DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa
The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arreola, Rodrigo; Vega-Miranda, Anita; Gómez-Puyou, Armando
The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2{sub 1} with unit-cell parameters a = 59.7, b = 87.4, c =more » 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22{sub 1}2{sub 1} with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms.« less
Crystallization and preliminary X-ray diffraction analysis of West Nile virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.
2010-05-25
West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less
Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy
2014-10-01
Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.
Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy
2014-01-01
Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cupp-Vickery, Jill R., E-mail: jvickery@uci.edu; Igarashi, Robert Y.; Meyer, Christopher R.
2005-03-01
Crystallization and X-ray diffraction methods for native A. tumefaciens ADP-glucose pyrophosphorylase and its selenomethionyl derivative are described. Two crystal forms are identified, both of which diffract to 2 Å.
Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.
2009-01-01
Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014
Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B
2009-10-01
Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.
Vyas, Rajan; Kumar, Vijay; Panjikar, Santosh; Karthikeyan, Subramanian; Kishan, K. V. Radha; Tewari, Rupinder; Weiss, Manfred S.
2008-01-01
Aspartate semialdehyde dehydrogenase from Mycobacterium tuberculosis (Asd, ASADH, Rv3708c), which is the second enzyme in the lysine/homoserine-biosynthetic pathways, has been expressed heterologously in Escherichia coli. The enzyme was purified using affinity and gel-filtration chromatographic techniques and crystallized in two different crystal forms. Preliminary diffraction data analysis suggested the presence of up to four monomers in the asymmetric unit of the orthorhombic crystal form A and of one or two monomers in the cubic crystal form B. PMID:18323599
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balotra, Sahil; Newman, Janet; French, Nigel G.
2014-02-19
The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Scott, Stacy A.; Holloway, Gavan; Coulson, Barbara S.
2005-06-01
The sialic acid-binding domain (VP8*) component of the porcine CRW-8 rotavirus spike protein has been overexpressed in E. coli, purified and co-crystallized with an N-acetylneuraminic acid derivative. X-ray diffraction data have been collected to 2.3 Å, which has enabled determination of the structure by molecular replacement. Rotavirus recognition and attachment to host cells involves interaction with the spike protein VP4 that projects outwards from the surface of the virus particle. An integral component of these spikes is the VP8* domain, which is implicated in the direct recognition and binding of sialic acid-containing cell-surface carbohydrates and facilitates subsequent invasion by themore » virus. The expression, purification, crystallization and preliminary X-ray diffraction analysis of VP8* from porcine CRW-8 rotavirus is reported. Diffraction data have been collected to 2.3 Å resolution, enabling the determination of the VP8* structure by molecular replacement.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Feifei; Gao, Feng; Li, Honglin
The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.
Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi
2006-01-01
The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559
Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.
Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping
2012-08-01
Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.
Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4
Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping
2012-01-01
Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128
Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase
Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo
2006-01-01
Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walanj, Rupa; Young, Paul; Baker, Heather M.
2005-04-01
APH(2′′)-Ib is an enzyme responsible for high-level gentamicin resistance in E. faecium isolates. Native crystals of this enzyme have been prepared and preliminary X-ray diffraction experiments have been undertaken. Bacterial resistance to the aminoglycoside antibiotics is primarily the result of deactivation of the drugs. Three families of enzymes are responsible for this activity, with one such family being the aminoglycoside phosphotransferases (APHs). The gene encoding one of these enzymes, APH(2′′)-Ib, has been cloned and the protein (comprising 299 amino-acid residues) expressed in Escherichia coli, purified and crystallized in the presence of 16%(w/v) PEG 3350 and gentamicin. The crystals belong tomore » the monoclinic space group P2{sub 1}, with approximate unit-cell parameters a = 79.7, b = 58.8, c = 81.4 Å, β = 98.4°, and preliminary X-ray diffraction analysis is consistent with the presence of two molecules in the asymmetric unit. Synchrotron diffraction data to approximately 2.65 Å resolution were collected from a native APH(2′′)-Ib crystal at beamline BL9-2 at SSRL (Stanford, CA, USA). Selenium-substituted crystals have also been produced and structure determination is proceeding.« less
Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel
2014-09-01
TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp
2007-09-01
A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.
2008-08-01
Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX
2006-10-01
Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marchi-Salvador, D. P.; Fernandes, C. A. H.; Amui, S. F.
2006-06-01
A non-catalytic and myotoxic Lys49-PLA{sub 2} from B. jararacussu venom was crystallized with BPB inhibitor and X-ray diffraction data were collected. Preliminary analysis indicates that the ligand is bound to the His48 residue. Structure determination may provide insights into the myotoxic and cytotoxic mechanisms of Lys49-PLA{sub 2}s. For the first time, a non-catalytic and myotoxic Lys49-PLA{sub 2} (BthTX-I from Bothrops jararacussu venom) has been crystallized with BPB inhibitor. X-ray diffraction data were collected and electron-density calculations showed that the ligand is bound to the His48 residue. BthTX-I with His48 chemically modified by BPB shows strongly reduced myotoxic and cytotoxic activities.more » This suggests a biological correlation between the modification of His48, which is associated with catalytic activity of PLA{sub 2}s, and other toxicological activities of Lys49-PLA{sub 2}s.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Olchowy, Jaroslaw; Jedrzejczak, Robert; Milewski, Slawomir
2005-11-01
The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to spacemore » group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers.« less
Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.
2010-11-12
Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.
Crystallization and preliminary X-ray analysis of Leishmania major glyoxalase I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ariza, Antonio; Vickers, Tim J.; Greig, Neil
2005-08-01
The detoxification enzyme glyoxalase I from L. major has been crystallized. Preliminary molecular-replacement calculations indicate the presence of three glyoxalase I dimers in the asymmetric unit. Glyoxalase I (GLO1) is a putative drug target for trypanosomatids, which are pathogenic protozoa that include the causative agents of leishmaniasis. Significant sequence and functional differences between Leishmania major and human GLO1 suggest that it may make a suitable template for rational inhibitor design. L. major GLO1 was crystallized in two forms: the first is extremely disordered and does not diffract, while the second, an orthorhombic form, produces diffraction to 2.0 Å. Molecular-replacement calculationsmore » indicate that there are three GLO1 dimers in the asymmetric unit, which take up a helical arrangement with their molecular dyads arranged approximately perpendicular to the c axis. Further analysis of these data are under way.« less
Synchrotron X-Ray Diffraction Analysis of Meteorites in Thin Section: Preliminary Results
NASA Technical Reports Server (NTRS)
Treiman, A. H.; Lanzirotti, A.; Xirouchakis, D.
2004-01-01
X-ray diffraction is the pre-eminent technique for mineral identification and structure determination, but is difficult to apply to grains in thin section, the standard meteorite preparation. Bright focused X-ray beams from synchrotrons have been used extensively in mineralogy and have been applied to extraterrestrial particles. The intensity and small spot size achievable in synchrotron X-ray beams makes them useful for study of materials in thin sections. Here, we describe Synchrotron X-ray Diffraction (SXRD) in thin section as done at the National Synchrotron Light Source, and cite examples of its value for studies of meteorites in thin section.
Data preparation and evaluation techniques for x-ray diffraction microscopy.
Steinbrener, Jan; Nelson, Johanna; Huang, Xiaojing; Marchesini, Stefano; Shapiro, David; Turner, Joshua J; Jacobsen, Chris
2010-08-30
The post-experiment processing of X-ray Diffraction Microscopy data is often time-consuming and difficult. This is mostly due to the fact that even if a preliminary result has been reconstructed, there is no definitive answer as to whether or not a better result with more consistently retrieved phases can still be obtained. We show here that the first step in data analysis, the assembly of two-dimensional diffraction patterns from a large set of raw diffraction data, is crucial to obtaining reconstructions of highest possible consistency. We have developed software that automates this process and results in consistently accurate diffraction patterns. We have furthermore derived some criteria of validity for a tool commonly used to assess the consistency of reconstructions, the phase retrieval transfer function, and suggest a modified version that has improved utility for judging reconstruction quality.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Erickson, Anna I.; Sarsam, Reta D.; Fisher, Andrew J., E-mail: ajfisher@ucdavis.edu
The cysQ gene from Mycobacterium tuberculosis was cloned and the expressed protein, a 3′-phosphoadenosine-5′’-phosphatase, was purified and crystallized. X-ray diffraction data were collected to 1.7 Å resolution.
NASA Astrophysics Data System (ADS)
Zhirenkina, Nina V.; Mashkovtsev, Maxim A.; Bereskina, Polina A.; Zakirov, Ilsur F.; Baksheev, Evgenie O.; Bujnachev, Sergey V.; Vereshchagin, Artem O.
2017-09-01
In this study, the effect of preliminary hydrolysis of zirconyl oxysulfate on the properties of ZrO2-7 % Y2O3 powders prepared by hydroxides precipitation at a constant pH of 5 was studied. X-ray diffraction analysis showed the monophasic nature of the samples and the insignificant difference between CSR (coherent scattering regions). Samples differed in particle size distribution, porosity and morphology.
Boer, D. Roeland; Müller, Axel; Fetzner, Susanne; Lowe, David J.; Romão, Maria João
2005-01-01
Isoquinoline 1-oxidoreductase (IOR) from Brevundimonas diminuta is a mononuclear molybdoenzyme of the xanthine-dehydrogenase family of proteins and catalyzes the conversion of isoquinoline to isoquinoline-1-one. Its primary sequence and behaviour, specifically in its substrate specificity and lipophilicity, differ from other members of the family. A crystal structure of the enzyme is expected to provide an explanation for these differences. This paper describes the crystallization and preliminary X-ray diffraction experiments as well as an optimized purification protocol for IOR. Crystallization of IOR was achieved using two different crystallization buffers. Streak-seeding and cross-linking were essential to obtain well diffracting crystals. Suitable cryo-conditions were found and a structure solution was obtained by molecular replacement. However, phases need to be improved in order to obtain a more interpretable electron-density map. PMID:16508115
Shimabuku, Patrícia S.; Fernandes, Carlos A. H.; Magro, Angelo J.; Costa, Tássia R.; Soares, Andreimar M.; Fontes, Marcos R. M.
2011-01-01
Phospholipases A2 (PLA2s) are one of the main components of bothropic venoms; in addition to their phospholipid hydrolysis action, they are involved in a wide spectrum of pharmacological activities, including neurotoxicity, myotoxicity and cardiotoxicity. Caffeic acid is an inhibitor that is present in several plants and is employed for the treatment of ophidian envenomations in the folk medicine of many developing countries; as bothropic snake bites are not efficiently neutralized by conventional serum therapy, it may be useful as an antivenom. In this work, the cocrystallization and preliminary X-ray diffraction analysis of the Lys49-PLA2 piratoxin I from Bothrops pirajai venom in the presence of the inhibitor caffeic acid (CA) are reported. The crystals diffracted X-rays to 1.65 Å resolution and the structure was solved by molecular-replacement techniques. The electron-density map unambiguously indicated the presence of three CA molecules that interact with the C-terminus of the protein. This is the first time a ligand has been observed bound to this region and is in agreement with various experiments previously reported in the literature. PMID:21301098
DOE Office of Scientific and Technical Information (OSTI.GOV)
Coates, Leighton; Cooper, Jon; Hussey, Robert
2008-01-01
Noroviruses are the predominant cause of human epidemic nonbacterial gastroenteritis. Viral replication requires a cysteine protease that cleaves a 200 kDa viral polyprotein into its constituent functional parts. Here, the crystallization of the recombinant protease from the Southampton norovirus is described. While the native crystals were found to diffract only to medium resolution (2.9 {angstrom}), cocrystals of an inhibitor complex diffracted X-rays to 1.7 {angstrom} resolution. The polypeptide inhibitor (Ac-EFQLQ-propenyl ethyl ester) possesses an amino-acid sequence designed to match the substrate specificity of the enzyme, but was synthesized with a reactive Michael acceptor group at the C-terminal end.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gromova, T. Yu., E-mail: duk@img.ras.ru; Demidyuk, I. V.; Kostrov, S. V.
2008-09-15
A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.
Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J
2014-06-01
LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.
Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.
2014-01-01
LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.
2007-07-01
P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less
Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S
2014-11-01
Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tseng, Quincy; Orans, Jillian; Hast, Michael A.
2012-03-16
MutS{beta} is a eukaryotic mismatch repair protein that preferentially targets extrahelical unpaired nucleotides and shares partial functional redundancy with MutS{alpha} (MSH2-MSH6). Although mismatch recognition by MutS{alpha} has been shown to involve a conserved Phe-X-Glu motif, little is known about the lesion-binding mechanism of MutS{beta}. Combined MSH3/MSH6 deficiency triggers a strong predisposition to cancer in mice and defects in msh2 and msh6 account for roughly half of hereditary nonpolyposis colorectal cancer mutations. These three MutS homologs are also believed to play a role in trinucleotide repeat instability, which is a hallmark of many neurodegenerative disorders. The baculovirus overexpression and purification ofmore » recombinant human MutS{beta} and three truncation mutants are presented here. Binding assays with heteroduplex DNA were carried out for biochemical characterization. Crystallization and preliminary X-ray diffraction analysis of the protein bound to a heteroduplex DNA substrate are also reported.« less
Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N
1993-12-20
gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.
Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J
2008-06-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.
Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio
2010-12-01
Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.
Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio
2010-01-01
Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221
Data preparation and evaluation techniques for x-ray diffraction microscopy
Steinbrener, Jan; Nelson, Johanna; Huang, Xiaojing; ...
2010-01-01
The post-experiment processing of X-ray Diffraction Microscopy data is often time-consuming and difficult. This is mostly due to the fact that even if a preliminary result has been reconstructed, there is no definitive answer as to whether or not a better result with more consistently retrieved phases can still be obtained. In addition, we show here that the first step in data analysis, the assembly of two-dimensional diffraction patterns from a large set of raw diffraction data, is crucial to obtaining reconstructions of highest possible consistency. We have developed software that automates this process and results in consistently accurate diffractionmore » patterns. We have furthermore derived some criteria of validity for a tool commonly used to assess the consistency of reconstructions, the phase retrieval transfer function, and suggest a modified version that has improved utility for judging reconstruction quality.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Budayova-Spano, Monika, E-mail: spano@embl-grenoble.fr; Institut Laue-Langevin, 6 Rue Jules Horowitz, BP 156, 38042 Grenoble; Bonneté, Françoise
2006-03-01
Neutron diffraction data of hydrogenated recombinant urate oxidase enzyme (Rasburicase), complexed with a purine-type inhibitor 8-azaxanthin, was collected to 2.1 Å resolution from a crystal grown in D{sub 2}O by careful control and optimization of crystallization conditions via knowledge of the phase diagram. Deuterium atoms were clearly seen in the neutron-scattering density map. Crystallization and preliminary neutron diffraction measurements of rasburicase, a recombinant urate oxidase enzyme expressed by a genetically modified Saccharomyces cerevisiae strain, complexed with a purine-type inhibitor (8-azaxanthin) are reported. Neutron Laue diffraction data were collected to 2.1 Å resolution using the LADI instrument from a crystal (grownmore » in D{sub 2}O) with volume 1.8 mm{sup 3}. The aim of this neutron diffraction study is to determine the protonation states of the inhibitor and residues within the active site. This will lead to improved comprehension of the enzymatic mechanism of this important enzyme, which is used as a protein drug to reduce toxic uric acid accumulation during chemotherapy. This paper illustrates the high quality of the neutron diffraction data collected, which are suitable for high-resolution structural analysis. In comparison with other neutron protein crystallography studies to date in which a hydrogenated protein has been used, the volume of the crystal was relatively small and yet the data still extend to high resolution. Furthermore, urate oxidase has one of the largest primitive unit-cell volumes (space group I222, unit-cell parameters a = 80, b = 96, c = 106 Å) and molecular weights (135 kDa for the homotetramer) so far successfully studied with neutrons.« less
Preliminary X-ray crystallographic analysis of glutathione transferase zeta 1 (GSTZ1a-1a)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boone, Christopher D.; Zhong, Guo; Smeltz, Marci
2014-01-21
Crystals of glutathione transferase zeta 1 were grown and shown to diffract X-rays to 3.1 Å resolution. They belonged to space group P1, with unit-cell parameters a = 42.0, b = 49.6, c = 54.6 Å, α = 82.9, β = 69.9, γ = 73.4°.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo
2006-05-01
The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lane, Michael Douglas; Nam, Hyun-Joo; Padron, Eric
2005-06-01
The production, purification, crystallization and preliminary X-ray crystallographic analysis of adeno-associated virus serotype 8 is reported. Adeno-associated viruses (AAVs) are actively being developed for clinical gene-therapy applications and the efficiencies of the vectors could be significantly improved by a detailed understanding of their viral capsid structures and the structural determinants of their tissue-transduction interactions. AAV8 is ∼80% identical to the more widely studied AAV2, but its liver-transduction efficiency is significantly greater than that of AAV2 and other serotypes. The production, purification, crystallization and preliminary X-ray crystallographic analysis of AAV8 viral capsids are reported. The crystals diffract X-rays to 3.0 Åmore » resolution using synchrotron radiation and belong to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = 257.5, c = 443.5 Å. The unit cell contains two viral particles, with ten capsid viral protein monomers per crystallographic asymmetric unit.« less
NASA Astrophysics Data System (ADS)
Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.
2017-11-01
The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jagadeesan, G.; Malathy, P.; Gunasekaran, K.
2014-10-25
The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.
The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less
Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta
2011-02-01
Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.
Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII
NASA Technical Reports Server (NTRS)
Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.
1999-01-01
Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.
2007-10-01
S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding themore » catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.« less
Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.
2008-01-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065
Serial femtosecond X-ray diffraction of enveloped virus microcrystals
Lawrence, Robert M.; Conrad, Chelsie E.; Zatsepin, Nadia A.; ...
2015-08-20
Serial femtosecond crystallography (SFX) using X-ray free-electron lasers has produced high-resolution, room temperature, time-resolved protein structures. We report preliminary SFX of Sindbis virus, an enveloped icosahedral RNA virus with ~700 Å diameter. Microcrystals delivered in viscous agarose medium diffracted to ~40 Å resolution. Small-angle diffuse X-ray scattering overlaid Bragg peaks and analysis suggests this results from molecular transforms of individual particles. Viral proteins undergo structural changes during entry and infection, which could, in principle, be studied with SFX. This is a pertinent step toward determining room temperature structures from virus microcrystals that may enable time-resolved studies of enveloped viruses.
Automated composite ellipsoid modelling for high frequency GTD analysis
NASA Technical Reports Server (NTRS)
Sze, K. Y.; Rojas, R. G.; Klevenow, F. T.; Scheick, J. T.
1991-01-01
The preliminary results of a scheme currently being developed to fit a composite ellipsoid to the fuselage of a helicopter in the vicinity of the antenna location are discussed under the assumption that the antenna is mounted on the fuselage. The parameters of the close-fit composite ellipsoid would then be utilized as inputs into NEWAIR3, a code programmed in FORTRAN 77 for high frequency Geometrical Theory of Diffraction (GTD) Analysis of the radiation of airborne antennas.
NASA Astrophysics Data System (ADS)
Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.
2017-11-01
The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi
2006-04-01
Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.
Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose
2014-01-01
Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.
2007-09-01
The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lemke, Christopher T.; Hwang, Jiyoung; Xiong, Bing
2005-06-01
Two crystal forms of the antibiotic resistance enzyme APH(9)-Ia from L. pneumophila are reported. 9-Aminoglycoside phosphotransferase type Ia [APH(9)-Ia] is a resistance factor in Legionella pneuemophila, the causative agent of legionnaires’ disease. It is responsible for providing intrinsic resistance to the antibiotic spectinomycin. APH(9)-Ia phosphorylates one of the hydroxyl moieties of spectinomycin in an ATP-dependent manner, abolishing the antibiotic properties of this drug. Here, the crystallization and preliminary X-ray studies of this enzyme in two crystal forms is reported. One of the these crystal forms provides diffraction data to a resolution of 1.7 Å.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brüx, Christian; Niefind, Karsten; Ben-David, Alon
2005-12-01
The crystallization and preliminary X-ray analysis of a β-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P2{sub 1}2{sub 1}2 and tetragonal P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2 Å. β-d-Xylosidases (EC 3.2.1.37) are hemicellulases that cleave single xylose units from the nonreducing end of xylooligomers. In this study, the crystallization and preliminary X-ray analysis of a β-d-xylosidase from Geobacillus stearothermophilus T-6more » (XynB3), a family 43 glycoside hydrolase, is described. XynB3 is a 535-amino-acid protein with a calculated molecular weight of 61 891 Da. Purified recombinant native and catalytic inactive mutant proteins were crystallized and cocrystallized with xylobiose in two different space groups, P2{sub 1}2{sub 1}2 (unit-cell parameters a = 98.32, b = 99.36, c = 258.64 Å) and P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2; unit-cell parameters a = b = 140.15, c = 233.11 Å), depending on the detergent. Transferring crystals to cryoconditions required a very careful protocol. Orthorhombic crystals diffract to 2.5 Å and tetragonal crystals to 2.2 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita
2008-04-01
Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
DOE Office of Scientific and Technical Information (OSTI.GOV)
Subburaman, P.; Austin, B.P.; Shaw, G.X.
2010-11-03
Francisella tularensis, a potential bioweapon, causes a rare infectious disease called tularemia in humans and animals. The macrophage growth locus A (MglA) protein from F. tularensis associates with RNA polymerase to positively regulate the expression of multiple virulence factors that are required for its survival and replication within macrophages. The MglA protein was overproduced in Escherichia coli, purified and crystallized. The crystals diffracted to 7.5 {angstrom} resolution at the Advanced Photon Source, Argonne National Laboratory and belonged to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 125, c = 54 {angstrom}.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra
2008-07-01
Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less
Aeroacoustic diffraction and dissipation by a short propeller cowl in subsonic flight
NASA Technical Reports Server (NTRS)
Martinez, Rudolph
1993-01-01
This report develops and applies an aeroacoustic diffraction theory for a duct, or cowl, placed around modelled sources of propeller noise. The regime of flight speed is high subsonic. The modelled cowl's inner wall contains a liner with axially variable properties. Its exterior is rigid. The analysis replaces both sides with an unsteady lifting surface coupled to a dynamic thickness problem. The resulting pair of aeroacoustic governing equations for a lined 'ring wing' is valid both for a passive and for an active liner. Their numerical solution yields the effective dipole and monopole distributions of the shrouding system and thereby determines the cowl-diffracted component of the total radiated field. The sample calculations here include a preliminary parametric search for that liner layout which maximizes the cowl's shielding effectiveness. The main conclusion of the study is that a short cowl, passively lined, should provide moderate reductions in propeller noise.
Crystallization and preliminary crystallographic analysis of the Clostridium perfringens enterotoxin
Briggs, David C.; Smedley, James G.; McClane, Bruce A.; Basak, Ajit K.
2010-01-01
Clostridium perfringens is a Gram-positive anaerobic species of bacterium that is notable for its ability to produce a plethora of toxins, including membrane-active toxins (α-toxins), pore-forming toxins (∊-toxins) and binary toxins (ι-toxins). Here, the crystallization of the full-length wild-type C. perfringens enterotoxin is reported, which is the causative agent of the second most prevalent food-borne illness in the United States and has been implicated in many other gastrointestinal pathologies. Several crystal forms were obtained. However, only two of these optimized crystal forms (I and II) were useable for X-ray diffraction data collection. The form I crystals diffracted to d min = 2.7 Å and belonged to space group C2, while the form II crystals diffracted to d min = 4 Å and belonged to space group P213. PMID:20606275
Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction.
Hughes, Ronny C; Coates, Leighton; Blakeley, Matthew P; Tomanicek, Steve J; Langan, Paul; Kovalevsky, Andrey Y; García-Ruiz, Juan M; Ng, Joseph D
2012-12-01
Inorganic pyrophosphatase (IPPase) from the archaeon Thermococcus thioreducens was cloned, overexpressed in Escherichia coli, purified and crystallized in restricted geometry, resulting in large crystal volumes exceeding 5 mm3. IPPase is thermally stable and is able to resist denaturation at temperatures above 348 K. Owing to the high temperature tolerance of the enzyme, the protein was amenable to room-temperature manipulation at the level of protein preparation, crystallization and X-ray and neutron diffraction analyses. A complete synchrotron X-ray diffraction data set to 1.85 Å resolution was collected at room temperature from a single crystal of IPPase (monoclinic space group C2, unit-cell parameters a=106.11, b=95.46, c=113.68 Å, α=γ=90.0, β=98.12°). As large-volume crystals of IPPase can be obtained, preliminary neutron diffraction tests were undertaken. Consequently, Laue diffraction images were obtained, with reflections observed to 2.1 Å resolution with I/σ(I) greater than 2.5. The preliminary crystallographic results reported here set in place future structure-function and mechanism studies of IPPase.
Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki
2006-01-01
Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489
Crystallization and preliminary X-ray analysis of a low density lipoprotein from human plasma.
Prassl, R; Chapman, J M; Nigon, F; Sara, M; Eschenburg, S; Betzel, C; Saxena, A; Laggner, P
1996-11-15
Single crystals of human plasma low density lipoprotein (LDL), the major transport vehicle for cholesterol in blood, have been produced with a view to analysis of the three-dimensional structure by x-ray crystallography. Crystals with dimensions of approximately 200 x 100 x 50 microm have been reproducibly obtained from highly homogeneous LDL particle subspecies, isolated in the density ranges d = 1.0271-1. 0297 g/ml and d = 1.0297-1.0327 g/ml. Electron microscopic imaging of ultrathin-sectioned preparations of the crystals confirmed the existence of a regular, quasihexagonal arrangement of spherical particles of approximately 18 nm in diameter, thereby resembling the dimensions characteristic of LDL after dehydration and fixation. X-ray diffraction with synchrotron radiation under cryogenic conditions revealed the presence of well resolved diffraction spots, to a resolution of about 29 A. The diffraction patterns are indexed in terms of a triclinic lattice with unit cell dimensions of a = 16. 1 nm, b = 39.0 nm, c = 43.9 nm; alpha = 96.2 degrees, beta = 92.1 degrees, gamma = 102 degrees, and with space group P1.
King, Gordon; Hill, Justine M.; Martin, Jennifer L.; Mylne, Joshua S.
2009-01-01
VERNALIZATION1 (VRN1) is required in the model plant Arabidopsis thaliana for the epigenetic suppression of the floral repressor FLC by prolonged cold treatment. Stable suppression of FLC accelerates flowering, a physiological process known as vernalization. VRN1 is a 341-residue DNA-binding protein that contains two plant-specific B3 domains (B3a and B3b), a putative nuclear localization sequence (NLS) and two putative PEST domains. VRN1208–341 includes the second B3 domain and a region upstream that is highly conserved in the VRN1 orthologues of other dicotyledonous plants. VRN1208–341 was crystallized by the hanging-drop method in 0.05 M sodium acetate pH 6.0 containing 1.0 M NaCl and 18%(w/v) PEG 3350. Preliminary X-ray diffraction data analysis revealed that the VRN1208–341 crystal diffracted to 2.1 Å and belonged to space group C2, with unit-cell parameters a = 105.2, b = 47.9, c = 61.2 Å, α = 90.0, β = 115.4, γ = 90.0°. Assuming that two molecules occupy the asymmetric unit, a Matthews coefficient of 2.05 Å3 Da−1 and a solvent content of 40.1% were calculated. PMID:19255487
A scattering approach to sea wave diffraction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Corradini, M. L., E-mail: letizia.corradini@unicam.it; Garbuglia, M., E-mail: milena.garbuglia@unicam.it; Maponi, P., E-mail: pierluigi.maponi@unicam.it
This paper intends to show a model for the diffraction of sea waves approaching an OWC device, which converts the sea waves motion into mechanical energy and then electrical energy. This is a preliminary study to the optimisation of the device, in fact the computation of sea waves diffraction around the device allows the estimation of the sea waves energy which enters into the device. The computation of the diffraction phenomenon is the result of a sea waves scattering problem, solved with an integral equation method.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kraschnefski, Mark J.; Scott, Stacy A.; Holloway, Gavan
2005-11-01
The carbohydrate-binding component (VP8*{sub 64–223}) of the human Wa rotavirus spike protein has been overexpressed in E. coli, purified and crystallized in two different crystal forms. X-ray diffraction data have been collected that have enabled determination of the Wa VP8*{sub 64–223} structure by molecular replacement. Rotaviruses exhibit host-specificity and the first crystallographic information on a rotavirus strain that infects humans is reported here. Recognition and attachment to host cells, leading to invasion and infection, is critically linked to the function of the outer capsid spike protein of the rotavirus particle. In some strains the VP8* component of the spike proteinmore » is implicated in recognition and binding of sialic-acid-containing cell-surface carbohydrates, thereby enabling infection by the virus. The cloning, expression, purification, crystallization and initial X-ray diffraction analysis of the VP8* core from human Wa rotavirus is reported. Two crystal forms (trigonal P3{sub 2}21 and monoclinic P2{sub 1}) have been obtained and X-ray diffraction data have been collected, enabling determination of the VP8*{sub 64–223} structure by molecular replacement.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi
2005-03-01
A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra
The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less
Laguerre, Aisha; Wielens, Jerome; Parker, Michael W.; Porter, Christopher J. H.; Scanlon, Martin J.
2011-01-01
Fatty-acid binding proteins (FABPs) are abundantly expressed proteins that bind a range of lipophilic molecules. They have been implicated in the import and intracellular distribution of their ligands and have been linked with metabolic and inflammatory responses in the cells in which they are expressed. Despite their high sequence identity, human intestinal FABP (hIFABP) and rat intestinal FABP (rIFABP) bind some ligands with different affinities. In order to address the structural basis of this differential binding, diffraction-quality crystals have been obtained of hIFABP and rIFABP in complex with the fluorescent fatty-acid analogue 11-(dansylamino)undecanoic acid. PMID:21301109
Optical analysis of high power free electron laser resonators
NASA Astrophysics Data System (ADS)
Knapp, C. E.; Viswanathan, V. K.; Appert, Q. D.; Bender, S. C.; McVey, B. D.
1987-06-01
The first part of this paper briefly describes the optics code used at Los Alamos National Laboratory to do optical analyses of various components of a free electron laser. The body of the paper then discusses the recent results in modeling low frequency gratings and ripple on the surfaces of liquid-cooled mirrors. The ripple is caused by structural/thermal effects in the mirror surface due to heating by optical absorption in high power resonators. Of interest is how much ripple can be permitted before diffractive losses or optical mode distortions become unacceptable. Preliminary work is presented involving classical diffraction problems to support the ripple study. The limitations of the techniques are discussed and the results are compared to experimental results where available.
Gavel, Olga Yu.; Kladova, Anna V.; Bursakov, Sergey A.; Dias, João M.; Texeira, Susana; Shnyrov, Valery L.; Moura, José J. G.; Moura, Isabel; Romão, Maria J.; Trincão, José
2008-01-01
Native zinc/cobalt-containing ATP sulfurylase (ATPS; EC 2.7.7.4; MgATP:sulfate adenylyltransferase) from Desulfovibrio desulfuricans ATCC 27774 was purified to homogeneity and crystallized. The orthorhombic crystals diffracted to beyond 2.5 Å resolution and the X-ray data collected should allow the determination of the structure of the zinc-bound form of this ATPS. Although previous biochemical studies of this protein indicated the presence of a homotrimer in solution, a dimer was found in the asymmetric unit. Elucidation of this structure will permit a better understanding of the role of the metal in the activity and stability of this family of enzymes. PMID:18607083
Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.; ...
2017-03-29
Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.
Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less
NASA Astrophysics Data System (ADS)
Bogusz, Michael
1993-01-01
The need for a systematic methodology for the analysis of aircraft electromagnetic compatibility (EMC) problems is examined. The available computer aids used in aircraft EMC analysis are assessed and a theoretical basis is established for the complex algorithms which identify and quantify electromagnetic interactions. An overview is presented of one particularly well established aircraft antenna to antenna EMC analysis code, the Aircraft Inter-Antenna Propagation with Graphics (AAPG) Version 07 software. The specific new algorithms created to compute cone geodesics and their associated path losses and to graph the physical coupling path are discussed. These algorithms are validated against basic principles. Loss computations apply the uniform geometrical theory of diffraction and are subsequently compared to measurement data. The increased modelling and analysis capabilities of the newly developed AAPG Version 09 are compared to those of Version 07. Several models of real aircraft, namely the Electronic Systems Trainer Challenger, are generated and provided as a basis for this preliminary comparative assessment. Issues such as software reliability, algorithm stability, and quality of hardcopy output are also discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weiss, Kevin L; Meilleur, Flora; Blakeley, Matthew
2008-01-01
Neutron crystallography is used to locate hydrogen atoms in biological materials and can distinguish between negatively scattering hydrogen and positively scattering deuterium substituted positions in isomorphous neutron structures. Recently, Hauptman and Langs (2003) have shown that neutron diffraction data can be used to solve macromolecular structures by direct methods and that solution is aided by the presence of negatively scattering hydrogen atoms in the structure. Selective labeling protocols allow the design and production of H/D-labeled macromolecular structures in which the ratio of hydrogen to deuterium atoms can be precisely controlled. We have applied methyl-selective labeling protocols to introduce (1H-delta methyl)-leucinemore » and (1H-gamma methyl)-valine into deuterated rubredoxin from Pyrococcus furiosus (PfRd). Here we report on the production, crystallization, and preliminary neutron analysis of the selectively CH3-protonated, deuterated PfRd sample, which provided a high quality neutron data set extending to 1.75 resolution at the new LADI-III instrument at the Insititut Laue-Langevin. Preliminary analysis of neutron density maps allows unambiguous assignment of the positions of hydrogen atoms at the methyl groups of the valine and leucine residues in the otherwise deuterated rubredoxin structure.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
DiMattia, Michael; Govindasamy, Lakshmanan; Levy, Hazel C.
2005-10-01
The production, purification, crystallization and preliminary crystallographic analysis of empty adeno-associated virus serotype 5 capsids are reported. Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Å resolution using synchrotron radiation and belong to the orthorhombicmore » space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c = 629.7 Å. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es
2014-02-19
The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less
NASA Astrophysics Data System (ADS)
Crews, Chiaki C. E.; O'Flynn, Daniel; Sidebottom, Aiden; Speller, Robert D.
2015-06-01
The prevalence of counterfeit and substandard medicines has been growing rapidly over the past decade, and fast, nondestructive techniques for their detection are urgently needed to counter this trend. In this study, energy-dispersive X-ray diffraction (EDXRD) combined with chemometrics was assessed for its effectiveness in quantitative analysis of compressed powder mixtures. Although EDXRD produces lower-resolution diffraction patterns than angular-dispersive X-ray diffraction (ADXRD), it is of interest for this application as it carries the advantage of allowing the analysis of tablets within their packaging, due to the higher energy X-rays used. A series of caffeine, paracetamol and microcrystalline cellulose mixtures were prepared with compositions between 0 - 100 weight% in 20 weight% steps (22 samples in total, including a centroid mixture), and were pressed into tablets. EDXRD spectra were collected in triplicate, and a principal component analysis (PCA) separated these into their correct positions in the ternary mixture design. A partial least-squares (PLS) regression model calibrated using this training set was validated using both segmented cross-validation, and with a test set of six samples (mixtures in 8:1:1 and 5⅓:2⅓:2⅓ ratios) - the latter giving a root-mean square error of prediction (RMSEP) of 1.30, 2.25 and 2.03 weight% for caffeine, paracetamol and cellulose respectively. These initial results are promising, with RMSEP values on a par with those reported in the ADXRD literature.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cummins, Dustin Ray; Vogel, Sven C.; Hollis, Kendall Jon
2016-10-18
This report uses neutron diffraction to investigate the crystal phase composition of uranium-molybdenum alloy foils (U-10Mo) for the CONVERT MP-1 Reactor Conversion Project, and determines the effect on alpha-uranium contamination following the deposition of a Zr metal diffusion layer by various methods: plasma spray deposition of Zr powders at LANL and hot co-rolling with Zr foils at BWXT. In summary, there is minimal decomposition of the gamma phase U-10Mo foil to alpha phase contamination following both plasma spraying and hot co-rolling. The average unit cell volume, i.e. lattice spacing, of the Zr layer can be mathematically extracted from the diffractionmore » data; co-rolled Zr matches well with literature values of bulk Zr, while plasma sprayed Zr shows a slight increase in the lattice spacing, indicative of interstitial oxygen in the lattice. Neutron diffraction is a beneficial alternative to conventional methods of phase composition, i.e. x ray diffraction (XRD) and destructive metallography. XRD has minimal penetration depth in high atomic number materials, particularly uranium, and can only probe the first few microns of the fuel plate; neutrons pass completely through the foil, allowing for bulk analysis of the foil composition and no issues with addition of cladding layers, as in the final, aluminum-clad reactor fuel plates. Destructive metallography requires skilled technicians, cutting of the foil into small sections, hazardous etching conditions, long polishing and microscopy times, etc.; the neutron diffraction system has an automated sample loader and can fit larger foils, so there is minimal analysis preparation; the total spectrum acquisition time is ~ 1 hour per sample. The neutron diffraction results are limited by spectra refinement/calculation times and the availability of the neutron beam source. In the case of LANSCE at Los Alamos, the beam operates ~50% of the year. Following the lessons learned from these preliminary results, optimizations to the process and analysis can be made, and neutron diffraction can become a viable and efficient technique for gamma/alpha phase composition determination for nuclear fuels.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan
2006-06-01
Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less
Maximizing Macromolecule Crystal Size for Neutron Diffraction Experiments
NASA Technical Reports Server (NTRS)
Judge, R. A.; Kephart, R.; Leardi, R.; Myles, D. A.; Snell, E. H.; vanderWoerd, M.; Curreri, Peter A. (Technical Monitor)
2002-01-01
A challenge in neutron diffraction experiments is growing large (greater than 1 cu mm) macromolecule crystals. In taking up this challenge we have used statistical experiment design techniques to quickly identify crystallization conditions under which the largest crystals grow. These techniques provide the maximum information for minimal experimental effort, allowing optimal screening of crystallization variables in a simple experimental matrix, using the minimum amount of sample. Analysis of the results quickly tells the investigator what conditions are the most important for the crystallization. These can then be used to maximize the crystallization results in terms of reducing crystal numbers and providing large crystals of suitable habit. We have used these techniques to grow large crystals of Glucose isomerase. Glucose isomerase is an industrial enzyme used extensively in the food industry for the conversion of glucose to fructose. The aim of this study is the elucidation of the enzymatic mechanism at the molecular level. The accurate determination of hydrogen positions, which is critical for this, is a requirement that neutron diffraction is uniquely suited for. Preliminary neutron diffraction experiments with these crystals conducted at the Institute Laue-Langevin (Grenoble, France) reveal diffraction to beyond 2.5 angstrom. Macromolecular crystal growth is a process involving many parameters, and statistical experimental design is naturally suited to this field. These techniques are sample independent and provide an experimental strategy to maximize crystal volume and habit for neutron diffraction studies.
Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.
