Sample records for preliminary diffraction studies

  1. Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

    PubMed Central

    Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

    2009-01-01

    Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

  2. Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

    PubMed

    Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

    2009-10-01

    Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  3. Crystallization and preliminary X-ray diffraction study of the protealysin precursor belonging to the peptidase family M4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gromova, T. Yu., E-mail: duk@img.ras.ru; Demidyuk, I. V.; Kostrov, S. V.

    2008-09-15

    A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.

  4. Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

    The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

  5. Purification, isolation, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 from Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.

    2017-11-01

    The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.

  6. Preliminary small-angle X-ray scattering and X-ray diffraction studies of the BTB domain of lola protein from Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.

    2017-11-01

    The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.

  7. Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

    2006-04-01

    Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

  8. Crystallization and preliminary X-ray diffraction study of thermostable RNase HIII from Bacillus stearothermophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi

    2005-03-01

    A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.

  9. Expression, purification and preliminary X-ray diffraction studies of the transcriptional factor PyrR from Bacillus halodurans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arreola, Rodrigo; Vega-Miranda, Anita; Gómez-Puyou, Armando

    The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2{sub 1} with unit-cell parameters a = 59.7, b = 87.4, c =more » 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22{sub 1}2{sub 1} with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms.« less

  10. A scattering approach to sea wave diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Corradini, M. L., E-mail: letizia.corradini@unicam.it; Garbuglia, M., E-mail: milena.garbuglia@unicam.it; Maponi, P., E-mail: pierluigi.maponi@unicam.it

    This paper intends to show a model for the diffraction of sea waves approaching an OWC device, which converts the sea waves motion into mechanical energy and then electrical energy. This is a preliminary study to the optimisation of the device, in fact the computation of sea waves diffraction around the device allows the estimation of the sea waves energy which enters into the device. The computation of the diffraction phenomenon is the result of a sea waves scattering problem, solved with an integral equation method.

  11. Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Feifei; Gao, Feng; Li, Honglin

    The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

  12. Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction.

    PubMed

    Hughes, Ronny C; Coates, Leighton; Blakeley, Matthew P; Tomanicek, Steve J; Langan, Paul; Kovalevsky, Andrey Y; García-Ruiz, Juan M; Ng, Joseph D

    2012-12-01

    Inorganic pyrophosphatase (IPPase) from the archaeon Thermococcus thioreducens was cloned, overexpressed in Escherichia coli, purified and crystallized in restricted geometry, resulting in large crystal volumes exceeding 5 mm3. IPPase is thermally stable and is able to resist denaturation at temperatures above 348 K. Owing to the high temperature tolerance of the enzyme, the protein was amenable to room-temperature manipulation at the level of protein preparation, crystallization and X-ray and neutron diffraction analyses. A complete synchrotron X-ray diffraction data set to 1.85 Å resolution was collected at room temperature from a single crystal of IPPase (monoclinic space group C2, unit-cell parameters a=106.11, b=95.46, c=113.68 Å, α=γ=90.0, β=98.12°). As large-volume crystals of IPPase can be obtained, preliminary neutron diffraction tests were undertaken. Consequently, Laue diffraction images were obtained, with reflections observed to 2.1 Å resolution with I/σ(I) greater than 2.5. The preliminary crystallographic results reported here set in place future structure-function and mechanism studies of IPPase.

  13. Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

    PubMed

    Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

    2014-09-01

    TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

  14. Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.

    2008-08-01

    Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

  15. The NN-explore Exoplanet Stellar Speckle Imager: Instrument Description and Preliminary Results

    NASA Astrophysics Data System (ADS)

    Scott, Nicholas J.; Howell, Steve B.; Horch, Elliott P.; Everett, Mark E.

    2018-05-01

    A new speckle and wide-field imaging instrument for the WIYN telescope called NN-EXPLORE Exoplanet Stellar Speckle Imager (NESSI) is described. NESSI offers simultaneous two-color diffraction-limited imaging and wide-field traditional imaging for validation and characterization of transit and precision RV exoplanet studies. Many exoplanet targets will come from the NASA K2 and Transiting Exoplanet Survey Satellite (TESS) missions. NESSI is capable of resolving close binaries at sub-arcsecond separations down to the diffraction limit and >6 mag contrast difference in the visible band on targets as faint as 14th mag. Preliminary results from the instrument commissioning at WIYN and demonstrations of the instrument’s capabilities are presented.

  16. A preliminary neutron diffraction study of rasburicase, a recombinant urate oxidase enzyme, complexed with 8-azaxanthin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Budayova-Spano, Monika, E-mail: spano@embl-grenoble.fr; Institut Laue-Langevin, 6 Rue Jules Horowitz, BP 156, 38042 Grenoble; Bonneté, Françoise

    2006-03-01

    Neutron diffraction data of hydrogenated recombinant urate oxidase enzyme (Rasburicase), complexed with a purine-type inhibitor 8-azaxanthin, was collected to 2.1 Å resolution from a crystal grown in D{sub 2}O by careful control and optimization of crystallization conditions via knowledge of the phase diagram. Deuterium atoms were clearly seen in the neutron-scattering density map. Crystallization and preliminary neutron diffraction measurements of rasburicase, a recombinant urate oxidase enzyme expressed by a genetically modified Saccharomyces cerevisiae strain, complexed with a purine-type inhibitor (8-azaxanthin) are reported. Neutron Laue diffraction data were collected to 2.1 Å resolution using the LADI instrument from a crystal (grownmore » in D{sub 2}O) with volume 1.8 mm{sup 3}. The aim of this neutron diffraction study is to determine the protonation states of the inhibitor and residues within the active site. This will lead to improved comprehension of the enzymatic mechanism of this important enzyme, which is used as a protein drug to reduce toxic uric acid accumulation during chemotherapy. This paper illustrates the high quality of the neutron diffraction data collected, which are suitable for high-resolution structural analysis. In comparison with other neutron protein crystallography studies to date in which a hydrogenated protein has been used, the volume of the crystal was relatively small and yet the data still extend to high resolution. Furthermore, urate oxidase has one of the largest primitive unit-cell volumes (space group I222, unit-cell parameters a = 80, b = 96, c = 106 Å) and molecular weights (135 kDa for the homotetramer) so far successfully studied with neutrons.« less

  17. Synchrotron X-Ray Diffraction Analysis of Meteorites in Thin Section: Preliminary Results

    NASA Technical Reports Server (NTRS)

    Treiman, A. H.; Lanzirotti, A.; Xirouchakis, D.

    2004-01-01

    X-ray diffraction is the pre-eminent technique for mineral identification and structure determination, but is difficult to apply to grains in thin section, the standard meteorite preparation. Bright focused X-ray beams from synchrotrons have been used extensively in mineralogy and have been applied to extraterrestrial particles. The intensity and small spot size achievable in synchrotron X-ray beams makes them useful for study of materials in thin sections. Here, we describe Synchrotron X-ray Diffraction (SXRD) in thin section as done at the National Synchrotron Light Source, and cite examples of its value for studies of meteorites in thin section.

  18. Crystallization and preliminary X-ray diffraction analysis of the amidase domain of allophanate hydrolase from Pseudomonas sp. strain ADP

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balotra, Sahil; Newman, Janet; French, Nigel G.

    2014-02-19

    The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.

  19. STRUCTURE OF POTASSIUM HYDROGEN MALEATE BY NEUTRON DIFFRACTION

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peterson, S.W.; Levy, H.A.

    1958-10-01

    The preliminary results of a neutron diffraction study are presented which confirm the existence in potassium hydrogen maleate of a short, strong, hydrogen bond and show the ion to be at least statistically symmetrical. The hydrogen is strongly linked to both neighboring oxygen atoms, and there is an existing mode of correlated motion of considerable amplitude in which the oxygen atoms are displaced but hydrogen is not. (J.R.D.)

  20. Preliminary experiments on the reduction of the uranyl ion to uraninite by carbonaceous substances

    USGS Publications Warehouse

    Breger, Irving A.; Moore, Richard T.

    1955-01-01

    An aqueous solution of uranyl sulfate containing a suspension of subbituminous coal has been heated at 210 C for three days. Examination of the coal at the end of the experiment showed it to contain 31.8 percent uranium recognizable as uraninite by a sharp, strong X-ray diffraction pattern. A similar experiment with degraded spruce wood also led to the formation of uraninite but in lesser quantity and with broader lines in the X-ray diffraction pattern. The ability of coal or wood to reduce the uranyl ion is a critical factor in the correlation of studies of uraniferous coals containing the uranyl ion with studies of uraninite-bearing coalified wood from the Colorado Plateau. Although these results are based an preliminary experiments, they are extremely important geochemically and warrant the development of the series of controlled studies that are proposed.

