRD), Hirshfeld surface, spectroscopy measurement, thermal study and photoluminescence (PL) properties. A preliminary SCXRD structural analysis revealed that it crystallized in the monoclinic system (space group P21/c) with the following unit cell parameters: a = 12.95823(16) Å, b = 14.92449(16) Å, c = 7.13838(9) Å and β = 103.2108(12)° with Z = 4. The refinement converged to R = 0.0164 and ωR = 0.0393. Its atomic arrangement can be described as an alternation of organic and inorganic layers along the a-axis. The crystal packing was governed by the N-H⋯Cl and O-H⋯Cl hydrogen bonding interaction between the 1.2-diammoniumcyclohexane cations, the [CdCl42n-]n anions and water molecule. The Hirshfeld surface analysis was conducted to investigate intermolecular interactions and associated 2D fingerprint plots, revealing the relative contribution of these interactions in the crystal structure quantitatively. Furthermore, the room temperature infrared (IR) spectrum of the title compound was recorded and analyzed on the basis of data found in the literature. Besides, the thermal analysis studies were performed, but no phase transition was found in the temperature range between 30 and 450 °C. The optical and PL properties of the compound were investigated in the solid state at room temperature and exhibited three bands at 225, 268 and 315 nm and a strong fluorescence at 443 nm.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie
2008-04-01
Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen
2006-11-01
Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen
The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less
Power scaling of diode-pumped neodymium yttrium aluminum borate laser
NASA Technical Reports Server (NTRS)
Hemmati, Hamid
1991-01-01
Preliminary results are presented of the efficient diode-pumped operation of a neodymium yttrium aluminum borate (NYAB) laser at 531.5 nm using two 1-W diode-laser arrays for the pump. With 1380 mW of CW power incident on the crystal, as much as 51 mW of 532.5-nm laser radiation was obtained with the unoptimized cavity. The corresponding optical-to-optical conversion efficiency was 3.7 percent. A plot of the output 531.5 nm vs incident 807 nm pump power is shown. The crystal output power was critically dependent on the rotational and translational adjustment of the NYAB crystal inside the cavity. It is suggested that a crystal cut at the exact phase matching angle, placed in a cavity with proper optimal reflection and transmission mirror coatings, and pumped at proper wavelength can result in higher output power. Thus, the NYAB output power approaches that of a CW intracavity frequency doubled Nd:YAG laser.
Taketa, Midori; Nakagawa, Hanae; Habukawa, Mao; Osuka, Hisao; Kihira, Kiyohito; Komori, Hirofumi; Shibata, Naoki; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi; Yoon, Ki-Seok; Ogo, Seiji; Shomura, Yasuhito; Higuchi, Yoshiki
2015-01-01
NAD+-reducing [NiFe] hydrogenases catalyze the oxidoreduction of dihydrogen concomitant with the interconversion of NAD+ and NADH. Here, the isolation, purification and crystallization of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1 are reported. Crystals of the NAD+-reducing [NiFe] hydrogenase were obtained within one week from a solution containing polyethylene glycol using the sitting-drop vapour-diffusion method and micro-seeding. The crystal diffracted to 2.58 Å resolution and belonged to space group C2, with unit-cell parameters a = 131.43, b = 189.71, c = 124.59 Å, β = 109.42°. Assuming the presence of two NAD+-reducing [NiFe] hydrogenase molecules in the asymmetric unit, V M was calculated to be 2.2 Å3 Da−1, which corresponds to a solvent content of 43%. Initial phases were determined by the single-wavelength anomalous dispersion method using the anomalous signal from the Fe atoms. PMID:25615977
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rengachari, Srinivasan; Aschauer, Philipp; Sturm, Christian
A soluble variant of the monoglyceride lipase Yju3p was successfully expressed, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. The protein Yju3p is the orthologue of monoglyceride lipases in the yeast Saccharomyces cerevisiae. A soluble variant of this lipase termed s-Yju3p (38.3 kDa) was generated and purified to homogeneity by affinity and size-exclusion chromatography. s-Yju3p was crystallized in a vapour-diffusion setup at 293 K and a complete data set was collected to 2.4 Å resolution. The crystal form was orthorhombic (space group P2{sub 1}2{sub 1}2{sub 1}), with unit-cell parameters a = 77.2, b = 108.6, c =more » 167.7 Å. The asymmetric unit contained four molecules with a solvent content of 46.4%.« less