Nanson, Jeffrey David; Forwood, Jade Kenneth
2014-01-01
The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bains, Jasleen; Boulanger, Martin J., E-mail: mboulang@uvic.ca
2008-05-01
Preliminary X-ray diffraction studies of a novel ring-cleaving enzyme from B. xenovorans LB400 encoded by the benzoate-oxidation (box) pathway. The assimilation of aromatic compounds by microbial species requires specialized enzymes to cleave the thermodynamically stable ring. In the recently discovered benzoate-oxidation (box) pathway in Burkholderia xenovorans LB400, this is accomplished by a novel dihydrodiol lyase (BoxC{sub C}). Sequence analysis suggests that BoxC{sub C} is part of the crotonase superfamily but includes an additional uncharacterized region of approximately 115 residues that is predicted to mediate ring cleavage. Processing of X-ray diffraction data to 1.5 Å resolution revealed that BoxC{sub C} crystallizedmore » with two molecules in the asymmetric unit of the P2{sub 1}2{sub 1}2{sub 1} space group, with a solvent content of 47% and a Matthews coefficient of 2.32 Å{sup 3} Da{sup −1}. Selenomethionine BoxC{sub C} has been purified and crystals are currently being refined for anomalous dispersion studies.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murakami, Mário T.; Center for Applied Toxinology, CAT-CEPID, São Paulo, SP; Advanced Center for Genomics and Proteomics, UNESP-State University of São Paulo, São José do Rio Preto 15054-000
2007-07-01
A single crystal of zhaoermiatoxin with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å. Zhaoermiatoxin, an Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis (formerly Trimeresurus mangshanensis, Ermia mangshanensis) venom is a novel member of the PLA{sub 2}-homologue family that possesses an arginine residue at position 49, probably arising from a secondary Lys49→Arg substitution that does notmore » alter the catalytic inactivity towards phospholipids. Like other Lys49 PLA{sub 2} homologues, zhaoermiatoxin induces oedema and strong myonecrosis without detectable PLA{sub 2} catalytic activity. A single crystal with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pathuri, Puja; Nguyen, Emily Tam; Luecke, Hartmut, E-mail: hudel@uci.edu
2006-11-01
α-11 giardin from the intestinal protozoan parasite, G. lamblia has been cloned, expressed, purified and crystallized under two different conditions and in two different space groups. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group and crystals obtained in the second condition diffracted to 2.93 Å and belong to a primitive monoclinic space group. α-11 Giardin, a protein from the annexin superfamily, is a 35.0 kDa protein from the intestinal protozoan parasite Giardia lamblia which triggers a form of diarrhea called giardiasis. Here, the cloning, expression, purification and the crystallization of α-11more » giardin under two different conditions and in two different space groups is reported. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group, while crystals from the second condition, which included calcium in the crystallization solution, diffracted to 2.93 Å and belong to a primitive monoclinic space group. Determination of the detailed atomic structure of α-11 giardin will provide a better insight into its biological function and might establish whether this class of proteins is a potential drug target against giardiasis.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6
2007-12-01
The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less
Zhang, Lilan; Zhao, Puya; Chen, Chun-Chi; Huang, Chun-Hsiang; Ko, Tzu-Ping; Zheng, Yingying; Guo, Rey-Ting
2014-07-01
β-1,3-1,4-Glucanases catalyze the specific hydrolysis of internal β-1,4-glycosidic bonds adjacent to the 3-O-substituted glucose residues in mixed-linked β-glucans. The thermophilic glycoside hydrolase CtGlu16A from Clostridium thermocellum exhibits superior thermal profiles, high specific activity and broad pH adaptability. Here, the catalytic domain of CtGlu16A was expressed in Escherichia coli, purified and crystallized in the trigonal space group P3121, with unit-cell parameters a=b=74.5, c=182.9 Å, by the sitting-drop vapour-diffusion method and diffracted to 1.95 Å resolution. The crystal contains two protein molecules in an asymmetric unit. Further structural determination and refinement are in progress.
Characteristics of Volcanic Soils in Landslide during the 2016 Kumamoto Earthquake, Japan
NASA Astrophysics Data System (ADS)
Hazarika, H.; Fukuoka, H.; Kokusho, T.; Sumartini, O.; Bhoopendra, D.
2017-12-01
There were many seismic subsidence, debris flows, landslides and slope failures, which occurred in Aso area due to the 2016 Kumamoto earthquake, Japan. This research aims to determine the failure mechanism of many mild slopes, and elucidate the strength characteristics of volcanic soils collected from the sites. A series of undrained static and cyclic triaxial tests, ring shear tests and direct shear tests were performed. Also, for further understanding of volcanic soils' material strength, X-ray powder diffraction analysis (XRD), X-ray fluorescence analysis (XRF), and Scanning electron microscope analysis (SEM) were performed. In this paper, preliminary results of the experimental testing program are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko
2007-11-01
The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less
Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...
2015-08-25
Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less
High-frequency techniques for RCS prediction of plate geometries
NASA Technical Reports Server (NTRS)
Balanis, Constantine A.; Polka, Lesley A.
1992-01-01
The principal-plane scattering from perfectly conducting and coated strips and rectangular plates is examined. Previous reports have detailed Geometrical Theory of Diffraction/Uniform Theory of Diffraction (GTD/UTD) solutions for these geometries. The GTD/UTD solution for the perfectly conducting plate yields monostatic radar cross section (RCS) results that are nearly identical to measurements and results obtained using the Moment Method (MM) and the Extended Physical Theory of Diffraction (EPTD). This was demonstrated in previous reports. The previous analysis is extended to bistatic cases. GTD/UTD results for the principal-plane scattering from a perfectly conducting, infinite strip are compared to MM and EPTD data. A comprehensive overview of the advantages and disadvantages of the GTD/UTD and of the EPTD and a detailed analysis of the results from both methods are provided. Several previous reports also presented preliminary discussions and results for a GTD/UTD model of the RCS of a coated, rectangular plate. Several approximations for accounting for the finite coating thickness, plane-wave incidence, and far-field observation were discussed. Here, these approximations are replaced by a revised wedge diffraction coefficient that implicitly accounts for a coating on a perfect conductor, plane-wave incidence, and far-field observation. This coefficient is computationally more efficient than the previous diffraction coefficient because the number of Maliuzhinets functions that must be calculated using numerical integration is reduced by a factor of 2. The derivation and the revised coefficient are presented in detail for the hard polarization case. Computations and experimental data are also included. The soft polarization case is currently under investigation.
The NN-explore Exoplanet Stellar Speckle Imager: Instrument Description and Preliminary Results
NASA Astrophysics Data System (ADS)
Scott, Nicholas J.; Howell, Steve B.; Horch, Elliott P.; Everett, Mark E.
2018-05-01
A new speckle and wide-field imaging instrument for the WIYN telescope called NN-EXPLORE Exoplanet Stellar Speckle Imager (NESSI) is described. NESSI offers simultaneous two-color diffraction-limited imaging and wide-field traditional imaging for validation and characterization of transit and precision RV exoplanet studies. Many exoplanet targets will come from the NASA K2 and Transiting Exoplanet Survey Satellite (TESS) missions. NESSI is capable of resolving close binaries at sub-arcsecond separations down to the diffraction limit and >6 mag contrast difference in the visible band on targets as faint as 14th mag. Preliminary results from the instrument commissioning at WIYN and demonstrations of the instrument’s capabilities are presented.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Gufeng; Departments of Molecular and Cell Biology, School of Life Sciences, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026; Huang, Qingqiu
2005-01-01
The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. Crystals of agkicetin-C suitable for structure determination were obtained from 1.8 M ammonium sulfate, 40 mM MES pH 6.5 with 2%(v/v) PEG 400. Interestingly, low buffer concentrations of MES seem to be necessary for crystal growth. The crystals of agkicetin-C belong tomore » space group C2, with unit-cell parameters a = 177.5, b = 97.7, c = 106.8 Å, β = 118.5°, and diffract to 2.4 Å resolution. Solution of the phase problem by the molecular-replacement method shows that there are four agkicetin-C molecules in the asymmetric unit, with a V{sub M} value of 3.4 Å{sup 3} Da{sup −1}, which corresponds to a high solvent content of approximately 64%. Self-rotation function calculations show a single well defined non-crystallographic twofold axis with features that may represent additional elements of non-crystallographic symmetry.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br
2006-10-01
Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less
Extracellular overproduction and preliminary crystallographic analysis of a family I.3 lipase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Angkawidjaja, Clement; You, Dong-Ju; Matsumura, Hiroyoshi
2007-03-01
A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. The crystal was grown at 277 K by the hanging-drop vapour-diffusion method. Native X-ray diffraction data were collected to 1.7 Å resolution using synchrotron radiation at station BL38B1, SPring-8. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 48.79, b = 84.06,more » c = 87.04 Å. Assuming the presence of one molecule per asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.73 Å{sup 3} Da{sup −1} and the solvent content was 55%.« less
Fernandes, Carlos A. H.; Gartuzo, Elaine C. G.; Pagotto, Ivan; Comparetti, Edson J.; Huancahuire-Vega, Salomón; Ponce-Soto, Luis Alberto; Costa, Tássia R.; Marangoni, Sergio; Soares, Andreimar M.; Fontes, Marcos R. M.
2012-01-01
Two myotoxic and noncatalytic Lys49-phospholipases A2 (braziliantoxin-II and MT-II) and a myotoxic and catalytic phospholipase A2 (braziliantoxin-III) from the venom of the Amazonian snake Bothrops brazili were crystallized. The crystals diffracted to resolutions in the range 2.56–2.05 Å and belonged to space groups P3121 (braziliantoxin-II), P6522 (braziliantoxin-III) and P21 (MT-II). The structures were solved by molecular-replacement techniques. Both of the Lys49-phospholipases A2 (braziliantoxin-II and MT-II) contained a dimer in the asymmetric unit, while the Asp49-phospholipase A2 braziliantoxin-III contained a monomer in its asymmetric unit. Analysis of the quaternary assemblies of the braziliantoxin-II and MT-II structures using the PISA program indicated that both models have a dimeric conformation in solution. The same analysis of the braziliantoxin-III structure indicated that this protein does not dimerize in solution and probably acts as a monomer in vivo, similar to other snake-venom Asp49-phospholipases A2. PMID:22869126
Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko
2005-08-01
This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus
2006-06-01
SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less
Salvador, G. H. M.; Fernandes, C. A. H.; Corrêa, L. C.; Santos-Filho, N. A.; Soares, A. M.; Fontes, M. R. M.
2009-01-01
Crotoxin B is a basic phospholipase A2 found in the venom of several Crotalus durissus ssp. rattlesnakes and is one of the subunits that constitute crotoxin, the main component of the venom of these snakes. This heterodimeric toxin is related to important envenomation effects such as neurological disorders, myotoxicity and renal failure. Although crotoxin was first crystallized in 1938, the first structural data only became available in 2007 (for crotoxin B from C. durissus terrificus) and showed an ambiguous result for the biological assembly, which could be either dimeric or tetrameric. In this work, the crystallization, X-ray diffraction data collection at 2.2 Å resolution and molecular-replacement solution of a dimeric complex formed by two crotoxin B isoforms from C. durissus collilineatus venom is presented. PMID:19851009
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago
2006-02-01
D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee,Y.; Kumar, S.; Jobichen, C.
2007-01-01
Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamasaki, Masayuki; Ogura, Kohei; Moriwaki, Satoko
The crystallization and preliminary characterization of the family PL-7 alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1 are presented. Alginate lyases depolymerize alginate, a heteropolysaccharide consisting of α-l-guluronate and β-d-mannuronate, through a β-elimination reaction. The alginate lyases A1-II (25 kDa) and A1-II′ (25 kDa) from Sphingomonas sp. A1, which belong to polysaccharide lyase family PL-7, exhibit 68% homology in primary structure but have different substrate specificities. To determine clearly the structural basis for substrate recognition in the depolymerization mechanism by alginate lyases, both proteins were crystallized at 293 K using the vapour-diffusion method. A crystal of A1-II belonged tomore » space group P2{sub 1} and diffracted to 2.2 Å resolution, with unit-cell parameters a = 51.3, b = 30.1, c = 101.6 Å, β = 100.2°, while a crystal of A1-II′ belonged to space group P2{sub 1}2{sub 1}2{sub 1} and diffracted to 1.0 Å resolution, with unit-cell parameters a = 34.6, b = 68.5, c = 80.3 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin
2005-07-01
Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less
Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A
2003-08-01
UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yang-De, E-mail: zhangyd1960@yahoo.com.cn; Li, Hao; Liu, Hui
2007-02-01
Porcine rotavirus strain OSU VP8* domain has been expressed, purified and crystallized. X-ray diffraction data from different crystal forms of the VP8* domain have been collected to 2.65 and 2.2 Å resolution, respectively. The rotavirus outer capsid spike protein VP4 is utilized in the process of rotavirus attachment to and membrane penetration of host cells. VP4 is cleaved by trypsin into two domains: VP8* and VP5*. The VP8* domain is implicated in initial interaction with sialic acid-containing cell-surface carbohydrates and triggers subsequent virus invasion. The VP8* domain from porcine OSU rotavirus was cloned and expressed in Escherichia coli. Different crystalmore » forms (orthorhombic P2{sub 1}2{sub 1}2{sub 1} and tetragonal P4{sub 1}2{sub 1}2) were harvested from two distinct crystallization conditions. Diffraction data have been collected to 2.65 and 2.2 Å resolution and the VP8*{sub 65–224} structure was determined by molecular replacement.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid
2006-12-01
The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano
The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei, E-mail: xlyang@scripps.edu
2006-12-01
Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4{sub 3}2{sub 1}2 or its enantiomorphic space group P4{sub 1}2{sub 1}2, with unit-cell parameters a =more » b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mise, Takeshi; Matsunami, Hideyuki; Samatey, Fadel A.
The periplasmic domain of the E. coli aspartate receptor Tar was cloned, expressed, purified and crystallized with and without bound ligand. The crystals obtained diffracted to resolutions of 1.58 and 1.95 Å, respectively. The cell-surface receptor Tar mediates bacterial chemotaxis toward an attractant, aspartate (Asp), and away from a repellent, Ni{sup 2+}. To understand the molecular mechanisms underlying the induction of Tar activity by its ligands, the Escherichia coli Tar periplasmic domain with and without bound aspartate (Asp-Tar and apo-Tar, respectively) were each crystallized in two different forms. Using ammonium sulfate as a precipitant, crystals of apo-Tar1 and Asp-Tar1 weremore » grown and diffracted to resolutions of 2.10 and 2.40 Å, respectively. Alternatively, using sodium chloride as a precipitant, crystals of apo-Tar2 and Asp-Tar2 were grown and diffracted to resolutions of 1.95 and 1.58 Å, respectively. Crystals of apo-Tar1 and Asp-Tar1 adopted space group P4{sub 1}2{sub 1}2, while those of apo-Tar2 and Asp-Tar2 adopted space groups P2{sub 1}2{sub 1}2{sub 1} and C2, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel
2006-01-01
The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less
Modeling 3-D objects with planar surfaces for prediction of electromagnetic scattering
NASA Technical Reports Server (NTRS)
Koch, M. B.; Beck, F. B.; Cockrell, C. R.
1992-01-01
Electromagnetic scattering analysis of objects at resonance is difficult because low frequency techniques are slow and computer intensive, and high frequency techniques may not be reliable. A new technique for predicting the electromagnetic backscatter from electrically conducting objects at resonance is studied. This technique is based on modeling three dimensional objects as a combination of flat plates where some of the plates are blocking the scattering from others. A cube is analyzed as a simple example. The preliminary results compare well with the Geometrical Theory of Diffraction and with measured data.
Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru
2009-01-01
Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737
Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru
2009-11-01
Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen
2006-10-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Guan-Jing; Li, Lan-Fen; Li, Dan
2007-09-01
A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng
2008-01-01
SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, SeungBum; Joo, Sangbum; Yoon, Hyun C.
2007-07-01
Est25, a ketoprofen-specific hormone-sensitive lipase from a metagenomic library, was crystallized and diffraction data were collected to 1.49 Å resolution. Ketoprofen, a nonsteroidal anti-inflammatory drug, inhibits the synthesis of prostaglandin. A novel hydrolase (Est25) with high ketoprofen specificity has previously been identified using a metagenomic library from environmental samples. Recombinant Est25 protein with a histidine tag at the N-terminus was expressed in Escherichia coli and purified in a homogenous form. Est25 was crystallized from 2.4 M sodium malonate pH 7.0 and X-ray diffraction data were collected to 1.49 Å using synchrotron radiation. The crystals belong to the monoclinic space groupmore » C2, with unit-cell parameters a = 197.8, b = 95.2, c = 99.4 Å, β = 97.1°.« less
Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song
2013-11-01
Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.
Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi
2009-01-01
RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733
Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi
2009-11-01
RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.
Mikhailov, A M; Smirnova, E A; Tsuprun, V L; Tagunova, I V; Vainshtein, B K; Linkova, E V; Komissarov, A A; Siprashvili, Z Z; Mironov, A S
1992-03-01
Uridine phosphorylase (UPH) from Escherichia coli K-12 has been purified to near homogeneity from a strain harbouring the udp gene, encoding UPH, on a multicopy plasmid. UPH was purified to electrophoretic homogeneity with the specific activity 230 units/mg with a recovery of 80%, yielding 120 mg of enzyme from 3g cells. Crystals of enzyme suitable for X-ray diffraction analysis were obtained in a preparative ultracentrifuge. The packing of the molecules in the crystals may be described by the space group P2(1)2(1)2(1) with the unit cell constants a = 90.4; b = 128.8; c = 136.8 A. There is one molecule per asymmetric unit, Vm = 2.4. These crystals diffract to at least 2.5-2.7 A resolution. The hexameric structure of UPH was directly demonstrated by electron microscopy study and image processing.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei
2007-07-01
An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less
Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S
2010-01-01
Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny
2006-01-01
Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balasubramanian, Anuradha; Ponnuraj, Karthe, E-mail: pkarthe@hotmail.com
Urease from pigeon pea was purified and crystallized and X-ray diffraction data were collected at 2.5 Å resolution. Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized andmore » the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lundgren, Stina; Andersen, Birgit; Piškur, Jure
2007-10-01
β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Qin, E-mail: yang@crystal.harvard.edu; Brüschweiler, Sven; Chou, James J., E-mail: yang@crystal.harvard.edu
2013-12-24
The N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1 was crystallized in the presence of Ca{sup 2+}. X-ray diffraction data were collected to 2.9 Å resolution from crystals which belonged to space group P6{sub 2}22.
STRUCTURE OF POTASSIUM HYDROGEN MALEATE BY NEUTRON DIFFRACTION
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peterson, S.W.; Levy, H.A.
1958-10-01
The preliminary results of a neutron diffraction study are presented which confirm the existence in potassium hydrogen maleate of a short, strong, hydrogen bond and show the ion to be at least statistically symmetrical. The hydrogen is strongly linked to both neighboring oxygen atoms, and there is an existing mode of correlated motion of considerable amplitude in which the oxygen atoms are displaced but hydrogen is not. (J.R.D.)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony
2006-03-01
A cytotoxin from Indian Russell’s viper (D. russelli russelli) venom having multifunctional activity has been crystallized in space group P4{sub 1}. Larger crystals diffracted to 1.5 Å but were found to be twinned; preliminary data were therefore collected (2.93 Å) from a smaller crystal. A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P4{sub 1}, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, weremore » found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V{sub M} value.« less
Wavelet-based tracking of bacteria in unreconstructed off-axis holograms.
Marin, Zach; Wallace, J Kent; Nadeau, Jay; Khalil, Andre
2018-03-01
We propose an automated wavelet-based method of tracking particles in unreconstructed off-axis holograms to provide rough estimates of the presence of motion and particle trajectories in digital holographic microscopy (DHM) time series. The wavelet transform modulus maxima segmentation method is adapted and tailored to extract Airy-like diffraction disks, which represent bacteria, from DHM time series. In this exploratory analysis, the method shows potential for estimating bacterial tracks in low-particle-density time series, based on a preliminary analysis of both living and dead Serratia marcescens, and for rapidly providing a single-bit answer to whether a sample chamber contains living or dead microbes or is empty. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
W Vallen Graham; A Magis; K Bailey
2011-12-31
Myosin light-chain kinase-dependent tight junction regulation is a critical event in inflammatory cytokine-induced increases in epithelial paracellular permeability. MLCK is expressed in human intestinal epithelium as two isoforms, long MLCK1 and long MLCK2, and MLCK1 is specifically localized to the tight junction, where it regulates paracellular permeability. The sole difference between these long MLCK splice variants is the presence of an immunoglobulin-like cell-adhesion molecule domain, IgCAM3, in MLCK1. To gain insight into the structure of the IgCAM3 domain, the IgCAM3 domain of MLCK1 has been expressed, purified and crystallized. Preliminary X-ray diffraction data were collected to 2.0 {angstrom} resolution andmore » were consistent with the primitive trigonal space group P2{sub 1}2{sub 1}2{sub 1}.« less
Rodamilans, Bernardo; Montoya, Guillermo
2007-01-01
DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P21, with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 Å, α = γ = 90, β = 101.02°, and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 Å using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS). PMID:17401195
Rodamilans, Bernardo; Montoya, Guillermo
2007-04-01
DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P2(1), with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 A, alpha = gamma = 90, beta = 101.02 degrees , and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 A using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS).
X-Ray Diffraction Study of Elemental Erbium to 65 GPa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pravica, M.G.; Lipinska-Kalita, K.; Quine, Z.
2006-02-02
We have investigated phase transitions in elemental erbium in a diamond anvil cell up to 65 GPa using x-ray powder diffraction methods. We present preliminary evidence of a series of phase transitions that appear to follow the expected hcp {yields} Sm-type {yields} dhcp {yields} distorted fcc sequence. In particular, we believe that we have evidence for the predicted dhcp {yields} distorted fcc transition between 43 GPa and 65 GPa.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rantanen, Mika K.; Lehtiö, Lari; Rajagopal, Lakshmi
Two S. agalactiae proteins, the inorganic pyrophosphatase and the serine/threonine phosphatase, were crystallized and diffraction data were collected and processed from these crystals. The data from the two protein crystals extended to 2.80 and 2.65 Å, respectively. Streptococcus agalactiae, which infects human neonates and causes sepsis and meningitis, has recently been shown to possess a eukaryotic-like serine/threonine protein phosphorylation signalling cascade. Through their target proteins, the S. agalactiae Ser/Thr kinase and Ser/Thr phosphatase together control the growth as well as the morphology and virulence of this organism. One of the targets is the S. agalactiae family II inorganic pyrophosphatase. Themore » inorganic pyrophosphatase and the serine/threonine phosphatase have therefore been purified and crystallized and diffraction data have been collected from their crystals. The data were processed using XDS. The inorganic pyrosphosphatase crystals diffracted to 2.80 Å and the Ser/Thr phosphatase crystals to 2.65 Å. Initial structure-solution experiments indicate that structure solution will be successful in both cases. Solving the structure of the proteins involved in this cascade is the first step towards understanding this phenomenon in atomic detail.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko
2007-08-01
Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan
2008-05-01
A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santos, K. F.; Murakami, M. T.; Cintra, A. C. O.
2007-04-01
Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained. Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained.more » The crotoxin complex crystal belongs to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 38.2, b = 68.7, c = 84.2 Å, and diffracted to 1.75 Å resolution. The crystal of the phospholipase A{sub 2} domain belongs to the hexagonal space group P6{sub 1}22 (or its enantiomorph P6{sub 5}22), with unit-cell parameters a = b = 38.7, c = 286.7 Å, and diffracted to 2.6 Å resolution. The crotapotin crystal diffracted to 2.3 Å resolution; however, the highly diffuse diffraction pattern did not permit unambiguous assignment of the unit-cell parameters.« less
Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim
2004-10-01
Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.
Bamford, Vicki A; Armour, Maria; Mitchell, Sue A; Cartron, Michaël; Andrews, Simon C; Watson, Kimberly A
2008-09-01
YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.
Design and analysis of multilayer x ray/XUV microscope
NASA Technical Reports Server (NTRS)
Shealy, David L.
1990-01-01
The design and analysis of a large number of normal incidence multilayer x ray microscopes based on the spherical mirror Schwarzschild configuration is examined. Design equations for the spherical mirror Schwarzschild microscopes are summarized and used to evaluate mirror parameters for microscopes with magnifications ranging from 2 to 50x. Ray tracing and diffraction analyses are carried out for many microscope configurations to determine image resolution as a function of system parameters. The results are summarized in three publication included herein. A preliminary study of advanced reflecting microscope configurations, where aspherics are used in place of the spherical microscope mirror elements, has indicated that the aspherical elements will improve off-axis image resolution and increase the effective field of view.
Taberman, Helena; Andberg, Martina; Parkkinen, Tarja; Richard, Peter; Hakulinen, Nina; Koivula, Anu; Rouvinen, Juha
2014-01-01
d-Galacturonic acid is the main component of pectin. It could be used to produce affordable renewable fuels, chemicals and materials through biotechnical conversion. Keto-deoxy-d-galactarate (KDG) dehydratase is an enzyme in the oxidative pathway of d-galacturonic acid in Agrobacterium tumefaciens (At). It converts 3-deoxy-2-keto-l-threo-hexarate to α-ketoglutaric semialdehyde. At KDG dehydratase was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 169.1, b = 117.8, c = 74.3 Å, β = 112.4° and an asymmetric unit of four monomers. X-ray diffraction data were collected to 1.9 Å resolution using synchrotron radiation. The three-dimensional structure of At KDG dehydratase will provide valuable information on the function of the enzyme and will allow it to be engineered for biorefinery-based applications. PMID:24419616
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen
2006-11-01
Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less
Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy
2005-08-01
Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less
Forst, D; Schülein, K; Wacker, T; Diederichs, K; Kreutz, W; Benz, R; Welte, W
1993-01-05
The sucrose-specific outer membrane porin ScrY of Salmonella typhimurium was isolated from Escherichia coli K-12 strain KS 26 containing the plasmid pPSO112. The protein was purified to homogeneity by differential extraction of the cell envelope in the presence of the detergents sodium dodecyl sulfate and lauryl (dimethyl)-amine oxide (LDAO). The porin had apparent molecular weights of 58 kDa and 120 kDa for the monomer and for the trimer, respectively, on SDS/PAGE. The purified trimers were crystallized using poly(ethylene glycol) 2000 and the detergents octylglucoside (OG) and hexyl-(dimethyl)-amine oxide (C6DAO). X-ray diffraction of the crystals showed reflections to 2.3 A. The space group of the crystals was R3 and the lattice constants of the hexagonal axes were a = b = 112.85 A and c = 149.9 A. The crystal volume per unit of protein molecular weight was 3.47 A3/Da.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rengachari, Srinivasan; Aschauer, Philipp; Sturm, Christian
A soluble variant of the monoglyceride lipase Yju3p was successfully expressed, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. The protein Yju3p is the orthologue of monoglyceride lipases in the yeast Saccharomyces cerevisiae. A soluble variant of this lipase termed s-Yju3p (38.3 kDa) was generated and purified to homogeneity by affinity and size-exclusion chromatography. s-Yju3p was crystallized in a vapour-diffusion setup at 293 K and a complete data set was collected to 2.4 Å resolution. The crystal form was orthorhombic (space group P2{sub 1}2{sub 1}2{sub 1}), with unit-cell parameters a = 77.2, b = 108.6, c =more » 167.7 Å. The asymmetric unit contained four molecules with a solvent content of 46.4%.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ku, Min-Je; Lee, Won-Ho; Biotechnology and Genetic Engineering, Korea University, Seoul 136-701
2005-04-01
The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn{sup 2+} ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. Themore » asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V{sub M}) of 3.3 Å{sup 3} Da{sup −1} and a solvent content of 62.7%.« less
Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor
2014-03-01
Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.
Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya
2010-01-01
A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161
Ullah, Anwar; de Giuseppe, Priscila Oliveira; Murakami, Mario Tyago; Trevisan-Silva, Dilza; Wille, Ana Carolina Martins; Chaves-Moreira, Daniele; Gremski, Luiza Helena; da Silveira, Rafael Bertoni; Sennf-Ribeiro, Andrea; Chaim, Olga Meiri; Veiga, Silvio Sanches; Arni, Raghuvir Krishnaswamy
2011-01-01
Phospholipases D are the major dermonecrotic component of Loxosceles venom and catalyze the hydrolysis of phospholipids, resulting in the formation of lipid mediators such as ceramide-1-phosphate and lysophosphatidic acid which can induce pathological and biological responses. Phospholipases D can be classified into two classes depending on their catalytic efficiency and the presence of an additional disulfide bridge. In this work, both wild-type and H12A-mutant forms of the class II phospholipase D from L. intermedia venom were crystallized. Wild-type and H12A-mutant crystals were grown under very similar conditions using PEG 200 as a precipitant and belonged to space group P1211, with unit-cell parameters a = 50.1, b = 49.5, c = 56.5 Å, β = 105.9°. Wild-type and H12A-mutant crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively. PMID:21301094
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu
2008-07-01
The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less
Petty, Tom J.; Nishimura, Taisuke; Emamzadah, Soheila; Gabus, Caroline; Paszkowski, Jerzy; Halazonetis, Thanos D.; Thore, Stéphane
2010-01-01
Of the known epigenetic control regulators found in plants, the Morpheus’ molecule 1 (MOM1) protein is atypical in that the deletion of MOM1 does not affect the level of epigenetic marks controlling the transcriptional status of the genome. A short 197-amino-acid fragment of the MOM1 protein sequence can complement MOM1 deletion when coupled to a nuclear localization signal, suggesting that this region contains a functional domain that compensates for the loss of the full-length protein. Numerous constructs centred on the highly conserved MOM1 motif 2 (CMM2) present in these 197 residues have been generated and expressed in Escherichia coli. Following purification and crystallization screening, diamond-shaped single crystals were obtained that diffracted to ∼3.2 Å resolution. They belonged to the trigonal space group P3121 (or P3221), with unit-cell parameters a = 85.64, c = 292.74 Å. Structure determination is ongoing. PMID:20693667
Petty, Tom J; Nishimura, Taisuke; Emamzadah, Soheila; Gabus, Caroline; Paszkowski, Jerzy; Halazonetis, Thanos D; Thore, Stéphane
2010-08-01
Of the known epigenetic control regulators found in plants, the Morpheus' molecule 1 (MOM1) protein is atypical in that the deletion of MOM1 does not affect the level of epigenetic marks controlling the transcriptional status of the genome. A short 197-amino-acid fragment of the MOM1 protein sequence can complement MOM1 deletion when coupled to a nuclear localization signal, suggesting that this region contains a functional domain that compensates for the loss of the full-length protein. Numerous constructs centred on the highly conserved MOM1 motif 2 (CMM2) present in these 197 residues have been generated and expressed in Escherichia coli. Following purification and crystallization screening, diamond-shaped single crystals were obtained that diffracted to approximately 3.2 A resolution. They belonged to the trigonal space group P3(1)21 (or P3(2)21), with unit-cell parameters a=85.64, c=292.74 A. Structure determination is ongoing.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan
2005-11-01
The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less
Gunn, Natalie J; Gorman, Michael A; Dobson, Renwick C J; Parker, Michael W; Mulhern, Terrence D
2011-03-01
The C-terminal Src kinase (Csk) and Csk-homologous kinase (CHK) are endogenous inhibitors of the proto-oncogenic Src family of protein tyrosine kinases (SFKs). Phosphotyrosyl peptide binding to their Src-homology 2 (SH2) domains activates Csk and CHK, enhancing their ability to suppress SFK signalling; however, the detailed mechanistic basis of this activation event is unclear. The CHK SH2 was expressed in Escherichia coli and the purified protein was characterized as monomeric by synchrotron small-angle X-ray scattering in-line with size-exclusion chromatography. The CHK SH2 crystallized in 0.2 M sodium bromide, 0.1 M bis-Tris propane pH 6.5 and 20% polyethylene glycol 3350 and the best crystals diffracted to ∼1.6 Å resolution. The crystals belonged to space group P2, with unit-cell parameters a=25.8, b=34.6, c=63.2 Å, β=99.4°.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trincão, José; Sousa Silva, Marta; Barata, Lídia
2006-08-01
A glyoxalase II from L. infantum was cloned, purified and crystallized and its structure was solved by X-ray crystallography. In trypanosomatids, trypanothione replaces glutathione in all glutathione-dependent processes. Of the two enzymes involved in the glyoxalase pathway, glyoxalase I and glyoxalase II, the latter shows absolute specificity towards trypanothione thioester, making this enzyme an excellent model to understand the molecular basis of trypanothione binding. Cloned glyoxalase II from Leishmania infantum was overexpressed in Escherichia coli, purified and crystallized. Crystals belong to space group C222{sub 1} (unit-cell parameters a = 65.6, b = 88.3, c = 85.2 Å) and diffract beyondmore » 2.15 Å using synchrotron radiation. The structure was solved by molecular replacement using the human glyoxalase II structure as a search model. These results, together with future detailed kinetic characterization using lactoyltrypanothione, should shed light on the evolutionary selection of trypanothione instead of glutathione by trypano-somatids.« less
MEMS-based tunable gratings and their applications
NASA Astrophysics Data System (ADS)
Yu, Yiting; Yuan, Weizheng; Qiao, Dayong
2015-03-01
The marriage of optics and MEMS has resulted in a new category of optical devices and systems that have unprecedented advantages compared with their traditional counterparts. As an important spatial light modulating technology, diffractive optical MEMS obtains a wide variety of successful commercial applications, e.g. projection displays, optical communication and spectral analysis, due to its features of highly compact, low-cost, IC-compatible, excellent performance, and providing possibilities for developing totally new, yet smart devices and systems. Three most successful MEMS diffraction gratings (GLVs, Polychromator and DMDs) are briefly introduced and their potential applications are analyzed. Then, three different MEMS tunable gratings developed by our group, named as micro programmable blazed gratings (μPBGs) and micro pitch-tunable gratings (μPTGs) working in either digital or analog mode, are demonstrated. The strategies to largely enhance the maximum blazed angle and grating period are described. Some preliminary application explorations based on the developed grating devices are also shown. For our ongoing research focus, we will further improve the device performance to meet the engineering application requirements.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Struble, E. B., E-mail: evi.struble@nist.gov; Department of Biochemistry and Molecular Biology, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD 21205; Center for Advanced Research in Biotechnology/NIST, 9600 Gudelsky Drive, Rockville, MD 20850
2007-06-01
Crystallization and preliminary diffraction data of the N-terminal 19–139 fragment of the origin-binding domain of bacteriophage λ O replication initiator are reported. The bacteriophage λ O protein binds to the λ replication origin (oriλ) and serves as the primary replication initiator for the viral genome. The binding energy derived from the binding of O to oriλ is thought to help drive DNA opening to facilitate initiation of DNA replication. Detailed understanding of this process is severely limited by the lack of high-resolution structures of O protein or of any lambdoid phage-encoded paralogs either with or without DNA. The production ofmore » crystals of the origin-binding domain of λ O that diffract to 2.5 Å is reported. Anomalous dispersion methods will be used to solve this structure.« less
Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi
2008-01-01
Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution. PMID:18931441
Preliminary experiments on the reduction of the uranyl ion to uraninite by carbonaceous substances
Breger, Irving A.; Moore, Richard T.
1955-01-01
An aqueous solution of uranyl sulfate containing a suspension of subbituminous coal has been heated at 210 C for three days. Examination of the coal at the end of the experiment showed it to contain 31.8 percent uranium recognizable as uraninite by a sharp, strong X-ray diffraction pattern. A similar experiment with degraded spruce wood also led to the formation of uraninite but in lesser quantity and with broader lines in the X-ray diffraction pattern. The ability of coal or wood to reduce the uranyl ion is a critical factor in the correlation of studies of uraniferous coals containing the uranyl ion with studies of uraninite-bearing coalified wood from the Colorado Plateau. Although these results are based an preliminary experiments, they are extremely important geochemically and warrant the development of the series of controlled studies that are proposed.
Cai, Chuner; Wu, Lian; Li, Chunxia; He, Peimin; Li, Jie; Zhou, Jiahai
2011-01-01
Porphyra yezoensis is one of the most important and widely cultured seaweeds in China. Phycobiliproteins exhibit excellent spectroscopic properties and play versatile roles in the biomedical, food, cosmetics and chemical synthetic dye industries. Here, the purification and crystallization of phycoerythrin and phycocyanin, two phycobiliproteins extracted from P. yezoensis, are described. Using a novel protocol including co-precipitation with ammonium sulfate and hydroxyapatite column chromatography, both phycobiliproteins were produced on a large scale with improved quality and yield compared with those previously reported. Native PAGE analysis indicated that phycoerythrin and phycocyanin exist as (αβ)3 heterohexamers in solution. The crystals of phycoerythrin diffracted to 2.07 Å resolution and belonged to space group R3. The unit-cell parameters referred to hexagonal axes are a = b = 187.7, c = 59.7 Å, with nine (αβ)2 heterotetramers per unit cell. The crystals of phycocyanin diffracted to 2.70 Å resolution in space group P21. Matthews coefficient analysis shows that 10–19 (αβ) heterodimers of phycocyanin in the asymmetric unit would be reasonable. A self-rotation function calculation clarified this ambiguity and indicated that 12 (αβ) heterodimers of phycocyanin are assembled in the asymmetric unit. PMID:21543866
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mastrangelo, Eloise; Bollati, Michela; Milani, Mario
2006-08-01
Two methyltransferases from flaviviruses (Meaban and Yokose viruses) have been overexpressed and crystallized. Diffraction data and characterization of the two crystal forms are presented, together with a preliminary molecular-replacement solution for both enzymes. Viral methyltranferases (MTase) are involved in the third step of the mRNA-capping process, transferring a methyl group from S-adenosyl-l-methionine (SAM) to the capped mRNA. MTases are classified into two groups: (guanine-N7)-methyltransferases (N7MTases), which add a methyl group onto the N7 atom of guanine, and (nucleoside-2′-O-)-methyltransferases (2′OMTases), which add a methyl group to a ribose hydroxyl. The MTases of two flaviviruses, Meaban and Yokose viruses, have been overexpressed,more » purified and crystallized in complex with SAM. Characterization of the crystals together with details of preliminary X-ray diffraction data collection (at 2.8 and 2.7 Å resolution, respectively) are reported here. The sequence homology relative to Dengue virus 2′OMTase and the structural conservation of specific residues in the putative active sites suggest that both enzymes belong to the 2′OMTase subgroup.« less
Influence of preliminary deformation on the hardening effect upon aging of Al-Cu-Li alloys
NASA Astrophysics Data System (ADS)
Betsofen, S. Ya.; Ashmarin, A. A.; Knyazev, M. I.; Dolgova, M. I.
2016-09-01
The influence of preliminary deformation upon rolling of wedge specimens on the mechanical properties and the structural phase state of Al-Cu-Li alloys are studied by X-ray diffraction and hardness measurements. Strong dependence of the hardening effect upon aging on the reduction upon rolling has been revealed. Deformation weakly influences the hardness and significantly increases the hardening upon aging. Herewith, the hardening effect is nearly absent at the minimum deformation ratio of 1% and increases with its increase. It is demonstrated that the content of T1 phase increases from 2 to 4% in the range of a preliminary deformation ratio of 6-10% and the content of δ' phase is 17% at a deformation ratio in the range 1‒6% and increases to 18-19% at a deformation ratio of 6-10%. The δ' phase in an alloy contains <20% nanocrystalline particles with 6-20 nm in size, and the remaining part consists of amorphous particles (as detected by X-ray diffraction) <5 nm in size, which precipitate coherently from the matrix and have the same orientation as the nanocrystalline particles and the solid solution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee
2007-08-01
The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.
2017-01-15
Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less
NASA Astrophysics Data System (ADS)
Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.
2017-01-01
Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.
Fluorescence and diffusive wave diffraction tomographic probes in turbid media
NASA Astrophysics Data System (ADS)
Li, Xingde
1998-10-01
Light transport over long distances in tissue-like highly scattering media is well approximated as a diffusive process. Diffusing photons can be used to detect, localize and characterize non-invasively optical inhomogeneities such as tumors and hematomas embedded in thick biological tissue. Most of the contrast relies on the endogenous optical property differences between the inhomogeneities and the surrounding media. Recently exogenous fluorescent contrast agents have been considered as a means to enhance the sensitivity and specificity for tumor detection. In the first part of the thesis (Chapter 2 and 3), a theoretical basis is established for modeling the transport, of fluorescent photons in highly scattering media. Fluorescent Diffuse Photon Density Waves (FDPDW) are used to describe the transport of fluorescent photons. A detailed analysis based upon a practical signal-to-noise model was used to access the utility of the fluorescent method. The analysis reveals that a small heterogeneity, embedded in deep tissue-like turbid media with biologically relevant parameters, and with a practically achievable 5-fold fluorophore concentration contrast, can be detected and localized when its radius is greater than 0.2 cm, and can be characterized when its radius is greater than 0.7 cm. In vivo and preliminary clinical studies demonstrate the feasibility of using FDPDW's for tumor diagnosis. Optical imaging with diffusing photons is challenging. Many of the imaging algorithms developed so far are either fundamentally incorrect as in the case of back- projection approach, or require a huge amount of computational resources and CPU time. In the second part of the thesis (Chapter 4), a fast, K-space diffraction tomographic imaging algorithm based upon spatial angular spectrum analysis is derived and applied. Absolute optical properties of thin inhomogeneities and relative optical properties of spatially extended inhomogeneities are reconstructed within a sub-second time scale. Phantom experiments have demonstrated the power of the K-space algorithm and preliminary clinical investigations have exhibited its potential for real time optical diagnosis and imaging of breast cancer.