  1. Preliminary crystallographic analysis of ADP-glucose pyrophosphorylase from Agrobacterium tumefaciens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cupp-Vickery, Jill R., E-mail: jvickery@uci.edu; Igarashi, Robert Y.; Meyer, Christopher R.

    2005-03-01

    Crystallization and X-ray diffraction methods for native A. tumefaciens ADP-glucose pyrophosphorylase and its selenomethionyl derivative are described. Two crystal forms are identified, both of which diffract to 2 Å.

  2. X-Ray Diffraction Study of Elemental Erbium to 65 GPa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pravica, M.G.; Lipinska-Kalita, K.; Quine, Z.

    2006-02-02

    We have investigated phase transitions in elemental erbium in a diamond anvil cell up to 65 GPa using x-ray powder diffraction methods. We present preliminary evidence of a series of phase transitions that appear to follow the expected hcp {yields} Sm-type {yields} dhcp {yields} distorted fcc sequence. In particular, we believe that we have evidence for the predicted dhcp {yields} distorted fcc transition between 43 GPa and 65 GPa.

  3. Crystallization and preliminary X-ray diffraction analysis of West Nile virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.

    2010-05-25

    West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less

  4. Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom.

    PubMed

    Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

    2014-10-01

    Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.

  5. Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom

    PubMed Central

    Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

    2014-01-01

    Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953

  6. The effect of preliminary hydrolysis on the properties of ZrO2-7% Y2O3 powders prepared by hydroxide precipitation

    NASA Astrophysics Data System (ADS)

    Zhirenkina, Nina V.; Mashkovtsev, Maxim A.; Bereskina, Polina A.; Zakirov, Ilsur F.; Baksheev, Evgenie O.; Bujnachev, Sergey V.; Vereshchagin, Artem O.

    2017-09-01

    In this study, the effect of preliminary hydrolysis of zirconyl oxysulfate on the properties of ZrO2-7 % Y2O3 powders prepared by hydroxides precipitation at a constant pH of 5 was studied. X-ray diffraction analysis showed the monophasic nature of the samples and the insignificant difference between CSR (coherent scattering regions). Samples differed in particle size distribution, porosity and morphology.

  7. Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

    PubMed

    Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

    2012-08-01

    Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

  8. Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

    PubMed Central

    Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

    2012-01-01

    Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

  9. Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

    PubMed Central

    Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

    2006-01-01

    Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

  10. Crystallization and preliminary X-ray diffraction studies of an RNA aptamer in complex with the human IgG Fc fragment

    PubMed Central

    Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi

    2008-01-01

    Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution. PMID:18931441

  11. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

    PubMed

    Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

    2014-11-01

    Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  12. Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony

    2006-03-01

    A cytotoxin from Indian Russell’s viper (D. russelli russelli) venom having multifunctional activity has been crystallized in space group P4{sub 1}. Larger crystals diffracted to 1.5 Å but were found to be twinned; preliminary data were therefore collected (2.93 Å) from a smaller crystal. A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P4{sub 1}, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, weremore » found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V{sub M} value.« less

  13. Purification, crystallization and preliminary X-ray diffraction analysis of aspartate semialdehyde dehydrogenase (Rv3708c) from Mycobacterium tuberculosis

    PubMed Central

    Vyas, Rajan; Kumar, Vijay; Panjikar, Santosh; Karthikeyan, Subramanian; Kishan, K. V. Radha; Tewari, Rupinder; Weiss, Manfred S.

    2008-01-01

    Aspartate semialdehyde dehydrogenase from Mycobacterium tuberculosis (Asd, ASADH, Rv3708c), which is the second enzyme in the lysine/homoserine-biosynthetic pathways, has been expressed heterologously in Escherichia coli. The enzyme was purified using affinity and gel-filtration chromatographic techniques and crystallized in two different crystal forms. Preliminary diffraction data analysis suggested the presence of up to four monomers in the asymmetric unit of the orthorhombic crystal form A and of one or two monomers in the cubic crystal form B. PMID:18323599

  14. Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto.

    PubMed

    Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

    2010-12-01

    Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.

  15. Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto

    PubMed Central

    Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

    2010-01-01

    Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221

  16. Crystallization and preliminary X-ray diffraction analysis of the sialic acid-binding domain (VP8*) of porcine rotavirus strain CRW-8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scott, Stacy A.; Holloway, Gavan; Coulson, Barbara S.

    2005-06-01

    The sialic acid-binding domain (VP8*) component of the porcine CRW-8 rotavirus spike protein has been overexpressed in E. coli, purified and co-crystallized with an N-acetylneuraminic acid derivative. X-ray diffraction data have been collected to 2.3 Å, which has enabled determination of the structure by molecular replacement. Rotavirus recognition and attachment to host cells involves interaction with the spike protein VP4 that projects outwards from the surface of the virus particle. An integral component of these spikes is the VP8* domain, which is implicated in the direct recognition and binding of sialic acid-containing cell-surface carbohydrates and facilitates subsequent invasion by themore » virus. The expression, purification, crystallization and preliminary X-ray diffraction analysis of VP8* from porcine CRW-8 rotavirus is reported. Diffraction data have been collected to 2.3 Å resolution, enabling the determination of the VP8* structure by molecular replacement.« less

  17. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

    2014-10-25

    The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

  18. Purification, crystallization and preliminary crystallographic studies of the TLDc domain of oxidation resistance protein 2 from zebrafish

    PubMed Central

    Alsarraf, Husam M. A. B.; Laroche, Fabrice; Spaink, Herman; Thirup, Søren; Blaise, Mickael

    2011-01-01

    Cell metabolic processes are constantly producing reactive oxygen species (ROS), which have deleterious effects by triggering, for example, DNA damage. Numerous enzymes such as catalase, and small compounds such as vitamin C, provide protection against ROS. The TLDc domain of the human oxidation resistance protein has been shown to be able to protect DNA from oxidative stress; however, its mechanism of action is still not understood and no structural information is available on this domain. Structural information on the TLDc domain may therefore help in understanding exactly how it works. Here, the purification, crystallization and preliminary crystallographic studies of the TLDc domain from zebrafish are reported. Crystals belonging to the orthorhombic space group P21212 were obtained and diffracted to 0.97 Å resolution. Selenomethionine-substituted protein could also be crystallized; these crystals diffracted to 1.1 Å resolution and the structure could be solved by SAD/MAD methods. PMID:22102041

  19. Incorporation of tramadol drug into Li-fluorohectorite clay: A preliminary study of a medical nanofluid

    NASA Astrophysics Data System (ADS)

    Valdés, L.; Hernández, D.; de Ménorval, L. Ch.; Pérez, I.; Altshuler, E.; Fossum, J. O.; Rivera, A.

    2016-07-01

    During the last years, clays have been increasingly explored as hosts for drugs. In the present paper, we have been able to host the non-steroidal anti-inflammatory drug, Tramadol, into the clay Li-fluorohectorite (Li-Fh). We preliminary evaluate its incorporation by means of UV spectroscopy and X ray diffraction. Our results indicate that the clay hosts the drug molecule in its interlayer space. We suggest a set of parameters to guarantee an efficient incorporation process. Future studies will concentrate on the release of the drug from the clay nanofluid.

  20. Influence of preliminary deformation on the hardening effect upon aging of Al-Cu-Li alloys

    NASA Astrophysics Data System (ADS)

    Betsofen, S. Ya.; Ashmarin, A. A.; Knyazev, M. I.; Dolgova, M. I.

    2016-09-01

    The influence of preliminary deformation upon rolling of wedge specimens on the mechanical properties and the structural phase state of Al-Cu-Li alloys are studied by X-ray diffraction and hardness measurements. Strong dependence of the hardening effect upon aging on the reduction upon rolling has been revealed. Deformation weakly influences the hardness and significantly increases the hardening upon aging. Herewith, the hardening effect is nearly absent at the minimum deformation ratio of 1% and increases with its increase. It is demonstrated that the content of T1 phase increases from 2 to 4% in the range of a preliminary deformation ratio of 6-10% and the content of δ' phase is 17% at a deformation ratio in the range 1‒6% and increases to 18-19% at a deformation ratio of 6-10%. The δ' phase in an alloy contains <20% nanocrystalline particles with 6-20 nm in size, and the remaining part consists of amorphous particles (as detected by X-ray diffraction) <5 nm in size, which precipitate coherently from the matrix and have the same orientation as the nanocrystalline particles and the solid solution.

  1. Serial femtosecond X-ray diffraction of enveloped virus microcrystals

    DOE PAGES

    Lawrence, Robert M.; Conrad, Chelsie E.; Zatsepin, Nadia A.; ...