Crystallization and preliminary crystallographic analysis of porcine acylaminoacyl peptidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wright, Helena; Kiss, András L.; Szeltner, Zoltán
2005-10-01
Acylaminoacyl peptidase from porcine liver has been crystallized. Data were collected to 3.4 Å from native crystals and a search for heavy-atom derivatives is in progress. Acylaminoacyl peptidase (also known as acylamino-acid-releasing enzyme or acylpeptide hydrolase; EC 3.4.19.1) is an unusual member of the prolyl oligopeptidase family catalysing the hydrolysis of an N-acylated peptide to an acylamino acid and a peptide with a free N-terminus. Acylaminoacyl peptidase purified from porcine liver has been crystallized in mother liquor containing 0.1 M Tris–HCl pH 7.0, 10%(w/v) polyethylene glycol 8000, 50 mM MgCl{sub 2} and 1%(w/v) CHAPS using the hanging-drop vapour-diffusion technique. Amore » full data set to 3.4 Å resolution was collected at ESRF beamline ID14-4 and space group C222 was assigned, with unit-cell parameters a = 84.8, b = 421.1, c = 212.0 Å and four molecules in the asymmetric unit.« less
Automated Sample Exchange Robots for the Structural Biology Beam Lines at the Photon Factory
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hiraki, Masahiko; Watanabe, Shokei; Yamada, Yusuke
2007-01-19
We are now developing automated sample exchange robots for high-throughput protein crystallographic experiments for onsite use at synchrotron beam lines. It is part of the fully automated robotics systems being developed at the Photon Factory, for the purposes of protein crystallization, monitoring crystal growth, harvesting and freezing crystals, mounting the crystals inside a hutch and for data collection. We have already installed the sample exchange robots based on the SSRL automated mounting system at our insertion device beam lines BL-5A and AR-NW12A at the Photon Factory. In order to reduce the time required for sample exchange further, a prototype ofmore » a double-tonged system was developed. As a result of preliminary experiments with double-tonged robots, the sample exchange time was successfully reduced from 70 seconds to 10 seconds with the exception of the time required for pre-cooling and warming up the tongs.« less
Ullah, Anwar; de Giuseppe, Priscila Oliveira; Murakami, Mario Tyago; Trevisan-Silva, Dilza; Wille, Ana Carolina Martins; Chaves-Moreira, Daniele; Gremski, Luiza Helena; da Silveira, Rafael Bertoni; Sennf-Ribeiro, Andrea; Chaim, Olga Meiri; Veiga, Silvio Sanches; Arni, Raghuvir Krishnaswamy
2011-01-01
Phospholipases D are the major dermonecrotic component of Loxosceles venom and catalyze the hydrolysis of phospholipids, resulting in the formation of lipid mediators such as ceramide-1-phosphate and lysophosphatidic acid which can induce pathological and biological responses. Phospholipases D can be classified into two classes depending on their catalytic efficiency and the presence of an additional disulfide bridge. In this work, both wild-type and H12A-mutant forms of the class II phospholipase D from L. intermedia venom were crystallized. Wild-type and H12A-mutant crystals were grown under very similar conditions using PEG 200 as a precipitant and belonged to space group P1211, with unit-cell parameters a = 50.1, b = 49.5, c = 56.5 Å, β = 105.9°. Wild-type and H12A-mutant crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively. PMID:21301094
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fulton, Zara; Crellin, Paul K.; Brammananth, Rajini
2008-05-28
Glycosidic bond formation is a ubiquitous enzyme-catalysed reaction. This glycosyltransferase-mediated process is responsible for the biosynthesis of innumerable oligosaccharides and glycoconjugates and is often organism- or cell-specific. However, despite the abundance of genomic information on glycosyltransferases (GTs), there is a lack of structural data for this versatile class of enzymes. Here, the cloning, expression, purification and crystallization of an essential 329-amino-acid (34.8 kDa) putative GT of the classic GT-A fold implicated in mycobacterial cell-wall biosynthesis are reported. Crystals of MAP2569c from Mycobacterium avium subsp. paratuberculosis were grown in 1.6 M monoammonium dihydrogen phosphate and 0.1 M sodium citrate pH 5.5.more » A complete data set was collected to 1.8 {angstrom} resolution using synchrotron radiation from a crystal belonging to space group P4{sub 1}2{sub 1}2.« less
Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.