Bamford, Vicki A.; Armour, Maria; Mitchell, Sue A.; Cartron, Michaël; Andrews, Simon C.; Watson, Kimberly A.
2008-01-01
YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 Å resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily. PMID:18765906
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajaj,M.; Moriyama, H.
2007-01-01
The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.
NASA Astrophysics Data System (ADS)
Korenev, Sergey; Sikolenko, Vadim
2004-09-01
The advantage of neutron-scattering studies as compared to the standard X-ray technique is the high penetration of neutrons that allow us to study volume effects. The high resolution of instrumentation on the basis neutron scattering allows measurement of the parameters of lattice structure with high precision. We suggest the use of neutron scattering from pulsed neutron sources for analysis of materials irradiated with pulsed high current electron and ion beams. The results of preliminary tests using this method for Ni foils that have been studied by neutron diffraction at the IBR-2 (Pulsed Fast Reactor at Joint Institute for Nuclear Research) are presented.
Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim
2006-03-01
Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.
Single Hit Energy-resolved Laue Diffraction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patel, Shamim; Suggit, Matthew J.; Stubley, Paul G.
2015-05-15
In situ white light Laue diffraction has been successfully used to interrogate the structure of single crystal materials undergoing rapid (nanosecond) dynamic compression up to megabar pressures. However, information on strain state accessible via this technique is limited, reducing its applicability for a range of applications. We present an extension to the existing Laue diffraction platform in which we record the photon energy of a subset of diffraction peaks. This allows for a measurement of the longitudinal and transverse strains in situ during compression. Consequently, we demonstrate measurement of volumetric compression of the unit cell, in addition to the limitedmore » aspect ratio information accessible in conventional white light Laue. We present preliminary results for silicon, where only an elastic strain is observed. VISAR measurements show the presence of a two wave structure and measurements show that material downstream of the second wave does not contribute to the observed diffraction peaks, supporting the idea that this material may be highly disordered, or has undergone large scale rotation.« less
Stewart, James A.; Brookman, G.; Price, Patrick Michael; ...
2018-04-25
In this study, the evolution and characterization of single-isolated-ion-strikes are investigated by combining atomistic simulations with selected-area electron diffraction (SAED) patterns generated from these simulations. Five molecular dynamics simulations are performed for a single 20 keV primary knock-on atom in bulk crystalline Si. The resulting cascade damage is characterized in two complementary ways. First, the individual cascade events are conventionally quantified through the evolution of the number of defects and the atomic (volumetric) strain associated with these defect structures. These results show that (i) the radiation damage produced is consistent with the Norgett, Robinson, and Torrens model of damage productionmore » and (ii) there is a net positive volumetric strain associated with the cascade structures. Second, virtual SAED patterns are generated for the resulting cascade-damaged structures along several zone axes. The analysis of the corresponding diffraction patterns shows the SAED spots approximately doubling in size, on average, due to broadening induced by the defect structures. Furthermore, the SAED spots are observed to exhibit an average radial outward shift between 0.33% and 0.87% depending on the zone axis. Finally, this characterization approach, as utilized here, is a preliminary investigation in developing methodologies and opportunities to link experimental observations with atomistic simulations to elucidate microstructural damage states.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stewart, James A.; Brookman, G.; Price, Patrick Michael
In this study, the evolution and characterization of single-isolated-ion-strikes are investigated by combining atomistic simulations with selected-area electron diffraction (SAED) patterns generated from these simulations. Five molecular dynamics simulations are performed for a single 20 keV primary knock-on atom in bulk crystalline Si. The resulting cascade damage is characterized in two complementary ways. First, the individual cascade events are conventionally quantified through the evolution of the number of defects and the atomic (volumetric) strain associated with these defect structures. These results show that (i) the radiation damage produced is consistent with the Norgett, Robinson, and Torrens model of damage productionmore » and (ii) there is a net positive volumetric strain associated with the cascade structures. Second, virtual SAED patterns are generated for the resulting cascade-damaged structures along several zone axes. The analysis of the corresponding diffraction patterns shows the SAED spots approximately doubling in size, on average, due to broadening induced by the defect structures. Furthermore, the SAED spots are observed to exhibit an average radial outward shift between 0.33% and 0.87% depending on the zone axis. Finally, this characterization approach, as utilized here, is a preliminary investigation in developing methodologies and opportunities to link experimental observations with atomistic simulations to elucidate microstructural damage states.« less
NASA Astrophysics Data System (ADS)
Stewart, J. A.; Brookman, G.; Price, P.; Franco, M.; Ji, W.; Hattar, K.; Dingreville, R.
2018-04-01
The evolution and characterization of single-isolated-ion-strikes are investigated by combining atomistic simulations with selected-area electron diffraction (SAED) patterns generated from these simulations. Five molecular dynamics simulations are performed for a single 20 keV primary knock-on atom in bulk crystalline Si. The resulting cascade damage is characterized in two complementary ways. First, the individual cascade events are conventionally quantified through the evolution of the number of defects and the atomic (volumetric) strain associated with these defect structures. These results show that (i) the radiation damage produced is consistent with the Norgett, Robinson, and Torrens model of damage production and (ii) there is a net positive volumetric strain associated with the cascade structures. Second, virtual SAED patterns are generated for the resulting cascade-damaged structures along several zone axes. The analysis of the corresponding diffraction patterns shows the SAED spots approximately doubling in size, on average, due to broadening induced by the defect structures. Furthermore, the SAED spots are observed to exhibit an average radial outward shift between 0.33% and 0.87% depending on the zone axis. This characterization approach, as utilized here, is a preliminary investigation in developing methodologies and opportunities to link experimental observations with atomistic simulations to elucidate microstructural damage states.
NASA Technical Reports Server (NTRS)
Alvarez, L. S.; Moore, M.; Veruttipong, W.; Andres, E.
1994-01-01
The design and implementation of an antenna beam-waveguide (BWG) mirror position control system at the DSS-13 34-m antenna is presented. While it has several potential applications, a positioner on the last flat-plate BWG mirror (M6) at DSS 13 is installed to demonstrate the conical scan (conscan) angle-tracking technique at the Ka-band (32-GHz) operating frequency. Radio frequency (RF) beam-scanning predictions for the M6 mirror, computed from a diffraction analysis, are presented. From these predictions, position control system requirements are then derived. The final mechanical positioner and servo system designs, as implemented at DSS 13, are illustrated with detailed design descriptions given in the appendices. Preliminary measurements of antenna Ka-band beam scan versus M6 mirror tilt made at DSS 13 in December 1993 are presented. After reduction, the initial measurements are shown to be in agreement with the RF predicts. Plans for preliminary conscan experimentation at DSS 13 are summarized.
DOE Office of Scientific and Technical Information (OSTI.GOV)
DiMattia,M.; Govindasamy, L.; Levy, H.
2005-01-01
Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Angstroms resolution using synchrotron radiation and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c =more » 629.7 Angstroms. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less
Hosterman, John W.; Loferski, Patricia J.
1978-01-01
The distribution of kaolinite in parts of the Devonian shale section is the most significant finding of this work. These shales are composed predominately of 2M illite and illitic mixed-layer clay with minor amounts of chlorite and kaolinite. Preliminary data indicate that kaolinite, the only allogenic clay mineral, is present in successively older beds of the Ohio Shale from south to north in the southern and middle parts of the Appalachian basin. This trend in the distribution of kaolinite shows a paleocurrent direction to the southwest. Three well-known methods of preparing the clay fraction for X-ray diffraction analysis were tested and evaluated. Kaolinite was not identified in two of the methods because of layering due to differing settling rates of the clay minerals. It is suggested that if one of the two settling methods of sample preparation is used, the clay film be thin enough for the X-ray beam to penetrate the entire thickness of clay.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta, Vibha; Gupta, Rakesh K.; Ram Lal Anand College, University of Delhi, Benito Juarez Road, New Delhi 110021
2008-05-01
The cloning, purification and crystallization of a bacterioferritin from M. tuberculosis together with preliminary X-ray characterization of its crystals are reported. Bacterioferritins (Bfrs) comprise a subfamily of the ferritin superfamily of proteins that play an important role in bacterial iron storage and homeostasis. Bacterioferritins differ from ferritins in that they have additional noncovalently bound haem groups. To assess the physiological role of this subfamily of ferritins, a greater understanding of the structural details of bacterioferritins from various sources is required. The gene encoding bacterioferritin A (BfrA) from Mycobacterium tuberculosis was cloned and expressed in Escherichia coli. The recombinant protein productmore » was purified by affinity chromatography on a Strep-Tactin column and crystallized with sodium chloride as a precipitant at pH 8.0 using the vapour-diffusion technique. The crystals diffracted to 2.1 Å resolution and belonged to space group P4{sub 2}, with unit-cell parameters a = 123.0, b = 123.0, c = 174.6 Å.« less
Dimasi, Nazzareno; Moretta, Lorenzo; Biassoni, Roberto; Mariuzza, Roy A
2003-10-01
p75/AIRM1 (Siglec-7) is a sialic acid-binding Ig-like lectin recently identified as an inhibitory receptor on natural killer cells. The expression, in vitro folding, circular-dichroism spectroscopy, crystallization and preliminary X-ray characterization of the Ig-V like domain of p75/AIRM1 are reported. X-ray data were collected from a single crystal at 100 K, with a maximum useful diffraction pattern extending to 1.45 A resolution on a synchrotron source. The crystal belongs to a primitive monoclinic space group, with unit-cell parameters a = 32.65, b = 49.72, c = 39.79 A, alpha = gamma = 90, beta = 113 degrees. The systematic absences indicate that the space group is P2(1). Assuming one molecule per asymmetric unit, V(M) (the Matthews coefficient) was calculated to be 1.879 A(3) Da(-1) and the solvent content was estimated to be 32.01%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Y Zhang; X Gao; G Buchko
2011-12-31
Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Y.; Robinson, H.; Gao, X.
2010-12-01
Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika
2007-08-01
The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less
Steinle, Dominik; Friedrich, Laura; Bevilacqua, Nico; von Hauff, Elizabeth; Gschwind, Fabienne
2016-01-01
One of the problems that arise with bifluoride- or fluoride-containing compounds is their poor solubility in non-aqueous solvents. We report herein a facile one-pot synthesis and the chemical analysis of fluoride/bifluoride-containing polymers, which are soluble in MeCN. Different polymers, such as Polyvinylacetate or Polyethylene imine and saccharides, such as maltodextrin, were complexed with ammonium (bi)fluoride using hydrogen bonds to form the desired (bi)fluoride-containing compounds. The newly formed hydrogen bonding (bi)fluoride-doped polymer matrices were analyzed using infrared and nuclear magnetic resonance spectroscopies, and X-ray diffraction. The promising materials also underwent impedance spectroscopy, conductivity measurements and preliminary tests as electrolytes for room temperature fluoride ion batteries along with an analysis of their performance. PMID:28774092
Replication of Holograms with Corn Syrup by Rubbing
Mejias-Brizuela, Nildia Y.; Olivares-Pérez, Arturo; Ortiz-Gutiérrez, Mauricio
2012-01-01
Corn syrup films are used to replicate holograms in order to fabricate micro-structural patterns without the toxins commonly found in photosensitive salts and dyes. We use amplitude and relief masks with lithographic techniques and rubbing techniques in order to transfer holographic information to corn syrup material. Holographic diffraction patterns from holographic gratings and computer Fourier holograms fabricated with corn syrup are shown. We measured the diffraction efficiency parameter in order to characterize the film. The versatility of this material for storage information is promising. Holographic gratings achieved a diffraction efficiency of around 8.4% with an amplitude mask and 36% for a relief mask technique. Preliminary results using corn syrup as an emulsion for replicating holograms are also shown in this work.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao
Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.
Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A
2014-02-01
Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.
Alsarraf, Husam M. A. B.; Laroche, Fabrice; Spaink, Herman; Thirup, Søren; Blaise, Mickael
2011-01-01
Cell metabolic processes are constantly producing reactive oxygen species (ROS), which have deleterious effects by triggering, for example, DNA damage. Numerous enzymes such as catalase, and small compounds such as vitamin C, provide protection against ROS. The TLDc domain of the human oxidation resistance protein has been shown to be able to protect DNA from oxidative stress; however, its mechanism of action is still not understood and no structural information is available on this domain. Structural information on the TLDc domain may therefore help in understanding exactly how it works. Here, the purification, crystallization and preliminary crystallographic studies of the TLDc domain from zebrafish are reported. Crystals belonging to the orthorhombic space group P21212 were obtained and diffracted to 0.97 Å resolution. Selenomethionine-substituted protein could also be crystallized; these crystals diffracted to 1.1 Å resolution and the structure could be solved by SAD/MAD methods. PMID:22102041
NASA Technical Reports Server (NTRS)
Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.
1992-01-01
Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.
Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim
2006-01-01
Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316
Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yin, Lei; Zhu, De-Yu; Yang, Na
2005-04-01
The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.
Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.
2005-01-01
This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108
Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki
2008-01-01
Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki
2006-02-01
PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi
Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Igarashi, Tomoko; Oishi, Yuko; Araki, Satohiko
Vascular apoptosis-inducing protein 1 (VAP1) and VAP2 from C. atrox venom were crystallized in variety of different crystal forms. Diffraction data sets were obtained to 2.5 and 2.15 Å resolution for VAP1 and VAP2, respectively. VAPs are haemorrhagic snake-venom toxins belonging to the reprolysin family of zinc metalloproteinases. In vitro, VAPs induce apoptosis specifically in cultured vascular endothelial cells. VAPs have a modular structure that bears structural homology to mammalian ADAMs (a disintegrin and metalloproteinases). VAP1 is a homodimer with a MW of 110 kDa in which the monomers are connected by a single disulfide bridge. VAP2 is homologous tomore » VAP1 and exists as a monomer with a MW of 55 kDa. In the current study, several crystal forms of VAP1 and VAP2 were obtained using the vapour-diffusion method and diffraction data sets were collected using SPring-8 beamlines. The best crystals of VAP1 and VAP2 generated data sets to 2.5 and 2.15 Å resolution, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Logsdon, Naomi J.; Allen, Christopher E.; Rajashankar, Kanagalaghatta R.
2012-02-08
Interleukin-20 (IL-20) is an IL-10-family cytokine that regulates innate and adaptive immunity in skin and other tissues. In addition to protecting the host from various external pathogens, dysregulated IL-20 signaling has been shown to contribute to the pathogenesis of human psoriasis. IL-20 signals through two cell-surface receptor heterodimers, IL-20R1-IL-20R2 and IL-22R1-IL-20R2. In this report, crystals of the IL-20-IL-20R1-IL-20R2 ternary complex have been grown from polyethylene glycol solutions. The crystals belonged to space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = 111, c = 135 {angstrom}, and diffracted X-rays to 3 {angstrom} resolution. The crystallographic asymmetricmore » unit contains one IL-20-IL-20R1-IL-20R2 complex, corresponding to a solvent content of approximately 54%.« less
Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting
2015-04-01
Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.
Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young
2013-01-01
YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570
Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young
2013-05-01
YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.
Preliminary crystallographic analysis of avian infectious bronchitis virus main protease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jun; Shen, Wei; Liao, Ming, E-mail: mliao@scau.edu.cn
The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed inmore » Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.« less
Kim, Seulgi; Ngo, Tri Duc; Kim, Kyeong Kyu; Kim, T Doohun
2012-11-01
The structures and reaction mechanisms of enantioselective hydrolases, which can be used in industrial applications such as biotransformations, are largely unknown. Here, the X-ray crystallographic study of a novel (S)-specific esterase (pfEstA) from Pseudomonas fluorescens KCTC 1767, which can be used in the production of (S)-ketoprofen, is described. Multiple sequence alignments with other hydrolases revealed that pfEstA contains a conserved Ser67 within the S-X-X-K motif as well as a highly conserved Tyr156. Recombinant protein containing an N-terminal His tag was expressed in Escherichia coli, purified to homogeneity and characterized using SDS-PAGE, MALDI-TOF MS and enantioselective analysis. pfEstA was crystallized using a solution consisting of 1 M sodium citrate, 0.1 M CHES pH 9.5, and X-ray diffraction data were collected to a resolution of 1.9 Å with an Rmerge of 7.9%. The crystals of pfEstA belonged to space group P2(1)2(1)2(1), with unit-cell parameters a=65.31, b=82.13, c=100.41 Å, α=β=γ=90°.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hou, Jing; Li, Ming; Chen, Jiashu
Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.
Russo Krauss, Irene; Merlino, Antonello; Randazzo, Antonio; Mazzarella, Lelio; Sica, Filomena
2010-01-01
The thrombin-binding aptamer (TBA) is a consensus DNA 15-mer that binds specifically to human α-thrombin at nanomolar concentrations and inhibits its procoagulant functions. Recently, a modified TBA (mTBA) containing a 5′–5′ inversion-of-polarity site has been shown to be more stable and to possess a higher thrombin affinity than its unmodified counterpart. The structure of the thrombin–TBA complex has previously been determined at low resolution, but did not provide a detailed picture of the aptamer conformation or of the protein–DNA assembly, while that of the complex with mTBA is unknown. Crystallographic analysis of the thrombin–mTBA complex has been attempted. The crystals diffracted to 2.15 Å resolution and belonged to space group I222. PMID:20693681
Crystallization and preliminary X-ray analysis of copper amine oxidase from Escherichia coli K-12.
Roh, J H; Suzuki, H; Kumagai, H; Yamashita, M; Azakami, H; Murooka, Y; Mikami, B
1994-05-13
Copper-containing monoamine oxidase (MAO) from Escherichia coli was overproduced in the periplasmic space by expression of the cloned gene. The purified MAO has been crystallized by means of the hanging drop technique using sodium citrate as a precipitant. The crystals belong to the orthorhombic system, space group P2(1)2(1)2(1), with unit cell dimensions of a = 136.1 A, b = 168.4 A and c = 81.6 A. The asymmetric unit contains one molecule of MAO, with a crystal volume per protein mass (Vm) of 2.88 A3/Da and a solvent content of 58% by volume. The crystals diffract X-rays to a resolution limit of at least 2.7 A and are resistant to X-ray radiation damage. They appear to be suitable for X-ray structure analysis.
NASA Astrophysics Data System (ADS)
Lee, J. H.; Sohn, S. G.; Jung, H. I.; An, Y. J.; Lee, S. H.
2013-07-01
OXA-17, an extended-spectrum β-lactamase (ESBL) conferring severe antibiotic resistance, hydrolytically inactivates β-lactam antibiotics, inducing a lack of eradication of pathogenic bacteria by oxyimino β-lactams and not helping hospital infection control. Thus, the enzyme is a potential target for developing antimicrobial agents against pathogens producing ESBLs. OXA-17 was purified and crystallized at 298 K. X-ray diffraction data from OXA-17 crystal have been collected to 1.85 Å resolution using synchrotron radiation. The crystal of OXA-17 belongs to space group P212121, with unit-cell parameters a = 48.37, b = 101.12, and c = 126.07 Å. Analysis of the packing density shows that the asymmetric unit probably contains two molecules with a solvent content of 54.6%.
Laboratory Detection and Analysis of Organic Compounds in Rocks Using HPLC and XRD Methods
NASA Technical Reports Server (NTRS)
Dragoi, D.; Kanik, I.; Bar-Cohen, Y.; Sherrit, S.; Tsapin, A.; Kulleck, J.
2004-01-01
In this work we describe an analytical method for determining the presence of organic compounds in rocks, limestone, and other composite materials. Our preliminary laboratory experiments on different rocks/limestone show that the organic component in mineralogical matrices is a minor phase on order of hundreds of ppm and can be better detected using high precision liquid chromatography (HPLC). The matrix, which is the major phase, plays an important role in embedding and protecting the organic molecules from the harsh Martian environment. Some rocks bear significant amounts of amino acids therefore, it is possible to identify these phases using powder x-ray diffraction (XRD) by crystallizing the organic. The method of detection/analysis of organics, in particular amino acids, that have been associated with life will be shown in the next section.
Prototype through-pellicle coherent imaging using a 30nm tabletop EUV source
NASA Astrophysics Data System (ADS)
Bevis, Charles S.; Karl, Robert M.; Wang, Bin; Esashi, Yuka; Tanksalvala, Michael; Porter, Christina L.; Johnsen, Peter; Adams, Daniel E.; Murnane, Margaret M.; Kapteyn, Henry C.
2018-03-01
We present preliminary through-pellicle imaging using a 30nm tabletop extreme ultraviolet (EUV) coherent diffractive imaging microscope. We show that even in a non-optimized setup, this technique enables through-pellicle imaging of a sample with no detectable impact on image fidelity or resolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abrescia, Nicola G. A.; Kivelä, Hanna M.; Grimes, Jonathan M.
2005-08-01
The viral capsid protein P2 of bacteriophage PM2 has been crystallized. Preliminary X-ray analysis demonstrates the position and orientation of the two trimers in the asymmetric unit. PM2 (Corticoviridae) is a dsDNA bacteriophage which contains a lipid membrane beneath its icosahedral capsid. In this respect it resembles bacteriophage PRD1 (Tectiviridae), although it is not known whether the similarity extends to the detailed molecular architecture of the virus, for instance the fold of the major coat protein P2. Structural analysis of PM2 has been initiated and virus-derived P2 has been crystallized by sitting-nanodrop vapour diffusion. Crystals of P2 have been obtainedmore » in space group P2{sub 1}2{sub 1}2, with two trimers in the asymmetric unit and unit-cell parameters a = 171.1, b = 78.7, c = 130.1 Å. The crystals diffract to 4 Å resolution at the ESRF BM14 beamline (Grenoble, France) and the orientation of the non-crystallographic threefold axes, the spatial relationship between the two trimers and the packing of the trimers within the unit cell have been determined. The trimers form tightly packed layers consistent with the crystal morphology, possibly recapitulating aspects of the arrangement of subunits in the virus.« less
Ding, Z.; Zheng, B.; Zhang, Jiahua; Belkin, H.E.; Finkelman, R.B.; Zhao, F.; Zhou, D.; Zhou, Y.; Chen, C.
1999-01-01
Coal samples from high arsenic coal areas have been analyzed by electron microprobe analyzer (EMPA), scanning electron microscopy with an energy dispersive X-ray analyzer (SEM-EDX), X-ray diffraction analysis (XRD), low temperature ashing (LTA), transmission electron microscopy (TEM), X-ray absorption fine structure (XAFS), instrument neutron activation analysis (INAA) and wet chemical analysis. Although some As-bearing minerals such as pyrite, arsenopyrite, realgar (?), As-bearing sulfate, and As-bearing clays are found in the high arsenic coals, their contents do not account for the abundance of arsenic in the some coals. Analysis of the coal indicates that arsenic exists mainly in the form of As5+ and As3+, combined with compounds in the organic matrix. The occurrence of such exceptionally high arsenic contents in coal and the fact that the arsenic is dominantly organically associated are unique observations. The modes of occurrence of arsenic in high As-coals are discussed.
Physico-chemical characteristics and antimicrobial studies of silver doped hydroxyapatite
NASA Astrophysics Data System (ADS)
Predoi, D.; Predoi, M. V.; Kettani, Moncef Ech Cherif El; Leduc, Damien; Iconaru, S. L.; Ciobanu, C. S.; Buton, N.; Petre, C. C.; Prodan, A. M.
2018-02-01
The present research is focused on the synthesis, structural and morphological characterization and antimicrobial evaluation of silver doped hydroxyapatite (AgHAp) in water. The preliminary ultrasonic characterizations of the AgHAp in water synthesized by an adapted co-precipitation method are also presented. X-ray diffraction result showed that silver ions were substituted in the hydroxyapatite structure. The lattice parameters increased when the silver substitution increased. The morphology of AgHAp were evaluated by Scanning Electron Microscopy (SEM). By EDX analysis the constituents elements of hydroxyapatite were detected in all analyzed samples. The silver was also found in the samples with xAg = 0.5 and 0.2. The colloidal properties of the resulted AgHAp (xAg = 0.0, 0.05 and 0.2) in water were analyzed by Dynamic Light Scattering (DLS) and zeta potential. On the other hand, the novelty of our research consists of preliminary ultrasonic measurements (US) conducted on AgHAp in water. Furthermore, the antimicrobial activity of AgHAp was evaluated and a decrease in the number of surviving cells was established.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yanfeng; Gao, Xiaoli; Qin, Lin
2010-12-01
Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and can cause neuroparalytic disease botulism. Due to the limitations of production and manipulation of holoenzymes, expressing non-toxic heavy chain receptor binding domains (HCR) has become a common strategy for vaccine and antibody development. Meanwhile, large quantities and highly purified soluble proteins are required for research areas such as antibody maturation and structural biology. We present high level expression and purification of the BoNT serotype D HCR in E. coli using a codon-optimized cDNA. By varying expression conditions, especially at low temperature, the protein was expressed at a high level withmore » high solubility. About 150-200 mg protein was purified to >90% purity from 1 L cell culture. The recombinant D_HCR was crystallized and the crystals diffracted to 1.65 Å resolution. The crystals belong to space group P212121 with unit cell dimensions a = 60.8 Å, b = 89.7 Å, c = 93.9 Å. Preliminary crystallographic data analysis revealed one molecule in asymmetric unit.« less
NASA Astrophysics Data System (ADS)
Sugahara, Mitsuaki; Sekino-Suzuki, Naoko; Ohno-Iwashita, Yoshiko; Miki, Kunio
1996-10-01
θ-Toxin (perfringolysin O), a cholesterol-binding, pore-forming cytolysin of Clostridium perfringens type A was crystallized by the vapor diffusion procedure using polyethyleneglycol 4000 and sodium chloride as precipitants in 2-(cyclohexylamino)ethanesulfonic acid (CHES) buffer at pH 9.5. The diffraction patterns of precession photographs indicated that the crystals belong to the orthorhombic system and the space group C222 1 with unit-cell dimensions of a = 47.7 Å, b = 182.0 Å and c = 175.8 Å. Assuming that the asymmetric unit contains one or two molecules (Mw 52 700), the Vm value is calculated as 3.6 or 1.8 Å 3/dalton, respectively. The crystals diffract X-rays to at least 3 Å resolution and are suitable for high resolution X-ray crystal structure determination.
NASA Astrophysics Data System (ADS)
Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.
2016-11-01
Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.
Toward in situ x-ray diffraction imaging at the nanometer scale
NASA Astrophysics Data System (ADS)
Zatsepin, Nadia A.; Dilanian, Ruben A.; Nikulin, Andrei Y.; Gable, Brian M.; Muddle, Barry C.; Sakata, Osami
2008-08-01
We present the results of preliminary investigations determining the sensitivity and applicability of a novel x-ray diffraction based nanoscale imaging technique, including simulations and experiments. The ultimate aim of this nascent technique is non-destructive, bulk-material characterization on the nanometer scale, involving three dimensional image reconstructions of embedded nanoparticles and in situ sample characterization. The approach is insensitive to x-ray coherence, making it applicable to synchrotron and laboratory hard x-ray sources, opening the possibility of unprecedented nanometer resolution with the latter. The technique is being developed with a focus on analyzing a technologically important light metal alloy, Al-xCu (where x is 2.0-5.0 %wt). The mono- and polycrystalline samples contain crystallographically oriented, weakly diffracting Al2Cu nanoprecipitates in a sparse, spatially random dispersion within the Al matrix. By employing a triple-axis diffractometer in the non-dispersive setup we collected two-dimensional reciprocal space maps of synchrotron x-rays diffracted from the Al2Cu nanoparticles. The intensity profiles of the diffraction peaks confirmed the sensitivity of the technique to the presence and orientation of the nanoparticles. This is a fundamental step towards in situ observation of such extremely sparse, weakly diffracting nanoprecipitates embedded in light metal alloys at early stages of their growth.
Improving the diffraction of apoA-IV crystals through extreme dehydration.
Deng, Xiaodi; Davidson, W Sean; Thompson, Thomas B
2012-01-01
Apolipoproteins are the protein component of high-density lipoproteins (HDL), which are necessary for mobilizing lipid-like molecules throughout the body. Apolipoproteins undergo self-association, especially at higher concentrations, making them difficult to crystallize. Here, the crystallization and diffraction of the core fragment of apolipoprotein A-IV (apoA-IV), consisting of residues 64-335, is presented. ApoA-IV(64-335) crystallized readily in a variety of hexagonal (P6) morphologies with similar unit-cell parameters, all containing a long axis of nearly 550 Å in length. Preliminary diffraction experiments with the different crystal morphologies all resulted in limited streaky diffraction to 3.5 Å resolution. Crystal dehydration was applied to the different morphologies with variable success and was also used as a quality indicator of crystal-growth conditions. The results show that the morphologies that withstood the most extreme dehydration conditions showed the greatest improvement in diffraction. One morphology in particular was able to withstand dehydration in 60% PEG 3350 for over 12 h, which resulted in well defined intensities to 2.7 Å resolution. These results suggest that the approach of integrating dehydration with variation in crystal-growth conditions might be a general technique to optimize diffraction. © 2012 International Union of Crystallography. All rights reserved.
NASA Astrophysics Data System (ADS)
Valdés, L.; Hernández, D.; de Ménorval, L. Ch.; Pérez, I.; Altshuler, E.; Fossum, J. O.; Rivera, A.
2016-07-01
During the last years, clays have been increasingly explored as hosts for drugs. In the present paper, we have been able to host the non-steroidal anti-inflammatory drug, Tramadol, into the clay Li-fluorohectorite (Li-Fh). We preliminary evaluate its incorporation by means of UV spectroscopy and X ray diffraction. Our results indicate that the clay hosts the drug molecule in its interlayer space. We suggest a set of parameters to guarantee an efficient incorporation process. Future studies will concentrate on the release of the drug from the clay nanofluid.
Balasubramanian, Anuradha; Ponnuraj, Karthe
2008-07-01
Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 A resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 A.
Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.
2013-01-01
Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835
One-step, low-temperature fabrication of CdS quantum dots by watermelon rind: a green approach
Lakshmipathy, Rajasekhar; Sarada, Nallani Chakravarthula; Chidambaram, K; Pasha, Sk Khadeer
2015-01-01
We investigated the one-step synthesis of CdS nanoparticles via green synthesis that used aqueous extract of watermelon rind as a capping and stabilizing agent. Preliminary phytochemical analysis depicted the presence of carbohydrates which can act as capping and stabilizing agents. Synthesized CdS nanoparticles were characterized using UV-visible, Fourier transform infrared spectroscopy, X-ray diffraction, EDX, dynamic light scattering, transmission electron microscopy, and atomic force microscopy techniques. The CdS nanoparticles were found to be size- and shape-controlled and were stable even after 3 months of synthesis. The results suggest that watermelon rind, an agro-waste, can be used for synthesis of CdS nanoparticles without any addition of stabilizing and capping agents. PMID:26491319
Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim
2005-06-01
Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.
Im, Dong-Won; Kim, Tae-O; Jung, Ha Yun; Oh, Ji Eun; Lee, Se Jin; Heo, Yong-Seok
2012-01-01
Primase is the enzyme that synthesizes RNA primers on single-stranded DNA during normal DNA replication. In this study, the catalytic core domain of primase from Streptococcus mutans UA159 was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 1.60 Å resolution using a synchrotron-radiation source. The crystal belonged to space group P41 or P43, with unit-cell parameters a = b = 52.63, c = 110.31 Å. The asymmetric unit is likely to contain one molecule, with a corresponding V M of 1.77 Å3 Da−1 and a solvent content of 30.7%. PMID:22232183
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ni, Shuisong; McAteer, Kathleen; Bussiere, Dirksen E.
2004-06-01
CylR2 is one of the two regulatory proteins associated with the quorum-sensing-dependent synthesis of cytolysin for the common pathogen Enterococcus faecalis. The protein was expressed with a C-terminal 6-histidine tag and purified to homogeneity with a cobalt affinity column followed by another size exclusion column. Both native and SeMet proteins were crystallized. A complete X-ray diffraction data set from the native crystal was collected to 2.3 resolution. The crystal was tetragonal, belonging to space group P41/43, with unit-cell dimensions a=b=66.2 , c=40.9 and a=b=g=90. The asymmetric unit contained two molecules of CylR2.
Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder
2006-01-01
Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268
dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor
2013-01-01
Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585
Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru
2006-01-01
A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260
Focused ion beam direct micromachining of DOEs
NASA Astrophysics Data System (ADS)
Khan Malek, Chantal; Hartley, Frank T.; Neogi, Jayant
2000-09-01
We discuss here the capability of direct manufacture of various high- resolution diffractive optics, in particular regarding micromachining of DOEs in 3D. Preliminary demonstrations were made in 2-D using an automated FIB system operated at 30 KeV with a Gallium liquid metal ion source and equipped with a gas injection system (GIS). Gratings with a 20 nm line width and zone plates with 32 nm outer ring were milled in a reactive atmosphere (iodine) directly through 3.5 (mu) m and 800 nm of gold respectively. Plans for combining FIB and X-ray lithography to make diffractive optical elements (DOEs) for JPL are also mentioned.
Crystallization and preliminary X-ray diffraction data of β-galactosidase from Aspergillus niger.
Rico-Díaz, Agustín; Vizoso Vázquez, Ángel; Cerdán, M Esperanza; Becerra, Manuel; Sanz-Aparicio, Julia
2014-11-01
β-Galactosidase from Aspergillus niger (An-β-Gal), belonging to the family 35 glycoside hydrolases, hydrolyzes the β-galactosidase linkages in lactose and other galactosides. It is extensively used in industry owing to its high hydrolytic activity and safety. The enzyme has been expressed in yeasts and purified by immobilized metal-ion affinity chromatography for crystallization experiments. The recombinant An-β-Gal, deglycosylated to avoid heterogeneity of the sample, has a molecular mass of 109 kDa. Rod-shaped crystals grew using PEG 3350 as the main precipitant agent. A diffraction data set was collected to 1.8 Å resolution.
NASA Technical Reports Server (NTRS)
Roeber, Dana; Achari, Aniruddha; Manavalan, Partha; Edmunds, Tim; Scott, David L.
2003-01-01
Acid beta-glucocerebrosidase (N-acylsphingosyl-1-O-beta-D-glucoside:glucohydrolase) is a lysosomal glycoprotein that catalyzes the hydrolysis of the glycolipid glucocerebroside to glucose and ceramide. Inadequate levels of this enzyme underly the pathophysiology of Gaucher's disease. Cerezyme (Genzyme Corporation, Cambridge, MA, USA) is a partially deglycosylated form of recombinant human acid beta-glucocerebrosidase that is used in the treatment of Gaucher patients. Although acid beta-glucocerebrosidase belongs to a large family of glycosidases, relatively little is known regarding its structural biology. Here, the crystallization and the initial diffraction analysis of Cerezyme are reported. The crystals are C-centered orthorhombic, with unit-cell parameters a = 285.0, b = 110.2, c = 91.7 A. A 99.9% complete data set has been collected to 2.75 A with an R(sym) of 8.8%.
NASA Technical Reports Server (NTRS)
Roeber, Dana F.; Achari, Aniruddha; Manavalan, Partha; Edmunds, Tim; Scott, David L.; Curreri, Peter A. (Technical Monitor)
2002-01-01
Acid beta-glucocerebrosidase (N-acylsphingosyl - O - beta-D - glucoside:glucohydrolase) is a lysosomal glycoprotein that catalyzes the hydrolysis of the glycolipid glucocerebroside to glucose and ceramide. Inadequate levels of this enzyme underly the pathophysiology of Gaucher's disease. Cerezyme(R) (Genzyme Corporation, Cambridge, MA) is a partially deglycosylated form of recombinant human acid beta-glucocerebrosidase that is commercially available for the treatment of Gaucher patients. Although acid beta-glucocerebrosidase belongs to a large family of glycosidases, relatively little is known regarding its structural biology. We report the crystallization and the initial diffraction analysis of Cerezyme(R). The crystals are C-centered orthorhombic, with unit-cell parameters of a = 285.0 A, b = 110.2 A, and c = 91.7 A. A 99.9 A complete data set has been collected to 2.75 A with an R(sub sym) of 8.8 %.
Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin
2016-01-01
Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855
Confined detection volume of fluorescence correlation spectroscopy by bare fiber probes.
Lu, Guowei; Lei, Franck H; Angiboust, Jean-François; Manfait, Michel
2010-04-01
A fiber-tip-based near-field fluorescence correlation spectroscopy (FCS) has been developed for confining the detection volume to sub-diffraction-limited dimensions. This near-field FCS is based on near-field illumination by coupling a scanning near-field optical microscope (SNOM) to a conventional confocal FCS. Single-molecule FCS analysis at 100 nM Rhodamine 6G has been achieved by using bare chemically etched, tapered fiber tips. The detection volume under control of the SNOM system has been reduced over one order of magnitude compared to that of the conventional confocal FCS. Related factors influencing the near-field FCS performance are investigated and discussed in detail. In this proof-of-principle study, the preliminary experimental results suggest that the fiber-tip-based near-field FCS might be a good alternative to realize localized analysis at the single-molecule level.
Processing of Lunar Soil Simulant for Space Exploration Applications
NASA Technical Reports Server (NTRS)
Sen, Subhayu; Ray, Chandra S.; Reddy, Ramana
2005-01-01
NASA's long-term vision for space exploration includes developing human habitats and conducting scientific investigations on planetary bodies, especially on Moon and Mars. To reduce the level of up-mass processing and utilization of planetary in-situ resources is recognized as an important element of this vision. Within this scope and context, we have undertaken a general effort aimed primarily at extracting and refining metals, developing glass, glass-ceramic, or traditional ceramic type materials using lunar soil simulants. In this paper we will present preliminary results on our effort on carbothermal reduction of oxides for elemental extraction and zone refining for obtaining high purity metals. In additions we will demonstrate the possibility of developing glasses from lunar soil simulant for fixing nuclear waste from potential nuclear power generators on planetary bodies. Compositional analysis, x-ray diffraction patterns and differential thermal analysis of processed samples will be presented.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Friedman, E. S.; Brody, A. J.; Young, M. L.
Seven bronze bangles from Tell en-Nasbeh, northern Judah, were investigated to understand the phase composition and manufacturing process of the artifacts, and possibly suggest a provenance for their origin. Synchrotron x-ray radiation diffraction (XRD) and fluorescence (XRF) were used in the analysis to avoid any destructive sampling and at the same time penetrate through the surface into the core metal. These techniques enabled us to determine that the bangles were not just tin bronze, but leaded tin bronze. Based on excavation reports, it is unlikely that the metal objects were manufactured locally at Tell en-Nasbeh; rather, preliminary XRD and XRFmore » data point towards the neighboring region of Edom as their origin. Despite their political enmity during the Iron Age II, the data suggest that Judahite social demands for bronze may have fostered a strong economic relationship between these two polities.« less
Lin, Chih-Ming; Liu, Hsin-Tzu; Zhong, Shi-Yao; Hsu, Chia-Hung; Chiu, Yi-Te; Tai, Ming-Fong; Juang, Jenh-Yih; Chuang, Yu-Chun; Liao, Yen-Fa
2016-01-01
Nanosized aluminum-doped zinc oxide Zn1−xAlxO (AZO) powders (AZO-NPs) with x = 0.01, 0.03, 0.06, 0.09 and 0.11 were synthesized by chemical precipitation method. The thermogravimetric analysis (TGA) indicated that the precursors were converted to oxides from hydroxides near 250 °C, which were then heated to 500 °C for subsequent thermal processes to obtain preliminary powders. The obtained preliminary powders were then calcined at 500 °C for three hours. The structure and morphology of the products were measured and characterized by angle-dispersive X-ray diffraction (ADXRD) and scanning electron microscopy (SEM). ADXRD results showed that AZO-NPs with Al content less than 11% exhibited würtzite zinc oxide structure and there was no other impurity phase in the AZO-NPs, suggesting substitutional doping of Al on Zn sites. The Zn0.97Al0.03O powders (A3ZO-NPs) with grain size of about 21.4 nm were used for high-pressure measurements. The in situ ADXRD measurements revealed that, for loading run, the pressure-induced würtzite (B4)-to-rocksalt (B1) structural phase transition began at 9.0(1) GPa. Compared to the predicted phase-transition pressure of ~12.7 GPa for pristine ZnO nanocrystals of similar grain size (~21.4 nm), the transition pressure for the present A3ZO-NPs exhibited a reduction of ~3.7 GPa. The significant reduction in phase-transition pressure is attributed to the effects of highly selective site occupation, namely Zn2+ and Al3+, were mainly found in tetrahedral and octahedral sites, respectively. PMID:28773683
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya
2007-11-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Quesada, Odayme; Gurda, Brittney; Govindasamy, Lakshmanan
2007-12-01
Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids have been produced which diffract X-rays to ∼3.0 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids diffract X-rays to ∼3.0 Å resolution. The crystals belong to the rhombohedral space group R3, with unit-cell parameters a = 252.4, c = 591.2 Å in the hexagonal setting. The diffraction data were processed and reduced to an overall completeness of 79.0% and an R{sub merge} of 12.0%. There are three viral capsids in the unit cell. The icosahedral threefold axis is coincident with the crystallographic threefold axis, resulting in one third of amore » capsid (20 monomers) per crystallographic asymmetric unit. The orientation of the viral capsid has been determined by rotation-function searches and is positioned at (0, 0, 0) by packing considerations.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi
2006-12-01
UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.