    2015-08-20

    Serial femtosecond crystallography (SFX) using X-ray free-electron lasers has produced high-resolution, room temperature, time-resolved protein structures. We report preliminary SFX of Sindbis virus, an enveloped icosahedral RNA virus with ~700 Å diameter. Microcrystals delivered in viscous agarose medium diffracted to ~40 Å resolution. Small-angle diffuse X-ray scattering overlaid Bragg peaks and analysis suggests this results from molecular transforms of individual particles. Viral proteins undergo structural changes during entry and infection, which could, in principle, be studied with SFX. This is a pertinent step toward determining room temperature structures from virus microcrystals that may enable time-resolved studies of enveloped viruses.

  2. Crystallization and preliminary X-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hou, Jing; Li, Ming; Chen, Jiashu

    Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.

  3. Crystallization and preliminary X-ray diffraction studies of a novel ferredoxin involved in the dioxygenation of carbazole by Novosphingobium sp. KA1

    PubMed Central

    Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki

    2008-01-01

    Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094

  4. Purification, crystallization and preliminary X-ray analysis of Enterococcus faecium aminoglycoside-2′′-phosphotransferase-Ib [APH(2′′)-Ib

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walanj, Rupa; Young, Paul; Baker, Heather M.

    2005-04-01

    APH(2′′)-Ib is an enzyme responsible for high-level gentamicin resistance in E. faecium isolates. Native crystals of this enzyme have been prepared and preliminary X-ray diffraction experiments have been undertaken. Bacterial resistance to the aminoglycoside antibiotics is primarily the result of deactivation of the drugs. Three families of enzymes are responsible for this activity, with one such family being the aminoglycoside phosphotransferases (APHs). The gene encoding one of these enzymes, APH(2′′)-Ib, has been cloned and the protein (comprising 299 amino-acid residues) expressed in Escherichia coli, purified and crystallized in the presence of 16%(w/v) PEG 3350 and gentamicin. The crystals belong tomore » the monoclinic space group P2{sub 1}, with approximate unit-cell parameters a = 79.7, b = 58.8, c = 81.4 Å, β = 98.4°, and preliminary X-ray diffraction analysis is consistent with the presence of two molecules in the asymmetric unit. Synchrotron diffraction data to approximately 2.65 Å resolution were collected from a native APH(2′′)-Ib crystal at beamline BL9-2 at SSRL (Stanford, CA, USA). Selenium-substituted crystals have also been produced and structure determination is proceeding.« less

  5. Dynamic fracture toughness of cellulose-fiber-reinforced polypropylene : preliminary investigation of microstructural effects

    Treesearch

    Craig M. Clemons; Daniel F. Caulfield; A. Jeffrey Giacomin

    1999-10-01

    In this study, the microstructure of injection-molded polypropylene reinforced with cellulose fiber was investigated. Scanning electron microscopy of the fracture surfaces and X-ray diffraction were used to investigate fiber orientation. The polypropylene matrix was removed by solvent extraction, and the lengths of the residual fibers were optically determined. Fiber...

  6. Crystallization and preliminary X-ray diffraction studies of θ-toxin (perfringolysin O), a pore-forming cytolysin of Clostridium perfringens

    NASA Astrophysics Data System (ADS)

    Sugahara, Mitsuaki; Sekino-Suzuki, Naoko; Ohno-Iwashita, Yoshiko; Miki, Kunio

    1996-10-01

    θ-Toxin (perfringolysin O), a cholesterol-binding, pore-forming cytolysin of Clostridium perfringens type A was crystallized by the vapor diffusion procedure using polyethyleneglycol 4000 and sodium chloride as precipitants in 2-(cyclohexylamino)ethanesulfonic acid (CHES) buffer at pH 9.5. The diffraction patterns of precession photographs indicated that the crystals belong to the orthorhombic system and the space group C222 1 with unit-cell dimensions of a = 47.7 Å, b = 182.0 Å and c = 175.8 Å. Assuming that the asymmetric unit contains one or two molecules (Mw 52 700), the Vm value is calculated as 3.6 or 1.8 Å 3/dalton, respectively. The crystals diffract X-rays to at least 3 Å resolution and are suitable for high resolution X-ray crystal structure determination.

  7. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2016-11-01

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

  8. Maximizing Macromolecule Crystal Size for Neutron Diffraction Experiments

    NASA Technical Reports Server (NTRS)

    Judge, R. A.; Kephart, R.; Leardi, R.; Myles, D. A.; Snell, E. H.; vanderWoerd, M.; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    A challenge in neutron diffraction experiments is growing large (greater than 1 cu mm) macromolecule crystals. In taking up this challenge we have used statistical experiment design techniques to quickly identify crystallization conditions under which the largest crystals grow. These techniques provide the maximum information for minimal experimental effort, allowing optimal screening of crystallization variables in a simple experimental matrix, using the minimum amount of sample. Analysis of the results quickly tells the investigator what conditions are the most important for the crystallization. These can then be used to maximize the crystallization results in terms of reducing crystal numbers and providing large crystals of suitable habit. We have used these techniques to grow large crystals of Glucose isomerase. Glucose isomerase is an industrial enzyme used extensively in the food industry for the conversion of glucose to fructose. The aim of this study is the elucidation of the enzymatic mechanism at the molecular level. The accurate determination of hydrogen positions, which is critical for this, is a requirement that neutron diffraction is uniquely suited for. Preliminary neutron diffraction experiments with these crystals conducted at the Institute Laue-Langevin (Grenoble, France) reveal diffraction to beyond 2.5 angstrom. Macromolecular crystal growth is a process involving many parameters, and statistical experimental design is naturally suited to this field. These techniques are sample independent and provide an experimental strategy to maximize crystal volume and habit for neutron diffraction studies.

  9. Development of a synchrotron biaxial tensile device for in situ characterization of thin films mechanical response.

    PubMed

    Geandier, G; Thiaudière, D; Randriamazaoro, R N; Chiron, R; Djaziri, S; Lamongie, B; Diot, Y; Le Bourhis, E; Renault, P O; Goudeau, P; Bouaffad, A; Castelnau, O; Faurie, D; Hild, F

    2010-10-01

    We have developed on the DIFFABS-SOLEIL beamline a biaxial tensile machine working in the synchrotron environment for in situ diffraction characterization of thin polycrystalline films mechanical response. The machine has been designed to test compliant substrates coated by the studied films under controlled, applied strain field. Technological challenges comprise the sample design including fixation of the substrate ends, the related generation of a uniform strain field in the studied (central) volume, and the operations from the beamline pilot. Preliminary tests on 150 nm thick W films deposited onto polyimide cruciform substrates are presented. The obtained results for applied strains using x-ray diffraction and digital image correlation methods clearly show the full potentialities of this new setup.

  10. [Fine stereo structure for natural organic molecules, a preliminary study. II. Melting point influenced by structure factors].

    PubMed

    Lu, Y; Zheng, Q; Lu, D; Ma, P; Chen, Y

    1995-06-01

    Crystal structures of two compounds from Tripterygium wilfordii Hook f. have been determined by X-ray diffraction method. Structure factors influencing melting point of solid state have been analysed. Crystal class (or space group), recrystallization solvent, force between molecules and fine changes of molecular structures will all cause melting point changes of crystal substance.

  11. Expression, purification and preliminary X-ray diffraction studies of VERNALIZATION1208–341 from Arabidopsis thaliana

    PubMed Central

    King, Gordon; Hill, Justine M.; Martin, Jennifer L.; Mylne, Joshua S.

    2009-01-01

    VERNALIZATION1 (VRN1) is required in the model plant Arabidopsis thaliana for the epigenetic suppression of the floral repressor FLC by prolonged cold treatment. Stable suppression of FLC accelerates flowering, a physiological process known as vernalization. VRN1 is a 341-residue DNA-binding protein that contains two plant-specific B3 domains (B3a and B3b), a putative nuclear localization sequence (NLS) and two putative PEST domains. VRN1208–341 includes the second B3 domain and a region upstream that is highly conserved in the VRN1 orthologues of other dicotyledonous plants. VRN1208–341 was crystallized by the hanging-drop method in 0.05 M sodium acetate pH 6.0 containing 1.0 M NaCl and 18%(w/v) PEG 3350. Preliminary X-ray diffraction data analysis revealed that the VRN1208–341 crystal diffracted to 2.1 Å and belonged to space group C2, with unit-cell parameters a = 105.2, b = 47.9, c = 61.2 Å, α = 90.0, β = 115.4, γ = 90.0°. Assuming that two molecules occupy the asymmetric unit, a Matthews coefficient of 2.05 Å3 Da−1 and a solvent content of 40.1% were calculated. PMID:19255487

  12. Crystallization and preliminary crystallographic analysis of an aminoglycoside kinase from Legionella pneumophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lemke, Christopher T.; Hwang, Jiyoung; Xiong, Bing

    2005-06-01

    Two crystal forms of the antibiotic resistance enzyme APH(9)-Ia from L. pneumophila are reported. 9-Aminoglycoside phosphotransferase type Ia [APH(9)-Ia] is a resistance factor in Legionella pneuemophila, the causative agent of legionnaires’ disease. It is responsible for providing intrinsic resistance to the antibiotic spectinomycin. APH(9)-Ia phosphorylates one of the hydroxyl moieties of spectinomycin in an ATP-dependent manner, abolishing the antibiotic properties of this drug. Here, the crystallization and preliminary X-ray studies of this enzyme in two crystal forms is reported. One of the these crystal forms provides diffraction data to a resolution of 1.7 Å.