Nanson, Jeffrey David; Forwood, Jade Kenneth
2014-01-01
The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamada, Mototsugu, E-mail: mototsugu-yamada@meiji.co.jp; Watanabe, Takashi; Baba, Nobuyoshi
The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 86.39,more » c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent.« less
Gunn, Natalie J; Gorman, Michael A; Dobson, Renwick C J; Parker, Michael W; Mulhern, Terrence D
2011-03-01
The C-terminal Src kinase (Csk) and Csk-homologous kinase (CHK) are endogenous inhibitors of the proto-oncogenic Src family of protein tyrosine kinases (SFKs). Phosphotyrosyl peptide binding to their Src-homology 2 (SH2) domains activates Csk and CHK, enhancing their ability to suppress SFK signalling; however, the detailed mechanistic basis of this activation event is unclear. The CHK SH2 was expressed in Escherichia coli and the purified protein was characterized as monomeric by synchrotron small-angle X-ray scattering in-line with size-exclusion chromatography. The CHK SH2 crystallized in 0.2 M sodium bromide, 0.1 M bis-Tris propane pH 6.5 and 20% polyethylene glycol 3350 and the best crystals diffracted to ∼1.6 Å resolution. The crystals belonged to space group P2, with unit-cell parameters a=25.8, b=34.6, c=63.2 Å, β=99.4°.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trincão, José; Sousa Silva, Marta; Barata, Lídia
2006-08-01
A glyoxalase II from L. infantum was cloned, purified and crystallized and its structure was solved by X-ray crystallography. In trypanosomatids, trypanothione replaces glutathione in all glutathione-dependent processes. Of the two enzymes involved in the glyoxalase pathway, glyoxalase I and glyoxalase II, the latter shows absolute specificity towards trypanothione thioester, making this enzyme an excellent model to understand the molecular basis of trypanothione binding. Cloned glyoxalase II from Leishmania infantum was overexpressed in Escherichia coli, purified and crystallized. Crystals belong to space group C222{sub 1} (unit-cell parameters a = 65.6, b = 88.3, c = 85.2 Å) and diffract beyondmore » 2.15 Å using synchrotron radiation. The structure was solved by molecular replacement using the human glyoxalase II structure as a search model. These results, together with future detailed kinetic characterization using lactoyltrypanothione, should shed light on the evolutionary selection of trypanothione instead of glutathione by trypano-somatids.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huché, Frédéric, E-mail: huche@pasteur.fr; Unité des Membranes Bactériennes, CNRS URA 2172, Département de Microbiologie Fondamentale et Médicale, Institut Pasteur, 25-28 Rue du Dr Roux, 75724 Paris CEDEX 15; Delepelaire, Philippe
2006-01-01
The expression, purification, and crystallization in space group P2{sub 1}2{sub 1}2{sub 1} of the complex HasA-HasR from S. marcescens are reported. Diffraction data have been collected and processed to 6.8 Å. Serratia marcescens is able to acquire iron using its haem-acquisition system (‘has’), which contains an outer membrane receptor HasR and a soluble haemophore HasA. After secretion, HasA binds free haem in the extracellular medium or extracts it from haemoproteins and delivers it to the receptor. Here, the crystallization of a HasA–HasR complex is reported. HasA and HasR have been overexpressed in Escherichia coli and the complex formed and crystallized.more » Small platelets and bunches of needles of dimensions 0.01 × 0.1 × 1 mm were obtained. A native data set has been collected to 6.8 Å.« less