2016-11-15
Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less
Optical fiber endface biosensor based on resonances in dielectric waveguide gratings
NASA Astrophysics Data System (ADS)
Wawro, Debra D.; Tibuleac, Sorin; Magnusson, Robert; Liu, Hanli
2000-05-01
A new fiber optic sensor integrating dielectric diffraction gratings and thin films on optical fiber endfaces is prosed for biomedical sensing applications. This device utilizes a resonant dielectric waveguide grating structure fabricated on an optical fiber endface to probe reactions occurring in a sensing layer deposited on its surface. The operation of this sensor is based upon a fundamental resonance effect that occurs in waveguide gratings. An incident broad- spectrum signal is guided within an optical fiber and is filtered to reflect or transmit a desired spectral band by the diffractive thin film structure on its endface. Slight changes in one or more parameters of the waveguide grating, such as refractive index or thickness, can result in a responsive shift of the reflected or transmitted spectral peak that can be detected with spectroscopic instruments. This new sensor concept combines improved sensitivity and accuracy with attractive features found separately in currently available fiber optic sensors, such as large dynamic range, small sensing proximity, real time operation, and remote sensing. Diffractive elements of this type consisting of a photoresist grating on a Si3N4 waveguide have been fabricated on multimode optical fiber endfaces with 100 micrometers cores. Preliminary experimental tests using a tunable Ti:sapphire laser indicate notches of 18 percent in the transmission spectrum of the fiber endface guided-mode resonance devices. A theoretical analysis of the device performance capabilities is presented and applied to evaluate the feasibility and potential advantages of this bioprobe.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Szostak, R.; Ingram, C.
Research efforts for the report period have been focused on the characterization of catalyst samples, mainly by ion exchange and spectroscopic techniques. Other activities included the preparation of more variants of the MeAPO-36 family containing various types and amounts of metals in their frameworks. Characterization of these samples by X-ray diffraction analysis was delayed due to malfunction of the Diffractometer since October of 1995. The instrument was back in working condition only since the ending of January and XRD analysis has resumed since then. Efforts from the research group were also concentrated on the preparation of manuscripts for publication. Workmore » in progress includes: synthesis of MnAPO5 and MgAPO5; synthesis of CoAPO5; chemical analysis; preliminary investigation of ion exchange capacities of zeolites; uptake kinetics on the Na-exchanged MnAPO5 and MgAPO5 with alkali and alkali earth metals.« less
An initial analysis of short- and medium-range correlations potential non-Pt catalysts in CoNx
NASA Astrophysics Data System (ADS)
Peterson, Joe
2009-10-01
A potential show stopper for the development of fuel cells for the commercial automotive industry is the design of low-cost catalysts. The best catalysts are based on platinum, which is a rare and expensive noble metal. Our group has been involved in the characterization of potential materials for non-Pt catalysts. In this presentation, I will present some preliminary neutron scattering data from a nanocrystalline powder sample of CoNx. It is apparent that the diffraction data cannot be analyzed with standard Riedveld refinement, and we have to invoke pair distribution function (PDF) analysis. The PDF provides insight into short-range correlations, as it measures the probabilities of short- and mid-range interatomic distances in a material. The analysis reveals a strong incoherent scattering response, which is indicative of the presence of hydrogen in the sample. After correcting for the incoherent scattering, one obtains the normalized scattering function S(Q), whose Fourier transform yields the PDF.
An initial analysis of short- and medium-range correlations potential non-Pt catalysts in CoNx
NASA Astrophysics Data System (ADS)
Peterson, Joe
2010-03-01
A potential show stopper for the development of fuel cells for the commercial automotive industry is the design of low-cost catalysts. The best catalysts are based on platinum, which is a rare and expensive noble metal. Our group has been involved in the characterization of potential materials for non-Pt catalysts. In this presentation, I will present some preliminary neutron scattering data from a nanocrystalline powder sample of CoNx. It is apparent that the diffraction data cannot be analyzed with standard Riedveld refinement, and we have to invoke pair distribution function (PDF) analysis. The PDF provides insight into short-range correlations, as it measures the probabilities of short- and mid-range interatomic distances in a material. The analysis reveals a strong incoherent scattering response, which is indicative of the presence of hydrogen in the sample. After correcting for the incoherent scattering, one obtains the normalized scattering function S(Q), whose Fourier transform yields the PDF.
Lu, Shuangshuang; Yao, Shugang; Chen, Rong; Zhang, Nianzhi; Chen, Jianmin; Gao, Feng; Xia, Chun
2012-04-01
β(2)-Microglobulin (β(2)m) is an essential subunit of the major histocompatibility complex (MHC) class I molecule that helps to stabilize the structure of peptide-MHC I (pMHC I). It is also one of the typical immunoglobulin superfamily (IgSF) molecules in the adaptive immune system (AIS). Sharks belong to the cartilaginous fish, which are the oldest jawed vertebrate ancestors with an AIS to exist in the world. Thus, the study of cartilaginous fish β(2)m would help in understanding the evolution of IgSF molecules. In order to demonstrate this, β(2)m from a cartilaginous fish, nurse shark (Ginglymostoma cirratum), was expressed, refolded, purified and crystallized. Diffraction data were collected to a resolution of 2.3 Å. The crystal belonged to space group P3(2)21, with unit-cell parameters a = b = 88.230, c = 67.146 Å. The crystal structure contained two molecules in the asymmetric unit. The results will provide structural information for study of the evolution of β(2)m and IgSF in the AIS. © 2012 International Union of Crystallography. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harmer, Nicholas J., E-mail: nic@cryst.bioc.cam.ac.uk; King, Jerry D.; Department of Veterinary Medicine, Cambridge CB3 0ES
2007-08-01
The expression, purification, and crystallisation of the short-chain dehydrogenases WbmF, WbmG and WbmH from B. bronchiseptica are described. Native diffraction data to 1.5, 2.0, and 2.2 Å were obtained for the three proteins, together with complexes with nucleotides. The short-chain dehydrogenase enzymes WbmF, WbmG and WbmH from Bordetella bronchiseptica were cloned into Escherichia coli expression vectors, overexpressed and purified to homogeneity. Crystals of all three wild-type enzymes were obtained using vapour-diffusion crystallization with high-molecular-weight PEGs as a primary precipitant at alkaline pH. Some of the crystallization conditions permitted the soaking of crystals with cofactors and nucleotides or nucleotide sugars, whichmore » are possible substrate compounds, and further conditions provided co-complexes of two of the proteins with these compounds. The crystals diffracted to resolutions of between 1.50 and 2.40 Å at synchrotron X-ray sources. The synchrotron data obtained were sufficient to determine eight structures of the three enzymes in complex with a variety of cofactors and substrate molecules.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Yong-Zhi; Sheng, Yu; Li, Lan-Fen
2007-09-01
A potential target for antibiotic drug design, d-alanine-d-alanine ligase from S. mutans, was expressed in E. coli, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. d-Alanine-d-alanine ligase is encoded by the gene ddl (SMU-599) in Streptococcus mutans. This ligase plays a very important role in cell-wall biosynthesis and may be a potential target for drug design. To study the structure and function of this ligase, the gene ddl was amplified from S. mutans genomic DNA and cloned into the expression vector pET28a. The protein was expressed in soluble form in Escherichia coli strain BL21 (DE3). Homogeneous proteinmore » was obtained using a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Purified protein was crystallized and the cube-shaped crystal diffracted to 2.4 Å. The crystal belongs to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 79.50, c = 108.97 Å. There is one molecule per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobayashi, Kan; RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198; Suzuki, Takehiro
2014-08-27
E. coli YfcM was expressed, purified and crystallized. Crystals of YfcM were obtained by the in situ proteolysis crystallization method. Using these crystals, an X-ray diffraction data set was collected at 1.45 Å resolution. Elongation factor P (EF-P) plays an essential role in the translation of polyproline-containing proteins in bacteria. It becomes functional by the post-translational modification of its highly conserved lysine residue. It is first β-lysylated by PoxA and then hydroxylated by YfcM. In this work, the YfcM protein from Escherichia coli was overexpressed, purified and crystallized. The crystal of YfcM was obtained by the in situ proteolysis crystallizationmore » method and diffracted X-rays to 1.45 Å resolution. It belonged to space group C2, with unit-cell parameters a = 124.4, b = 37.0, c = 37.6 Å, β = 101.2°. The calculated Matthews coefficient (V{sub M}) of the crystal was 1.91 Å{sup 3} Da{sup −1}, indicating that one YfcM molecule is present in the asymmetric unit with a solvent content of 35.7%.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Altenfeld, Anika; Wohlgemuth, Sabine; Wehenkel, Annemarie
The 800 kDa complex of the human Rod, Zwilch and ZW10 proteins (the RZZ complex) was reconstituted in insect cells, purified, crystallized and subjected to preliminary X-ray diffraction analysis. The spindle-assembly checkpoint (SAC) monitors kinetochore–microtubule attachment during mitosis. In metazoans, the three-subunit Rod–Zwilch–ZW10 (RZZ) complex is a crucial SAC component that interacts with additional SAC-activating and SAC-silencing components, including the Mad1–Mad2 complex and cytoplasmic dynein. The RZZ complex contains two copies of each subunit and has a predicted molecular mass of ∼800 kDa. Given the low abundance of the RZZ complex in natural sources, its recombinant reconstitution was attempted bymore » co-expression of its subunits in insect cells. The RZZ complex was purified to homogeneity and subjected to systematic crystallization attempts. Initial crystals containing the entire RZZ complex were obtained using the sitting-drop method and were subjected to optimization to improve the diffraction resolution limit. The crystals belonged to space group P3{sub 1} (No. 144) or P3{sub 2} (No. 145), with unit-cell parameters a = b = 215.45, c = 458.7 Å, α = β = 90.0, γ = 120.0°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kang, Ji Yong; Lee, Hyung Ho; Yoon, Hye Jin
2006-11-01
Phosphopantetheine adenylyltransferase from En. faecalis was crystallized and X-ray diffraction data were collected to 2.70 Å resolution. Phosphopantetheine adenylyltransferase, an essential enzyme in the coenzyme A biosynthetic pathway, catalyzes the reversible transfer of an adenylyl group from ATP to 4′-phosphopantetheine, yielding 3′-dephospho-CoA and pyrophosphate. Enterococcus faecalis PPAT has been overexpressed in Escherichia coli as a fusion with a C-terminal purification tag and crystallized at 297 K using a reservoir solution consisting of 0.1 M sodium HEPES pH 7.5, 0.8 M sodium dihydrogen phosphate and 0.8 M potassium dihydrogen phosphate. X-ray diffraction data were collected to 2.70 Å at 100 K.more » The crystals belong to the primitive tetragonal space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 160.81, c = 225.68 Å. Four copies of the hexameric molecule are likely to be present in the asymmetric unit, giving a crystal volume per protein weight (V{sub M}) of 3.08 Å{sup 3} Da{sup −1} and a solvent content of 60.1%.« less
Kasaboğlu, Oğuzcan; Er, Nuray; Tümer, Celal; Akkocaoğlu, Murat
2004-10-01
Sialoliths are common in the submandibular gland and its duct system. The exact cause of formation of a sialolith is still a matter of debate. The aim of this study was to analyze 6 sialoliths ultrastructurally to determine their development mechanism in the submandibular salivary glands. Six sialoliths retrieved from the hilus and duct of the submandibular salivary glands of 6 patients with sialadenitis were analyzed ultrastructurally by scanning electron microscope and x-ray diffractometer. Scanning electron microscope revealed mainly irregular, partly rudely hexagonal, needle-like and plate-shaped crystals. The cross-section from the surface to the inner part of the sialoliths showed no organic material. X-ray diffraction showed that the sialoliths were composed of hydroxyapatite crystals. Energy dispersive x-ray microanalysis showed that all of the samples contained high levels of Ca and P, and small amounts of Mg, Na, Cl, Si, Fe, and K. The main structures of the submandibular sialoliths were found to be hydroxyapatite crystals. No organic cores were observed in the central parts of the sialoliths. In accordance with these preliminary results, sialoliths in the submandibular salivary glands may arise secondary to sialadenitis, but not via a luminal organic nidus.
Jarrott, R; Shouldice, S R; Guncar, G; Totsika, M; Schembri, M A; Heras, B
2010-05-01
Pathogens require protein-folding enzymes to produce functional virulence determinants. These foldases include the Dsb family of proteins, which catalyze oxidative folding in bacteria. Bacterial disulfide catalytic processes have been well characterized in Escherichia coli K-12 and these mechanisms have been extrapolated to other organisms. However, recent research indicates that the K-12 complement of Dsb proteins is not common to all bacteria. Importantly, many pathogenic bacteria have an extended arsenal of Dsb catalysts that is linked to their virulence. To help to elucidate the process of oxidative folding in pathogens containing a wide repertoire of Dsb proteins, Salmonella enterica serovar Typhimurium has been focused on. This Gram-negative bacterium contains three DsbA proteins: SeDsbA, SeDsbL and SeSrgA. Here, the expression, purification, crystallization and preliminary diffraction analysis of these three proteins are reported. SeDsbA, SeDsbL and SeSrgA crystals diffracted to resolution limits of 1.55, 1.57 and 2.6 A and belonged to space groups P2(1), P2(1)2(1)2 and C2, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuzu, Mutlu; Niefind, Karsten; Hummel, Werner
2005-05-01
The water-forming flavoenzyme NADH oxidase was crystallized successfully for the first time. The crystals diffract X-rays to at least 4.0 Å resolution. NADH oxidase (NOX) from Lactobacillus brevis is a homotetrameric flavoenzyme composed of 450 amino acids per subunit. The molecular weight of each monomer is 48.8 kDa. The enzyme catalyzes the oxidation of two equivalents of NADH and reduces one equivalent of oxygen to yield two equivalents of water, without releasing hydrogen peroxide after the reduction of the first equivalent of NADH. Crystals of this protein were grown in the presence of 34% polyethylene glycol monomethyl ether 2000, 0.1more » M sodium acetate and 0.2 M ammonium sulfate at pH 5.4. They belong to the tetragonal space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 74.8, b = 95.7, c = 116.9 Å, α = γ = 90, β = 103.8°. The current diffraction limit is 4.0 Å. The self-rotation function of the native data set is consistent with a NOX tetramer in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jackson, Colin J.; Carr, Paul D.; Kim, Hye-Kyung
2006-07-01
The metallo-glycerophosphodiesterase from E. aerogenes (GpdQ) has been cloned, expressed in E. coli and purified. Initial screening of crystallization conditions for this enzyme resulted in the identification of needles from one condition in a sodium malonate grid screen. Removal of the metals from the enzyme and subsequent optimization of these conditions led to crystals. The metallo-glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) has been cloned, expressed in Escherichia coli and purified. Initial screening of crystallization conditions for this enzyme resulted in the identification of needles from one condition in a sodium malonate grid screen. Removal of the metals from the enzyme andmore » subsequent optimization of these conditions led to crystals that diffracted to 2.9 Å and belonged to space group P2{sub 1}3, with unit-cell parameter a = 164.1 Å. Self-rotation function analysis and V{sub M} calculations indicated that the asymmetric unit contains two copies of the monomeric enzyme, corresponding to a solvent content of 79%. It is intended to determine the structure of this protein utilizing SAD phasing from transition metals or molecular replacement.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji
Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less
Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian Peter
2014-05-01
Ergothioneine is an amino-acid betaine derivative of histidine that was discovered more than one century ago. Despite significant research pointing to a function in oxidative stress defence, the exact mechanisms of action of ergothioneine remain elusive. Although both humans and bacterial pathogens such as Mycobacterium tuberculosis seem to depend on ergothioneine, humans are devoid of the corresponding biosynthetic enzymes. Therefore, its biosynthesis may emerge as potential drug target in the development of novel therapeutics against tuberculosis. The recent identification of ergothioneine-biosynthetic genes in M. smegmatis enables a more systematic study of its biology. The pathway is initiated by EgtD, a SAM-dependent methyltransferase that catalyzes a trimethylation reaction of histidine to give N(α),N(α),N(α)-trimethylhistidine. Here, the recombinant production, purification and crystallization of EgtD are reported. Crystals of native EgtD diffracted to 2.35 Å resolution at a synchrotron beamline, whereas crystals of seleno-L-methionine-labelled protein diffracted to 1.75 Å resolution and produced a significant anomalous signal to 2.77 Å resolution at the K edge. All of the crystals belonged to space group P212121, with two EgtD monomers in the asymmetric unit.
Craig M. Clemons; Daniel F. Caulfield; A. Jeffrey Giacomin
1999-10-01
In this study, the microstructure of injection-molded polypropylene reinforced with cellulose fiber was investigated. Scanning electron microscopy of the fracture surfaces and X-ray diffraction were used to investigate fiber orientation. The polypropylene matrix was removed by solvent extraction, and the lengths of the residual fibers were optically determined. Fiber...
NASA Astrophysics Data System (ADS)
Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.
2015-11-01
HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.
Dependence of magnetic permeability on residual stresses in alloyed steels
NASA Astrophysics Data System (ADS)
Hristoforou, E.; Ktena, A.; Vourna, P.; Argiris, K.
2018-04-01
A method for the monitoring of residual stress distribution in steels has been developed based on non-destructive surface magnetic permeability measurements. In order to investigate the potential utilization of the magnetic method in evaluating residual stresses, the magnetic calibration curves of various ferromagnetic alloyed steels' grade (AISI 4140, TRIP and Duplex) were examined. X-Ray diffraction technique was used for determining surface residual stress values. The overall measurement results have shown that the residual stress determined by the magnetic method was in good agreement with the diffraction results. Further experimental investigations are required to validate the preliminary results and to verify the presence of a unique normalized magnetic stress calibration curve.
A new scheme for velocity analysis and imaging of diffractions
NASA Astrophysics Data System (ADS)
Lin, Peng; Peng, Suping; Zhao, Jingtao; Cui, Xiaoqin; Du, Wenfeng
2018-06-01
Seismic diffractions are the responses of small-scale inhomogeneities or discontinuous geological features, which play a vital role in the exploitation and development of oil and gas reservoirs. However, diffractions are generally ignored and considered as interference noise in conventional data processing. In this paper, a new scheme for velocity analysis and imaging of seismic diffractions is proposed. Two steps compose of this scheme in our application. First, the plane-wave destruction method is used to separate diffractions from specular reflections in the prestack domain. Second, in order to accurately estimate migration velocity of the diffractions, the time-domain dip-angle gathers are derived from a Kirchhoff-based angle prestack time migration using separated diffractions. Diffraction events appear flat in the dip-angle gathers when imaged above the diffraction point with selected accurate migration velocity for diffractions. The selected migration velocity helps to produce the desired prestack imaging of diffractions. Synthetic and field examples are applied to test the validity of the new scheme. The diffraction imaging results indicate that the proposed scheme for velocity analysis and imaging of diffractions can provide more detailed information about small-scale geologic features for seismic interpretation.
Detecting Negative Obstacles by Use of Radar
NASA Technical Reports Server (NTRS)
Mittskus, Anthony; Lux, James
2006-01-01
Robotic land vehicles would be equipped with small radar systems to detect negative obstacles, according to a proposal. The term "negative obstacles" denotes holes, ditches, and any other terrain features characterized by abrupt steep downslopes that could be hazardous for vehicles. Video cameras and other optically based obstacle-avoidance sensors now installed on some robotic vehicles cannot detect obstacles under adverse lighting conditions. Even under favorable lighting conditions, they cannot detect negative obstacles. A radar system according to the proposal would be of the frequency-modulation/ continuous-wave (FM/CW) type. It would be installed on a vehicle, facing forward, possibly with a downward slant of the main lobe(s) of the radar beam(s) (see figure). It would utilize one or more wavelength(s) of the order of centimeters. Because such wavelengths are comparable to the characteristic dimensions of terrain features associated with negative hazards, a significant amount of diffraction would occur at such features. In effect, the diffraction would afford a limited ability to see corners and to see around corners. Hence, the system might utilize diffraction to detect corners associated with negative obstacles. At the time of reporting the information for this article, preliminary analyses of diffraction at simple negative obstacles had been performed, but an explicit description of how the system would utilize diffraction was not available.
NASA Astrophysics Data System (ADS)
Benedetti, Laura Robin; Eggert, J. H.; Kilkenny, J. D.; Bradley, D. K.; Bell, P. M.; Palmer, N. E.; Rygg, J. R.; Boehly, T. R.; Collins, G. W.; Sorce, C.
2017-06-01
Since X-ray diffraction is the most definitive method for identifying crystalline phases of a material, it is an important technique for probing high-energy-density materials during laser-driven compression experiments. We are developing a design for collecting several x-ray diffraction datasets during a single laser-driven experiment, with a goal of achieving temporal resolution better than 1ns. The design combines x-ray streak cameras, for a continuous temporal record of diffraction, with fast x-ray imagers, to collect several diffraction patterns with sufficient solid angle range and resolution to identify crystalline texture. Preliminary experiments will be conducted at the Omega laser and then implemented at the National Ignition Facility. We will describe the status of the conceptual design, highlighting tradeoffs in the design process. We will also discuss the technical issues that must be addressed in order to develop a successful experimental platform. These include: Facility-specific geometric constraints such as unconverted laser light and target alignment; EMP issues when electronic diagnostics are close to the target; X-ray source requirements; and detector capabilities. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344, LLNL-ABS-725146.
Balasubramanian, Anuradha; Ponnuraj, Karthe
2008-01-01
Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å. PMID:18607103
Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi
2009-01-01
2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007
Titanium leaching from red mud by diluted sulfuric acid at atmospheric pressure.
Agatzini-Leonardou, S; Oustadakis, P; Tsakiridis, P E; Markopoulos, Ch
2008-09-15
Laboratory-scale research has focused on the recovery of titanium from red mud, which is obtained from bauxite during the Bayer process for alumina production. The leaching process is based on the extraction of this element with diluted sulfuric acid from red mud under atmospheric conditions and without using any preliminary treatment. Statistical design and analysis of experiments were used, in order to determine the main effects and interactions of the leaching process factors, which were: acid normality, temperature and solid to liquid ratio. The titanium recovery efficiency on the basis of red mud weight reached 64.5%. The characterization of the initial red mud, as well as this of the leached residues was carried out by X-ray diffraction, TG-DTA and scanning electron microscopy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Agarkar, Vinod B.; Babayeva, Nigar D.; Rizzino, Angie
2010-10-08
Ets proteins are transcription factors that activate or repress the expression of genes that are involved in various biological processes, including cellular proliferation, differentiation, development, transformation and apoptosis. Like other Ets-family members, Elf3 functions as a sequence-specific DNA-binding transcriptional factor. A mouse Elf3 C-terminal fragment (amino-acid residues 269-371) containing the DNA-binding domain has been crystallized in complex with mouse type II TGF-{beta} receptor promoter (TR-II) DNA. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 42.66, b = 52, c = 99.78 {angstrom}, and diffracted to a resolution of 2.2 {angstrom}.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, G.J.; Garen, C.R.; Cherney, M.M.
2009-06-03
The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less
Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Linhard, Verena; Fritzsch, Günter; Zhang, Bin; Michel, Hartmut; Stöckigt, Joachim
2004-09-01
Crystals of vinorine synthase (VS) from medicinal plant Rauvolfia serpentina expressed in Escherichia coli have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. The enzyme is involved in the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure of a member of this enzyme family is known. The crystals belong to the space group P2(1)2(1)2(1) with cell dimensions of a=82.3 A, b=89.6 A and c=136.2 A. Under cryoconditions (120 K), a complete data set up to 2.8 A was collected at a synchrotron source.
Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho
2008-02-01
6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 A resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 A , and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 A , and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement.
Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho
2008-01-01
6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 Å resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 Å, and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 Å, and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement. PMID:18271114
Xu, Zhen; Yang, Weili; Shi, Nuo; Gao, Yongxiang; Teng, Maikun; Niu, Liwen
2010-08-01
The histone chaperone SET encoded by the SET gene, which is also known as template-activating factor Iß (TAF-Iß), is a multifunctional molecule that is involved in many biological phenomena such as histone binding, nucleosome assembly, chromatin remodelling, replication, transcription and apoptosis. A truncated SET/TAF-Iß ΔN protein that lacked the first 22 residues of the N-terminus but contained the C-terminal acidic domain and an additional His6 tag at the C-terminus was overexpressed in Escherichia coli and crystallized by the hanging-drop vapour-diffusion method using sodium acetate as precipitant at 283 K. The crystals diffracted to 2.7 A resolution and belonged to space group P4(3)2(1)2.
Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G
2013-08-01
Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.
Mesozoic clay diagenesis in the Appalachian Plateau
NASA Astrophysics Data System (ADS)
Boles, A.; Mulch, A.; van der Pluijm, B.
2017-12-01
Integrated investigation of authigenic clays in the Appalachian Plateau of the northeastern US Midcontinent using X-ray goniometry, Rietveld-method based illite polytype analysis, and 40Ar/39Ar geochronology yields novel insights about the structural diagenetic history of the North American sedimentary cover sequence. Texture analysis by High Resolution X-ray Texture Goniometry records the presence of a bedding-parallel diagenetic fabric, corresponding to a burial depth of 2-5 km. New development of polytype modeling using BGMN®, a quantitative X-ray powder diffraction forward modeling and whole-pattern matching program matches mineralic characteristic of illite at those depths and reduces uncertainty estimates in age analysis. Based on dating size fractions, the diagenetic age is constrained to 225-250 Ma (Triassic) by four authigenic illite samples, reflecting protracted, regional diagenesis in the area. Preliminary H isotopic analysis points to a surface-derived diagenetic fluid with δD values ranging from -48 to -72‰ (in the range of predicted Pangea meteoric fluid), with a dependence on proximity to the Appalachian Mountains that may reflect a rain shadow effect.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rathinaswamy, Priya; Pundle, Archana V.; Prabhune, Asmita A.
An unannotated protein reported from B. subtilis has been expressed in E. coli and identified as possessing penicillin V acylase activity. The crystallization and preliminary crystallographic analysis of this penicillin V acylase is presented. Penicillin acylase proteins are amidohydrolase enzymes that cleave penicillins at the amide bond connecting the side chain to their β-lactam nucleus. An unannotated protein from Bacillus subtilis has been expressed in Escherichia coli, purified and confirmed to possess penicillin V acylase activity. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 4 M sodium formate in 100 mM Tris–HCl buffer pH 8.2.more » Diffraction data were collected under cryogenic conditions to a spacing of 2.5 Å. The crystals belonged to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 111.0, b = 308.0, c = 56.0 Å. The estimated Matthews coefficient was 3.23 Å{sup 3} Da{sup −1}, corresponding to 62% solvent content. The structure has been solved using molecular-replacement methods with B. sphaericus penicillin V acylase (PDB code 2pva) as the search model.« less
Lu, Y; Zheng, Q; Lu, D; Ma, P; Chen, Y
1995-06-01
Crystal structures of two compounds from Tripterygium wilfordii Hook f. have been determined by X-ray diffraction method. Structure factors influencing melting point of solid state have been analysed. Crystal class (or space group), recrystallization solvent, force between molecules and fine changes of molecular structures will all cause melting point changes of crystal substance.
Paleoenvironmental Interpretation of drill core from Tugen Hills, Kenya through X-ray Diffraction
NASA Astrophysics Data System (ADS)
Minkara, K. E.; Rabideaux, N. M.; Deocampo, D.; Kingston, J.; Cohen, A. S.
2016-12-01
Paleoenvironmental reconstruction in regions of significant archeological and paleontological discoveries can be used to help better understand early hominin history in relation to environmental changes. Using X-ray diffraction (XRD) analysis of lacustrine sediments obtained from core material recovered during the Hominin Sites and Paleolakes Drilling Project (HSPDP) campaign at the Tugen Hills drilling site in central Kenya we can reconstruct a high-resolution record of paleoclimate and tectonics from the lake sediments during the Plio-Pleistocene. XRD analysis enables us to identify the mineralogical trends from the 227m core, which can be employed to understand the geochemical evolution of the basin. We want to test whether 23-kyr precessional cyclicity is the primary driver of environmental change at Lake Baringo, and how that change influenced vertebrate and hominin evolution. Our goals are to understand how the paleolake geochemically evolved over time and how the mineralogical characteristics are related to climate change. Preliminary results indicate discrete zones of carbonate and zeolite mineral occurrence, suggesting possible paleoclimate indicators of humidity versus aridity. Geochemical and sedimentological analysis will be required to distinguish primary lacustrine carbonate versus secondary or pedogenic carbonate, which does not carry a lacustrine signal. Quartz-rich intervals and diatomaceous sequences are distinct from zeolitic zones, suggesting variable salinities. Furthermore, hkl reflections of clay-rich bulk samples suggest varying relative abundances of kaolinite and smectite. As we extract clay fractions and analyze the clay mineralogy in further detail, this ratio may provide an indicator of paleoweathering intensity within the basin.
Mineralogy of Eolian Sands at Gale Crater
NASA Technical Reports Server (NTRS)
Achilles, C. N.; Vaniman, D. T.; Blake, D. F.; Bristow, T. F.; Rampe, E. B.; Ming, D. W.; Chipera, S. J.; Morris, R. V.; Morrison, S. M.; Downs, R. T.;
2016-01-01
The Mars Science Laboratory rover Curiosity has been exploring outcrop and regolith in Gale crater since August 6, 2012. During this exploration, the mission has collected 10 samples for mineralogical analysis by X-ray diffraction (XRD), using the CheMin instrument. The CheMin (Chemistry and Mineralogy) instrument on the Mars Science Laboratory rover Curiosity uses a CCD detector and a Co-anode tube source to acquire both mineralogy (from the pat-tern of Co diffraction) and chemical information (from energies of fluoresced X-rays). A detailed description of CheMin is provided in [1]. As part of the rover checkout after landing, the first sample selected for analysis was an eolian sand deposit (the Rocknest "sand shadow"). This sample was selected in part to characterize unconsolidated eolian regolith, but primarily to prove performance of the scoop collection system on the rover. The focus of the mission after Rocknest was on the consolidated sediments of Gale crater, so all of the nine subsequent samples were collected by drilling into bedrock com-posed of lithified sedimentary materials, including mudstone and sandstone. No scoop samples have been collected since Rocknest, but at the time this abstract was written the mission stands poised to use the scoop again, to collect active dune sands from the Bagnold dune field. Several abstracts at this conference outline the Bagnold dune campaign and summarize preliminary results from analyses on approach to the Namib dune sampling site. In this abstract we review the mineralogy of Rocknest, contrast that with the mineralogy of local sediments, and anticipate what will be learned by XRD analysis of Bagnold dune sands.
NASA Technical Reports Server (NTRS)
McAdam, A. C.; Mahaffy, P. R.; Blake, D. F.; Ming, D. W.; Franz, H. B.; Eigenbrode, J. L.; Steele, A.
2010-01-01
The 2009 Arctic Mars Analog Svalbard Expedition (AMASE) investigated several geologic settings using methodologies and techniques being developed or considered for future Mars missions, such as the Mars Science Laboratory (MSL), ExoMars, and Mars Sample Return (MSR). AMASE-related research comprises both analyses conducted during the expedition and further analyses of collected samples using laboratory facilities at a variety of institutions. The Sample Analysis at Mars (SAM) instrument suite, which will be part of the Analytical Laboratory on MSL, consists of a quadrupole mass spectrometer (QMS), a gas chromatograph (GC), and a tunable laser spectrometer (TLS). An Evolved Gas Analysis Mass Spectrometer (EGA-MS) was used during AMASE to represent part of the capabilities of SAM. The other instrument included in the MSL Analytical Laboratory is CheMin, which uses X-Ray Diffraction (XRD) and X-Ray Fluorescence (XRF) to perform quantitative mineralogical characterization of samples. Field-portable versions of CheMin were used during the AMASE 2009. Here, we discuss the preliminary interpretation of EGA and XRD analyses of selected AMASE carbonate samples and implications for mineralogical interpretations from MSL. Though CheMin will be the primary mineralogical tool on MSL, SAM EGA could be used to support XRD identifications or indicate the presence of volatile-bearing minerals which may be near or below XRD detection limits. Data collected with instruments in the field and in comparable laboratory setups (e.g., the SAM breadboard) will be discussed.
Bertacchini, Lucia; Durante, Caterina; Marchetti, Andrea; Sighinolfi, Simona; Silvestri, Michele; Cocchi, Marina
2012-08-30
Aim of this work is to assess the potentialities of the X-ray powder diffraction technique as fingerprinting technique, i.e. as a preliminary tool to assess soil samples variability, in terms of geochemical features, in the context of food geographical traceability. A correct approach to sampling procedure is always a critical issue in scientific investigation. In particular, in food geographical traceability studies, where the cause-effect relations between the soil of origin and the final foodstuff is sought, a representative sampling of the territory under investigation is certainly an imperative. This research concerns a pilot study to investigate the field homogeneity with respect to both field extension and sampling depth, taking also into account the seasonal variability. Four Lambrusco production sites of the Modena district were considered. The X-Ray diffraction spectra, collected on the powder of each soil sample, were treated as fingerprint profiles to be deciphered by multivariate and multi-way data analysis, namely PCA and PARAFAC. The differentiation pattern observed in soil samples, as obtained by this fast and non-destructive analytical approach, well matches with the results obtained by characterization with other costly analytical techniques, such as ICP/MS, GFAAS, FAAS, etc. Thus, the proposed approach furnishes a rational basis to reduce the number of soil samples to be collected for further analytical characterization, i.e. metals content, isotopic ratio of radiogenic element, etc., while maintaining an exhaustive description of the investigated production areas. Copyright © 2012 Elsevier B.V. All rights reserved.
Characterization of a bent Laue double-crystal beam-expanding monochromator
Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo; ...
2017-10-19
A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less
Characterization of a bent Laue double-crystal beam-expanding monochromator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo
A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui
2007-06-01
The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Worrall, Liam; Walkinshaw, Malcolm D., E-mail: m.walkinshaw@ed.ac.uk
Crystals of the C-terminal 10 kDa lid subdomain from the C. elegans chaperone Hsp70 have been obtained that diffract X-rays to ∼3.5 Å and belong to space group I2{sub 1}2{sub 1}2{sub 1}. Analysis of X-ray data and initial heavy-atom phasing reveals 24 monomers in the asymmetric unit related by 432 non-crystallographic symmetry. Hsp70 is an important molecular chaperone involved in the regulation of protein folding. Crystals of the C-terminal 10 kDa helical lid domain (residues 542–640) from a Caenorhabditis elegans Hsp70 homologue have been produced that diffract X-rays to ∼3.4 Å. Crystals belong to space group I2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = b = 197, c = 200 Å. The Matthews coefficient, self-rotation function and Patterson map indicate 24 monomers in the asymmetric unit, showing non-crystallographic 432 symmetry. Molecular-replacement studies using the corresponding domain from rat, the only eukaryotic homologue with a known structure, failed and a mercury derivative was obtained. Preliminary MAD phasing using SHELXD and SHARP for location and refinement of the heavy-atom substructure and SOLOMON for density modification produced interpretable maps with a clear protein–solvent boundary. Further density-modification, model-building and refinement are currently under way.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen
The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bacik, John-Paul; Brigley, Angela M.; Channon, Lisa D.
2005-06-01
Ectromelia virus glutaredoxin has been crystallized in the presence of the reducing agent DTT. A diffraction data set has been collected and processed to 1.8 Å resolution. Ectromelia, vaccinia, smallpox and other closely related viruses of the orthopoxvirus genus encode a glutaredoxin gene that is not present in poxviruses outside of this genus. The vaccinia glutaredoxin O2L has been implicated as the reducing agent for ribonucleotide reductase and may thus play an important role in viral deoxyribonucleotide synthesis. As part of an effort to understand nucleotide metabolism by poxviruses, EVM053, the O2L ortholog of the ectromelia virus, has been crystallized.more » EVM053 crystallizes in space group C222{sub 1}, with unit-cell parameters a = 61.98, b = 67.57, c = 108.55 Å. Diffraction data have been processed to 1.8 Å resolution and a self-rotation function indicates that there are two molecules per asymmetric unit.« less
Improving the performance of methylene blue sensitized photopolymer by doping with nickel ion
NASA Astrophysics Data System (ADS)
Aswathy, G.; Rajesh, C. S.; Sreekumar, K.; Joseph, R.; Kartha, C. Sudha
2016-05-01
Holographic performance of an economically cheap metal ion doped photopolymer material is presented. We investigated the effect of incorporation of nickel ion into the methylene blue sensitized poly (vinyl alcohol)/acrylamide (MBPVA/AA) photopolymer system. The composition and preliminary characterization of the developed photopolymer material is reported. The presence of nickel ion improves the diffraction efficiency, stability of the material and it operates in a wide range of spatial frequencies (550-2000 lines/mm) at exposure energy of 100 mJ/cm2. When nickel ion concentration was 0.01 mM, maximum diffraction efficiency of 84% at exposure energy of 100 mJ/cm2 with spatial frequency 1335 lines/mm could be achieved for gratings recorded using wavelength of 632.8 nm. The material showed panchromaticity with more than 70% diffraction efficiency in both blue and green regions. Effects of humidity and temperature on the stored gratings were studied by keeping films in different environmental conditions. Suitability of recording large area holograms was also explored.
Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro
2007-02-01
D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.
Thin film solar cell design based on photonic crystal and diffractive grating structures.
Mutitu, James G; Shi, Shouyuan; Chen, Caihua; Creazzo, Timothy; Barnett, Allen; Honsberg, Christiana; Prather, Dennis W
2008-09-15
In this paper we present novel light trapping designs applied to multiple junction thin film solar cells. The new designs incorporate one dimensional photonic crystals as band pass filters that reflect short light wavelengths (400 - 867 nm) and transmit longer wavelengths(867 -1800 nm) at the interface between two adjacent cells. In addition, nano structured diffractive gratings that cut into the photonic crystal layers are incorporated to redirect incoming waves and hence increase the optical path length of light within the solar cells. Two designs based on the nano structured gratings that have been realized using the scattering matrix and particle swarm optimization methods are presented. We also show preliminary fabrication results of the proposed devices.
Geandier, G; Thiaudière, D; Randriamazaoro, R N; Chiron, R; Djaziri, S; Lamongie, B; Diot, Y; Le Bourhis, E; Renault, P O; Goudeau, P; Bouaffad, A; Castelnau, O; Faurie, D; Hild, F
2010-10-01
We have developed on the DIFFABS-SOLEIL beamline a biaxial tensile machine working in the synchrotron environment for in situ diffraction characterization of thin polycrystalline films mechanical response. The machine has been designed to test compliant substrates coated by the studied films under controlled, applied strain field. Technological challenges comprise the sample design including fixation of the substrate ends, the related generation of a uniform strain field in the studied (central) volume, and the operations from the beamline pilot. Preliminary tests on 150 nm thick W films deposited onto polyimide cruciform substrates are presented. The obtained results for applied strains using x-ray diffraction and digital image correlation methods clearly show the full potentialities of this new setup.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jackson, Michael R.; Selby, Thomas L.