  13. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

    2007-11-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

  14. Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Quesada, Odayme; Gurda, Brittney; Govindasamy, Lakshmanan

    2007-12-01

    Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids have been produced which diffract X-rays to ∼3.0 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids diffract X-rays to ∼3.0 Å resolution. The crystals belong to the rhombohedral space group R3, with unit-cell parameters a = 252.4, c = 591.2 Å in the hexagonal setting. The diffraction data were processed and reduced to an overall completeness of 79.0% and an R{sub merge} of 12.0%. There are three viral capsids in the unit cell. The icosahedral threefold axis is coincident with the crystallographic threefold axis, resulting in one third of amore » capsid (20 monomers) per crystallographic asymmetric unit. The orientation of the viral capsid has been determined by rotation-function searches and is positioned at (0, 0, 0) by packing considerations.« less

  15. Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

    2006-12-01

    UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

  16. Aeroacoustic diffraction and dissipation by a short propeller cowl in subsonic flight

    NASA Technical Reports Server (NTRS)

    Martinez, Rudolph

    1993-01-01

    This report develops and applies an aeroacoustic diffraction theory for a duct, or cowl, placed around modelled sources of propeller noise. The regime of flight speed is high subsonic. The modelled cowl's inner wall contains a liner with axially variable properties. Its exterior is rigid. The analysis replaces both sides with an unsteady lifting surface coupled to a dynamic thickness problem. The resulting pair of aeroacoustic governing equations for a lined 'ring wing' is valid both for a passive and for an active liner. Their numerical solution yields the effective dipole and monopole distributions of the shrouding system and thereby determines the cowl-diffracted component of the total radiated field. The sample calculations here include a preliminary parametric search for that liner layout which maximizes the cowl's shielding effectiveness. The main conclusion of the study is that a short cowl, passively lined, should provide moderate reductions in propeller noise.

  17. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2016-11-15

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less

  18. Purification, crystallization and preliminary X-ray diffraction of the N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Qin, E-mail: yang@crystal.harvard.edu; Brüschweiler, Sven; Chou, James J., E-mail: yang@crystal.harvard.edu

    2013-12-24

    The N-terminal calmodulin-like domain of the human mitochondrial ATP-Mg/P{sub i} carrier SCaMC1 was crystallized in the presence of Ca{sup 2+}. X-ray diffraction data were collected to 2.9 Å resolution from crystals which belonged to space group P6{sub 2}22.

  19. Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

    PubMed Central

    Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

    2006-01-01

    The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

  20. Isolation, purification, crystallization, and preliminary X-ray diffraction study of the crystals of HU protein from M. gallisepticum

    NASA Astrophysics Data System (ADS)

    Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.

    2015-11-01

    HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.

  1. Data preparation and evaluation techniques for x-ray diffraction microscopy.

    PubMed

    Steinbrener, Jan; Nelson, Johanna; Huang, Xiaojing; Marchesini, Stefano; Shapiro, David; Turner, Joshua J; Jacobsen, Chris

    2010-08-30

    The post-experiment processing of X-ray Diffraction Microscopy data is often time-consuming and difficult. This is mostly due to the fact that even if a preliminary result has been reconstructed, there is no definitive answer as to whether or not a better result with more consistently retrieved phases can still be obtained. We show here that the first step in data analysis, the assembly of two-dimensional diffraction patterns from a large set of raw diffraction data, is crucial to obtaining reconstructions of highest possible consistency. We have developed software that automates this process and results in consistently accurate diffraction patterns. We have furthermore derived some criteria of validity for a tool commonly used to assess the consistency of reconstructions, the phase retrieval transfer function, and suggest a modified version that has improved utility for judging reconstruction quality.

  2. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic study of DHNA synthetase from Geobacillus kaustophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman

    2007-02-01

    DHNA synthetase from G. kaustophilus has been cloned, expressed, purified and crystallized. The aerobic Gram-positive bacterium Geobacillus kaustophilus is a bacillus species that was isolated from deep-sea sediment from the Mariana Trench. 1,4-Dihydroxy-2-naphthoate (DHNA) synthetase plays a vital role in the biosynthesis of menaquinone (vitamin K{sub 2}) in this bacterium. DHNA synthetase from Geobacillus kaustophilus was crystallized in the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 77.01, b = 130.66, c = 131.69 Å. The crystal diffracted to a resolution of 2.2 Å. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetricmore » unit.« less

  3. Crystallization and preliminary X-ray diffraction analysis of two extracytoplasmic solute receptors of the DctP family from Bordetella pertussis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX

    2006-10-01

    Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less

  4. Crystallization and preliminary X-ray diffraction analysis of a myotoxic Lys49-PLA{sub 2} from Bothrops jararacussu venom complexed with p-bromophenacyl bromide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchi-Salvador, D. P.; Fernandes, C. A. H.; Amui, S. F.

    2006-06-01

    A non-catalytic and myotoxic Lys49-PLA{sub 2} from B. jararacussu venom was crystallized with BPB inhibitor and X-ray diffraction data were collected. Preliminary analysis indicates that the ligand is bound to the His48 residue. Structure determination may provide insights into the myotoxic and cytotoxic mechanisms of Lys49-PLA{sub 2}s. For the first time, a non-catalytic and myotoxic Lys49-PLA{sub 2} (BthTX-I from Bothrops jararacussu venom) has been crystallized with BPB inhibitor. X-ray diffraction data were collected and electron-density calculations showed that the ligand is bound to the His48 residue. BthTX-I with His48 chemically modified by BPB shows strongly reduced myotoxic and cytotoxic activities.more » This suggests a biological correlation between the modification of His48, which is associated with catalytic activity of PLA{sub 2}s, and other toxicological activities of Lys49-PLA{sub 2}s.« less

  5. Development of a synchrotron biaxial tensile device for in situ characterization of thin films mechanical response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geandier, G.; Synchrotron SOLEIL, L'Orme des Merisiers, BP 48, 91192 Gif sur Yvette; LPMTM, UPR 9001 CNRS, Universite Paris-Nord, 93430 Villetaneuse

    2010-10-15

    We have developed on the DIFFABS-SOLEIL beamline a biaxial tensile machine working in the synchrotron environment for in situ diffraction characterization of thin polycrystalline films mechanical response. The machine has been designed to test compliant substrates coated by the studied films under controlled, applied strain field. Technological challenges comprise the sample design including fixation of the substrate ends, the related generation of a uniform strain field in the studied (central) volume, and the operations from the beamline pilot. Preliminary tests on 150 nm thick W films deposited onto polyimide cruciform substrates are presented. The obtained results for applied strains usingmore » x-ray diffraction and digital image correlation methods clearly show the full potentialities of this new setup.« less

  6. Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp

    2007-09-01

    A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less

  7. On the purification and preliminary crystallographic analysis of isoquinoline 1-oxidoreductase from Brevundimonas diminuta 7

    PubMed Central

    Boer, D. Roeland; Müller, Axel; Fetzner, Susanne; Lowe, David J.; Romão, Maria João

    2005-01-01

    Isoquinoline 1-oxidoreductase (IOR) from Brevundimonas diminuta is a mononuclear molybdoenzyme of the xanthine-dehydrogenase family of proteins and catalyzes the conversion of isoquinoline to isoquinoline-1-one. Its primary sequence and behaviour, specifically in its substrate specificity and lipophilicity, differ from other members of the family. A crystal structure of the enzyme is expected to provide an explanation for these differences. This paper describes the crystallization and preliminary X-ray diffraction experiments as well as an optimized purification protocol for IOR. Crystallization of IOR was achieved using two different crystallization buffers. Streak-seeding and cross-linking were essential to obtain well diffracting crystals. Suitable cryo-conditions were found and a structure solution was obtained by molecular replacement. However, phases need to be improved in order to obtain a more interpretable electron-density map. PMID:16508115

  8. Extracellular overproduction and preliminary crystallographic analysis of a family I.3 lipase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Angkawidjaja, Clement; You, Dong-Ju; Matsumura, Hiroyoshi

    2007-03-01

    A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. The crystal was grown at 277 K by the hanging-drop vapour-diffusion method. Native X-ray diffraction data were collected to 1.7 Å resolution using synchrotron radiation at station BL38B1, SPring-8. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 48.79, b = 84.06,more » c = 87.04 Å. Assuming the presence of one molecule per asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.73 Å{sup 3} Da{sup −1} and the solvent content was 55%.« less

  9. Optical analysis of high power free electron laser resonators

    NASA Astrophysics Data System (ADS)

    Knapp, C. E.; Viswanathan, V. K.; Appert, Q. D.; Bender, S. C.; McVey, B. D.

    1987-06-01

    The first part of this paper briefly describes the optics code used at Los Alamos National Laboratory to do optical analyses of various components of a free electron laser. The body of the paper then discusses the recent results in modeling low frequency gratings and ripple on the surfaces of liquid-cooled mirrors. The ripple is caused by structural/thermal effects in the mirror surface due to heating by optical absorption in high power resonators. Of interest is how much ripple can be permitted before diffractive losses or optical mode distortions become unacceptable. Preliminary work is presented involving classical diffraction problems to support the ripple study. The limitations of the techniques are discussed and the results are compared to experimental results where available.

  10. Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

    PubMed

    Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

    2007-02-01

    D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

  11. Purification, crystallization and preliminary X-ray diffraction analysis of adenosine triphosphate sulfurylase (ATPS) from the sulfate-reducing bacterium Desulfovibrio desulfuricans ATCC 27774

    PubMed Central

    Gavel, Olga Yu.; Kladova, Anna V.; Bursakov, Sergey A.; Dias, João M.; Texeira, Susana; Shnyrov, Valery L.; Moura, José J. G.; Moura, Isabel; Romão, Maria J.; Trincão, José

    2008-01-01

    Native zinc/cobalt-containing ATP sulfurylase (ATPS; EC 2.7.7.4; MgATP:sulfate adenylyltransferase) from Desulfovibrio desulfuricans ATCC 27774 was purified to homogeneity and crystallized. The orthorhombic crystals diffracted to beyond 2.5 Å resolution and the X-ray data collected should allow the determination of the structure of the zinc-bound form of this ATPS. Although previous biochemical studies of this protein indicated the presence of a homotrimer in solution, a dimer was found in the asymmetric unit. Elucidation of this structure will permit a better understanding of the role of the metal in the activity and stability of this family of enzymes. PMID:18607083

  12. Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

    PubMed Central

    Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony; Dattagupta, Jiban K.; Sen, Udayaditya

    2006-01-01

    A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P41, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, were found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V M value. PMID:16511326

  13. Diagnosis Applications of Non-Crystalline Diffraction of Collagen Fibres: Breast Cancer and Skin Diseases

    NASA Astrophysics Data System (ADS)

    Costa, M.; Benseny-Cases, N.; Cócera, M.; Teixeira, C. V.; Alsina, M.; Cladera, J.; López, O.; Fernández, M.; Sabés, M.

    In previous chapters, the basis of SAXS for the study of biological systems like proteins in solution have been presented. The SAXS patterns of proteins in solution present, in general, broad dependences with the scattering vector, and the interpretation requires a huge component of modelling. In this chapter and in the following one, it is shown how SAXS technique can be used to study biological systems that are partially crystalline and with a large crystalline cells. This is done by analysing the diffraction obtained from these systems at small angles. In this chapter, a new approach to the application of small-angle X-ray scattering (SAXS) for diagnosis using the diffraction pattern of collagen is presented. This chapter shows the development of a new strategy in the preventive diagnosis of breast cancer following changes on collagen from breast connective tissue. SAXS profiles are related to different features in cutaneous preparations and to the supra-molecular arrangement of skin layers (stratum corneum, epidermis and dermis), in order to introduce objective values on the diagnosis of different skin pathologies. Working parameters (size, thickness) and methods (freezing, paraffin embedment) have been established. The results suggest that collagen diffraction patterns could be used as diagnostic indicators; especially for breast cancer and preliminary results obtained with skin collagen are promising too.

  14. Purification, crystallization and preliminary diffraction studies of an ectromelia virus glutaredoxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacik, John-Paul; Brigley, Angela M.; Channon, Lisa D.

    2005-06-01

    Ectromelia virus glutaredoxin has been crystallized in the presence of the reducing agent DTT. A diffraction data set has been collected and processed to 1.8 Å resolution. Ectromelia, vaccinia, smallpox and other closely related viruses of the orthopoxvirus genus encode a glutaredoxin gene that is not present in poxviruses outside of this genus. The vaccinia glutaredoxin O2L has been implicated as the reducing agent for ribonucleotide reductase and may thus play an important role in viral deoxyribonucleotide synthesis. As part of an effort to understand nucleotide metabolism by poxviruses, EVM053, the O2L ortholog of the ectromelia virus, has been crystallized.more » EVM053 crystallizes in space group C222{sub 1}, with unit-cell parameters a = 61.98, b = 67.57, c = 108.55 Å. Diffraction data have been processed to 1.8 Å resolution and a self-rotation function indicates that there are two molecules per asymmetric unit.« less

  15. Improving the performance of methylene blue sensitized photopolymer by doping with nickel ion

    NASA Astrophysics Data System (ADS)

    Aswathy, G.; Rajesh, C. S.; Sreekumar, K.; Joseph, R.; Kartha, C. Sudha

    2016-05-01

    Holographic performance of an economically cheap metal ion doped photopolymer material is presented. We investigated the effect of incorporation of nickel ion into the methylene blue sensitized poly (vinyl alcohol)/acrylamide (MBPVA/AA) photopolymer system. The composition and preliminary characterization of the developed photopolymer material is reported. The presence of nickel ion improves the diffraction efficiency, stability of the material and it operates in a wide range of spatial frequencies (550-2000 lines/mm) at exposure energy of 100 mJ/cm2. When nickel ion concentration was 0.01 mM, maximum diffraction efficiency of 84% at exposure energy of 100 mJ/cm2 with spatial frequency 1335 lines/mm could be achieved for gratings recorded using wavelength of 632.8 nm. The material showed panchromaticity with more than 70% diffraction efficiency in both blue and green regions. Effects of humidity and temperature on the stored gratings were studied by keeping films in different environmental conditions. Suitability of recording large area holograms was also explored.

  16. Crystallization and preliminary crystallographic characterization of the origin-binding domain of the bacteriophage λ O replication initiator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Struble, E. B., E-mail: evi.struble@nist.gov; Department of Biochemistry and Molecular Biology, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD 21205; Center for Advanced Research in Biotechnology/NIST, 9600 Gudelsky Drive, Rockville, MD 20850

    2007-06-01

    Crystallization and preliminary diffraction data of the N-terminal 19–139 fragment of the origin-binding domain of bacteriophage λ O replication initiator are reported. The bacteriophage λ O protein binds to the λ replication origin (oriλ) and serves as the primary replication initiator for the viral genome. The binding energy derived from the binding of O to oriλ is thought to help drive DNA opening to facilitate initiation of DNA replication. Detailed understanding of this process is severely limited by the lack of high-resolution structures of O protein or of any lambdoid phage-encoded paralogs either with or without DNA. The production ofmore » crystals of the origin-binding domain of λ O that diffract to 2.5 Å is reported. Anomalous dispersion methods will be used to solve this structure.« less

  17. Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

    2007-07-01

    P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

  18. Crystallization and preliminary X-ray analysis of Leishmania major glyoxalase I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ariza, Antonio; Vickers, Tim J.; Greig, Neil

    2005-08-01

    The detoxification enzyme glyoxalase I from L. major has been crystallized. Preliminary molecular-replacement calculations indicate the presence of three glyoxalase I dimers in the asymmetric unit. Glyoxalase I (GLO1) is a putative drug target for trypanosomatids, which are pathogenic protozoa that include the causative agents of leishmaniasis. Significant sequence and functional differences between Leishmania major and human GLO1 suggest that it may make a suitable template for rational inhibitor design. L. major GLO1 was crystallized in two forms: the first is extremely disordered and does not diffract, while the second, an orthorhombic form, produces diffraction to 2.0 Å. Molecular-replacement calculationsmore » indicate that there are three GLO1 dimers in the asymmetric unit, which take up a helical arrangement with their molecular dyads arranged approximately perpendicular to the c axis. Further analysis of these data are under way.« less

  19. Crystallisation and preliminary X-ray diffraction analysis of the protease from Southampton norovirus complexed with a Michael-acceptor inhibitor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coates, Leighton; Cooper, Jon; Hussey, Robert

    2008-01-01

    Noroviruses are the predominant cause of human epidemic nonbacterial gastroenteritis. Viral replication requires a cysteine protease that cleaves a 200 kDa viral polyprotein into its constituent functional parts. Here, the crystallization of the recombinant protease from the Southampton norovirus is described. While the native crystals were found to diffract only to medium resolution (2.9 {angstrom}), cocrystals of an inhibitor complex diffracted X-rays to 1.7 {angstrom} resolution. The polypeptide inhibitor (Ac-EFQLQ-propenyl ethyl ester) possesses an amino-acid sequence designed to match the substrate specificity of the enzyme, but was synthesized with a reactive Michael acceptor group at the C-terminal end.