2012-10-30
A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.
Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony; Dattagupta, Jiban K.; Sen, Udayaditya
2006-01-01
A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P41, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, were found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V M value. PMID:16511326
A Preliminary Attempt at Sintering an Ultrafine Alumina Powder Using Microwaves
1994-09-01
and unusual properties [Ref. B4]. Dielectric properties of individual ceramic phases differ depending on parameters such as compositicn...useful parameter is an estimate of the amount of power dissipated into a dielectric with a known effective loss factor. For a high frequency electric...cavities, and their influence in ceramic samples must be considered. Therefore scattering, diffraction, interference, and reflection and refraction
Kim, Keon Young; Kim, Sunmin; Park, Jeong Kuk; Song, HyoJin; Park, SangYoun
2014-01-01
Full-length SigR from Streptomyces coelicolor A3(2) was overexpressed in Escherichia coli, purified and submitted to crystallization trials using either polyethylene glycol 3350 or 4000 as a precipitant. X-ray diffraction data were collected to 2.60 Å resolution under cryoconditions using synchrotron X-rays. The crystal packs in space group P43212, with unit-cell parameters a = b = 42.14, c = 102.02 Å. According to the Matthews coefficient, the crystal asymmetric unit cannot contain the full-length protein. Molecular replacement with the known structures of region 2 and region 4 as independent search models indicates that the crystal contains only the −35 element-binding carboxyl-terminal region 4 of full-length SigR. Mass-spectrometric analysis of the harvested crystal confirms this, suggesting a crystal volume per protein weight (V M) of 2.24 Å3 Da−1 and 45.1% solvent content. PMID:24915084
Morioka, Hideaki; Miki, Yasuhiro; Saito, Kei; Tomoo, Koji; Ishida, Toshimasa; Hasegawa, Tomokazu; Yamano, Akihito; Takada, Chiaki; Miyamoto, Katsushiro; Tsujibo, Hiroshi
2010-07-01
BxlA from Streptomyces thermoviolaceus OPC-520, together with the extracellular BxlE and the integral membrane proteins BxlF and BxlG, constitutes a xylanolytic system that participates in the intracellular transport of xylan-degradation products and the production of xylose. To elucidate the mechanism of the hydrolytic degradation of xylooligosaccharides to xylose at the atomic level, X-ray structural analysis of BxlA was attempted. The recombinant BxlA protein (molecular weight 82 kDa) was crystallized by the hanging-drop vapour-diffusion method at 289 K. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 142.2, b = 129.5, c = 101.4 A, beta = 119.8 degrees , and contained two molecules per asymmetric unit (V(M) = 2.47 A(3) Da(-1)). Diffraction data were collected to a resolution to 2.50 A and provided a data set with an overall R(merge) of 8.3%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vivian, J. P.; Porter, C.; Wilce, J. A.
2006-11-01
A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pyburn, Tasia M.; Yankovskaya, Victoria; Bensing, Barbara A.
2012-07-11
The carbohydrate-binding region of the bacterial adhesin GspB from Streptococcus gordonii strain M99 (GspB{sub BR}) was expressed in Escherichia coli and purified using affinity and size-exclusion chromatography. Separate sparse-matrix screening of GspB{sub BR} buffered in either 20 mM Tris pH 7.4 or 20 mM HEPES pH 7.5 resulted in different crystallographic behavior such that different precipitants, salts and additives supported crystallization of GspB{sub BR} in each buffer. While both sets of conditions supported crystal growth in space group P2{sub 1}2{sub 1}2{sub 1}, the crystals had distinct unit-cell parameters of a = 33.3, b = 86.7, c = 117.9 {angstrom} formore » crystal form 1 and a = 34.6, b = 98.3, c = 99.0 {angstrom} for crystal form 2. Additive screening improved the crystals grown in both conditions such that diffraction extended to beyond 2 {angstrom} resolution. A complete data set has been collected to 1.3 {angstrom} resolution with an overall R{sub merge} value of 0.04 and an R{sub merge} value of 0.33 in the highest resolution shell.« less
Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki
2015-06-01
Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.
Campos, Bruna Medeia; Liberato, Marcelo Vizona; Polikarpov, Igor; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio
2015-03-01
In recent years, biofuels have attracted great interest as a source of renewable energy owing to the growing global demand for energy, the dependence on fossil fuels, limited natural resources and environmental pollution. However, the cost-effective production of biofuels from plant biomass is still a challenge. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases to polysaccharides, is crucial for enzyme development. Aiming at the structural and functional characterization of novel CBMs involved in plant polysaccharide deconstruction, an analysis of the CAZy database was performed and CBM family 64 was chosen owing to its capacity to bind with high specificity to microcrystalline cellulose and to the fact that is found in thermophilic microorganisms. In this communication, the CBM-encoding module named StX was expressed, purified and crystallized, and X-ray diffraction data were collected from native and derivatized crystals to 1.8 and 2.0 Å resolution, respectively. The crystals, which were obtained by the hanging-drop vapour-diffusion method, belonged to space group P3121, with unit-cell parameters a = b = 43.42, c = 100.96 Å for the native form. The phases were found using the single-wavelength anomalous diffraction method.
Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian Peter
2014-01-01
Ergothioneine is an amino-acid betaine derivative of histidine that was discovered more than one century ago. Despite significant research pointing to a function in oxidative stress defence, the exact mechanisms of action of ergothioneine remain elusive. Although both humans and bacterial pathogens such as Mycobacterium tuberculosis seem to depend on ergothioneine, humans are devoid of the corresponding biosynthetic enzymes. Therefore, its biosynthesis may emerge as potential drug target in the development of novel therapeutics against tuberculosis. The recent identification of ergothioneine-biosynthetic genes in M. smegmatis enables a more systematic study of its biology. The pathway is initiated by EgtD, a SAM-dependent methyltransferase that catalyzes a trimethylation reaction of histidine to give N(α),N(α),N(α)-trimethylhistidine. Here, the recombinant production, purification and crystallization of EgtD are reported. Crystals of native EgtD diffracted to 2.35 Å resolution at a synchrotron beamline, whereas crystals of seleno-l-methionine-labelled protein diffracted to 1.75 Å resolution and produced a significant anomalous signal to 2.77 Å resolution at the K edge. All of the crystals belonged to space group P212121, with two EgtD monomers in the asymmetric unit. PMID:24817736
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Hyun Ho; Tookes, Hansel Emory; Wu, Hao, E-mail: haowu@med.cornell.edu
2006-06-01
The D. melanogaster Drep-3 protein has been crystallized. Crystals were obtained at 293 K that diffracted to 2.8 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}. During apoptosis, DNA fragmentation is mainly mediated by the caspase-activated DFF40 nuclease. DFF40 exists as a heterodimeric complex with its inhibitor DFF45. Upon apoptosis induction, DFF45 is cleaved by caspases to allow DFF40 activation. Drep-3 is a recently identified regulator of the DFF40 system in Drosophila melanogaster. Here, Drep-3 was expressed with a C-terminal His tag in Escherichia coli and the protein was purified to homogeneity. Multi-angle light-scattering analysis showed thatmore » Drep-3 is a homotetramer in solution. Native and selenomethionine-substituted Drep-3 proteins were crystallized at 293 K and X-ray diffraction data were collected to 2.8 and 3.0 Å resolution, respectively. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 56.9, b = 125.4, c = 168.7 Å. The asymmetric unit is estimated to contain one homotetramer.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marland, Zara; Beddoe, Travis; Zaker-Tabrizi, Leyla
2005-12-01
A lipoprotein implicated in mycobacterial cell-wall biosynthesis, LpqW, was expressed in E. coli. Crystals were obtained that diffracted to 2.4 Å resolution. Mycobacterium tuberculosis is a renewed cause of devastation in the developing world. Critical to the success of this re-emerging pathogen is its unusual waxy cell wall, which is rich in rare components including lipoarabinomannan (LAM) and its precursors, the phosphatidylinositol mannosides (PIMs). Balanced synthesis of these related glycolipids is intrinsic to both cell-wall integrity and virulence in M. tuberculosis and presents a promising, albeit poorly defined, therapeutic target. Here, the expression, purification and crystallization of an essential 600-amino-acidmore » lipoprotein, LpqW, implicated in this process are reported. Crystals of LpqW were grown using 20–24%(w/v) PEG 4000, 8–16%(v/v) 2-propanol, 100 mM sodium citrate pH 5.5 and 10 mM DTT. A complete data set was collected at 2.4 Å using synchrotron radiation on a crystal belonging to space group C222, with unit-cell parameters a = 188.57, b = 312.04, c = 104.15 Å. Structure determination is under way.« less
Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus
Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko
2013-01-01
Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P212121, with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å. PMID:23295485
Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus.
Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko
2013-01-01
Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å.
NASA Astrophysics Data System (ADS)
Mrozek, S. A.; Buck, B. J.; Brock, A. L.
2004-12-01
Las Vegas, Nevada is one of the fastest growing cities in the United States. Faced with water restrictions, decorative rock xeroscaping has become a very popular form of landscaping. Currently, there are no regulations controlling the geochemistry of the decorative rocks that can be used for these purposes. In this study, we examined three sites containing two different decorative rock products. The landscaping rocks, underlying soil, and surface salt crusts were analyzed to determine their mineralogy and chemistry. Methods of analysis include scanning electron microscopy (SEM), energy dispersive X-ray spectrometry (EDS), X-ray diffraction (XRD), inductively coupled plasma atomic emission spectroscopy (ICP), thin section analysis, and laser particle size analysis (LPSA). Preliminary results indicate the presence of halite (NaCl), bloedite (Na2Mg(SO4)2 4H2O), a hydrated magnesium sulfate, and possibly copper sulfate and copper chloride mineral phases in the surface salt crusts. Both copper minerals are regarded as hazardous substances by the Occupational Safety and Health Administration (OSHA) and the Environmental Protection Agency (EPA); these agencies have established minimum exposure limits for human contact with these substances. Copper sulfate and copper chloride are not naturally occurring minerals in the soils of the Las Vegas Valley, and analyses indicate that their formation may be attributed to the mineralogy of the decorative landscaping rocks. Further testing is needed to characterize this potential health hazard; however the preliminary results of this study demonstrate the need for regulations controlling the geochemistry of decorative rocks used for urban landscaping.
Purification, crystallization and preliminary X-ray diffraction of human S100A15
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boeshans, Karen M.; Wolf, Ronald; Voscopoulos, Christopher
2006-05-01
S100 proteins are differentially expressed during epithelial cell maturation, tumorigenesis and inflammation. The novel human S100A15 protein has been cloned, expressed, purified and crystallized in two crystal forms, a triclinic and a monoclinic form, which diffract to 1.7 and 2.0 Å, respectively. Human S100A15 is a novel member of the S100 family of EF-hand calcium-binding proteins and was recently identified in psoriasis, where it is significantly upregulated in lesional skin. The protein is implicated as an effector in calcium-mediated signal transduction pathways. Although its biological function is unclear, the association of the 11.2 kDa S100A15 with psoriasis suggests that itmore » contributes to the pathogenesis of the disease and could provide a molecular target for therapy. To provide insight into the function of S100A15, the protein was crystallized to visualize its structure and to further the understanding of how the many similar calcium-binding mediator proteins in the cell distinguish their cognate target molecules. The S100A15 protein has been cloned, expressed and purified to homogeneity and produced two crystal forms. Crystals of form I are triclinic, with unit-cell parameters a = 33.5, b = 44.3, c = 44.8 Å, α = 71.2, β = 68.1, γ = 67.8° and an estimated two molecules in the asymmetric unit, and diffract to 1.7 Å resolution. Crystals of form II are monoclinic, with unit-cell parameters a = 82.1, b = 33.6, c = 52.2 Å, β = 128.2° and an estimated one molecule in the asymmetric unit, and diffract to 2.0 Å resolution. This structural analysis of the human S100A15 will further aid in the phylogenic comparison between the other members of the S100 protein family, especially the highly homologous paralog S100A7.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Galeša, Katja; Brzin, Jože; Sabotič, Jerica
2006-01-01
Clitocypin is a cysteine protease inhibitor from the mushroom Clitocybe nebularis. The protein has been purified from natural sources and crystallized in a variety of non-isomorphous forms belonging to monoclinic and triclinic space groups. Clitocypin is a cysteine protease inhibitor from the mushroom Clitocybe nebularis. The protein has been purified from natural sources and crystallized in a variety of non-isomorphous forms belonging to monoclinic and triclinic space groups. A diffraction data set to 1.55 Å resolution was obtained from a crystal belonging to space group P2, with unit-cell parameters a = 38.326, b = 33.597, c = 55.568 Å, βmore » = 104°. An inability to achieve isomorphism forced the use of MAD and SAD phasing methods. Phasing is in progress.« less
Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S
2003-10-01
Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.
Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki
2007-09-01
Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sayer, Christopher; Isupov, Michail N.; Littlechild, Jennifer A., E-mail: j.a.littlechild@exeter.ac.uk
2007-02-01
An ω-amino acid:pyruvate transaminase from C. violaceum has been purified and crystallized in two crystal forms. The structure has been solved using molecular replacement. The enzyme ω-transaminase catalyses the conversion of chiral ω-amines to ketones. The recombinant enzyme from Chromobacterium violaceum has been purified to homogeneity. The enzyme was crystallized from PEG 4000 using the microbatch method. Data were collected to 1.7 Å resolution from a crystal belonging to the triclinic space group P1, with unit-cell parameters a = 58.9, b = 61.9, c = 63.9 Å, α = 71.9, β = 87.0, γ = 74.6°. Data were also collectedmore » to 1.95 Å from a second triclinic crystal form. The structure has been solved using the molecular-replacement method.« less
Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu
Kondou, Youhei; Kitazawa, Daisuke; Takeda, Shigeki; Yamashita, Eiki; Mizuguchi, Mineyuki; Kawano, Keiichi; Tsukihara, Tomitake
2005-01-01
Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-rays to at least 2.1 Å resolution and are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan. PMID:16508104
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke
2007-08-01
Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke
2007-01-01
Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368
Chen, Shang-ke; Wang, Kui; Liu, Yuhuan; Hu, Xiaopeng
2012-01-01
Feruloyl esterase cleaves the ester linkage formed between ferulic acid and polysaccharides in plant cell walls and thus has wide potential industrial applications. A novel feruloyl esterase (EstF27) identified from a soil metagenomic library was crystallized and a complete data set was collected from a single cooled crystal using an in-house X-ray source. The crystal diffracted to 2.9 Å resolution and belonged to space group P212121, with unit-cell parameters a = 94.35, b = 106.19, c = 188.51 Å, α = β = γ = 90.00°. A Matthews coefficient of 2.55 Å3 Da−1, with a corresponding solvent content of 51.84%, suggested the presence of ten protein subunits in the asymmetric unit. PMID:22750860
Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin
2013-04-01
Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.
Brito, José A.; Gutierres, André; Denkmann, Kevin; Dahl, Christiane; Archer, Margarida
2014-01-01
The ability to perform the very simple oxidation of two molecules of thiosulfate to tetrathionate is widespread among prokaryotes. Despite the prevalent occurrence of tetrathionate formation and its well documented significance within the sulfur cycle, little is known about the enzymes that catalyze the oxidative condensation of two thiosulfate anions. To fill this gap, the thiosulfate dehydrogenase (TsdA) enzyme from the purple sulfur bacterium Allochromatium vinosum was recombinantly expressed in Escherichia coli, purified and crystallized, and a crystallographic data set was collected. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 79.2, b = 69.9, c = 57.9 Å, β = 129.3°, contained one monomer per asymmetric unit and diffracted to a resolution of 1.98 Å. PMID:25286955
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshida, Ayako; Tomita, Takeo; Kuzuyama, Tomohisa
2007-02-01
To elucidate the mechanism of regulation of aspartate kinase, the regulatory subunit (the β subunit of T. thermophilus aspartate kinase) was crystallized in the presence of the inhibitor threonine. Aspartate kinase (AK) from Thermus thermophilus, which catalyzes the first step of threonine and methionine biosynthesis, is regulated via feedback inhibition by the end product threonine. To elucidate the mechanism of regulation of AK, the regulatory subunit (the β subunit of T. thermophilus AK) was crystallized in the presence of the inhibitor threonine. Diffraction data were collected to 2.15 Å at a synchrotron source. The crystal belongs to the cubic spacemore » group P4{sub 3}32 or P4{sub 1}32, with unit-cell parameters a = b = c = 141.8 Å.« less
Hayashi, Shintaro; Akiyama, Tomonori; Sagane, Yoshimasa; Miyashita, Shin-Ichiro; Watanabe, Toshihiro; Yajima, Shunsuke; Niwa, Koichi
2014-03-01
The botulinum toxin complex, the causative agent of botulism, passes through the intestinal wall via sugar-chain-dependent cell binding of a haemagglutinin of 33 kDa molecular weight (HA-33). The amino-acid sequence of the C-terminal half of HA-33 of the serotype C strain Yoichi (C-Yoichi) shares only 46% identity with those of the major serotype C strains. Additionally, C-Yoichi HA-33 exhibits a unique sugar-binding specificity. In the present work, C-Yoichi HA-33 was expressed in Escherichia coli and crystallized. Diffraction data were collected at a resolution of 2.2 Å. The crystals belonged to space group R3. The complete detailed protein structure will yield insight into how the unique HA-33 protein recognizes sugar moieties.
Djeghader, Ahmed; Gotthard, Guillaume; Suh, Andrew; Gonzalez, Daniel; Scott, Ken; Chabriere, Eric; Elias, Mikael
2013-01-01
In prokaryotes, phosphate starvation induces the expression of numerous phosphate-responsive genes, such as the pst operon including the high-affinity phosphate-binding protein (PBP or pstS) and alkaline phosphatases such as PhoA. This response increases the cellular inorganic phosphate import efficiency. Notably, some Pseudomonas species secrete, via a type-2 secretion system, a phosphate-binding protein dubbed LapA endowed with phosphatase activity. Here, the expression, purification, crystallization and X-ray data collection at 0.87 Å resolution of LapA are described. Combined with biochemical and enzymatic characterization, the structure of this intriguing phosphate-binding protein will help to elucidate the molecular origin of its phosphatase activity and to decipher its putative role in phosphate uptake. PMID:24100568
High-resolution electron microscopy and its applications.
Li, F H
1987-12-01
A review of research on high-resolution electron microscopy (HREM) carried out at the Institute of Physics, the Chinese Academy of Sciences, is presented. Apart from the direct observation of crystal and quasicrystal defects for some alloys, oxides, minerals, etc., and the structure determination for some minute crystals, an approximate image-contrast theory named pseudo-weak-phase object approximation (PWPOA), which shows the image contrast change with crystal thickness, is described. Within the framework of PWPOA, the image contrast of lithium ions in the crystal of R-Li2Ti3O7 has been observed. The usefulness of diffraction analysis techniques such as the direct method and Patterson method in HREM is discussed. Image deconvolution and resolution enhancement for weak-phase objects by use of the direct method are illustrated. In addition, preliminary results of image restoration for thick crystals are given.
Adequacy of laser diffraction for soil particle size analysis
Fisher, Peter; Aumann, Colin; Chia, Kohleth; O'Halloran, Nick; Chandra, Subhash
2017-01-01
Sedimentation has been a standard methodology for particle size analysis since the early 1900s. In recent years laser diffraction is beginning to replace sedimentation as the prefered technique in some industries, such as marine sediment analysis. However, for the particle size analysis of soils, which have a diverse range of both particle size and shape, laser diffraction still requires evaluation of its reliability. In this study, the sedimentation based sieve plummet balance method and the laser diffraction method were used to measure the particle size distribution of 22 soil samples representing four contrasting Australian Soil Orders. Initially, a precise wet riffling methodology was developed capable of obtaining representative samples within the recommended obscuration range for laser diffraction. It was found that repeatable results were obtained even if measurements were made at the extreme ends of the manufacturer’s recommended obscuration range. Results from statistical analysis suggested that the use of sample pretreatment to remove soil organic carbon (and possible traces of calcium-carbonate content) made minor differences to the laser diffraction particle size distributions compared to no pretreatment. These differences were found to be marginally statistically significant in the Podosol topsoil and Vertosol subsoil. There are well known reasons why sedimentation methods may be considered to ‘overestimate’ plate-like clay particles, while laser diffraction will ‘underestimate’ the proportion of clay particles. In this study we used Lin’s concordance correlation coefficient to determine the equivalence of laser diffraction and sieve plummet balance results. The results suggested that the laser diffraction equivalent thresholds corresponding to the sieve plummet balance cumulative particle sizes of < 2 μm, < 20 μm, and < 200 μm, were < 9 μm, < 26 μm, < 275 μm respectively. The many advantages of laser diffraction for soil particle size analysis, and the empirical results of this study, suggest that deployment of laser diffraction as a standard test procedure can provide reliable results, provided consistent sample preparation is used. PMID:28472043
NASA Astrophysics Data System (ADS)
Goharipour, Muhammad; Khanpour, Hamzeh; Guzey, Vadim
2018-04-01
We present GKG18-DPDFs, a next-to-leading order (NLO) QCD analysis of diffractive parton distribution functions (diffractive PDFs) and their uncertainties. This is the first global set of diffractive PDFs determined within the xFitter framework. This analysis is motivated by all available and most up-to-date data on inclusive diffractive deep inelastic scattering (diffractive DIS). Heavy quark contributions are considered within the framework of the Thorne-Roberts (TR) general mass variable flavor number scheme (GM-VFNS). We form a mutually consistent set of diffractive PDFs due to the inclusion of high-precision data from H1/ZEUS combined inclusive diffractive cross sections measurements. We study the impact of the H1/ZEUS combined data by producing a variety of determinations based on reduced data sets. We find that these data sets have a significant impact on the diffractive PDFs with some substantial reductions in uncertainties. The predictions based on the extracted diffractive PDFs are compared to the analyzed diffractive DIS data and with other determinations of the diffractive PDFs.
Hybrid Modes in Long Wavelength Free Electron Lasers
2010-12-01
response, including the time for reviewing instruction, searching existing data sources, gathering and maintaining the data needed, and completing and...diffraction along one axis, allowing free space diffraction along the other axis. We continue the analysis of the relativistic electron beam, co-propagating...control diffraction along one axis, allowing free space diffraction along the other axis. We continue the analysis of the relativistic electron beam, co
Phasor Analysis of Binary Diffraction Gratings with Different Fill Factors
ERIC Educational Resources Information Center
Martinez, Antonio; Sanchez-Lopez, Ma del Mar; Moreno, Ignacio
2007-01-01
In this work, we present a simple analysis of binary diffraction gratings with different slit widths relative to the grating period. The analysis is based on a simple phasor technique directly derived from the Huygens principle. By introducing a slit phasor and a grating phasor, the intensity of the diffracted orders and the grating's resolving…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman
2007-02-01
DHNA synthetase from G. kaustophilus has been cloned, expressed, purified and crystallized. The aerobic Gram-positive bacterium Geobacillus kaustophilus is a bacillus species that was isolated from deep-sea sediment from the Mariana Trench. 1,4-Dihydroxy-2-naphthoate (DHNA) synthetase plays a vital role in the biosynthesis of menaquinone (vitamin K{sub 2}) in this bacterium. DHNA synthetase from Geobacillus kaustophilus was crystallized in the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 77.01, b = 130.66, c = 131.69 Å. The crystal diffracted to a resolution of 2.2 Å. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetricmore » unit.« less
Preliminary neutron and X-ray crystallographic studies of equine cyanomethemoglobin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kovalevsky, A.Y.; Fisher, S.Z.; Seaver, S.
2010-08-18
Room-temperature and 100 K X-ray and room-temperature neutron diffraction data have been measured from equine cyanomethemoglobin to 1.7 {angstrom} resolution using a home source, to 1.6 {angstrom} resolution on NE-CAT at the Advanced Photon Source and to 2.0 {angstrom} resolution on the PCS at Los Alamos Neutron Science Center, respectively. The cyanomethemoglobin is in the R state and preliminary room-temperature electron and neutron scattering density maps clearly show the protonation states of potential Bohr groups. Interestingly, a water molecule that is in the vicinity of the heme group and coordinated to the distal histidine appears to be expelled from thismore » site in the low-temperature structure.« less
Fast and accurate focusing analysis of large photon sieve using pinhole ring diffraction model.
Liu, Tao; Zhang, Xin; Wang, Lingjie; Wu, Yanxiong; Zhang, Jizhen; Qu, Hemeng
2015-06-10
In this paper, we developed a pinhole ring diffraction model for the focusing analysis of a large photon sieve. Instead of analyzing individual pinholes, we discuss the focusing of all of the pinholes in a single ring. An explicit equation for the diffracted field of individual pinhole ring has been proposed. We investigated the validity range of this generalized model and analytically describe the sufficient conditions for the validity of this pinhole ring diffraction model. A practical example and investigation reveals the high accuracy of the pinhole ring diffraction model. This simulation method could be used for fast and accurate focusing analysis of a large photon sieve.
NASA Astrophysics Data System (ADS)
Lassoued, Mohamed Saber; Abdelbaky, Mohammed S. M.; Lassoued, Abdelmajid; Gadri, Abdellatif; Ammar, Salah; Ben Salah, Abdelhamid; García-Granda, Santiago
2017-08-01
The present paper reports the synthesis of a single crystal of a new organic-inorganic hybrid compound, with the formula (C6H14N2) CdCl4·H2O, by slow evaporation method at room temperature. It was characterized by single crystal X-ray diffraction (SCXRD), powder X-ray diffraction (PXRD), Hirshfeld surface, spectroscopy measurement, thermal study and photoluminescence (PL) properties. A preliminary SCXRD structural analysis revealed that it crystallized in the monoclinic system (space group P21/c) with the following unit cell parameters: a = 12.95823(16) Å, b = 14.92449(16) Å, c = 7.13838(9) Å and β = 103.2108(12)° with Z = 4. The refinement converged to R = 0.0164 and ωR = 0.0393. Its atomic arrangement can be described as an alternation of organic and inorganic layers along the a-axis. The crystal packing was governed by the N-H⋯Cl and O-H⋯Cl hydrogen bonding interaction between the 1.2-diammoniumcyclohexane cations, the [CdCl42n-]n anions and water molecule. The Hirshfeld surface analysis was conducted to investigate intermolecular interactions and associated 2D fingerprint plots, revealing the relative contribution of these interactions in the crystal structure quantitatively. Furthermore, the room temperature infrared (IR) spectrum of the title compound was recorded and analyzed on the basis of data found in the literature. Besides, the thermal analysis studies were performed, but no phase transition was found in the temperature range between 30 and 450 °C. The optical and PL properties of the compound were investigated in the solid state at room temperature and exhibited three bands at 225, 268 and 315 nm and a strong fluorescence at 443 nm.
Experimental Studies of Elementary Particle Interactions at High Energies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goulianos, Konstantin
This is the final report of a program of research on "Experimental Studies of Elementary Particle Interactions at High Energies'' of the High Energy Physics (HEP) group of The Rockefeller University. The research was carried out using the Collider Detector at Fermilab (CDF) and the Compact Muon Solenoid (CMS) detector at the Large Hadron Collider (LHC) at CERN. Three faculty members, two research associates, and two postdoctoral associates participated in this project. At CDF, we studied proton-antiproton collisions at an energy of 1.96 TeV. We focused on diffractive interactions, in which the colliding antiproton loses a small fraction of itsmore » momentum, typically less than 1%, while the proton is excited into a high mass state retaining its quantum numbers. The study of such collisions provides insight into the nature of the diffractive exchange, conventionally referred to as Pomeron exchange. In studies of W and Z production, we found results that point to a QCD-based interpretation of the diffractive exchange, as predicted in a data-driven phenomenology developed within the Rockefeller HEP group. At CMS, we worked on diffraction, supersymmetry (SUSY), dark matter, large extra dimensions, and statistical applications to data analysis projects. In diffraction, we extended our CDF studies to higher energies working on two fronts: measurement of the single/double diffraction and of the rapidity gap cross sections at 7 TeV, and development of a simulation of diffractive processes along the lines of our successful model used at CDF. Working with the PYTHIA8 Monte Carlo simulation authors, we implemented our model as a PYTHIA8-MBR option in PYTHIA8 and used it in our data analysis. Preliminary results indicate good agreement. We searched for SUSY by measuring parameters in the Constrained Minimal Supersymmetric extension of the Standard Model (CMSSM) and found results which, combined with other experimental constraints and theoretical considerations, indicate that the CMSSM is not a viable model. Expressing our results in terms of simple topologies, we exclude squark masses below 0.75 TeV and gluino masses below 1.1 TeV. Astrophysical measurements suggest that about 80% of the matter density of the Universe is non-luminous. One of the theories on dark matter attributes it to Weakly Interacting Massive Particles (WIMPs). We searched for WIMPs in 7 TeV and 8 TeV collisions at CMS and set limits on WIMP production rates, which are competitive and complementary to those of direct detection experiments. Searching for monojets (events with only one jet), which in a popular model could be produced by a jet paired by a gravitino that escapes into extra dimensions, we significantly improved the previously set limit. Our results have been used to set limits on Higgs decay to invisible particles and on production of top squarks in compressed SUSY scenarios. Statistics. We computed Bayesian reference priors for several types of measurement and used them in the analysis of CMS data; investigated the applicability of bootstrap methods to HEP measurements; studied several issues associated with simple-versus-simple hypothesis testing and applied the resulting methods to the measurement of some properties of the top quark and Higgs boson.« less
Type I and type II residual stress in iron meteorites determined by neutron diffraction measurements
NASA Astrophysics Data System (ADS)
Caporali, Stefano; Pratesi, Giovanni; Kabra, Saurabh; Grazzi, Francesco
2018-04-01
In this work we present a preliminary investigation by means of neutron diffraction experiment to determine the residual stress state in three different iron meteorites (Chinga, Sikhote Alin and Nantan). Because of the very peculiar microstructural characteristic of this class of samples, all the systematic effects related to the measuring procedure - such as crystallite size and composition - were taken into account and a clear differentiation in the statistical distribution of residual stress in coarse and fine grained meteorites were highlighted. Moreover, the residual stress state was statistically analysed in three orthogonal directions finding evidence of the existence of both type I and type II residual stress components. Finally, the application of von Mises approach allowed to determine the distribution of type II stress.
Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki
2007-01-01
BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abramchik, Yu. A., E-mail: inna@ns.crys.ras.ru; Timofeev, V. I., E-mail: espiov@ibch.ru; Zhukhlistova, N. E., E-mail: tostars@mail.ru
2015-07-15
Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamermore » is the biological active form of E. coli. purine nucleoside phosphorylase.« less
Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro
2007-01-01
d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-psicose has not been reported with epimerases other than P. cichorii D-TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-04-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-01-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geandier, G.; Synchrotron SOLEIL, L'Orme des Merisiers, BP 48, 91192 Gif sur Yvette; LPMTM, UPR 9001 CNRS, Universite Paris-Nord, 93430 Villetaneuse
2010-10-15
We have developed on the DIFFABS-SOLEIL beamline a biaxial tensile machine working in the synchrotron environment for in situ diffraction characterization of thin polycrystalline films mechanical response. The machine has been designed to test compliant substrates coated by the studied films under controlled, applied strain field. Technological challenges comprise the sample design including fixation of the substrate ends, the related generation of a uniform strain field in the studied (central) volume, and the operations from the beamline pilot. Preliminary tests on 150 nm thick W films deposited onto polyimide cruciform substrates are presented. The obtained results for applied strains usingmore » x-ray diffraction and digital image correlation methods clearly show the full potentialities of this new setup.« less
Dollberg, D D; Bolyard, M L; Smith, D L
1986-03-01
This investigation has shown that crystalline silica has been identified as being present in the Mount St. Helens volcanic ash at levels of 3 to 7 per cent by weight. This identification has been established using X-ray powder diffraction, infrared spectrophotometry, visible spectrophotometry, electron microscopy, and Laser Raman spectrophotometry. Quantitative analysis by IR, XRD, and visible spectrophotometry requires a preliminary phosphoric acid digestion of the ash sample to remove the plagioclase silicate material which interferes with the determination by these methods. Electron microscopic analysis as well as Laser Raman spectrophotometric analysis of the untreated ash confirms the presence of silica and at levels found by the XRD and IR analysis of the treated samples. An interlaboratory study of volcanic ash samples by 15 laboratories confirms the presence and levels of crystalline silica. Although several problems with applying the digestion procedure were observed in this hastily organized supply, all laboratories employing the digestion procedure reported the presence of crystalline silica. These results unequivocally put to rest the question of the presence of silica in the volcanic ash from eruptions of Mount St. Helens in 1980.
NASA Astrophysics Data System (ADS)
Costa, M.; Benseny-Cases, N.; Cócera, M.; Teixeira, C. V.; Alsina, M.; Cladera, J.; López, O.; Fernández, M.; Sabés, M.
In previous chapters, the basis of SAXS for the study of biological systems like proteins in solution have been presented. The SAXS patterns of proteins in solution present, in general, broad dependences with the scattering vector, and the interpretation requires a huge component of modelling. In this chapter and in the following one, it is shown how SAXS technique can be used to study biological systems that are partially crystalline and with a large crystalline cells. This is done by analysing the diffraction obtained from these systems at small angles. In this chapter, a new approach to the application of small-angle X-ray scattering (SAXS) for diagnosis using the diffraction pattern of collagen is presented. This chapter shows the development of a new strategy in the preventive diagnosis of breast cancer following changes on collagen from breast connective tissue. SAXS profiles are related to different features in cutaneous preparations and to the supra-molecular arrangement of skin layers (stratum corneum, epidermis and dermis), in order to introduce objective values on the diagnosis of different skin pathologies. Working parameters (size, thickness) and methods (freezing, paraffin embedment) have been established. The results suggest that collagen diffraction patterns could be used as diagnostic indicators; especially for breast cancer and preliminary results obtained with skin collagen are promising too.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taguchi, Chiho; Quantum Beam Science Directorate, Japan Atomic Energy Agency; Taura, Futoshi
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b =more » 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.« less
Structural studies on Pax-8 Prd domain/DNA complex.
Campagnolo, M; Pesaresi, A; Zelezetsky, I; Geremia, S; Randaccio, L; Bisca, A; Tell, G
2007-04-01
Pax-8 is a member of the Pax family of transcription factors and is essential in the development of thyroid follicular cells. Pax-8 has two DNA-binding domains: the paired domain and the homeo domain. In this study, a preliminary X-ray diffraction analysis of the mammalian Pax-8 paired domain in complex with the C-site of the thyroglobulin promoter was achieved. The Pax-8 paired domain was crystallized by the hanging-drop vapor-diffusion method in complex with both a blunt-ended 26 bp DNA fragment and with a sticky-ended 24 bp DNA fragment with two additional overhanging bases. Crystallization experiments make clear that the growth of transparent crystals with large dimensions and regular shape is particularly influenced by ionic strength. The crystals of Pax-8 complex with blunt-ended and sticky-ended DNA, diffracted synchrotron radiation to 6.0 and 8.0 A resolution and belongs both to the C centered monoclinic system with cell dimensions: a = 89.88 A, b = 80.05 A, c = 67.73 A, and beta = 124.3 degrees and a = 256.56, b = 69.07, c = 99.32 A, and beta = 98.1 degrees , respectively. Fluorescence experiments suggest that the crystalline disorder, deduced by the poor diffraction, can be attributed to the low homogeneity of the protein-DNA sample. The theoretical comparative model of the Pax-8 paired domain complexed with the C-site of the thyroglobulin promoter shows the probable presence of some specific protein-DNA interactions already observed in other Pax proteins and the important role of the cysteine residues of PAI subdomain in the redox control of the DNA recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie
2008-04-01
Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less
Neutron detectors for the ESS diffractometers
NASA Astrophysics Data System (ADS)
Stefanescu, I.; Christensen, M.; Fenske, J.; Hall-Wilton, R.; Henry, P. F.; Kirstein, O.; Müller, M.; Nowak, G.; Pooley, D.; Raspino, D.; Rhodes, N.; Šaroun, J.; Schefer, J.; Schooneveld, E.; Sykora, J.; Schweika, W.
2017-01-01
The ambitious instrument suite for the future European Spallation Source whose civil construction started recently in Lund, Sweden, demands a set of diverse and challenging requirements for the neutron detectors. For instance, the unprecedented high flux expected on the samples to be investigated in neutron diffraction or reflectometry experiments requires detectors that can handle high counting rates, while the investigation of sub-millimeter protein crystals will only be possible with large-area detectors that can achieve a position resolution as low as 200 μm. This has motivated an extensive research and development campaign to advance the state-of-the-art detector and to find new technologies that can reach maturity by the time the ESS will operate at full potential. This paper presents the key detector requirements for three of the Time-of-Flight (TOF) diffraction instrument concepts selected by the Scientific Advisory Committee to advance into the phase of preliminary engineering design. We discuss the detector technologies commonly employed at the existing similar instruments and their major challenges for ESS. The detector technologies selected by the instrument teams to collect the diffraction patterns are also presented. Analytical calculations, Monte-Carlo simulations, and real experimental data are used to develop a generic method to estimate the event rate in the diffraction detectors. We apply this method to make predictions for the future diffraction instruments, and thus provide additional information that can help the instrument teams with the optimisation of the detector designs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zou, Peijian; Institute of Structural Biology, Helmholtz Zentrum München, Ingolstädter Landstrasse 1, 85764 Neuherberg; Groves, Matthew R.
2008-05-01
The haem-binding protein HbpS from Streptomyces reticuli was crystallized and diffraction data were collected to a maximal resolution of 2.25 Å. Streptomyces reticuli is a soil-growing Gram-positive bacteria that has been shown to secrete a novel haem-binding protein known as HbpS. Sequence analysis reveals that homologues of HbpS are found in a wide variety of bacteria, including different Actinobacteria and the Gram-negative Vibrio cholera and Klebsiella pneumoniae. The in vivo production of HbpS is greatly increased when S. reticuli is cultured in the presence of the natural antibiotic haemin (Fe{sup 3+} oxidized form of haem). Mutational analysis demonstrated that HbpSmore » significantly increases the resistance of S. reticuli to toxic concentrations of haemin. Previous data show that the presence of the newly identified two-component sensor system SenS–SenR also considerably enhances the resistance of S. reticuli to haemin and the redox-cycling compound plumbagin, suggesting a role in the sensing of redox changes. Specific interaction between HbpS and SenS–SenR, which regulates the expression of the catalase–peroxidase CpeB, as well as HbpS, has been demonstrated in vitro. HbpS has been recombinantly overexpressed, purified and crystallized in space group P2{sub 1}3, with a cell edge of 152.5 Å. Diffraction data were recorded to a maximal resolution of 2.25 Å and phases were obtained using the SAD method from crystals briefly soaked in high concentrations of sodium bromide.« less
Light distribution in diffractive multifocal optics and its optimization.
Portney, Valdemar
2011-11-01
To expand a geometrical model of diffraction efficiency and its interpretation to the multifocal optic and to introduce formulas for analysis of far and near light distribution and their application to multifocal intraocular lenses (IOLs) and to diffraction efficiency optimization. Medical device consulting firm, Newport Coast, California, USA. Experimental study. Application of a geometrical model to the kinoform (single focus diffractive optical element) was expanded to a multifocal optic to produce analytical definitions of light split between far and near images and light loss to other diffraction orders. The geometrical model gave a simple interpretation of light split in a diffractive multifocal IOL. An analytical definition of light split between far, near, and light loss was introduced as curve fitting formulas. Several examples of application to common multifocal diffractive IOLs were developed; for example, to light-split change with wavelength. The analytical definition of diffraction efficiency may assist in optimization of multifocal diffractive optics that minimize light loss. Formulas for analysis of light split between different foci of multifocal diffractive IOLs are useful in interpreting diffraction efficiency dependence on physical characteristics, such as blaze heights of the diffractive grooves and wavelength of light, as well as for optimizing multifocal diffractive optics. Disclosure is found in the footnotes. Copyright © 2011 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Frequency analysis for modulation-enhanced powder diffraction.
Chernyshov, Dmitry; Dyadkin, Vadim; van Beek, Wouter; Urakawa, Atsushi
2016-07-01
Periodic modulation of external conditions on a crystalline sample with a consequent analysis of periodic diffraction response has been recently proposed as a tool to enhance experimental sensitivity for minor structural changes. Here the intensity distributions for both a linear and nonlinear structural response induced by a symmetric and periodic stimulus are analysed. The analysis is further extended for powder diffraction when an external perturbation changes not only the intensity of Bragg lines but also their positions. The derived results should serve as a basis for a quantitative modelling of modulation-enhanced diffraction data measured in real conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru
2015-09-15
Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp.more » gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rong, Hui; Li, Yan; Lou, Xiao-hua
2007-02-01
A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less
Off-plane x-ray reflection grating fabrication
NASA Astrophysics Data System (ADS)
Peterson, Thomas J.; DeRoo, Casey T.; Marlowe, Hannah; McEntaffer, Randall L.; Miles, Drew M.; Tutt, James H.; Schultz, Ted B.
2015-09-01
Off-plane X-ray diffraction gratings with precision groove profiles at the submicron scale will be used in next generation X-ray spectrometers. Such gratings will be used on a current NASA suborbital rocket mission, the Off-plane Grating Rocket Experiment (OGRE), and have application for future grating missions. The fabrication of these gratings does not come without challenges. High performance off-plane gratings must be fabricated with precise radial grating patterns, optically at surfaces, and specific facet angles. Such gratings can be made using a series of common micro-fabrication techniques. The resulting process is highly customizable, making it useful for a variety of different mission architectures. In this paper, we detail the fabrication method used to produce high performance off-plane gratings and report the results of a preliminary qualification test of a grating fabricated in this manner. The grating was tested in the off-plane `Littrow' configuration, for which the grating is most efficient for a given diffraction order, and found to achieve 42% relative efficiency in the blaze order with respect to all diffracted light.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi
2014-09-25
A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less
Quantitative analysis of thoria phase in Th-U alloys using diffraction studies
NASA Astrophysics Data System (ADS)
Thakur, Shital; Krishna, P. S. R.; Shinde, A. B.; Kumar, Raj; Roy, S. B.
2017-05-01
In the present study the quantitative phase analysis of Th-U alloys in bulk form namely Th-52 wt% U and Th-3wt%U has been performed over the data obtained from both X ray diffraction and neutron diffraction technique using Rietveld method of FULLPROF software. Quantifying thoria (ThO2) phase present in bulk of the sample is limited due to surface oxidation and low penetration of x rays in high Z material. Neutron diffraction study probing bulk of the samples has been presented in comparison with x-ray diffraction study.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adams, Melanie A.; Udell, Christian M.; Pal, Gour Pada
The crystallization and preliminary X-ray diffraction analysis of MraZ, formerly known as hypothetical protein YabB, from Escherichia coli K-12 is presented. The MraZ family of proteins, also referred to as the UPF0040 family, are highly conserved in bacteria and are thought to play a role in cell-wall biosynthesis and cell division. The murein region A (mra) gene cluster encodes MraZ proteins along with a number of other proteins involved in this complex process. To date, there has been no clear functional assignment provided for MraZ proteins and the structure of a homologue from Mycoplasma pneumoniae, MPN314, failed to suggest amore » molecular function. The b0081 gene from Escherichia coli that encodes the MraZ protein was cloned and the protein was overexpressed, purified and crystallized. This data is presented along with evidence that the E. coli homologue exists in a different oligomeric state to the MPN314 protein.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika
A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less
Rosenthal, Cindy; Mueller, Uwe; Panjikar, Santosh; Sun, Lianli; Ruppert, Martin; Zhao, Yu; Stöckigt, Joachim
2006-01-01
Perakine reductase (PR) is a novel member of the aldo-keto reductase enzyme superfamily from higher plants. PR from the plant Rauvolfia serpentina is involved in the biosynthesis of monoterpenoid indole alkaloids by performing NADPH-dependent reduction of perakine, yielding raucaffrinoline. However, PR can also reduce cinnamic aldehyde and some of its derivatives. After heterologous expression of a triple mutant of PR in Escherichia coli, crystals of the purified and methylated enzyme were obtained by the hanging-drop vapour-diffusion technique at 293 K with 100 mM sodium citrate pH 5.6 and 27% PEG 4000 as precipitant. Crystals belong to space group C2221 and diffract to 2.0 Å, with unit-cell parameters a = 58.9, b = 93.0, c = 143.4 Å. PMID:17142919
Hong, Seung Kon; Kim, Kook Han; Kim, Eunice EunKyeong
2010-01-01
Malonyl-CoA:acyl-carrier protein transacylase (MCAT), encoded by the fabd gene, is a key enzyme in type II fatty-acid biosynthesis. It is responsible for transferring the malonyl group from malonyl-CoA to the holo acyl-carrier protein (ACP). Since the type II system differs from the type I system that mammals use, it has received enormous attention as a possible antibiotic target. In particular, only a single isoform of MCAT has been reported and a continuous coupled enzyme assay has been developed. MCAT from Staphylococcus aureus was overexpressed in Escherichia coli and the protein was purified and crystallized. Diffraction data were collected to 1.2 A resolution. The crystals belonged to space group P2(1), with unit-cell parameters a = 41.608, b = 86.717, c = 43.163 A, alpha = gamma = 90, beta = 106.330 degrees . The asymmetric unit contains one SaMCAT molecule.
Xu, Anbi; Huang, Laiqiang
2014-02-01
The tomato (Lycopersicon esculentum) pollen-specific receptor kinase 2 (LePRK2) is a member of the large receptor-like kinase (RLK) family and is expressed specifically in mature pollen and pollen tubes in L. esculentum. Like other RLKs, LePRK2 contains a characteristic N-terminal leucine-rich repeat (LRR) extracellular domain, the primary function of which is in protein-protein interactions. The LePRK2 LRR is likely to bind candidate ligands from the external environment, leading to a signal transduction cascade required for successful pollination. LePRK2-LRR was purified using an insect-cell secretion expression system and was crystallized using the vapour-diffusion method. The crystals diffracted to a resolution of 2.50 Å and belonged to space group I4(1)22, with unit-cell parameters a = b = 93.94, c = 134.44 Å and one molecule per asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun
2008-08-01
Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leung, Daisy W.; Borek, Dominika; Farahbakhsh, Mina
2010-06-21
VP35 is one of seven structural proteins encoded by the Ebola viral genome and mediates viral replication, nucleocapsid formation and host immune suppression. The C-terminal interferon inhibitory domain (IID) of VP35 is critical for dsRNA binding and interferon inhibition. The wild-type VP35 IID structure revealed several conserved residues that are important for dsRNA binding and interferon antagonism. Here, the expression, purification and crystallization of recombinant Zaire Ebola VP35 IID mutants R312A, K319A/R322A and K339A in space groups P6{sub 1}22, P2{sub 1}2{sub 1}2{sub 1} and P2{sub 1}, respectively, are described. Diffraction data were collected using synchrotron sources at the Advanced Lightmore » Source and the Advanced Photon Source.« less
Dielectric and electrical characteristics of Sr modified Ca1Cu3Ti4O12
NASA Astrophysics Data System (ADS)
Sahu, M.; Choudhary, R. N. P.; Roul, B. K.
2018-05-01
This paper mainly reports on the effect of Sr substitution on dielectric and electrical properties of CaCu3Ti4O12 at different temperature and frequency. Preliminary analysis of X-ray diffraction data of sintered samples confirms the reported cubic structure. Study of surface morphology shows that the surface of the samples contains well-defined and uniformly distributed grains. Some electrical parameters (permittivity, tangent loss and impedance) of the materials were measured and analyzed over a wide range of temperature (25 to 315 °C) and frequency (50 to 2x106 Hz). The ultra high dielectric constant and low energy dissipation have been observed in the said experimental conditions of phase-pure prepared compounds. It is expected that the addition of nano-size compounds or oxide will help to enhance the above properties useful for fabrication of super-capacitor.
Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin
2013-01-01
Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659
DOE Office of Scientific and Technical Information (OSTI.GOV)
Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168
2008-02-01
The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less
Squeglia, Flavia; Bachert, Beth; Romano, Maria; Lukomski, Slawomir; Berisio, Rita
2013-09-01
Streptococcal collagen-like proteins (Scls) are widely expressed by the well recognized human pathogen Streptococcus pyogenes. These surface proteins contain a signature central collagen-like region and an amino-terminal globular domain, termed the variable domain, which is protruded away from the cell surface by the collagen-like domain. Despite their recognized importance in bacterial pathogenicity, no structural information is presently available on proteins of the Scl class. The variable domain of Scl2 from invasive M3-type S. pyogenes has successfully been crystallized using vapour-diffusion methods. The crystals diffracted to 1.5 Å resolution and belonged to space group H32, with unit-cell parameters a = 44.23, b = 44.23, c = 227.83 Å. The crystal structure was solved by single-wavelength anomalous dispersion using anomalous signal from a europium chloride derivative.|
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol
2006-10-01
CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less
Lee, Saeyoung; Lee, Jonas Yun; Ha, Sung Chul; Jung, Jina; Shin, Dong Hae; Kim, Kyoung Heon; Choi, In-Geol
2009-01-01
Many agarolytic bacteria degrade agar polysaccharide into the disaccharide unit neoagarobiose [O-3,6-anhydro-α-l-galactopyranosyl-(1→3)-d-galactose] using various β-agarases. Neoagarobiose hydrolase is an enzyme that acts on the α-1,3 linkage in neoagarobiose to yield d-galactose and 3,6-anhydro-l-galactose. This activity is essential in both the metabolism of agar by agarolytic bacteria and the production of fermentable sugars from agar biomass for bioenergy production. Neoagarobiose hydrolase from the marine bacterium Saccharophagus degradans 2-40 was overexpressed in Escherichia coli and crystallized in the monoclinic space group C2, with unit-cell parameters a = 129.83, b = 76.81, c = 90.11 Å, β = 101.86°. The crystals diffracted to 1.98 Å resolution and possibly contains two molecules in the asymmetric unit. PMID:20054134
Takeshita, Daijiro; Kataoka, Michihiko; Miyakawa, Takuya; Miyazono, Ken-ichi; Uzura, Atsuko; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru
2009-01-01
(R)-3-Quinuclidinol is a useful compound that is applicable to the synthesis of various pharmaceuticals. The NADPH-dependent carbonyl reductase 3-quinuclidinone reductase from Rhodotorula rubra catalyzes the stereospecific reduction of 3-quinuclidinone to (R)-3-quinuclidinol and is expected to be utilized in industrial production of this alcohol. 3-Quinuclidinone reductase from R. rubra was expressed in Escherichia coli and purified using Ni-affinity and ion-exchange column chromatography. Crystals of the protein were obtained by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitant. The crystals belonged to space group P41212, with unit-cell parameters a = b = 91.3, c = 265.4 Å, and diffracted X-rays to 2.2 Å resolution. The asymmetric unit contained four molecules of the protein and the solvent content was 48.4%. PMID:19478454
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko
2007-10-01
Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakamura, Toshio; Tonozuka, Takashi; Kotani, Mao
2007-12-01
HA3, a 70 kDa haemagglutinating protein, is a precursor form of HA3a and HA3b, the subcomponents of Clostridium botulinum type C 16S progenitor toxin. In this report, recombinant HA3 protein was overexpressed in Escherichia coli, purified and crystallized. HA3, a 70 kDa haemagglutinating protein, is a precursor form of HA3a and HA3b, the subcomponents of Clostridium botulinum type C 16S progenitor toxin. In this report, recombinant HA3 protein was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 2.6 Å resolution and the crystal belonged to the hexagonal space group P6{sub 3}. Matthews coefficient and self-rotation functionmore » calculations indicate that there is probably one molecule of HA3 in the asymmetric unit. A search for heavy-atom derivatives has been undertaken.« less
Maurice, Claire; Fortunier, Roland; Driver, Julian; Day, Austin; Mingard, Ken; Meaden, Graham
2010-06-01
This comment on the paper "Bragg's Law diffraction simulations for electron backscatter diffraction analysis" by Kacher et al. explains the limitations in determining elastic strains using synthetic EBSD patterns. Of particular importance are those due to the accuracy of determination of the EBSD geometry projection parameters. Additional references and supporting information are provided. Copyright 2010 Elsevier B.V. All rights reserved.
40 CFR 161.170 - Preliminary analysis.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Preliminary analysis. (a) If the product is produced by an integrated system, the applicant must provide a preliminary analysis of each technical grade of active ingredient contained in the product to identify all... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Preliminary analysis. 161.170 Section...
Beekman, Alice; Shan, Daxian; Ali, Alana; Dai, Weiguo; Ward-Smith, Stephen; Goldenberg, Merrill
2005-04-01
This study evaluated the effect of the imaginary component of the refractive index on laser diffraction particle size data for pharmaceutical samples. Excipient particles 1-5 microm in diameter (irregular morphology) were measured by laser diffraction. Optical parameters were obtained and verified based on comparison of calculated vs. actual particle volume fraction. Inappropriate imaginary components of the refractive index can lead to inaccurate results, including false peaks in the size distribution. For laser diffraction measurements, obtaining appropriate or "effective" imaginary components of the refractive index was not always straightforward. When the recommended criteria such as the concentration match and the fit of the scattering data gave similar results for very different calculated size distributions, a supplemental technique, microscopy with image analysis, was used to decide between the alternatives. Use of effective optical parameters produced a good match between laser diffraction data and microscopy/image analysis data. The imaginary component of the refractive index can have a major impact on particle size results calculated from laser diffraction data. When performed properly, laser diffraction and microscopy with image analysis can yield comparable results.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mitchell, M.; Nam, H; Carter, A
2009-01-01
Adeno-associated virus (AAV) serotype 9, which is under development for gene-delivery applications, shows significantly enhanced capsid-associated transduction efficiency in muscle compared with other AAV serotypes. With the aim of characterizing the structural determinants of this property, the purification, crystallization and preliminary X-ray crystallographic analyses of the AAV9 viral capsid are reported. The crystals diffracted X-rays to 2.8 A resolution using synchrotron radiation and belonged to the trigonal space group P32, with unit-cell parameters a = b = 251.0, c = 640.0 A. There are three complete viral capsids in the crystal unit cell. The orientation and position of the asymmetricmore » unit capsid have been determined by molecular-replacement methods and structure determination is in progress.« less
Festa, G; Grazzi, F; Pietropaolo, A; Scherillo, A; Schooneveld, E M
2017-12-01
Experimental tests are presented that assess the cross-talk level among three scintillation detectors used as neutron counters exploiting the thermal neutron radiative capture on Cd. The measurements were done at the INES diffractometer operating at the ISIS spallation neutron source (Rutherford Appleton Laboratory, UK). These tests follow a preliminary set of measurements performed on the same instrument to study the effectiveness of this thermal neutron counting strategy in neutron diffraction measurements, typically performed on INES using squashed 3 He filled gas tubes. The experimental data were collected in two different geometrical configurations of the detectors and compared to results of Monte Carlo simulations, performed using the MCNP code. Copyright © 2017 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing
2005-09-01
Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less
Chen, Zhaosan; Zhang, Nianzhi; Lu, Shuangshuang; Tariq, Mansoor; Wang, Junya; Xia, Chun
2015-01-01
β2-Microglobulin (β2m) noncovalently associates with the heavy chain of major histocompatibility complex class I (MHC I) molecules, which bind foreign antigen peptides to control the cytotoxic T lymphocyte (CTL) immune response. In contrast to mammals, there are distinct types of β2ms derived from two loci in a number of teleost species. In order to clarify the structures of the β2ms, the zebrafish (Danio rerio) β2ms Dare-β2m-I and Dare-β2m-II were expressed in Escherichia coli, purified and crystallized, and diffraction data were collected to 1.6 and 1.9 Å resolution, respectively. Both crystals belonged to space group P212121. The unit-cell parameters were determined to be a = 38.2, b = 50.4, c = 50.9 Å for Dare-β2m-I and a = 38.9, b = 52.7, c = 65.8 Å for Dare-β2m-II. Each asymmetric unit was constituted of one molecule, with Matthews coefficients of 2.22 and 3.01 Å3 Da−1 and solvent contents of 45 and 59% for Dare-β2m-I and Dare-β2m-II, respectively. These two β2m structures will provide relevant information for further studies of the structures of the MHC I complex. PMID:26057815
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wei, Wenqing; Zhao, Wei; Key Laboratory of Structural Biology, Chinese Academy of Sciences, 96 Jinzhai Road, Hefei, Anhui 230027
2007-08-01
The thrombin-like enzyme saxthrombin has been purified from G. saxatilis snake venom. Crystallization conditions were found and a data set was obtained to 1.43 Å. The snake-venom thrombin-like enzymes (SVTLEs) are a class of serine proteinases that show fibrinogen-clotting and esterolytic activities. Most TLEs convert fibrinogen to fibrin by releasing either fibrinopeptide A or fibrinopeptide B and cannot activate factor XIII. The enzymes hydrolyze fibrinogen to produce non-cross-linked fibrins, which are susceptible to the lytic action of plasmin. Because of these physiological properties, TLEs have important medical applications in myocardial infarction, ischaemic stroke and thrombotic diseases. Here, a three-step chromatographymore » procedure was used to purify saxthrombin (AAP20638) from Gloydius saxatilis venom to homogeneity. Its molecular weight is about 30 kDa as estimated by SDS–PAGE. A saxthrombin crystal was obtained using the hanging-drop vapour-diffusion method and diffracted to a resolution limit of 1.43 Å. The crystal belongs to space group C2, with unit-cell parameters a = 97.23, b = 52.21, c = 50.10 Å, β = 96.72°, and the Matthews coefficient (V{sub M}) was calculated to be 2.13 Å{sup 3} Da{sup −1} with one molecule in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.
Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less
A numerical wave-optical approach for the simulation of analyzer-based x-ray imaging
NASA Astrophysics Data System (ADS)
Bravin, A.; Mocella, V.; Coan, P.; Astolfo, A.; Ferrero, C.
2007-04-01
An advanced wave-optical approach for simulating a monochromator-analyzer set-up in Bragg geometry with high accuracy is presented. The polychromaticity of the incident wave on the monochromator is accounted for by using a distribution of incoherent point sources along the surface of the crystal. The resulting diffracted amplitude is modified by the sample and can be well represented by a scalar representation of the optical field where the limitations of the usual ‘weak object’ approximation are removed. The subsequent diffraction mechanism on the analyzer is described by the convolution of the incoming wave with the Green-Riemann function of the analyzer. The free space propagation up to the detector position is well reproduced by a classical Fresnel-Kirchhoff integral. The preliminary results of this innovative approach show an excellent agreement with experimental data.
Toward Sodium X-Ray Diffraction in the High-Pressure Regime
NASA Astrophysics Data System (ADS)
Gong, X.; Polsin, D. N.; Rygg, J. R.; Boehly, T. R.; Crandall, L.; Henderson, B. J.; Hu, S. X.; Huff, M.; Saha, R.; Collins, G. W.; Smith, R.; Eggert, J.; Lazicki, A. E.; McMahon, M.
2017-10-01
We are working to quasi-isentropically compress sodium into the terapascal regime to test theoretical predictions that sodium transforms to an electride. A series of hydrodynamic simulations have been performed to design experiments to investigate the structure and optical properties of sodium at pressures up to 500 GPa. We show preliminary results where sodium samples, sandwiched between diamond plates and lithium-fluoride windows, are ramp compressed by a gradual increase in the drive-laser intensity. The low sound speed in sodium makes it particularly susceptible to forming a shock; therefore, it is difficult to compress without melting the sample. Powder x-ray diffraction is used to provide information on the structure of sodium at these high pressures. This material is based upon work supported by the Department of Energy National Nuclear Security Administration under Award Number DE-NA0001944.
Development of high-average-power DPSSL with high beam quality
NASA Astrophysics Data System (ADS)
Nakai, Sadao; Kanabe, Tadashi; Kawashima, Toshiyuki; Yamanaka, Masanobu; Izawa, Yasukazu; Nakatuka, Masahiro; Kandasamy, Ranganathan; Kan, Hirofumi; Hiruma, Teruo; Niino, Masayuki
2000-08-01
The recent progress of high power diode laser is opening new fields of laser and its application. We are developing high average power diode pumped solid state laser DPSSL for laser fusion power plant, for space propulsion and for various applications in industry. The common features or requirements of our High Average-power Laser for Nuclear-fusion Application (HALNA) are large pulse energy with relatively low repetition of few tens Hz, good beam quality of order of diffraction limit and high efficiency more than 10%. We constructed HALNA 10 (10J X 10 Hz) and tested the performance to clarify the scalability to higher power system. We have obtained in a preliminary experiment a 8.5 J output energy at 0.5 Hz with beam quality of 2 times diffraction limited far-field pattern.
Center for Macromolecular Crystallography, University of Alabama in Birmingham
NASA Technical Reports Server (NTRS)
Navia, Manuel A.
1991-01-01
Porcine pancreatic elastase (PPE) crystals grown under microgravity conditions on mission STS-26 of the Space Shuttle Discovery were shown to diffract to considerably higher resolution than the best PPE crystals grown by us on the ground. We have now independently refined both the microgravity and ground-based data. Preliminary results of these refinements are summarized. These results show nearly a doubling of experimental diffraction data for this structure, exceeding 1.3 A resolution. Improved phase information derived from the refined structure of PPE based on this microgravity data has allowed us to interpret previously-uninterpretable electron density obtained from ground-based crystals of a complex of PPE with a chemically-reactive inhibitor. Intermediate stages in the enzyme-inhibitor reaction mechanism in the crystal can now be directly observed. Further refinement of PPE structures is in progress.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kiyota, Eduardo; Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP; Sousa, Sylvia Morais de
Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automatedmore » molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.« less
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-26
..., 2011, the Department issued its Post-Preliminary Analysis of Cross-ownership and its Post- Preliminary Analysis of New Subsidy Allegations. On that date, the Department also issued its Post-Preliminary Analysis... Post-Preliminary Analysis: GOK Preferential Lending Under the Daewoo Workout, and the GOK, LGE, SEC...
Migration velocity analysis using residual diffraction moveout: a real-data example
NASA Astrophysics Data System (ADS)
Gonzalez, Jaime A. C.; de Figueiredo, José J. S.; Coimbra, Tiago A.; Schleicher, Jörg; Novais, Amélia
2016-08-01
Unfocused seismic diffraction events carry direct information about errors in the migration-velocity model. The residual-diffraction-moveout (RDM) migration-velocity-analysis (MVA) method is a recent technique that extracts this information by means of adjusting ellipses or hyperbolas to uncollapsed migrated diffractions. In this paper, we apply this method, which has been tested so far only on synthetic data, to a real data set from the Viking Graben. After application of a plane-wave-destruction (PWD) filter to attenuate the reflected energy, the diffractions in the real data become interpretable and can be used for the RDM method. Our analysis demonstrates that the reflections need not be completely removed for this purpose. Beyond the need to identify and select diffraction events in post-stack migrated sections in the depth domain, the method has a very low computational cost and processing time. To reach an acceptable velocity model of comparable quality as one obtained with common-midpoint (CMP) processing, only two iterations were necessary.
Takahashi, Yukio; Suzuki, Akihiro; Zettsu, Nobuyuki; Oroguchi, Tomotaka; Takayama, Yuki; Sekiguchi, Yuki; Kobayashi, Amane; Yamamoto, Masaki; Nakasako, Masayoshi
2013-01-01
We report the first demonstration of the coherent diffraction imaging analysis of nanoparticles using focused hard X-ray free-electron laser pulses, allowing us to analyze the size distribution of particles as well as the electron density projection of individual particles. We measured 1000 single-shot coherent X-ray diffraction patterns of shape-controlled Ag nanocubes and Au/Ag nanoboxes and estimated the edge length from the speckle size of the coherent diffraction patterns. We then reconstructed the two-dimensional electron density projection with sub-10 nm resolution from selected coherent diffraction patterns. This method enables the simultaneous analysis of the size distribution of synthesized nanoparticles and the structures of particles at nanoscale resolution to address correlations between individual structures of components and the statistical properties in heterogeneous systems such as nanoparticles and cells.
Biological imaging by soft X-ray diffraction microscopy
NASA Astrophysics Data System (ADS)
Shapiro, David
We have developed a microscope for soft x-ray diffraction imaging of dry or frozen hydrated biological specimens. This lensless imaging system does not suffer from the resolution or specimen thickness limitations that other short wavelength microscopes experience. The microscope, currently situated at beamline 9.0.1 of the Advanced Light Source, can collect diffraction data to 12 nm resolution with 750 eV photons and 17 nm resolution with 520 eV photons. The specimen can be rotated with a precision goniometer through an angle of 160 degrees allowing for the collection of nearly complete three-dimensional diffraction data. The microscope is fully computer controlled through a graphical user interface and a scripting language automates the collection of both two-dimensional and three-dimensional data. Diffraction data from a freeze-dried dwarf yeast cell, Saccharomyces cerevisiae carrying the CLN3-1 mutation, was collected to 12 run resolution from 8 specimen orientations spanning a total rotation of 8 degrees. The diffraction data was phased using the difference map algorithm and the reconstructions provide real space images of the cell to 30 nm resolution from each of the orientations. The agreement of the different reconstructions provides confidence in the recovered, and previously unknown, structure and indicates the three dimensionality of the cell. This work represents the first imaging of the natural complex refractive contrast from a whole unstained cell by the diffraction microscopy method and has achieved a resolution superior to lens based x-ray tomographic reconstructions of similar specimens. Studies of the effects of exposure to large radiation doses were also carried out. It was determined that the freeze-dried cell suffers from an initial collapse, which is followed by a uniform, but slow, shrinkage. This structural damage to the cell is not accompanied by a diminished ability to see small features in the specimen. Preliminary measurements on frozen-hydrated yeast indicate that the frozen specimens do not exhibit these changes even with doses as high as 5 x 109 Gray.
Bunch length measurement at the Fermilab A0 photoinjector using a Martin-Puplett interferometer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thurman-Keup, Randy; Fliller, Raymond Patrick; Kazakevich, Grigory
2008-05-01
We present preliminary measurements of the electron bunch lengths at the Fermilab A0 Photoinjector using a Martin-Puplett interferometer on loan from DESY. The photoinjector provides a relatively wide range of bunch lengths through laser pulse width adjustment and compression of the beam using a magnetic chicane. We present comparisons of data with simulations that account for diffraction distortions in the signal and discuss future plans for improving the measurement.
Deane, Janet E.; Cordes, Frank S.; Roversi, Pietro; Johnson, Steven; Kenjale, Roma; Picking, William D.; Picking, Wendy L.; Lea, Susan M.; Blocker, Ariel
2006-01-01
A monodisperse truncation mutant of MxiH, the subunit of the needle from the Shigella flexneri type III secretion system (TTSS), has been overexpressed and purified. Crystals were grown of native and selenomethionine-labelled MxiHCΔ5 and diffraction data were collected to 1.9 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 183.4, b = 28.1, c = 27.8 Å, β = 96.5°. An anomalous difference Patterson map calculated with the data from the SeMet-labelled crystals revealed a single peak on the Harker section v = 0. Inspection of a uranyl derivative also revealed one peak in the isomorphous difference Patterson map on the Harker section v = 0. Analysis of the self-rotation function indicates the presence of a twofold non-crystallographic symmetry axis approximately along a. The calculated Matthews coefficient is 1.9 Å3 Da−1 for two molecules per asymmetric unit, corresponding to a solvent content of 33%. PMID:16511329
Deane, Janet E; Cordes, Frank S; Roversi, Pietro; Johnson, Steven; Kenjale, Roma; Picking, William D; Picking, Wendy L; Lea, Susan M; Blocker, Ariel
2006-03-01
A monodisperse truncation mutant of MxiH, the subunit of the needle from the Shigella flexneri type III secretion system (TTSS), has been overexpressed and purified. Crystals were grown of native and selenomethionine-labelled MxiH(CDelta5) and diffraction data were collected to 1.9 A resolution. The crystals belong to space group C2, with unit-cell parameters a = 183.4, b = 28.1, c = 27.8 A, beta = 96.5 degrees. An anomalous difference Patterson map calculated with the data from the SeMet-labelled crystals revealed a single peak on the Harker section v = 0. Inspection of a uranyl derivative also revealed one peak in the isomorphous difference Patterson map on the Harker section v = 0. Analysis of the self-rotation function indicates the presence of a twofold non-crystallographic symmetry axis approximately along a. The calculated Matthews coefficient is 1.9 A3 Da(-1) for two molecules per asymmetric unit, corresponding to a solvent content of 33%.
NASA Astrophysics Data System (ADS)
Xiao, Xiao; Liang, Jingwen; Xie, Jingyi; Liu, Xin; Zhu, Dongsheng; Dong, Yuan
2017-10-01
Organotin carboxylates based on an amide carboxylic acid 2-(1,3-dioxo-1H-benzo[de]isoquinolin-2(3H)-yl)acetic acid (HL): [(Bn2Sn)2O2L]2·2C6H6 (1) (Bn = benzyl group) and (Ph2Sn)(L)2 (2) were synthesized and characterized by elemental analysis, IR, 1H, 13C, 119Sn NMR spectroscopy and X-ray crystallography diffraction analysis. Complex 1 is dimeric carboxylate tetraorganodistannoxane and show a "ladder-like" molecular structure. Complex 2 is a dialkyltin carboxylate monomer possessing crystallographically imposed two-fold symmetry. Ligand in 1 and 2 adopts unidentate and bidentate coordination respectively. Both 1 and 2 form 1D, 2D and 3D supramolecular organizations in the solid state mediated through Csbnd H⋯O and π⋯π interactions which are discussed in detail. The luminescent properties and preliminary antitumor activities about this series of complexes were also studied.
NASA Astrophysics Data System (ADS)
Hijas, K. M.; Madan Kumar, S.; Byrappa, K.; Geethakrishnan, T.; Jeyaram, S.; Nagalakshmi, R.
2018-03-01
Single crystals of 2-methoxy-4(phenyliminomethyl)phenol were grown from ethanol by slow evaporation solution growth technique. Single crystal X-ray diffraction experiment reveals the crystallization in orthorhombic system having non-centrosymmetric space group C2221. Geometrical optimization by density functional theory method was carried out using Gaussian program and compared with experimental results. Detailed experimental and theoretical vibrational analyses were carried out and the results were correlated to find close agreement. Thermal analyses show the material is thermally stable with a melting point of 159 °C. Natural bond orbital analysis was carried out to explain charge transfer interactions through hydrogen bonding. Relatively smaller HOMO-LUMO band gap favors the non linear optical activity of the molecule. Natural population analysis and molecular electrostatic potential calculations visualize the charge distribution in an isolated molecule. Calculated first-order molecular hyperpolarizability and preliminary second harmonic generation test carried out using Kurtz-Perry technique establish 2-methoxy-4(phenyliminomethyl)phenol crystal as a good non linear optical material. Z-scan proposes the material for reverse saturable absorption.
Wang, Yu-Ling; Goh, King-Xiang; Wu, Wen-guey; Chen, Chun-Jung
2004-10-01
Cysteine-rich secretory proteins (CRISPs) play an important role in the innate immune system and are transcriptionally regulated by androgens in several tissues. The proteins are mostly found in the epididymis and granules of mammals, whilst a number of snake venoms also contain CRISP-family proteins. The natrin protein from the venom of Naja atra (Taiwan cobra), which belongs to a family of CRISPs and has a cysteine-rich C-terminal amino-acid sequence, has been purified using a three-stage chromatography procedure and crystals suitable for X-ray analysis have been obtained using the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 1.58 A resolution using synchrotron radiation; the crystals belong to space group C222(1), with unit-cell parameters a = 59.172, b = 65.038, c = 243.156 A. There are two protein molecules in the asymmetric unit and the Matthews coefficient is estimated to be 2.35 A3 Da(-1), corresponding to a solvent content of 47.60%.
Lee, Hyung Ho; Jung, Sang Taek
2013-02-01
β-N-acetylglucosaminidase (NagA) protein hs a chitin-degrading activity and chitin is one of the most abundant polymers in nature. NagA contains a family 3 glycoside (GH3)-type N-terminal domain and a unique C-terminal domain. The structurally uncharacterized C-terminal domain of NagA may be involved in substrate specificity. To provide a structural basis for the substrate specificity of NagA, structural analysis of NagA from Thermotoga maritima encoded by the Tm0809 gene was initiated. NagA from T. maritima has been overexpressed in Escherichia coli and crystallized at 296 K using ammonium sulfate as a precipitant. Crystals of T. maritima NagA diffracted to 3.80 Å resolution and belonged to the monoclinic space group C2, with unit-cell parameters a = 231.15, b = 133.62, c = 140.88 Å, β = 89.97°. The crystallization of selenomethionyl-substituted protein is in progress to solve the crystal structure of T. maritima NagA.
Preliminary study of raw material for calcium silicate/PVA coating on Ti-6Al-4V alloy
NASA Astrophysics Data System (ADS)
Azam, Farah Atiqah bt Abdul; Shamsudin, Roslinda
2015-09-01
Calcium silicate bioceramic was prepared from the rice husk and limestone resources using the sol gel method. The preparations of CaSiO3 formulation were differ from the previous study due CaO/SiO2 amount with 45:55 ratio. X-Ray Fluorescence analysis was carried out to clarify the amount of SiO2 and CaO content in the limestone and rice husk ash. The high amount of CaO was found in the limestone with the percentages of 97.22%, whereby 89% of SiO2 content of the rice husk ash. Several milling time were studied to obtain the optimized milling ti me and speed in progress to obtain nano size particle. The particle size analysis result confirms that increase in milling time does not certainly reduce the size of particle. The addition of 0.05% polyvinyl alcohol as a binder did not change the phases or composition of calcium silicates after examined by X-Ray diffraction analysis which make it suitable to be used as a binder for calcium silicate coating without changing the chemical structure.
Data for ground-water test hole near Zamora, Central Valley Aquifer Project, California
French, J.J.; Page, R.W.; Bertoldi, G.L.
1982-01-01
Preliminary data are presented for the first of seven test holes drilled as a part of the Central Valley Aquifer Project which is part of the National Regional Aquifer Systems Analysis Program. The test hole was drilled in the SW 1/4 SE 1/4 sec. 34, T. 12 N. , R. 1 E., Yolo County, California, about 3 miles northeast of the town of Zamora. Drilled to a depth of 2,500 feet below land surface, the hole is cased to a depth of 190 feet and equipped with three piezometer tubes to depths of 947, 1,401, and 2,125 feet. A 5-foot well screen is at the bottom of each piezometer. Eighteen cores and 68 sidewall cores were recovered. Laboratory tests were made for mineralogy, hydraulic conductivity, porosity , consolidation, grain-size distribution, Atterberg limits, X-ray diffraction, diatom identification, thermal conductivity, and chemical analysis of water. Geophysical and thermal gradient logs were made. The hole is sampled periodically for chemical analysis and measured for water level in the three tapped zones. This report presents methods used to obtain field samples, laboratory procedures, and the data obtained. (USGS)
Matsuno, Asuka; Gai, Zuoqi; Tanaka, Miyuki; Kato, Koji; Kato, Sanae; Katoh, Tsuyoshi; Shimizu, Takeshi; Yoshioka, Takeya; Kishimura, Hideki; Tanaka, Yoshikazu; Yao, Min
2015-06-01
Many molluscs transport oxygen using a very large cylindrical multimeric copper-containing protein named hemocyanin. The molluscan hemocyanin forms a decamer (cephalopods) or multidecamer (gastropods) of approximately 330-450kDa subunits, resulting in a molecular mass >3.3MDa. Therefore, molluscan hemocyanin is one of the largest proteins. The reason why these organisms use such a large supermolecule for oxygen transport remains unclear. Atomic-resolution X-ray crystallographic analysis is necessary to unveil the detailed molecular structure of this mysterious large molecule. However, its propensity to dissociate in solution has hampered the crystallization of its intact form. In the present study, we successfully obtained the first crystals of an intact decameric molluscan hemocyanin. The diffraction dataset at 3.0-Å resolution was collected by merging the datasets of two isomorphic crystals. Electron microscopy analysis of the dissolved crystals revealed cylindrical particles. Furthermore, self-rotation function analysis clearly showed the presence of a fivefold symmetry with several twofold symmetries perpendicular to the fivefold axis. The absorption spectrum of the crystals showed an absorption peak around 345nm. These results indicated that the crystals contain intact hemocyanin decamers in the oxygen-bound form. Copyright © 2015 Elsevier Inc. All rights reserved.
Takehira, Rieko; Momose, Yasunori; Yamamura, Shigeo
2010-10-15
A pattern-fitting procedure using an X-ray diffraction pattern was applied to the quantitative analysis of binary system of crystalline pharmaceuticals in tablets. Orthorhombic crystals of isoniazid (INH) and mannitol (MAN) were used for the analysis. Tablets were prepared under various compression pressures using a direct compression method with various compositions of INH and MAN. Assuming that X-ray diffraction pattern of INH-MAN system consists of diffraction intensities from respective crystals, observed diffraction intensities were fitted to analytic expression based on X-ray diffraction theory and separated into two intensities from INH and MAN crystals by a nonlinear least-squares procedure. After separation, the contents of INH were determined by using the optimized normalization constants for INH and MAN. The correction parameter including all the factors that are beyond experimental control was required for quantitative analysis without calibration curve. The pattern-fitting procedure made it possible to determine crystalline phases in the range of 10-90% (w/w) of the INH contents. Further, certain characteristics of the crystals in the tablets, such as the preferred orientation, size of crystallite, and lattice disorder were determined simultaneously. This method can be adopted to analyze compounds whose crystal structures are known. It is a potentially powerful tool for the quantitative phase analysis and characterization of crystals in tablets and powders using X-ray diffraction patterns. Copyright 2010 Elsevier B.V. All rights reserved.
SU-E-I-44: Some Preliminary Analysis of Angular Distribution of X-Ray Scattered On Soft Tissues
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ganezer, K; Krmar, M; Cvejic, Z
2015-06-15
Purpose: The angular distribution of x-radiation scattered at small angles (up to 16 degrees) from several different animal soft tissue (skin, fat, muscle, retina, etc) were measured using standard equipment devoted to study of crystal structure which provides excellent geometry conditions of measurements. showed measurable differences for different tissues. In the simplest possible case when measured samples do not differ in structure (different concentration solutions) it can be seen that intensity of scattered radiation is decreasing function of the concentration and the peak of the maximum of scattering distribution depends on the concentration as well. Methods: An x-ray scattering profilemore » usually consists of sharp diffraction peak; however some properties of the spatial profiles of scattered radiation as intensity, the peak position, height, area, FWHM, the ratio of peak heights, etc. Results: The data contained measurable differences for different tissues. In the simplest possible case when measured samples do not differ in structure (different concentration solutions) it can be seen that intensity of scattered radiation is decreasing function of the concentration and the peak of the maximum of scattering distribution depends on the concentration as well. Measurements of different samples in the very preliminary phase showed that simple biological material used in study showed slightly different scattering pattern, especially at higher angles (around 10degrees). Intensity of radiation scattered from same tissue type is very dependent on water content and several more parameters. Conclusion: This preliminary study using animal soft tissues on the angular distributions of scattered x-rays suggests that angular distributions of X-rays scattered off of soft tissues might be useful in distinguishing healthy tissue from malignant soft tissue.« less
2006-06-01
Polarisation measurement with a dual beam interferometer (CATSI) Exploratory results and preliminary phenomenological analysis H. Lavoie J.-M... Polarisation measurement with a dual beam interferometer (CATSI) Exploratory results and preliminary phenomenological analysis H. Lavoie J.-M. Thériault... Polarisation measurement with a dual beam interferometer (CATSI) - Exploratory results and preliminary phenomenological analysis. ECR 2004-372. DRDC Valcartier
NASA Technical Reports Server (NTRS)
Archilles, Cherie; Ming, D. W.; Morris, R. V.; Blake, D. F.