  20. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

    PubMed

    Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

    2014-06-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

  1. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

    PubMed Central

    Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

    2014-01-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

  2. Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

    2007-06-01

    The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

  3. Preliminary neutron and X-ray crystallographic studies of equine cyanomethemoglobin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kovalevsky, A.Y.; Fisher, S.Z.; Seaver, S.

    2010-08-18

    Room-temperature and 100 K X-ray and room-temperature neutron diffraction data have been measured from equine cyanomethemoglobin to 1.7 {angstrom} resolution using a home source, to 1.6 {angstrom} resolution on NE-CAT at the Advanced Photon Source and to 2.0 {angstrom} resolution on the PCS at Los Alamos Neutron Science Center, respectively. The cyanomethemoglobin is in the R state and preliminary room-temperature electron and neutron scattering density maps clearly show the protonation states of potential Bohr groups. Interestingly, a water molecule that is in the vicinity of the heme group and coordinated to the distal histidine appears to be expelled from thismore » site in the low-temperature structure.« less

  4. Preliminary characterization of (nucleoside-2′-O-)-methyltransferase crystals from Meaban and Yokose flaviviruses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mastrangelo, Eloise; Bollati, Michela; Milani, Mario

    2006-08-01

    Two methyltransferases from flaviviruses (Meaban and Yokose viruses) have been overexpressed and crystallized. Diffraction data and characterization of the two crystal forms are presented, together with a preliminary molecular-replacement solution for both enzymes. Viral methyltranferases (MTase) are involved in the third step of the mRNA-capping process, transferring a methyl group from S-adenosyl-l-methionine (SAM) to the capped mRNA. MTases are classified into two groups: (guanine-N7)-methyltransferases (N7MTases), which add a methyl group onto the N7 atom of guanine, and (nucleoside-2′-O-)-methyltransferases (2′OMTases), which add a methyl group to a ribose hydroxyl. The MTases of two flaviviruses, Meaban and Yokose viruses, have been overexpressed,more » purified and crystallized in complex with SAM. Characterization of the crystals together with details of preliminary X-ray diffraction data collection (at 2.8 and 2.7 Å resolution, respectively) are reported here. The sequence homology relative to Dengue virus 2′OMTase and the structural conservation of specific residues in the putative active sites suggest that both enzymes belong to the 2′OMTase subgroup.« less

  5. Crystallization and preliminary X-ray analysis of the isomerase domain of glucosamine-6-phosphate synthase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olchowy, Jaroslaw; Jedrzejczak, Robert; Milewski, Slawomir

    2005-11-01

    The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to spacemore » group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers.« less

  6. Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A., E-mail: inna@ns.crys.ras.ru; Timofeev, V. I., E-mail: espiov@ibch.ru; Zhukhlistova, N. E., E-mail: tostars@mail.ru

    2015-07-15

    Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamermore » is the biological active form of E. coli. purine nucleoside phosphorylase.« less

  7. Purification, crystallization and preliminary X-ray diffraction studies of d-tagatose 3-epimerase from Pseudomonas cichorii

    PubMed Central

    Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

    2007-01-01

    d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-­psicose has not been reported with epimerases other than P. cichorii D-­TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456

  8. Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

    PubMed

    Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

    1977-04-01

    Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

  9. Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

    PubMed Central

    Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

    1977-01-01

    Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188

  10. Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

    PubMed

    Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

    1993-12-20

    gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

  11. Detection Limit of Smectite by Chemin IV Laboratory Instrument: Preliminary Implications for Chemin on the Mars Science Laboratory Mission

    NASA Technical Reports Server (NTRS)

    Archilles, Cherie; Ming, D. W.; Morris, R. V.; Blake, D. F.

    2011-01-01

    The CheMin instrument on the Mars Science Laboratory (MSL) is an miniature X-ray diffraction (XRD) and X-ray fluorescence (XRF) instrument capable of detecting the mineralogical and elemental compositions of rocks, outcrops and soils on the surface of Mars. CheMin uses a microfocus-source Co X-ray tube, a transmission sample cell, and an energy-discriminating X-ray sensitive CCD to produce simultaneous 2-D XRD patterns and energy-dispersive X-ray histograms from powdered samples. CRISM and OMEGA have identified the presence of phyllosilicates at several locations on Mars including the four candidate MSL landing sites. The objective of this study was to conduct preliminary studies to determine the CheMin detection limit of smectite in a smectite/olivine mixed mineral system.

  12. Single Hit Energy-resolved Laue Diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patel, Shamim; Suggit, Matthew J.; Stubley, Paul G.

    2015-05-15

    In situ white light Laue diffraction has been successfully used to interrogate the structure of single crystal materials undergoing rapid (nanosecond) dynamic compression up to megabar pressures. However, information on strain state accessible via this technique is limited, reducing its applicability for a range of applications. We present an extension to the existing Laue diffraction platform in which we record the photon energy of a subset of diffraction peaks. This allows for a measurement of the longitudinal and transverse strains in situ during compression. Consequently, we demonstrate measurement of volumetric compression of the unit cell, in addition to the limitedmore » aspect ratio information accessible in conventional white light Laue. We present preliminary results for silicon, where only an elastic strain is observed. VISAR measurements show the presence of a two wave structure and measurements show that material downstream of the second wave does not contribute to the observed diffraction peaks, supporting the idea that this material may be highly disordered, or has undergone large scale rotation.« less

  13. Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

    PubMed Central

    Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

    2010-01-01

    The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-­terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288

  14. Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1.

    PubMed

    Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

    2010-07-01

    The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.

  15. Crystallization and preliminary X-ray diffraction analysis of the wild-type haloalkane dehalogenase DhaA and its variant DhaA13 complexed with different ligands.

    PubMed

    Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta

    2011-02-01

    Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.

  16. Data preparation and evaluation techniques for x-ray diffraction microscopy

    DOE PAGES

    Steinbrener, Jan; Nelson, Johanna; Huang, Xiaojing; ...

    2010-01-01

    The post-experiment processing of X-ray Diffraction Microscopy data is often time-consuming and difficult. This is mostly due to the fact that even if a preliminary result has been reconstructed, there is no definitive answer as to whether or not a better result with more consistently retrieved phases can still be obtained. In addition, we show here that the first step in data analysis, the assembly of two-dimensional diffraction patterns from a large set of raw diffraction data, is crucial to obtaining reconstructions of highest possible consistency. We have developed software that automates this process and results in consistently accurate diffractionmore » patterns. We have furthermore derived some criteria of validity for a tool commonly used to assess the consistency of reconstructions, the phase retrieval transfer function, and suggest a modified version that has improved utility for judging reconstruction quality.« less

  17. Production, purification, crystallization and preliminary X-ray structural studies of adeno-associated virus serotype 5

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    DiMattia, Michael; Govindasamy, Lakshmanan; Levy, Hazel C.

    2005-10-01

    The production, purification, crystallization and preliminary crystallographic analysis of empty adeno-associated virus serotype 5 capsids are reported. Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Å resolution using synchrotron radiation and belong to the orthorhombicmore » space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c = 629.7 Å. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less

  18. Replication of Holograms with Corn Syrup by Rubbing

    PubMed Central

    Mejias-Brizuela, Nildia Y.; Olivares-Pérez, Arturo; Ortiz-Gutiérrez, Mauricio

    2012-01-01

    Corn syrup films are used to replicate holograms in order to fabricate micro-structural patterns without the toxins commonly found in photosensitive salts and dyes. We use amplitude and relief masks with lithographic techniques and rubbing techniques in order to transfer holographic information to corn syrup material. Holographic diffraction patterns from holographic gratings and computer Fourier holograms fabricated with corn syrup are shown. We measured the diffraction efficiency parameter in order to characterize the film. The versatility of this material for storage information is promising. Holographic gratings achieved a diffraction efficiency of around 8.4% with an amplitude mask and 36% for a relief mask technique. Preliminary results using corn syrup as an emulsion for replicating holograms are also shown in this work.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

    Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

  20. Production, purification, crystallization and preliminary X-ray analysis of adeno-associated virus serotype 8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lane, Michael Douglas; Nam, Hyun-Joo; Padron, Eric

    2005-06-01

    The production, purification, crystallization and preliminary X-ray crystallographic analysis of adeno-associated virus serotype 8 is reported. Adeno-associated viruses (AAVs) are actively being developed for clinical gene-therapy applications and the efficiencies of the vectors could be significantly improved by a detailed understanding of their viral capsid structures and the structural determinants of their tissue-transduction interactions. AAV8 is ∼80% identical to the more widely studied AAV2, but its liver-transduction efficiency is significantly greater than that of AAV2 and other serotypes. The production, purification, crystallization and preliminary X-ray crystallographic analysis of AAV8 viral capsids are reported. The crystals diffract X-rays to 3.0 Åmore » resolution using synchrotron radiation and belong to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = 257.5, c = 443.5 Å. The unit cell contains two viral particles, with ten capsid viral protein monomers per crystallographic asymmetric unit.« less

  1. Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

    PubMed

    Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

    2014-02-01

    Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

  2. Crystallization and preliminary X-ray diffraction analysis of a Lys49-phospholipase A2 complexed with caffeic acid, a molecule with inhibitory properties against snake venoms

    PubMed Central

    Shimabuku, Patrícia S.; Fernandes, Carlos A. H.; Magro, Angelo J.; Costa, Tássia R.; Soares, Andreimar M.; Fontes, Marcos R. M.

    2011-01-01

    Phospholipases A2 (PLA2s) are one of the main components of bothropic venoms; in addition to their phospholipid hydrolysis action, they are involved in a wide spectrum of pharmacological activities, including neurotoxicity, myo­toxicity and cardiotoxicity. Caffeic acid is an inhibitor that is present in several plants and is employed for the treatment of ophidian envenomations in the folk medicine of many developing countries; as bothropic snake bites are not efficiently neutralized by conventional serum therapy, it may be useful as an antivenom. In this work, the cocrystallization and preliminary X-ray diffraction analysis of the Lys49-PLA2 piratoxin I from Bothrops pirajai venom in the presence of the inhibitor caffeic acid (CA) are reported. The crystals diffracted X-rays to 1.65 Å resolution and the structure was solved by molecular-replacement techniques. The electron-density map unambiguously indicated the presence of three CA molecules that interact with the C-terminus of the protein. This is the first time a ligand has been observed bound to this region and is in agreement with various experiments previously reported in the literature. PMID:21301098

  3. Production, Purification and Preliminary X-ray Crystallographic Studies of Adeno-Associated Virus Serotype 9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mitchell, M.; Nam, H; Carter, A

    2009-01-01

    Adeno-associated virus (AAV) serotype 9, which is under development for gene-delivery applications, shows significantly enhanced capsid-associated transduction efficiency in muscle compared with other AAV serotypes. With the aim of characterizing the structural determinants of this property, the purification, crystallization and preliminary X-ray crystallographic analyses of the AAV9 viral capsid are reported. The crystals diffracted X-rays to 2.8 A resolution using synchrotron radiation and belonged to the trigonal space group P32, with unit-cell parameters a = b = 251.0, c = 640.0 A. There are three complete viral capsids in the crystal unit cell. The orientation and position of the asymmetricmore » unit capsid have been determined by molecular-replacement methods and structure determination is in progress.« less

  4. Thermal neutron radiative capture on cadmium as a counting technique at the INES beam line at ISIS: A preliminary investigation of detector cross-talk.

    PubMed

    Festa, G; Grazzi, F; Pietropaolo, A; Scherillo, A; Schooneveld, E M

    2017-12-01

    Experimental tests are presented that assess the cross-talk level among three scintillation detectors used as neutron counters exploiting the thermal neutron radiative capture on Cd. The measurements were done at the INES diffractometer operating at the ISIS spallation neutron source (Rutherford Appleton Laboratory, UK). These tests follow a preliminary set of measurements performed on the same instrument to study the effectiveness of this thermal neutron counting strategy in neutron diffraction measurements, typically performed on INES using squashed 3 He filled gas tubes. The experimental data were collected in two different geometrical configurations of the detectors and compared to results of Monte Carlo simulations, performed using the MCNP code. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Purification, crystallization and X-ray diffraction analysis of a novel ring-cleaving enzyme (BoxC{sub C}) from Burkholderia xenovorans LB400

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bains, Jasleen; Boulanger, Martin J., E-mail: mboulang@uvic.ca

    2008-05-01

    Preliminary X-ray diffraction studies of a novel ring-cleaving enzyme from B. xenovorans LB400 encoded by the benzoate-oxidation (box) pathway. The assimilation of aromatic compounds by microbial species requires specialized enzymes to cleave the thermodynamically stable ring. In the recently discovered benzoate-oxidation (box) pathway in Burkholderia xenovorans LB400, this is accomplished by a novel dihydrodiol lyase (BoxC{sub C}). Sequence analysis suggests that BoxC{sub C} is part of the crotonase superfamily but includes an additional uncharacterized region of approximately 115 residues that is predicted to mediate ring cleavage. Processing of X-ray diffraction data to 1.5 Å resolution revealed that BoxC{sub C} crystallizedmore » with two molecules in the asymmetric unit of the P2{sub 1}2{sub 1}2{sub 1} space group, with a solvent content of 47% and a Matthews coefficient of 2.32 Å{sup 3} Da{sup −1}. Selenomethionine BoxC{sub C} has been purified and crystals are currently being refined for anomalous dispersion studies.« less

  6. Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee

    2007-08-01

    The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less

  7. Crystallization and preliminary X-ray diffraction study of phosphopantetheine adenylyltransferase from M. tuberculosis crystallizing in space group P3{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.

    Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiyota, Eduardo; Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP; Sousa, Sylvia Morais de

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automatedmore » molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.« less

  9. Expression, purification and preliminary crystallographic analysis of Mycobacterium tuberculosis CysQ, a phosphatase involved in sulfur metabolism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Erickson, Anna I.; Sarsam, Reta D.; Fisher, Andrew J., E-mail: ajfisher@ucdavis.edu

    The cysQ gene from Mycobacterium tuberculosis was cloned and the expressed protein, a 3′-phosphoadenosine-5′’-phosphatase, was purified and crystallized. X-ray diffraction data were collected to 1.7 Å resolution.

  10. Crystallization and preliminary X-ray diffraction study of phosphoribosyl pyrophosphate synthetase from E. Coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru

    2015-09-15

    Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp.more » gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.« less

  11. Nonlocal nonlinear refraction in Hibiscus sabdariffa with large phase shifts.

    PubMed

    Ramírez-Martínez, D; Alvarado-Méndez, E; Trejo-Durán, M; Vázquez-Guevara, M A

    2014-10-20

    In this work we present a study of nonlinear optical properties in organic materials (hibiscus sabdariffa). Our results demonstrate that the medium exhibits a highly nonlocal nonlinear response. We show preliminary numerical results of the transmittance as nonlocal response by considering, simultaneously, the nonlinear absorption and refraction in media. Numerical results are accord to measurement obtained by Z- scan technique where we observe large phase shifts. We also analyze the far field diffraction ring patterns of the sample.

  12. Purification, crystallization and preliminary X-ray studies of human augmenter of liver regeneration.

    PubMed

    Ji, Chao-Neng; Cai, Zai-Long; Cao, Gen-Tao; Yin, Gang; Jiao, Bing-Hua; Jiang, Tao; Shu, Guang; Mao, Ji-Fang; Xie, Yi; Mao, Yu-Min

    2002-12-01

    Human augmenter of liver regeneration has been expressed in Escherichia coli, purified and crystallized. The crystals belong to space group C222, with unit-cell parameters a=51.7 A, b=78.8 A, c=63.7 A. Diffraction data were collected to 2.80 A with a completeness of 99.9% (99.9% for the last shell), a R(sym) value of 0.092(0.236) and an I/sigma(I) value of 6.2(2.7).

  13. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taguchi, Chiho; Quantum Beam Science Directorate, Japan Atomic Energy Agency; Taura, Futoshi

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b =more » 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.« less

  14. A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

    NASA Technical Reports Server (NTRS)

    Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

    1992-01-01

    Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

  15. Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation.

    PubMed

    Mohamed Abubakkar, M; Saraboji, K; Ponnuswamy, M N

    2013-02-01

    Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively.

  16. Preliminary in situ and real-time study of directional solidification of metallic alloys by x-ray imaging techniques

    NASA Astrophysics Data System (ADS)

    Nguyen Thi, H.; Jamgotchian, H.; Gastaldi, J.; Härtwig, J.; Schenk, T.; Klein, H.; Billia, B.; Baruchel, J.; Dabo, Y.

    2003-05-01

    During directional solidification of a binary alloy, the solid-liquid interface exhibits a variety of patterns that are due to the Mullins-Sekerka instability and governed by the growth conditions. It is well known that properties of the grown material are largely controlled by the microstructures left in the solid during processing. Thus, a precise mastering of the solidification is essential to tailor products in a reproducible fashion to a specified quality. One major difficulty for this study is the real-time and in situ observation of the interface, especially for metallic alloys. A possibility is to use an intense and coherent third generation x-ray beam. By combining different x-ray imaging techniques (absorption/phase contrast radiography and diffraction topography), we have studied the directional melting and solidification of aluminium-based alloys. The preliminary results show the great potential of these techniques for the study of the coupling between stress effects and microstructure formation in solidification processing.