2011-01-01
The CheMin instrument on the Mars Science Laboratory (MSL) is an miniature X-ray diffraction (XRD) and X-ray fluorescence (XRF) instrument capable of detecting the mineralogical and elemental compositions of rocks, outcrops and soils on the surface of Mars. CheMin uses a microfocus-source Co X-ray tube, a transmission sample cell, and an energy-discriminating X-ray sensitive CCD to produce simultaneous 2-D XRD patterns and energy-dispersive X-ray histograms from powdered samples. CRISM and OMEGA have identified the presence of phyllosilicates at several locations on Mars including the four candidate MSL landing sites. The objective of this study was to conduct preliminary studies to determine the CheMin detection limit of smectite in a smectite/olivine mixed mineral system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schoepe, Jan, E-mail: jschoepe@smail.uni-koeln.de; Niefind, Karsten; Chatterjee, Shivani
2006-07-01
The crystallization and preliminary X-ray characterization of a shikimate dehydrogenase from C. glutamicum is presented. The shikimate dehydrogenase from Corynebacterium glutamicum has been cloned into an Escherichia coli expression vector, overexpressed and purified. Native crystals were obtained by the vapour-diffusion technique using 2-methyl-2,4-pentanediol as a precipitant. The crystals belong to the centred monoclinic space group C2, with unit-cell parameters a = 118.77, b = 63.17, c = 35.67 Å, β = 92.26° (at 100 K), and diffract to 1.64 Å on a synchrotron X-ray source. The asymmetric unit is likely to contain one molecule, corresponding to a packing density ofmore » 2.08 Å{sup 3} Da{sup −1} and a solvent content of about 41%.« less
Quantitative assessment of image motion blur in diffraction images of moving biological cells
NASA Astrophysics Data System (ADS)
Wang, He; Jin, Changrong; Feng, Yuanming; Qi, Dandan; Sa, Yu; Hu, Xin-Hua
2016-02-01
Motion blur (MB) presents a significant challenge for obtaining high-contrast image data from biological cells with a polarization diffraction imaging flow cytometry (p-DIFC) method. A new p-DIFC experimental system has been developed to evaluate the MB and its effect on image analysis using a time-delay-integration (TDI) CCD camera. Diffraction images of MCF-7 and K562 cells have been acquired with different speed-mismatch ratios and compared to characterize MB quantitatively. Frequency analysis of the diffraction images shows that the degree of MB can be quantified by bandwidth variations of the diffraction images along the motion direction. The analytical results were confirmed by the p-DIFC image data acquired at different speed-mismatch ratios and used to validate a method of numerical simulation of MB on blur-free diffraction images, which provides a useful tool to examine the blurring effect on diffraction images acquired from the same cell. These results provide insights on the dependence of diffraction image on MB and allow significant improvement on rapid biological cell assay with the p-DIFC method.
Płotek, Michał; Starosta, Radosław; Komarnicka, Urszula K; Skórska-Stania, Agnieszka; Kołoczek, Przemysław; Kyzioł, Agnieszka
2017-05-01
Reaction of {[Ru(η 6 -p-cymene)Cl] 2 (μ-Cl) 2 } (1) with aminomethylphosphane derived from morpholine (P{CH 2 N(CH 2 CH 2 ) 2 O} 3 (A), PPh 2 {CH 2 N(CH 2 CH 2 ) 2 O} (B)) or piperazine (P{CH 2 N(CH 2 CH 2 ) 2 NCH 2 CH 3 } 3 (C), PPh 2 {CH 2 N(CH 2 CH 2 ) 2 NCH 2 CH 3 } (D)) results in four new piano stool ruthenium(II) coordination compounds: [Ru(η 6 -p-cymene)Cl 2 (A)] (2A), [Ru(η 6 -p-cymene)Cl 2 (B)] (2B), [Ru(η 6 -p-cymene)Cl 2 (C)] (2C) and [Ru(η 6 -p-cymene)Cl 2 (D)] (2D). Every complex was fully characterized using spectroscopic methods ( 1 H, 13 C{ 1 H}, 31 P{ 1 H} NMR and ESI-MS), elemental analysis, X-ray single crystal diffraction and DFT calculations. Preliminary studies of in vitro cytotoxicity on the A549 (human lung adenocarcinoma) and MCF7 (human breast adenocarcinoma) cell lines revealed 2A-2D activity in the same order of magnitude as in the case of cisplatin. Additionally, the study confirmed the ability of 2A-2D to interact with DNA helix and transferrin. Copyright © 2017 Elsevier Inc. All rights reserved.
Chemical vapor deposition growth
NASA Technical Reports Server (NTRS)
Ruth, R. P.; Manasevit, H. M.; Kenty, J. L.; Moudy, L. A.; Simpson, W. I.; Yang, J. J.
1976-01-01
A chemical vapor deposition (CVD) reactor system with a vertical deposition chamber was used for the growth of Si films on glass, glass-ceramic, and polycrystalline ceramic substrates. Silicon vapor was produced by pyrolysis of SiH4 in a H2 or He carrier gas. Preliminary deposition experiments with two of the available glasses were not encouraging. Moderately encouraging results, however, were obtained with fired polycrystalline alumina substrates, which were used for Si deposition at temperatures above 1,000 C. The surfaces of both the substrates and the films were characterized by X-ray diffraction, reflection electron diffraction, scanning electron microscopy optical microscopy, and surface profilometric techniques. Several experiments were conducted to establish baseline performance data for the reactor system, including temperature distributions on the sample pedestal, effects of carrier gas flow rate on temperature and film thickness, and Si film growth rate as a function of temperature.
X-ray diffraction studies of enkephalins. Crystal structure of [(4'-bromo) Phe4,Leu5]enkephalin.
Ishida, T; Kenmotsu, M; Mino, Y; Inoue, M; Fujiwara, T; Tomita, K; Kimura, T; Sakakibara, S
1984-01-01
In order to investigate the structure-activity relationship of [Leu5]- and [Met5]enkephalins, [(4'-bromo)Phe4, Leu5]-, [(4'-bromo)Phe4, Met5]- and [Met5] enkephalins were synthesized and crystallized. The crystal structure of [(4'-bromo) Phe4, Leu5]- enkephalin was determined by X-ray diffraction method using the heavy atom method and refined to R = 0.092 by the least-squares method. The molecule in this crystal took essentially the same type I' beta-turn conformation found in [Leu5]enkephalin [Smith & Griffin (1978) Science 199, 1214-1216). On the other hand, the preliminary three-dimensional Patterson analyses showed that the most probable conformations of [(4'-bromo)Phe4,Met5]- and [Met5]enkephalins are both the dimeric extended forms. Based on these insights, the biologically active conformation of enkephalin was discussed in relation to the mu- and delta-receptors. PMID:6721829
Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla
2009-09-01
Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.
Strategies for Time-resolved X-ray Diffraction of Phase Transitions with Laser Compression
NASA Astrophysics Data System (ADS)
Benedetti, Laura Robin; Eggert, J. H.; Bradley, D. K.; Bell, P. M.; Kilkenny, J. D.; Palmer, N.; Petre, R. B.; Rygg, J. R.; Sorce, C.; Collins, G. W.; Boehly, T. R.
2017-10-01
As part of a program to document kinetics of phase transitions under laser-driven dynamic compression, we are designing a platform to make multiple x-ray diffraction measurements during a single laser experiment. Our plans include experimental development at Omega-EP and eventual implementation at NIF. We will present our strategy for designing a robust platform that can effectively document a wide variety of phase transformations by utilizing both streaked and multiple-frame imaging detectors. Preliminary designs utilize a novel CMOS detector designed by Sandia National Lab. Our initial experiments include scoping studies that will focus on photometrics and shielding requirements in the high EMP environment close to the target. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344. Lawrence Livermore National Security, LLC, LLNL-ABS-734470.
Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi
2010-01-01
The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288
Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi
2010-07-01
The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.
Sun, Tao; Fezzaa, Kamel
2016-06-17
Here, a high-speed X-ray diffraction technique was recently developed at the 32-ID-B beamline of the Advanced Photon Source for studying highly dynamic, yet non-repeatable and irreversible, materials processes. In experiments, the microstructure evolution in a single material event is probed by recording a series of diffraction patterns with extremely short exposure time and high frame rate. Owing to the limited flux in a short pulse and the polychromatic nature of the incident X-rays, analysis of the diffraction data is challenging. Here, HiSPoD, a stand-alone Matlab-based software for analyzing the polychromatic X-ray diffraction data from polycrystalline samples, is described. With HiSPoD,more » researchers are able to perform diffraction peak indexing, extraction of one-dimensional intensity profiles by integrating a two-dimensional diffraction pattern, and, more importantly, quantitative numerical simulations to obtain precise sample structure information.« less
NASA Astrophysics Data System (ADS)
Reena Philip, Rachel; Pradeep, B.; Shripathi, T.
2005-04-01
Thin films of the off-tie-line ordered vacancy compound CuIn7Se12 were deposited on optically flat glass substrates by multi-source co-evaporation method. The preliminary structural, compositional and morphological characterizations were done using X-ray diffraction, energy dispersive X-ray analysis and atomic force microscopy. The X-ray diffraction data were further analysed applying the Nelson-Riley method and CTB plus = experiment rule, respectively, for lattice constants (a = 5.746 Å and c = 11.78 Å) and bond length estimations (RCu-Se = 2.465 Å and RIn-Se = 2.554 Å). A detailed analysis of the optical absorption spectra of the compound, which exhibited a three-fold optical absorption structure in the fundamental gap region, yielded three characteristic direct energy gaps at 1.37, 1.48(7) and 1.72(8) eV indicative of valence band splitting, which were evaluated using Hopfield's quasi-cubic model. The 0.04 eV increase in spin-orbit splitting parameter of the compound (0.27 eV) compared to that of CuInSe2 (0.23 eV) is found to be suggestive of the smaller contribution of Cu d orbitals to hybridization (determined by the linear hybridization model) in this Cu-deficient compound. Spectral response spectra exhibit, in addition to a maximum around 1.34 ± 0.03 eV, two other defect transition peaks near 1.07 and 0.85 eV. The binding energies of Cu, In and Se in the compound were determined using X-ray photoelectron spectroscopy.
Nonlocal nonlinear refraction in Hibiscus sabdariffa with large phase shifts.
Ramírez-Martínez, D; Alvarado-Méndez, E; Trejo-Durán, M; Vázquez-Guevara, M A
2014-10-20
In this work we present a study of nonlinear optical properties in organic materials (hibiscus sabdariffa). Our results demonstrate that the medium exhibits a highly nonlocal nonlinear response. We show preliminary numerical results of the transmittance as nonlocal response by considering, simultaneously, the nonlinear absorption and refraction in media. Numerical results are accord to measurement obtained by Z- scan technique where we observe large phase shifts. We also analyze the far field diffraction ring patterns of the sample.
Ji, Chao-Neng; Cai, Zai-Long; Cao, Gen-Tao; Yin, Gang; Jiao, Bing-Hua; Jiang, Tao; Shu, Guang; Mao, Ji-Fang; Xie, Yi; Mao, Yu-Min
2002-12-01
Human augmenter of liver regeneration has been expressed in Escherichia coli, purified and crystallized. The crystals belong to space group C222, with unit-cell parameters a=51.7 A, b=78.8 A, c=63.7 A. Diffraction data were collected to 2.80 A with a completeness of 99.9% (99.9% for the last shell), a R(sym) value of 0.092(0.236) and an I/sigma(I) value of 6.2(2.7).
Mao, Shan; Cui, Qingfeng; Piao, Mingxu; Zhao, Lidong
2016-05-01
A mathematical model of diffraction efficiency and polychromatic integral diffraction efficiency affected by environment temperature change and incident angle for three-layer diffractive optics with different dispersion materials is put forward, and its effects are analyzed. Taking optical materials N-FK5 and N-SF1 as the substrates of multilayer diffractive optics, the effect on diffraction efficiency and polychromatic integral diffraction efficiency with intermediate materials POLYCARB is analyzed with environment temperature change as well as incident angle. Therefore, three-layer diffractive optics can be applied in more wide environmental temperature ranges and larger incident angles for refractive-diffractive hybrid optical systems, which can obtain better image quality. Analysis results can be used to guide the hybrid imaging optical system design for optical engineers.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-03
... Response to Comments on Previous Analysis C. Summary of the Comparative Analysis 1. Quantitative Analysis 2... preliminary quantitative analysis are specific building designs, in most cases with specific spaces defined... preliminary determination. C. Summary of the Comparative Analysis DOE carried out both a broad quantitative...
NASA Technical Reports Server (NTRS)
Reddy, C. J.; Deshpande, M. D.; Fralick, D. T.; Cockrell, C. R.; Beck, F. B.
1996-01-01
Radiation pattern prediction analysis of elliptically polarized cavity-backed aperture antennas in a finite ground plane is performed using a combined Finite Element Method/Method of Moments/Geometrical Theory of Diffraction (FEM/MoM/GTD) technique. The magnetic current on the cavity-backed aperture in an infinite ground plane is calculated using the combined FEM/MoM analysis. GTD, including the slope diffraction contribution, is used to calculate the diffracted fields caused by both soft and hard polarizations at the edges of the finite ground plane. Explicit expressions for regular diffraction coefficients and slope diffraction coefficients are presented. The slope of the incident magnetic field at the diffraction points is derived and analytical expressions are presented. Numerical results for the radiation patterns of a cavity-backed circular spiral microstrip patch antenna excited by a coaxial probe in a finite rectangular ground plane are computed and compared with experimental results.
Dynamical effects in Bragg coherent x-ray diffraction imaging of finite crystals
NASA Astrophysics Data System (ADS)
Shabalin, A. G.; Yefanov, O. M.; Nosik, V. L.; Bushuev, V. A.; Vartanyants, I. A.
2017-08-01
We present simulations of Bragg coherent x-ray diffractive imaging (CXDI) data from finite crystals in the frame of the dynamical theory of x-ray diffraction. The developed approach is based on a numerical solution of modified Takagi-Taupin equations and can be applied for modeling of a broad range of x-ray diffraction experiments with finite three-dimensional crystals of arbitrary shape also in the presence of strain. We performed simulations for nanocrystals of a cubic and hemispherical shape of different sizes and provided a detailed analysis of artifacts in the Bragg CXDI reconstructions introduced by the dynamical diffraction. Based on our theoretical analysis we developed an analytical procedure to treat effects of refraction and absorption in the reconstruction. Our results elucidate limitations for the kinematical approach in the Bragg CXDI and suggest a natural criterion to distinguish between kinematical and dynamical cases in coherent x-ray diffraction on a finite crystal.
Clifford G. Shull, Neutron Diffraction, Hydrogen Atoms, and Neutron
Analysis of NaH and NaD, DOE Technical Report, April 1947 The Diffraction of Neutrons by Crystalline Powders; DOE Technical Report; 1948 Neutron Diffraction Studies, DOE Technical Report, 1948 Laue Structure of Thorium and Zirconium Dihydrides by X-ray and Neutron Diffraction, DOE Technical Report, April
Bates, S; Jonaitis, D; Nail, S
2013-10-01
Total X-ray Powder Diffraction Analysis (TXRPD) using transmission geometry was able to observe significant variance in measured powder patterns for sucrose lyophilizates with differing residual water contents. Integrated diffraction intensity corresponding to the observed variances was found to be linearly correlated to residual water content as measured by an independent technique. The observed variance was concentrated in two distinct regions of the lyophilizate powder pattern, corresponding to the characteristic sucrose matrix double halo and the high angle diffuse region normally associated with free-water. Full pattern fitting of the lyophilizate powder patterns suggested that the high angle variance was better described by the characteristic diffraction profile of a concentrated sucrose/water system rather than by the free-water diffraction profile. This suggests that the residual water in the sucrose lyophilizates is intimately mixed at the molecular level with sucrose molecules forming a liquid/solid solution. The bound nature of the residual water and its impact on the sucrose matrix gives an enhanced diffraction response between 3.0 and 3.5 beyond that expected for free-water. The enhanced diffraction response allows semi-quantitative analysis of residual water contents within the studied sucrose lyophilizates to levels below 1% by weight. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Palosz, B.; Grzanka, E.; Stelmakh, S.; Pielaszek, R.; Bismayer, U.; Neuefiend, J.; Weber, H.-P.; Proffen, T.; VonDreele, R.; Palosz, W.;
2002-01-01
Fundamental limitations, with respect to nanocrystalline materials, of the traditional elaboration of powder diffraction data like the Rietveld method are discussed. A tentative method of the analysis of powder diffraction patterns of nanocrystals is introduced which is based on the examination of the variation of lattice parameters calculated from individual Bragg lines (named the "apparent lattice parameter", alp). We examine the application of our methodology using theoretical diffraction patterns computed for models of nanocrystals with a perfect crystal lattice and for grains with a two-phase, core-shell structure. We use the method for the analysis of X-ray and neutron experimental diffraction data of nanocrystalline diamond powders of 4, 6 and 12 nm in diameter. The effects of an internal pressure and strain at the grain surface is discussed. This is based on the dependence of the alp values oil the diffraction vector Q and on the PDF analysis. It is shown, that the experimental results support well the concept of the two-phase structure of nanocrystalline diamond.
Photoinhibition superresolution lithography
NASA Astrophysics Data System (ADS)
Forman, Darren Lawrence
While the prospect of nanoscale manufacturing has generated tremendous excitement, arbitrary patterning at nanometer length scales cannot be brought about with current photolithography---the technology that for decades has driven electronics miniaturization and enabled mass production of digital logic, memory, MEMS and flat-panel displays. This is due to the relatively long wavelength of light and diffraction, which imposes a physical not technological limit on the resolution of a far-field optical pattern. Photoinhibited superresolution (PInSR) lithography is a new scheme designed to beat the diffraction limit through two-color confinement of photopolymerization and, via efficient single-photon absorption kinetics, also be high-throughput capable. This thesis describes development of an integrated optical and materials system for investigating spatiotemporal dynamics of photoinhibited superresolution lithography, with a demonstrated 3x superresolution beyond the diffraction limit. The two-color response, arising from orthogonal photogeneration of species that participate in competing reactions, is shown to be highly complex. This is both a direct and indirect consequence of mobility. Interesting trade-offs arise: thin-film resins (necessitated by single-photon absorption kinetics) require high viscosity for film stability, but the photoinhibition effect is suppressed in viscous resins. Despite this apparent suppression, which can be overcome with high excitation of the photoinhibition system, the low mobility afforded by viscous materials is beneficial for confinement of active species. Diffusion-induced blurring of patterned photoinhibition is problematic in a resin with viscosity = 1,000 cP, and overcome in a resin with viscosity eta = 500,000 cP. Superresolution of factor 3x beyond the diffraction limit is demonstrated at 0.2 NA, with additional results indicating superresolution ability at 1.2 NA. Investigating the effect of diminished photoinhibition efficacy with increased resin viscosity, analysis shows that it is an inevitable side-effect of reduction of the diffusion-limited termination rate constant. Further analysis confirms the experimental result that the viscosity effect may be overcome, with photogeneration of a large concentration of inhibiting radicals. Elevated radical concentration is also shown to be necessary for reducing diffusion-lengths, owing to the bimolecular nature of radical termination. The quantitative kinetics of photoinitiation, photoinhibition and chain polymerization are individually developed, validated and finally incorporated into a unified model. Finally, taking into account the complex, highly-coupled nature of PInSR requirements and operation, an alternate superresolution scheme is presented. In particular, the scheme is aimed at achieving deep-subwavelength superresolution with a single monochromatic source and multiple exposures. It utilizes a surface-tethered photochemistry that requires no films or gas-management, and essentially eliminates diffusion of active species. Preliminary, single-exposure results are shown.
Diffraction as a Method of Critical Policy Analysis
ERIC Educational Resources Information Center
Ulmer, Jasmine B.
2016-01-01
Recent developments in critical policy analysis have occurred alongside the new materialisms in qualitative research. These lines of scholarship have unfolded along two separate, but related, tracks. In particular, the new materialist method of "diffraction" aligns with many elements of critical policy analysis. Both involve critical…
Single-Slit Diffraction and the Uncertainty Principle
ERIC Educational Resources Information Center
Rioux, Frank
2005-01-01
A theoretical analysis of single-slit diffraction based on the Fourier transform between coordinate and momentum space is presented. The transform between position and momentum is used to illuminate the intimate relationship between single-slit diffraction and uncertainty principle.
Computer modeling of electromagnetic problems using the geometrical theory of diffraction
NASA Technical Reports Server (NTRS)
Burnside, W. D.
1976-01-01
Some applications of the geometrical theory of diffraction (GTD), a high frequency ray optical solution to electromagnetic problems, are presented. GTD extends geometric optics, which does not take into account the diffractions occurring at edges, vertices, and various other discontinuities. Diffraction solutions, analysis of basic structures, construction of more complex structures, and coupling using GTD are discussed.
Robust reconstruction of time-resolved diffraction from ultrafast streak cameras
Badali, Daniel S.; Dwayne Miller, R. J.
2017-01-01
In conjunction with ultrafast diffraction, streak cameras offer an unprecedented opportunity for recording an entire molecular movie with a single probe pulse. This is an attractive alternative to conventional pump-probe experiments and opens the door to studying irreversible dynamics. However, due to the “smearing” of the diffraction pattern across the detector, the streaking technique has thus far been limited to simple mono-crystalline samples and extreme care has been taken to avoid overlapping diffraction spots. In this article, this limitation is addressed by developing a general theory of streaking of time-dependent diffraction patterns. Understanding the underlying physics of this process leads to the development of an algorithm based on Bayesian analysis to reconstruct the time evolution of the two-dimensional diffraction pattern from a single streaked image. It is demonstrated that this approach works on diffraction peaks that overlap when streaked, which not only removes the necessity of carefully choosing the streaking direction but also extends the streaking technique to be able to study polycrystalline samples and materials with complex crystalline structures. Furthermore, it is shown that the conventional analysis of streaked diffraction can lead to erroneous interpretations of the data. PMID:28653022
Colmont, Marie; Palatinus, Lukas; Huvé, Marielle; Kabbour, Houria; Saitzek, Sébastien; Djelal, Nora; Roussel, Pascal
2016-03-07
A new lanthanum oxide, KLa5O5(VO4)2, was synthesized using a flux growth technique that involved solid-state reaction under an air atmosphere at 900 °C. The crystal structure was solved and refined using an innovative approach recently established and based on three-dimensional (3D) electron diffraction data, using precession of the electron beam and then validated against Rietveld refinement and denisty functional theory (DFT) calculations. It crystallizes in a monoclinic unit cell with space group C2/m and has unit cell parameters of a = 20.2282(14) Å, b = 5.8639(4) Å, c = 12.6060(9) Å, and β = 117.64(1)°. Its structure is built on Cresnel-like two-dimensional (2D) units (La5O5) of 4*3 (OLa4) tetrahedra, which run parallel to (001) plane, being surrounded by isolated VO4 tetrahedra. Four isolated vanadate groups create channels that host K(+) ions. Substitution of K(+) cations by another alkali metal is possible, going from lithium to rubidium. Li substitution led to a similar phase with a primitive monoclinic unit cell. A complementary selected area electron diffraction (SAED) study highlighted diffuse streaks associated with stacking faults observed on high-resolution electron microscopy (HREM) images of the lithium compound. Finally, preliminary catalytic tests for ethanol oxidation are reported, as well as luminescence evidence. This paper also describes how solid-state chemists can take advantages of recent progresses in electron crystallography, assisted by DFT calculations and powder X-ray diffraction (PXRD) refinements, to propose new structural types with potential applications to the physicist community.
Sekiguchi, Yuki; Oroguchi, Tomotaka; Nakasako, Masayoshi
2016-01-01
Coherent X-ray diffraction imaging (CXDI) is one of the techniques used to visualize structures of non-crystalline particles of micrometer to submicrometer size from materials and biological science. In the structural analysis of CXDI, the electron density map of a sample particle can theoretically be reconstructed from a diffraction pattern by using phase-retrieval (PR) algorithms. However, in practice, the reconstruction is difficult because diffraction patterns are affected by Poisson noise and miss data in small-angle regions due to the beam stop and the saturation of detector pixels. In contrast to X-ray protein crystallography, in which the phases of diffracted waves are experimentally estimated, phase retrieval in CXDI relies entirely on the computational procedure driven by the PR algorithms. Thus, objective criteria and methods to assess the accuracy of retrieved electron density maps are necessary in addition to conventional parameters monitoring the convergence of PR calculations. Here, a data analysis scheme, named ASURA, is proposed which selects the most probable electron density maps from a set of maps retrieved from 1000 different random seeds for a diffraction pattern. Each electron density map composed of J pixels is expressed as a point in a J-dimensional space. Principal component analysis is applied to describe characteristics in the distribution of the maps in the J-dimensional space. When the distribution is characterized by a small number of principal components, the distribution is classified using the k-means clustering method. The classified maps are evaluated by several parameters to assess the quality of the maps. Using the proposed scheme, structure analysis of a diffraction pattern from a non-crystalline particle is conducted in two stages: estimation of the overall shape and determination of the fine structure inside the support shape. In each stage, the most accurate and probable density maps are objectively selected. The validity of the proposed scheme is examined by application to diffraction data that were obtained from an aggregate of metal particles and a biological specimen at the XFEL facility SACLA using custom-made diffraction apparatus.
Crystallization and preliminary crystallographic analysis of human Atg4B–LC3 complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Satoo, Kenji; Suzuki, Nobuo N.; Fujioka, Yuko
2007-02-01
Human Atg4B and LC3 were expressed, purified and crystallized as a complex. Diffraction data were collected to a resolution of 1.9 Å. The reversible modification of Atg8 with phosphatidylethanolamine (PE) is crucial for autophagy, the bulk degradation process of cytoplasmic components by the vacuolar/lysosomal system. Atg4 is a cysteine protease that is responsible for the processing and deconjugation of Atg8. Human Atg4B (HsAtg4B; a mammalian orthologue of yeast Atg4) and LC3 (a mammalian orthologue of yeast Atg8) were expressed and purified and two complexes, one consisting of HsAtg4B(1–354) and LC3(1–120) (complex I; the product complex) and the other consisting ofmore » HsAtg4B(1–354) and LC3(1–124) (complex II; the substrate complex), were crystallized using polyethylene glycol 3350 as a precipitant. In both complexes His280 of HsAtg4B was mutated to alanine. The crystals belong to the same space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.5, b = 91.8, c = 102.6 Å for complex I and a = 46.9, b = 90.9, c = 102.5 Å for complex II. Diffraction data were collected to a resolution of 1.9 Å from both crystals.« less
Publications - GMC 297 | Alaska Division of Geological & Geophysical
DGGS GMC 297 Publication Details Title: X-ray diffraction analysis of cuttings from the: Texaco Inc information. Bibliographic Reference Unknown, 2001, X-ray diffraction analysis of cuttings from the: Texaco
Publications - GMC 43 | Alaska Division of Geological & Geophysical Surveys
DGGS GMC 43 Publication Details Title: X-ray diffraction clay mineralogy analysis of 23 North Slope more information. Bibliographic Reference Unknown, 1983, X-ray diffraction clay mineralogy analysis of
Preliminary evaluation of the diffraction behind the PROBA 3/ASPIICS optimized occulter
NASA Astrophysics Data System (ADS)
Baccani, Cristian; Landini, Federico; Romoli, Marco; Taccola, Matteo; Schweitzer, Hagen; Fineschi, Silvano; Bemporad, Alessandro; Loreggia, Davide; Capobianco, Gerardo; Pancrazzi, Maurizio; Focardi, Mauro; Noce, Vladimiro; Thizy, Cédric; Servaye, Jean-Sébastien; Renotte, Etienne
2016-07-01
PROBA-3 is a technological mission of the European Space Agency (ESA), devoted to the in-orbit demon- stration of formation flying (FF) techniques and technologies. ASPIICS is an externally occulted coronagraph approved by ESA as payload in the framework of the PROBA-3 mission and is currently in its C/D phase. FF offers a solution to investigate the solar corona close the solar limb using a two-component space system: the external occulter on one spacecraft and the optical instrument on the other, separated by a large distance and kept in strict alignment. ASPIICS is characterized by an inter-satellite distance of ˜144 m and an external occulter diameter of 1.42 m. The stray light due to the diffraction by the external occulter edge is always the most critical offender to a coronagraph performance: the designer work is focused on reducing the stray light and carefully evaluating the residuals. In order to match this goal, external occulters are usually characterized by an optimized shape along the optical axis. Part of the stray light evaluation process is based on the diffraction calculation with the optimized occulter and with the whole solar disk as a source. We used the field tracing software VirtualLabTM Fusion by Wyrowski Photonics [1] to simulate the diffraction. As a first approach and in order to evaluate the software, we simulated linear occulters, through as portions of the flight occulter, in order to make a direct comparison with the Phase-A measurements [2].
A Preliminary Analysis of the Costs and Benefits of Older Age Accessions.
1984-03-01
8217AD-A143 160 A PRELIMINARY ANALYSIS OF THE COSTS AND BENEFITS OF I/ OLDER AGE ACCESSIONS(U) NAVAL POSTGRADUATE SCHOOL N A MONTEREY CA S D BARCLAY MAR...ELECTE JUL 1884d THESIS A PRELIMINARY ANALYSIS CF THE COSTS AND BENEFITS OF OLDER AGE ACCESSIONS CL by Susan D. Barclay March 1984 Thesis Advisor...for public release; distribution unlimited. A Preliminary Analysis of the Costs and Benefits of Older Age Accessions by Susan D. Barclay Lieutenant
Chang, Shaojie; Song, Xiaomin; Yan, Ming; Zhou, Zhaocai; Wu, Fang; Gong, Weimin
2004-01-01
The proteins Spe31 and Spe32, named after their respective molecular weights of about 31 and 32 kDa, were purified simultaneously from the seeds of Pachyrrhizus erosus. They cannot be separated from each other by column chromatography. N-terminal sequence analysis indicated that they belonged to the papain family of cysteine proteases. An in-gel activity assay revealed that Spe31 possesses proteolytic activity while Spe32 only displays very weak activity for protein degradation. Both of them are glycoproteins as detected by the periodic acid and Schiff's reagent method. Crystals were obtained from the protein mixture by the hanging-drop vapour-diffusion method; they diffracted to a resolution of 2.61 A on an in-house X-ray source. The crystals belong to space group P4(1(3))2(1)2, with unit-cell parameters a = b = 61.96, c = 145.61 A. Gel electrophoresis under non-denaturing conditions showed that the protein crystallized was Spe31.
Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kondou, Youhei; Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, Toyama; Kitazawa, Daisuke
2005-01-01
Bacteriophage Mu baseplate protein gene product 44 was crystallized. The crystal belongs to space group R3, with unit-cell parameters a = b = 126.6, c = 64.2 Å. Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-rays to at least 2.1 Å resolution andmore » are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruggiero, Alessia; Tizzano, Barbara; Geerlof, Arie
2007-10-01
The first crystallization of a resuscitation-promoting factor has been performed. Multiwavelength anomalous dispersion experiments have been carried out to obtain experimental phases using data at 2.9 Å resolution from a selenomethionine derivative. The resuscitation-promoting factor RpfB, the most complex of the five resuscitation-promoting factors produced by M. tuberculosis, is devoted to bacterial reactivation from the dormant state. RpfB consists of 362 residues predicted to form five domains. An RpfB fragment containing the protein catalytic domain and a G5 domain has been successfully crystallized using vapour-diffusion methods. This is the first crystallographic study of a resuscitation-promoting factor. Crystals of this proteinmore » belong to space group I422, with unit-cell parameters a = 97.63, b = 97.63, c = 114.87 Å. Diffraction data have also been collected from a selenomethionine derivative at 2.9 Å resolution. Model building using the phases derived from the multiwavelength anomalous dispersion experiment is in progress.« less
Wang, Hongpeng; Zhang, Yan; Zhang, Zhenyi; Jin, Wei Lin; Wu, Geng
2014-01-01
Bin-Amphiphysin-Rvs (BAR) domain proteins play essential roles in diverse cellular processes by inducing membrane invaginations or membrane protrusions. Among the BAR superfamily, the `classical' BAR and Fes/CIP4 homology BAR (F-BAR) subfamilies of proteins usually promote membrane invaginations, whereas the inverse BAR (I-BAR) subfamily generally incur membrane protrusions. Despite possessing an N-terminal F-BAR domain, the srGAP2 protein regulates neurite outgrowth and neuronal migration by causing membrane protrusions reminiscent of the activity of I-BAR domain proteins. In this study, the inverse F-BAR (IF-BAR) domain of human srGAP2 was overexpressed, purified and crystallized. The crystals of the srGAP2 IF-BAR domain protein diffracted to 3.50 Å resolution and belonged to space group P2(1). These results will facilitate further structural determination of the srGAP2 IF-BAR domain and the ultimate elucidation of its peculiar behaviour of inducing membrane protrusions rather than membrane invaginations.
Chen, J.R.; Chao, E.C.T.; Minkin, J.A.; Back, J.M.; Bagby, W.C.; Rivers, M.L.; Sutton, S.R.; Gordon, B.M.; Hanson, A.L.; Jones, K.W.
1987-01-01
The occurrence of the so-called invisible gold in two unoxidized Carlin-type gold samples from Nevada has been determined using synchrotron X-ray fluorescence (SXRF) analysis at the National Synchrotron Light Source, Brookhaven National Laboratory. A bedded sample from the East ore zone of the Carlin deposit and a breccia sample from Horse Canyon were analyzed. Preliminary results show that gold is found only in the Horse Canyon breccia sample. Experimental details including other X-ray line and diffraction peak interferences, standards used, and minimum detection limits (MDLs) are discussed. Gold, with a MDL range of 0.8 to 3 ppm, was not detected in euhedral pyrite crystals except in the interior porous portion of one grain. Gold was detected in some parts of the matrix. The phase which contains gold has not yet been identified. The highest content of gold so far analyzed is about 40 ppm. There are interesting implications of these new findings. ?? 1987.
Single Crystal Synthesis and STM Studies of High Temperature Superconductors
NASA Technical Reports Server (NTRS)
Barrientos, Alfonso
1997-01-01
This is a final report for the work initiated in September of 1994 under the grant NAG8-1085 - NASA/OMU, on the fabrication of bulk and single crystal synthesis, specific heat measuring and STM studies of high temperature superconductors. Efforts were made to fabricate bulk and single crystals of mercury based superconducting material. A systematic thermal analysis on the precursors for the corresponding oxides and carbonates were carried out to synthesized bulk samples. Bulk material was used as seed in an attempt to grow single crystals by a two-step self flux process. On the other hand bulk samples were characterized by x-ray diffraction, electrical resistivity and magnetic susceptibility, We studied the specific heat behavior in the range from 80 to 300 K. Some preliminary attempts were made to study the atomic morphology of our samples. As part of our efforts we built an ac susceptibility apparatus for measuring the transition temperature of our sintered samples.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, George J.; Garen, Craig R.; Cherney, Maia M.
2007-11-01
The C-terminal portion of the arginine repressor protein from M. tuberculosis H37Rv has been crystallized. The complete transcriptional factor regulates arginine biosynthesis by binding operator DNA when arginine is bound at the C-terminal domain. The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 Å. The crystals belong to space group P1 and themore » Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of six molecules per unit cell.« less
Crystallization and preliminary X-ray analysis of membrane-bound pyrophosphatases.
Kellosalo, Juho; Kajander, Tommi; Honkanen, Riina; Goldman, Adrian
2013-02-01
Membrane-bound pyrophosphatases (M-PPases) are enzymes that enhance the survival of plants, protozoans and prokaryotes in energy constraining stress conditions. These proteins use pyrophosphate, a waste product of cellular metabolism, as an energy source for sodium or proton pumping. To study the structure and function of these enzymes we have crystallized two membrane-bound pyrophosphatases recombinantly produced in Saccharomyces cerevisae: the sodium pumping enzyme of Thermotoga maritima (TmPPase) and the proton pumping enzyme of Pyrobaculum aerophilum (PaPPase). Extensive crystal optimization has allowed us to grow crystals of TmPPase that diffract to a resolution of 2.6 Å. The decisive step in this optimization was in-column detergent exchange during the two-step purification procedure. Dodecyl maltoside was used for high temperature solubilization of TmPPase and then exchanged to a series of different detergents. After extensive screening, the new detergent, octyl glucose neopentyl glycol, was found to be the optimal for TmPPase but not PaPPase.
Crystal-Chemical Analysis Martian Minerals in Gale Crater
NASA Technical Reports Server (NTRS)
Morrison, S. M.; Downs, R. T.; Blake, D. F.; Bish, D. L.; Ming, D. W.; Morris, R. V.; Yen, A. S.; Chipera, S. J.; Treiman, A. H.; Vaniman, D. T.;
2015-01-01
The CheMin instrument on the Mars Science Laboratory rover Curiosity performed X-ray diffraction analyses on scooped soil at Rocknest and on drilled rock fines at Yellowknife Bay (John Klein and Cumberland samples), The Kimberley (Windjana sample), and Pahrump (Confidence Hills sample) in Gale crater, Mars. Samples were analyzed with the Rietveld method to determine the unit-cell parameters and abundance of each observed crystalline phase. Unit-cell parameters were used to estimate compositions of the major crystalline phases using crystal-chemical techniques. These phases include olivine, plagioclase and clinopyroxene minerals. Comparison of the CheMin sample unit-cell parameters with those in the literature provides an estimate of the chemical compositions of the major crystalline phases. Preliminary unit-cell parameters, abundances and compositions of crystalline phases found in Rocknest and Yellowknife Bay samples were reported in. Further instrument calibration, development of 2D-to- 1D pattern conversion corrections, and refinement of corrected data allows presentation of improved compositions for the above samples.
Taketa, Midori; Nakagawa, Hanae; Habukawa, Mao; Osuka, Hisao; Kihira, Kiyohito; Komori, Hirofumi; Shibata, Naoki; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi; Yoon, Ki-Seok; Ogo, Seiji; Shomura, Yasuhito; Higuchi, Yoshiki
2015-01-01
NAD+-reducing [NiFe] hydrogenases catalyze the oxidoreduction of dihydrogen concomitant with the interconversion of NAD+ and NADH. Here, the isolation, purification and crystallization of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1 are reported. Crystals of the NAD+-reducing [NiFe] hydrogenase were obtained within one week from a solution containing polyethylene glycol using the sitting-drop vapour-diffusion method and micro-seeding. The crystal diffracted to 2.58 Å resolution and belonged to space group C2, with unit-cell parameters a = 131.43, b = 189.71, c = 124.59 Å, β = 109.42°. Assuming the presence of two NAD+-reducing [NiFe] hydrogenase molecules in the asymmetric unit, V M was calculated to be 2.2 Å3 Da−1, which corresponds to a solvent content of 43%. Initial phases were determined by the single-wavelength anomalous dispersion method using the anomalous signal from the Fe atoms. PMID:25615977
Off-axis mirror fabrication from spherical surfaces under mechanical stress
NASA Astrophysics Data System (ADS)
Izazaga-Pérez, R.; Aguirre-Aguirre, D.; Percino-Zacarías, M. E.; Granados-Agustín, Fermin-Salomon
2013-09-01
The preliminary results in the fabrication of off-axis optical surfaces are presented. The propose using the conventional polishing method and with the surface under mechanical stress at its edges. It starts fabricating a spherical surface using ZERODUR® optical glass with the conventional polishing method, the surface is deformed by applying tension and/or compression at the surface edges using a specially designed mechanical mount. To know the necessary deformation, the interferogram of the deformed surface is analyzed in real time with a ZYGO® Mark II Fizeau type interferometer, the mechanical stress is applied until obtain the inverse interferogram associated to the off-axis surface that we need to fabricate. Polishing process is carried out again until obtain a spherical surface, then mechanical stress in the edges are removed and compares the actual interferogram with the theoretical associated to the off-axis surface. To analyze the resulting interferograms of the surface we used the phase shifting analysis method by using a piezoelectric phase-shifter and Durango® interferometry software from Diffraction International™.
NASA Astrophysics Data System (ADS)
El-Faham, Ayman; Soliman, Saied M.; Ghabbour, Hazem A.; Elnakady, Yasser A.; Mohaya, Talal A.; Siddiqui, Mohammed R. H.; Albericio, Fernando
2016-12-01
Novel series of s-triazine-Schiff base derivatives were synthesized employing ultrasonic irradiation and characterized by NMR (1H and 13C), FT-IR, and elemental analysis. The use of ultrasonic irradiation has allowed the preparation of the target products with better yields in shorter reaction time and excellent purities compared to the conventional heating. X-ray single crystal diffraction experiments verified the molecular structure of four from the new prepared s-triaizne-Schiff base derivatives. The molecular structures of the studied compounds are computerized using DFT/B3LYP method. The effects of substituent at the triazine and phenyl ring on the electronic and spectroscopic properties of the studied compounds were also investigated. The natural atomic charges showed that pipridino-s-triazine derivatives are richer in electrons than those having morpholino derivatives. The anti-proliferative effects for the prepared compounds were tested against three different cancer cell lines.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kapetaniou, Evangelia G.; Kotsifaki, Dina; Providaki, Mary
2007-01-01
The DNA methyltransferase M.BseCI from B. stearothermophilus was crystallized as a complex with its cognate DNA. Crystals belong to space group P6 and diffract to 2.5 Å resolution at a synchrotron source. The DNA methyltransferase M.BseCI from Bacillus stearothermophilus (EC 2.1.1.72), a 579-amino-acid enzyme, methylates the N6 atom of the 3′ adenine in the sequence 5′-ATCGAT-3′. M.BseCI was crystallized in complex with its cognate DNA. The crystals were found to belong to the hexagonal space group P6, with unit-cell parameters a = b = 87.0, c = 156.1 Å, β = 120.0° and one molecule in the asymmetric unit. Twomore » complete data sets were collected at wavelengths of 1.1 and 2.0 Å to 2.5 and 2.8 Å resolution, respectively, using synchrotron radiation at 100 K.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiu-Fu, Lu, E-mail: jiufulu@163.com; Hong-Guang, Ge; Juan, Shi
2015-12-15
Reaction of 2-(1-methyl-1,2-dihydroimidazol-3-yl)acetonitrile tetrafluoroborate with silver oxide in dichloromethane readily yields [Ag(DIM){sub 2}]BF{sub 4}, where DIM is 2-(1-methyl-1, 2-dihydroimidazol-3-yl)acetonitrile, representing a carbene organic ligand. The title compound was characterized by elemental analysis, IR, MS and single crystal X-ray diffraction. The crystal is of monoclinic system, space group C2/c with a = 14.010(18), b = 8.303(11), c = 14.936(20) Å, β = 93.910(4)°, V = 1639(4) Å{sup 3}, Z = 4, D{sub x} = 1.771 g/cm{sup 3}, F (000) = 864, µ(MoK{sub α}) = 1.278 mm{sup –1}. The final R{sup 1} = 0.0711 and wR{sup 2} = 0.1903 for reflections withmore » I > 2σ(I). In addition, the preliminary biological test showed that the title compound had anti-fungus yeast activity.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamada, Mototsugu, E-mail: mototsugu-yamada@meiji.co.jp; Watanabe, Takashi; Baba, Nobuyoshi
The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 86.39,more » c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir
The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bourke, Mark Andrew; Vogel, Sven C.; Voit, Stewart Lancaster
Tomographic imaging and diffraction measurements were performed on nine pellets; four UN/ U Si composite formulations (two enrichment levels), three pure U 3Si 5 reference formulations (two enrichment levels) and two reject pellets with visible flaws (to qualify the technique). The U-235 enrichments ranged from 0.2 to 8.8 wt.%. The nitride/silicide composites are candidate compositions for use as Accident Tolerant Fuel (ATF). The monophase U 3Si 5 material was included as a reference. Pellets from the same fabrication batches will be inserted in the Advanced Test Reactor at Idaho during 2016. The goal of the Advanced Non-destructive Fuel Examination workmore » package is the development and application of non-destructive neutron imaging and scattering techniques to ceramic and metallic nuclear fuels. Data reported in this report were collected in the LANSCE run cycle that started in September 2015 and ended in March 2016. Data analysis is ongoing; thus, this report provides a preliminary review of the measurements and provides an overview of the characterized samples.« less
Kuzu, Mutlu; Niefind, Karsten; Hummel, Werner; Schomburg, Dietmar
2005-01-01
NADH oxidase (NOX) from Lactobacillus brevis is a homotetrameric flavoenzyme composed of 450 amino acids per subunit. The molecular weight of each monomer is 48.8 kDa. The enzyme catalyzes the oxidation of two equivalents of NADH and reduces one equivalent of oxygen to yield two equivalents of water, without releasing hydrogen peroxide after the reduction of the first equivalent of NADH. Crystals of this protein were grown in the presence of 34% polyethylene glycol monomethyl ether 2000, 0.1 M sodium acetate and 0.2 M ammonium sulfate at pH 5.4. They belong to the tetragonal space group P43212, with unit-cell parameters a = 74.8, b = 95.7, c = 116.9 Å, α = γ = 90, β = 103.8°. The current diffraction limit is 4.0 Å. The self-rotation function of the native data set is consistent with a NOX tetramer in the asymmetric unit. PMID:16511087
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huché, Frédéric, E-mail: huche@pasteur.fr; Unité des Membranes Bactériennes, CNRS URA 2172, Département de Microbiologie Fondamentale et Médicale, Institut Pasteur, 25-28 Rue du Dr Roux, 75724 Paris CEDEX 15; Delepelaire, Philippe
2006-01-01
The expression, purification, and crystallization in space group P2{sub 1}2{sub 1}2{sub 1} of the complex HasA-HasR from S. marcescens are reported. Diffraction data have been collected and processed to 6.8 Å. Serratia marcescens is able to acquire iron using its haem-acquisition system (‘has’), which contains an outer membrane receptor HasR and a soluble haemophore HasA. After secretion, HasA binds free haem in the extracellular medium or extracts it from haemoproteins and delivers it to the receptor. Here, the crystallization of a HasA–HasR complex is reported. HasA and HasR have been overexpressed in Escherichia coli and the complex formed and crystallized.more » Small platelets and bunches of needles of dimensions 0.01 × 0.1 × 1 mm were obtained. A native data set has been collected to 6.8 Å.« less
Park, Sun Hee; Piao, Shunfu; Kwon, Hyun-Mi; Kim, Eun-Hye; Lee, Bok Luel; Ha, Nam-Chul
2010-01-01
The Toll signalling pathway, which is crucial for innate immunity, is transduced in insect haemolymph via a proteolytic cascade consisting of three serine proteases. The proteolytic cascade is downregulated by a specific serine protease inhibitor (serpin). Recently, the serpin SPN48 was found to show an unusual specific reactivity towards the terminal serine protease, Spätzle-processing enzyme, in the beetle Tenebrio molitor. In this study, the mature form of SPN48 was overexpressed in Escherichia coli and purified. The purified SPN48 protein was crystallized using 14% polyethylene glycol 8000 and 0.1 M 2-(N-morpholino)ethanesulfonic acid pH 6.0 as the precipitant. The crystals diffracted X-rays to 2.1 Å resolution and were suitable for structure determination. The crystals belonged to space group P21. The crystal structure will provide information regarding how SPN48 achieves its unusual specificity for its target protease. PMID:20124722
Structural analysis and antimicrobial activity of 2[1H]-pyrimidinethione/selenone derivatives
NASA Astrophysics Data System (ADS)
Żesławska, Ewa; Korona-Głowniak, Izabela; Szczesio, Małgorzata; Olczak, Andrzej; Żylewska, Alicja; Tejchman, Waldemar; Malm, Anna
2017-08-01
Four new crystal structures of sulfur and selenium analogues of 2[1H]-pyrimidinone derivatives were determined with the use of X-ray diffraction method. The molecular geometry and intermolecular interactions of the investigated molecules were analyzed in order to find the structural features and geometrical parameters, which can be responsible for antimicrobial activities. The influence of chalcogen substituents (sulfur and selenium) on the crystal packing was also studied. The main differences in the molecular structures exist in mutual arrangement of two aromatic rings. The intermolecular interactions in all investigated compounds are similar. Furthermore, the in vitro antibacterial and antifungal activities for these compounds were evaluated. Preliminary investigations have identified two highly potent antibacterial compounds containing selenium atom, which display selectivity towards staphylococci and micrococci. This selectivity was not observed for a control compound used as a drug, namely vancomycin. These compounds possess also good antifungal activity. This is the first report of biological activities of 2[1H]-pyrimidineselenone derivatives.
The Growth of Protein Crystals Using McDUCK
NASA Technical Reports Server (NTRS)
Ewing, Felicia; Wilson, Lori; Nadarajah, Arunan; Pusey, Marc
1998-01-01
Most of the current microgravity crystal growth hardware is optimized to produce crystals within the limited time available on orbit. This often results in the actual nucleation and growth process being rushed or the system not coming to equilibrium within the limited time available. Longer duration hardware exists, but one cannot readily pick out crystals grown early versus those which nucleated and grew more slowly. We have devised a long duration apparatus, the Multi-chamber Dialysis Unit for Crystallization Kinetics, or McDUCK. This apparatus-is a series of protein chambers, stacked upon a precipitant reservoir chamber. All chambers are separated by a dialysis membrane, which serves to pass small molecules while retaining the protein. The volume of the Precipitant chamber is equal to the sum of the volumes of the protein chamber. In operation, the appropriate chambers are filled with precipitant solution or protein solution, and the McDUCK is placed standing upright, with the precipitant chamber on the bottom. The precipitant diffuses upwards over time, with the time to reach equilibration a function of the diffusivity of the precipitant and the overall length of the diffusion pathway. Typical equilibration times are approximately 2-4 months, and one can readily separate rapid from slow nucleation and growth crystals. An advantage on Earth is that the vertical precipitant concentration gradient dominates that of the solute, thus dampening out solute density gradient driven convective flows. However, large Earth-grown crystals have so far tended to be more two dimensional. Preliminary X-ray diffraction analysis of lysozyme crystals grown in McDUCK have indicated that the best, and largest, come from the middle chambers, suggesting that there is an optimal growth rate. Further, the improvements in diffraction resolution have been better signal to noise ratios in the low resolution data, not an increase in resolution overall. Due to the persistently large crystals grown we are currently proposing McDUCK for the growth of macromolecule crystals for use in neutron diffraction studies.
Publications - GMC 95 | Alaska Division of Geological & Geophysical Surveys
DGGS GMC 95 Publication Details Title: X-ray diffraction analysis of seven core samples from the information. Bibliographic Reference Bergman, S.C., and Stuart, C.J., 1988, X-ray diffraction analysis of
40 CFR 158.345 - Preliminary analysis.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...
40 CFR 158.345 - Preliminary analysis.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...
40 CFR 158.345 - Preliminary analysis.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...
40 CFR 158.345 - Preliminary analysis.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...
40 CFR 158.345 - Preliminary analysis.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...
10 CFR 830.206 - Preliminary documented safety analysis.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Preliminary documented safety analysis. 830.206 Section 830.206 Energy DEPARTMENT OF ENERGY NUCLEAR SAFETY MANAGEMENT Safety Basis Requirements § 830.206 Preliminary documented safety analysis. If construction begins after December 11, 2000, the contractor...
Micro X-ray diffraction analysis of thin films using grazing-exit conditions.
Noma, T; Iida, A
1998-05-01
An X-ray diffraction technique using a hard X-ray microbeam for thin-film analysis has been developed. To optimize the spatial resolution and the surface sensitivity, the X-ray microbeam strikes the sample surface at a large glancing angle while the diffracted X-ray signal is detected with a small (grazing) exit angle. Kirkpatrick-Baez optics developed at the Photon Factory were used, in combination with a multilayer monochromator, for focusing X-rays. The focused beam size was about 10 x 10 micro m. X-ray diffraction patterns of Pd, Pt and their layered structure were measured. Using a small exit angle, the signal-to-background ratio was improved due to a shallow escape depth. Under the grazing-exit condition, the refraction effect of diffracted X-rays was observed, indicating the possibility of surface sensitivity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Haishuang; Krysiak, Yaşar; Hoffmann, Kristin
The crystal structure and disorder phenomena of Al{sub 4}B{sub 2}O{sub 9}, an aluminum borate from the mullite-type family, were studied using automated diffraction tomography (ADT), a recently established method for collection and analysis of electron diffraction data. Al{sub 4}B{sub 2}O{sub 9}, prepared by sol-gel approach, crystallizes in the monoclinic space group C2/m. The ab initio structure determination based on three-dimensional electron diffraction data from single ordered crystals reveals that edge-connected AlO{sub 6} octahedra expanding along the b axis constitute the backbone. The ordered structure (A) was confirmed by TEM and HAADF-STEM images. Furthermore, disordered crystals with diffuse scattering along themore » b axis are observed. Analysis of the modulation pattern implies a mean superstructure (AAB) with a threefold b axis, where B corresponds to an A layer shifted by ½a and ½c. Diffraction patterns simulated for the AAB sequence including additional stacking disorder are in good agreement with experimental electron diffraction patterns. - Graphical abstract: Crystal structure and disorder phenomena of B-rich Al{sub 4}B{sub 2}O{sub 9} studied by automated electron diffraction tomography (ADT) and described by diffraction simulation using DISCUS. - Highlights: • Ab-initio structure solution by electron diffraction from single nanocrystals. • Detected modulation corresponding mainly to three-fold superstructure. • Diffuse diffraction streaks caused by stacking faults in disordered crystals. • Observed streaks explained by simulated electron diffraction patterns.« less
Analysis of the role of diffraction in topographic site effects using boundary element techniques
NASA Astrophysics Data System (ADS)
Gomez, Juan; Restrepo, Doriam; Jaramillo, Juan; Valencia, Camilo
2013-10-01
The role played by the diffraction field on the problem of seismic site effects is studied. For that purpose we solve and analyze simple scattering problems under P and SV in-plane wave assumptions, using two well known direct boundary-element-based numerical methods. After establishing the difference between scattered and diffracted motions, and introducing the concept of artificious and physically based incoming fields, we obtain the amplitude of the Fourier spectra for the diffracted part of the response: this is achieved after establishing the connection between the spatial distribution of the transfer function over the studied simple topographies and the diffracted field. From the numerical simulations it is observed that this diffracted part of the response is responsible for the amplification of the surface ground motions due to the geometric effect. Furthermore, it is also found that the diffraction field sets in a fingerprint of the topographic effect in the total ground motions. These conclusions are further supported by observations in the time-domain in terms of snapshots of the propagation patterns over the complete computational model. In this sense the geometric singularities are clearly identified as sources of diffraction and for the considered range of dimensionless frequencies it is evident that larger amplifications are obtained for the geometries containing a larger number of diffraction sources thus resulting in a stronger topographic effect. The need for closed-form solutions of canonical problems to construct a robust analysis method based on the diffraction field is identified.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-03
...-preliminary analysis and released the results of the analysis on May 19, 2010. We gave the interested parties an opportunity to comment on the Preliminary Results and the post-preliminary analysis. Based on our analysis of the comments received, we have made changes to the margin calculation. The final weighted...
Surface modification of TiO2 nanotubes by grafting with APTS coupling agents
NASA Astrophysics Data System (ADS)
Phan Duong, Hong; Le, Minh Duc; Dao, Hung Cuong; Chen, Chia-Yun
2017-10-01
Titanium dioxide nanotubes (TNTs) have been considered the promising nanostructures employed for many practical applications such as biomedical, photonic and optoelectronic devices. Nevertheless, strong aggregation of TNTs within various aqueous media significantly hindered their practical utilizations and the capability of dispersing TNTs in the desired solvents are urgent to be improved. Therefore, in this study, the methodic investigations have been performed on the grafted modification of 3-aminopropyl triethoxysilane (APTS) on the surfaces of synthesized TNTs. A preliminary study was carried out to evaluate the influences of key parameters, including the concentrations of coupling agents, temperatures and the reaction durations, on the grafting efficiency of the aminosilane using Statistical design of experiments (DoE) methodology. TNTs with approximately 10-20 nm in diameter were prepared with the controlled hydrothermal treatment of commercialized P25 particles. The obtained products were revealed by the modern physicochemical systems including x-ray diffraction (XRD), transmission electron microscopy (TEM) and Brunauer-Emmett-Teller (BET) analysis. The additions of silane agent, reaction temperature and time have been adjusted to reveal the influences of the grafting efficiency (from 2.5 to 7.8 wt %) by thermal gravimetric analysis (TGA). Analysis of Fourier transform infrared spectroscopy (FTIR) has confirmed the successful link of Ti-O-Si chemical bonds on the grafted TNTs.
Advanced Test Reactor National Scientific User Facility (ATR NSUF) Monthly ReportJanuary 2015
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soelberg, Renae
2015-01-01
Highlights; Mike Worley and Shane Johnson visited INL Jan. 22 for an NSUF strategy discussion; Rory Kennedy attended a NSLS-2 Beamline Advisory Team meeting at Brookhaven; Provided a final cost estimate to the NSUF Program Office in support of the NEET/NSUF proposal, “Metal-ceramic and metal-metal composites for extreme radiation and temperature environment: An in situ interface stability and mechanical behavior study by high energy x-ray diffraction with a synchrotron probe.”; Assisted in the development of conceptual designs and performed a preliminary thermal hydraulic analysis for two NEET/NSUF proposals. The challenge for both experiments is to provide high (>1000 C andmore » up to 1600 C)) specimen temperatures in a small space (0.5" diameter ATR Outboard A-position) without overheating the coolant. Several designs were analyzed and found to be feasible, although detailed design and analysis will be required after the projects are awarded; and A single USU TEM specimen is packaged and awaiting shipment from MFC to CAES. Once at CAES, SEM, TEM and LEAP analysis will be performed. Professor Ban has requested additional sub-samples to be made to take back to his laboratory at USU for thermal diffusivity studies.« less
Publications - GMC 361 | Alaska Division of Geological & Geophysical
DGGS GMC 361 Publication Details Title: X-ray Diffraction Analysis of: Drew Point #1, East Simpson Test , 2009, X-ray Diffraction Analysis of: Drew Point #1, East Simpson Test Well #1, East Simpson #2
Publications - GMC 41 | Alaska Division of Geological & Geophysical Surveys
DGGS GMC 41 Publication Details Title: X-ray diffraction clay mineralogy analysis of core samples from Unknown, [n.d.], X-ray diffraction clay mineralogy analysis of core samples from Mobil West Staines State
Image contrast of diffraction-limited telescopes for circular incoherent sources of uniform radiance
NASA Technical Reports Server (NTRS)
Shackleford, W. L.
1980-01-01
A simple approximate formula is derived for the background intensity beyond the edge of the image of uniform incoherent circular light source relative to the irradiance near the center of the image. The analysis applies to diffraction-limited telescopes with or without central beam obscuration due to a secondary mirror. Scattering off optical surfaces is neglected. The analysis is expected to be most applicable to spaceborne IR telescopes, for which diffraction can be the major source of off-axis response.
Analysis of XFEL serial diffraction data from individual crystalline fibrils
Wojtas, David H.; Ayyer, Kartik; Liang, Mengning; Mossou, Estelle; Romoli, Filippo; Seuring, Carolin; Beyerlein, Kenneth R.; Bean, Richard J.; Morgan, Andrew J.; Oberthuer, Dominik; Fleckenstein, Holger; Heymann, Michael; Gati, Cornelius; Yefanov, Oleksandr; Barthelmess, Miriam; Ornithopoulou, Eirini; Galli, Lorenzo; Xavier, P. Lourdu; Ling, Wai Li; Frank, Matthias; Yoon, Chun Hong; White, Thomas A.; Bajt, Saša; Mitraki, Anna; Boutet, Sebastien; Aquila, Andrew; Barty, Anton; Forsyth, V. Trevor; Chapman, Henry N.; Millane, Rick P.
2017-01-01
Serial diffraction data collected at the Linac Coherent Light Source from crystalline amyloid fibrils delivered in a liquid jet show that the fibrils are well oriented in the jet. At low fibril concentrations, diffraction patterns are recorded from single fibrils; these patterns are weak and contain only a few reflections. Methods are developed for determining the orientation of patterns in reciprocal space and merging them in three dimensions. This allows the individual structure amplitudes to be calculated, thus overcoming the limitations of orientation and cylindrical averaging in conventional fibre diffraction analysis. The advantages of this technique should allow structural studies of fibrous systems in biology that are inaccessible using existing techniques. PMID:29123682
Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi
2010-05-01
The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.
Double-pulse laser-induced breakdown spectroscopy analysis of scales from petroleum pipelines
NASA Astrophysics Data System (ADS)
Cavalcanti, G. H.; Rocha, A. A.; Damasceno, R. N.; Legnaioli, S.; Lorenzetti, G.; Pardini, L.; Palleschi, V.
2013-09-01
Pipeline scales from the Campos Bay Petroleum Field near Rio de Janeiro, Brazil have been analyzed by both Raman spectroscopy and by laser-induced breakdown spectroscopy (LIBS) using a double-pulse, calibration-free approach. Elements that are characteristic of petroleum (e.g. C, H, N, O, Mg, Na, Fe and V) were detected, in addition to the Ca, Al, and Si which form the matrix of the scale. The LIBS results were compared with the results of micro-Raman spectroscopy, which confirmed the nature of the incrustations inferred by the LIBS analysis. Results of this preliminary study suggest that diffusion of pipe material into the pipeline intake column plays an important role in the growth of scale. Thanks to the simplicity and relative low cost of equipment and to the fact that no special chemical pre-treatment of the samples is needed, LIBS can offer very fast acquisition of data and the possibility of in situ measurements. LIBS could thus represent an alternative or complementary method for the chemical characterization of the scales by comparison to conventional analytical techniques, such as X-ray diffraction or X-ray fluorescence.
NASA Astrophysics Data System (ADS)
Gordina, N. E.; Prokof'ev, V. Yu.; Khramtsova, A. P.; Cherednikova, D. S.; Konstantinova, E. M.
2018-05-01
Processes of the thermal treatment of 6Al2Si4O7: 12NaOH mixtures for the synthesis of zeolites are studied. The mixtures are subjected to ultrasonic treatment and mechanochemical activation, after which the suspensions are evaporated, granulated, and dried. The study is performed using X-ray diffraction, synchronous thermal analysis, and electron microscopy. It is established that calcination below 500°C leads to the dehydration of the LTA zeolite and sodium hydroaluminates formed earlier, and Al2Si4O7 reacts with LTA and NaOH in the range of 500-800°C to form Na6Al4Si4O17 and Na8Al4Si4O18. Using the Ozawa-Flynn-Wall and Kissinger-Akahira-Sunose methods, the apparent activation energies (E) are calculated for this range. The two methods yield close results. It is found that E grows from 30-80 to 240-300 kJ/mol as conversion increases. It is shown that preliminary ultrasonic treatment and mechanochemical activation reduce apparent energy of activation E due to changes in the morphology of particles.
Stalder, Claudio; Rüggeberg, Andres; Neururer, Christoph; Spangenberg, Jorge E.; Spezzaferri, Silvia
2018-01-01
The marine environment in the Gulf of Gabes (southern Tunisia) is severely impacted by phosphate industries. Nowadays, three localities, Sfax, Skhira and Gabes produce phosphoric acid along the coasts of this Gulf and generate a large amount of phosphogypsum as a waste product. The Gabes phosphate industry is the major cause of pollution in the Gulf because most of the waste is directly discharged into the sea without preliminary treatment. This study investigates the marine environment in the proximity of the phosphate industries of Gabes and the coastal marine environment on the eastern coast of Djerba, without phosphate industry. This site can be considered as "pristine" and enables a direct comparison between polluted and “clean” adjacent areas. Phosphorous, by sequential extractions (SEDEX), Rock-Eval, C, H, N elemental analysis, and stable carbon isotope composition of sedimentary organic matter, X-ray diffraction (qualitative and quantitative analysis) were measured on sediments. Temperature, pH and dissolved oxygen were measured on the water close to the sea floor of each station to estimate environmental conditions. These analyses are coupled with video surveys of the sea floor. This study reveals clear differentiations in pollution and eutrophication in the investigated areas. PMID:29771969
NASA Technical Reports Server (NTRS)
Nakamura, T.; Noguchi, T.; Tsuchiyama, A.; Ushikubo, T.; Kita, N. T.; Valley, J. W.; Zolensky, M. E.; Kakazu, Y.; Sakamoto, K.; Mashio, E.;
2008-01-01
Preliminary examinations of small dust particles from comet 82P/Wild 2 revealed many expected and unexpected features. Among them the most striking feature is the presence of abundant crystalline material in the comet. Synchrotron radiation X-ray diffraction and microtomography are the most efficient methods to detect and describe bulk mineralogical features of crystalline cometary particles. In the present study, in addition to these two non-destructive techniques, electron microscopy and ion-probe mass spectrometry were carried out on the four crystalline particles.
Horsham, Matt; Saxby, Harriet; Blake, James; Isaacs, Neil W.; Mitchell, Tim J.; Riboldi-Tunnicliffe, Alan
2010-01-01
The enzyme transketolase from the lactic acid bacterium Lactobacillus salivarius (subsp. salivarius UCC118) has been recombinantly expressed and purified using an Escherichia coli expression system. Purified transketolase from L. salivarius has been crystallized using the vapour-diffusion technique. The crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 75.43, c = 184.11 Å, and showed diffraction to 2.3 Å resolution. PMID:20693662
Texture and phase analysis of deformed SUS304 by using HIPPO
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takajo, Shigehiro; Vogel, Sven C.
2016-11-15
These slides represent the author's research activity at Los Alamos National Laboratory (LANL), which is about texture and phase analysis of deformed SUS304 by using HIPPO. The following topics are covered: diffraction histogram at each sample position, diffraction histogram (all bank data averaged), possiblity of ε-phase, MAUD analysis with including ε-phase.
Instrumentation progress at the Giant Magellan Telescope project
NASA Astrophysics Data System (ADS)
Jacoby, George H.; Bernstein, R.; Bouchez, A.; Colless, M.; Crane, Jeff; DePoy, D.; Espeland, B.; Hare, Tyson; Jaffe, D.; Lawrence, J.; Marshall, J.; McGregor, P.; Shectman, Stephen; Sharp, R.; Szentgyorgyi, A.; Uomoto, Alan; Walls, B.
2016-08-01
Instrument development for the 24m Giant Magellan Telescope (GMT) is described: current activities, progress, status, and schedule. One instrument team has completed its preliminary design and is currently beginning its final design (GCLEF, an optical 350-950 nm, high-resolution and precision radial velocity echelle spectrograph). A second instrument team is in its conceptual design phase (GMACS, an optical 350-950 nm, medium resolution, 6-10 arcmin field, multi-object spectrograph). A third instrument team is midway through its preliminary design phase (GMTIFS, a near-IR YJHK diffraction-limited imager/integral-field-spectrograph), focused on risk reduction prototyping and design optimization. A fourth instrument team is currently fabricating the 5 silicon immersion gratings needed to begin its preliminary design phase (GMTNIRS, a simultaneous JHKLM high-resolution, AO-fed, echelle spectrograph). And, another instrument team is focusing on technical development and prototyping (MANIFEST, a facility robotic, multifiber feed, with a 20 arcmin field of view). In addition, a medium-field (6 arcmin, 0.06 arcsec/pix) optical imager will support telescope and AO commissioning activities, and will excel at narrow-band imaging. In the spirit of advancing synergies with other groups, the challenges of running an ELT instrument program and opportunities for cross-ELT collaborations are discussed.
Skab, Ihor; Vlokh, Rostyslav
2012-04-01
Acousto-optic diffraction of light in optically active cubic crystals is analyzed from the viewpoint of conservation of optical angular momentum. It is shown that the availability of angular momentum in the diffracted optical beam can be necessarily inferred from the requirements of angular momentum conservation law. As follows from our analysis, a circularly polarized diffracted wave should bear an orbital angular momentum. The efficiency of the spin-to-orbit momentum conversion is governed by the efficiency of acousto-optic diffraction.
ERIC Educational Resources Information Center
Loehlin, James H.; Norton, Alexandra P.
1988-01-01
Describes a crystallography experiment using both diffraction-angle and diffraction-intensity information to determine the lattice constant and a lattice independent molecular parameter, while still employing standard X-ray powder diffraction techniques. Details the method, experimental details, and analysis for this activity. (CW)
NASA Astrophysics Data System (ADS)
Suchwalko, Agnieszka; Buzalewicz, Igor; Podbielska, Halina
2012-01-01
In the presented paper the optical system with converging spherical wave illumination for classification of bacteria species, is proposed. It allows for compression of the observation space, observation of Fresnel patterns, diffraction pattern scaling and low level of optical aberrations, which are not possessed by other optical configurations. Obtained experimental results have shown that colonies of specific bacteria species generate unique diffraction signatures. Analysis of Fresnel diffraction patterns of bacteria colonies can be fast and reliable method for classification and recognition of bacteria species. To determine the unique features of bacteria colonies diffraction patterns the image processing analysis was proposed. Classification can be performed by analyzing the spatial structure of diffraction patterns, which can be characterized by set of concentric rings. The characteristics of such rings depends on the bacteria species. In the paper, the influence of basic features and ring partitioning number on the bacteria classification, is analyzed. It is demonstrated that Fresnel patterns can be used for classification of following species: Salmonella enteritidis, Staplyococcus aureus, Proteus mirabilis and Citrobacter freundii. Image processing is performed by free ImageJ software, for which a special macro with human interaction, was written. LDA classification, CV method, ANOVA and PCA visualizations preceded by image data extraction were conducted using the free software R.
Schellenberger, Pascale; Demangeat, Gérard; Lemaire, Olivier; Ritzenthaler, Christophe; Bergdoll, Marc; Oliéric, Vincent; Sauter, Claude; Lorber, Bernard
2011-05-01
The small icosahedral plant RNA nepovirus Grapevine fanleaf virus (GFLV) is specifically transmitted by a nematode and causes major damage to vineyards worldwide. To elucidate the molecular mechanisms underlying the recognition between the surface of its protein capsid and cellular components of its vector, host and viral proteins synthesized upon infection, the wild type GFLV strain F13 and a natural mutant (GFLV-TD) carrying a Gly₂₉₇Asp mutation were purified, characterized and crystallized. Subsequently, the geometry and volume of their crystals was optimized by establishing phase diagrams. GFLV-TD was twice as soluble as the parent virus in the crystallization solution and its crystals diffracted X-rays to a resolution of 2.7 Å. The diffraction limit of GFLV-F13 crystals was extended from 5.5 to 3 Å by growth in agarose gel. Preliminary crystallographic analyses indicate that both types of crystals are suitable for structure determination. Keys for the successful production of GFLV crystals include the rigorous quality control of virus preparations, crystal quality improvement using phase diagrams, and crystal lattice reinforcement by growth in agarose gel. These strategies are applicable to the production of well-diffracting crystals of other viruses and macromolecular assemblies. Copyright © 2011 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, Edward B.; Gurda-Whitaker, Brittney; Govindasamy, Lakshmanan
2006-12-01
Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. The diffraction data were subsequently processed and reduced with an overall R{sub sym} of 12.3% and a completeness of 89.0%. Based on the unit-cellmore » volume, rotation-function and translation-function results and packing considerations, there is one virus capsid (60 viral proteins) per unit cell and there are ten viral proteins per crystallographic asymmetric unit. The AAV1 capsid shares both the twofold and threefold crystallographic symmetry operators. The AAV1 data have been initially phased using a polyalanine model (based on the crystal structure of AAV4) to 4.0 Å resolution and the structure determination and refinement is in progress using tenfold noncrystallographic symmetry electron-density averaging.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie
2005-01-01
The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less
NASA Astrophysics Data System (ADS)
Robertson, J. Gordon; Bland-Hawthorn, Joss
2012-09-01
As telescopes get larger, the size of a seeing-limited spectrograph for a given resolving power becomes larger also, and for ELTs the size will be so great that high resolution instruments of simple design will be infeasible. Solutions include adaptive optics (but not providing full correction for short wavelengths) or image slicers (which give feasible but still large instruments). Here we develop the solution proposed by Bland-Hawthorn and Horton: the use of diffraction-limited spectrographs which are compact even for high resolving power. Their use is made possible by the photonic lantern, which splits a multi-mode optical fiber into a number of single-mode fibers. We describe preliminary designs for such spectrographs, at a resolving power of R ~ 50,000. While they are small and use relatively simple optics, the challenges are to accommodate the longest possible fiber slit (hence maximum number of single-mode fibers in one spectrograph) and to accept the beam from each fiber at a focal ratio considerably faster than for most spectrograph collimators, while maintaining diffraction-limited imaging quality. It is possible to obtain excellent performance despite these challenges. We also briefly consider the number of such spectrographs required, which can be reduced by full or partial adaptive optics correction, and/or moving towards longer wavelengths.
Prabhudeva, Malledevarapura Gurumurthy; Bharath, Srinivasan; Kumar, Achutha Dileep; Naveen, Shivalingegowda; Lokanath, Neratur Krishnappagowda; Mylarappa, Bantaganahalli Ningappa; Kumar, Kariyappa Ajay
2017-08-01
Oxidative-stress induces inflammatory diseases and infections caused by drug-resistant microbial strains are on the rise necessitating the discovery of novel small-molecules for intervention therapy. The current study presents an effective and new green protocol for the synthesis of thiophene-appended pyrazoles through 3+2 annulations method. Chalcones 3(a-g) were prepared from 5-chloro-2-acetylthiophene and aromatic aldehydes by Claisen-Schmidt approach. The reaction of chalcones 3(a-g) with phenylhydrazine hydrochlorides 4(a-b) in acetic acid (30%) medium and also with freshly prepared citrus extract medium under reflux conditions produced the thiophene appended pyrazoles 5(a-l) in moderate yields. Structures of synthesized new pyrazoles were confirmed by spectral studies, elemental analysis and single crystal X-ray diffraction studies. Further, preliminary assessment of the anti-inflammatory properties of the compounds showed that, amongst the series, compounds 5d, 5e and 5l have excellent anti-inflammatory activities. Further, compounds 5c, 5d, 5g, and 5i exhibited excellent DPPH radical scavenging abilities in comparison with the standard ascorbic acid. Furthermore, using detailed structural modeling and docking efforts, combined with preliminary SAR, we show possible structural and chemical features on both the small-molecules and the protein that might contribute to the binding and inhibition. Copyright © 2017 Elsevier Inc. All rights reserved.
Diffraction analysis of customized illumination technique
NASA Astrophysics Data System (ADS)
Lim, Chang-Moon; Kim, Seo-Min; Eom, Tae-Seung; Moon, Seung Chan; Shin, Ki S.
2004-05-01
Various enhancement techniques such as alternating PSM, chrome-less phase lithography, double exposure, etc. have been considered as driving forces to lead the production k1 factor towards below 0.35. Among them, a layer specific optimization of illumination mode, so-called customized illumination technique receives deep attentions from lithographers recently. A new approach for illumination customization based on diffraction spectrum analysis is suggested in this paper. Illumination pupil is divided into various diffraction domains by comparing the similarity of the confined diffraction spectrum. Singular imaging property of individual diffraction domain makes it easier to build and understand the customized illumination shape. By comparing the goodness of image in each domain, it was possible to achieve the customized shape of illumination. With the help from this technique, it was found that the layout change would not gives the change in the shape of customized illumination mode.
Zhang, C.; Balachandran, S.; Eisenlohr, P.; ...
2017-10-04
The subsurface dislocation content in a Ti-5Al-2.5Sn (wt%) uniaxial tension sample deformed at ambient temperature was characterized by peak streak analysis of micro-Laue diffraction patterns collected non-destructively by differential aperture X-raymicroscopy, and with focused ion beam transmission electron microscopy of material in the same volume. This comparison reveals that micro-Laue diffraction streak analysis based on an edge dislocation assumption can accurately identify the dominant dislocation slip system history (Burgers vector and plane observed by TEM), despite the fact that dislocations have predominantly screw character. As a result, other dislocations identified by TEM were not convincingly discernible from the peak streakmore » analysis.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, C.; Balachandran, S.; Eisenlohr, P.
The subsurface dislocation content in a Ti-5Al-2.5Sn (wt%) uniaxial tension sample deformed at ambient temperature was characterized by peak streak analysis of micro-Laue diffraction patterns collected non-destructively by differential aperture X-raymicroscopy, and with focused ion beam transmission electron microscopy of material in the same volume. This comparison reveals that micro-Laue diffraction streak analysis based on an edge dislocation assumption can accurately identify the dominant dislocation slip system history (Burgers vector and plane observed by TEM), despite the fact that dislocations have predominantly screw character. As a result, other dislocations identified by TEM were not convincingly discernible from the peak streakmore » analysis.« less
NASA Astrophysics Data System (ADS)
Cook, Emily Jane
2008-12-01
This thesis presents the analysis of low angle X-ray scatter measurements taken with an energy dispersive system for substance identification, imaging and system control. Diffraction measurements were made on illicit drugs, which have pseudo- crystalline structures and thus produce diffraction patterns comprising a se ries of sharp peaks. Though the diffraction profiles of each drug are visually characteristic, automated detection systems require a substance identification algorithm, and multivariate analysis was selected as suitable. The software was trained with measured diffraction data from 60 samples covering 7 illicit drugs and 5 common cutting agents, collected with a range of statistical qual ities and used to predict the content of 7 unknown samples. In all cases the constituents were identified correctly and the contents predicted to within 15%. Soft tissues exhibit broad peaks in their diffraction patterns. Diffraction data were collected from formalin fixed breast tissue samples and used to gen erate images. Maximum contrast between healthy and suspicious regions was achieved using momentum transfer windows 1.04-1.10 and 1.84-1.90 nm_1. The resulting images had an average contrast of 24.6% and 38.9% compared to the corresponding transmission X-ray images (18.3%). The data was used to simulate the feedback for an adaptive imaging system and the ratio of the aforementioned momentum transfer regions found to be an excellent pa rameter. Investigation into the effects of formalin fixation on human breast tissue and animal tissue equivalents indicated that fixation in standard 10% buffered formalin does not alter the diffraction profiles of tissue in the mo mentum transfer regions examined, though 100% unbuffered formalin affects the profile of porcine muscle tissue (a substitute for glandular and tumourous tissue), though fat is unaffected.
Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.
2006-01-01
The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P41212 or P43212, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°. PMID:16820689
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin
2006-02-01
Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less
Shadfan, Adam; Pawlowski, Michal; Wang, Ye; Subramanian, Kaushik; Gabay, Ilan; Ben-Yakar, Adela; Tkaczyk, Tomasz
2016-01-01
A miniature laser ablation probe relying on an optical fiber to deliver light requires a high coupling efficiency objective with sufficient magnification in order to provide adequate power and field for surgery. A diffraction-limited optical design is presented that utilizes high refractive index zinc sulfide to meet specifications while reducing the miniature objective down to two lenses. The design has a hypercentric conjugate plane on the fiber side and is telecentric on the tissue end. Two versions of the objective were built on a diamond lathe—a traditional cylindrical design and a custom-tapered mount. Both received an antireflective coating. The objectives performed as designed in terms of observable resolution and field of view as measured by imaging a 1951 USAF resolution target. The slanted edge technique was used to find Strehl ratios of 0.75 and 0.78, respectively, indicating nearly diffraction-limited performance. Finally, preliminary ablation experiments indicated threshold fluence of gold film was comparable to similar reported probes. PMID:28579656
Velisavljevic, N.; Sinogeikin, S.; Saavedra, R.; ...
2014-05-07
Here, we have designed a portable pressure controller module to tune compression rates and maximum pressures attainable in a standard gas-membrane diamond anvil cell (DAC). During preliminary experiments, performed on zirconium (Zr) metal sample, pressure jumps of up to 80 GPa were systematically obtained in less than 0.2s (resulting in compression rate of few GPa/s up to more than 400 GPa/s). In-situ x-ray diffraction and electrical resistance measurements were performed simultaneously during this rapid pressure increase to provide the first time resolved data on α → ω → β structural evolution in Zr at high pressures. Direct control of compressionmore » rates and peak pressures, which can be held for prolonged time, allows for investigation of structural evolution and kinetics of structural phase transitions of materials under previously unexplored compression rate-pressure conditions that bridge traditional static and shock/dynamic experimental platforms.« less