  17. Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

    2010-11-12

    Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

  18. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

    PubMed

    Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

    2008-06-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

  19. Crystallization and preliminary crystallographic analysis of a family 43 β-d-xylosidase from Geobacillus stearothermophilus T-6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brüx, Christian; Niefind, Karsten; Ben-David, Alon

    2005-12-01

    The crystallization and preliminary X-ray analysis of a β-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P2{sub 1}2{sub 1}2 and tetragonal P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2 Å. β-d-Xylosidases (EC 3.2.1.37) are hemicellulases that cleave single xylose units from the nonreducing end of xylooligomers. In this study, the crystallization and preliminary X-ray analysis of a β-d-xylosidase from Geobacillus stearothermophilus T-6more » (XynB3), a family 43 glycoside hydrolase, is described. XynB3 is a 535-amino-acid protein with a calculated molecular weight of 61 891 Da. Purified recombinant native and catalytic inactive mutant proteins were crystallized and cocrystallized with xylobiose in two different space groups, P2{sub 1}2{sub 1}2 (unit-cell parameters a = 98.32, b = 99.36, c = 258.64 Å) and P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2; unit-cell parameters a = b = 140.15, c = 233.11 Å), depending on the detergent. Transferring crystals to cryoconditions required a very careful protocol. Orthorhombic crystals diffract to 2.5 Å and tetragonal crystals to 2.2 Å.« less

  20. Prototype through-pellicle coherent imaging using a 30nm tabletop EUV source

    NASA Astrophysics Data System (ADS)

    Bevis, Charles S.; Karl, Robert M.; Wang, Bin; Esashi, Yuka; Tanksalvala, Michael; Porter, Christina L.; Johnsen, Peter; Adams, Daniel E.; Murnane, Margaret M.; Kapteyn, Henry C.

    2018-03-01

    We present preliminary through-pellicle imaging using a 30nm tabletop extreme ultraviolet (EUV) coherent diffractive imaging microscope. We show that even in a non-optimized setup, this technique enables through-pellicle imaging of a sample with no detectable impact on image fidelity or resolution.

  1. Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

    2007-09-01

    The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

  2. Quantitative energy-dispersive x-ray diffraction for identification of counterfeit medicines: a preliminary study

    NASA Astrophysics Data System (ADS)

    Crews, Chiaki C. E.; O'Flynn, Daniel; Sidebottom, Aiden; Speller, Robert D.

    2015-06-01

    The prevalence of counterfeit and substandard medicines has been growing rapidly over the past decade, and fast, nondestructive techniques for their detection are urgently needed to counter this trend. In this study, energy-dispersive X-ray diffraction (EDXRD) combined with chemometrics was assessed for its effectiveness in quantitative analysis of compressed powder mixtures. Although EDXRD produces lower-resolution diffraction patterns than angular-dispersive X-ray diffraction (ADXRD), it is of interest for this application as it carries the advantage of allowing the analysis of tablets within their packaging, due to the higher energy X-rays used. A series of caffeine, paracetamol and microcrystalline cellulose mixtures were prepared with compositions between 0 - 100 weight% in 20 weight% steps (22 samples in total, including a centroid mixture), and were pressed into tablets. EDXRD spectra were collected in triplicate, and a principal component analysis (PCA) separated these into their correct positions in the ternary mixture design. A partial least-squares (PLS) regression model calibrated using this training set was validated using both segmented cross-validation, and with a test set of six samples (mixtures in 8:1:1 and 5⅓:2⅓:2⅓ ratios) - the latter giving a root-mean square error of prediction (RMSEP) of 1.30, 2.25 and 2.03 weight% for caffeine, paracetamol and cellulose respectively. These initial results are promising, with RMSEP values on a par with those reported in the ADXRD literature.

  3. Preliminary studies of enhanced contrast radiography in anatomy and embryology of insects with Elettra synchrotron light

    NASA Astrophysics Data System (ADS)

    Hönnicke, M. G.; Foerster, L. A.; Navarro-Silva, M. A.; Menk, R.-H.; Rigon, L.; Cusatis, C.

    2005-08-01

    Enhanced contrast X-ray imaging is achieved by exploiting the real part of the refraction index, which is responsible for the phase shifts, in addition to the imaginary part, which is responsible for the absorption. Such techniques are called X-ray phase contrast imaging. An analyzer-based X-ray phase contrast imaging set-up with Diffraction Enhanced Imaging processing (DEI) were used for preliminary studies in anatomy and embryology of insects. Parasitized stinkbug and moth eggs used as control agents of pests in vegetables and adult stinkbugs and mosquitoes ( Aedes aegypti) were used as samples. The experimental setup was mounted in the SYRMEP beamline at ELETTRA. Images were obtained using a high spatial resolution CCD detector (pixel size 14×14 μm 2) coupled with magnifying optics. Analyzer-based X-ray phase contrast images (PCI) and edge detection images show contrast and details not observed with conventional synchrotron radiography and open the possibility for future study in the embryonic development of insects.

  4. Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

    2008-01-01

    SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

  5. X-ray diffraction studies of enkephalins. Crystal structure of [(4'-bromo) Phe4,Leu5]enkephalin.

    PubMed Central

    Ishida, T; Kenmotsu, M; Mino, Y; Inoue, M; Fujiwara, T; Tomita, K; Kimura, T; Sakakibara, S

    1984-01-01

    In order to investigate the structure-activity relationship of [Leu5]- and [Met5]enkephalins, [(4'-bromo)Phe4, Leu5]-, [(4'-bromo)Phe4, Met5]- and [Met5] enkephalins were synthesized and crystallized. The crystal structure of [(4'-bromo) Phe4, Leu5]- enkephalin was determined by X-ray diffraction method using the heavy atom method and refined to R = 0.092 by the least-squares method. The molecule in this crystal took essentially the same type I' beta-turn conformation found in [Leu5]enkephalin [Smith & Griffin (1978) Science 199, 1214-1216). On the other hand, the preliminary three-dimensional Patterson analyses showed that the most probable conformations of [(4'-bromo)Phe4,Met5]- and [Met5]enkephalins are both the dimeric extended forms. Based on these insights, the biologically active conformation of enkephalin was discussed in relation to the mu- and delta-receptors. PMID:6721829

  6. Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

    PubMed Central

    Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

    2009-01-01

    RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

  7. Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

    PubMed

    Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

    2009-11-01

    RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

  8. Isolation, crystallization in the macrogravitation field, preliminary X-ray investigation of uridine phosphorylase from Escherichia coli K-12.

    PubMed

    Mikhailov, A M; Smirnova, E A; Tsuprun, V L; Tagunova, I V; Vainshtein, B K; Linkova, E V; Komissarov, A A; Siprashvili, Z Z; Mironov, A S

    1992-03-01

    Uridine phosphorylase (UPH) from Escherichia coli K-12 has been purified to near homogeneity from a strain harbouring the udp gene, encoding UPH, on a multicopy plasmid. UPH was purified to electrophoretic homogeneity with the specific activity 230 units/mg with a recovery of 80%, yielding 120 mg of enzyme from 3g cells. Crystals of enzyme suitable for X-ray diffraction analysis were obtained in a preparative ultracentrifuge. The packing of the molecules in the crystals may be described by the space group P2(1)2(1)2(1) with the unit cell constants a = 90.4; b = 128.8; c = 136.8 A. There is one molecule per asymmetric unit, Vm = 2.4. These crystals diffract to at least 2.5-2.7 A resolution. The hexameric structure of UPH was directly demonstrated by electron microscopy study and image processing.

  9. Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

    PubMed

    Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

    2009-09-01

    Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

  10. Strategies for Time-resolved X-ray Diffraction of Phase Transitions with Laser Compression

    NASA Astrophysics Data System (ADS)

    Benedetti, Laura Robin; Eggert, J. H.; Bradley, D. K.; Bell, P. M.; Kilkenny, J. D.; Palmer, N.; Petre, R. B.; Rygg, J. R.; Sorce, C.; Collins, G. W.; Boehly, T. R.

    2017-10-01

    As part of a program to document kinetics of phase transitions under laser-driven dynamic compression, we are designing a platform to make multiple x-ray diffraction measurements during a single laser experiment. Our plans include experimental development at Omega-EP and eventual implementation at NIF. We will present our strategy for designing a robust platform that can effectively document a wide variety of phase transformations by utilizing both streaked and multiple-frame imaging detectors. Preliminary designs utilize a novel CMOS detector designed by Sandia National Lab. Our initial experiments include scoping studies that will focus on photometrics and shielding requirements in the high EMP environment close to the target. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344. Lawrence Livermore National Security, LLC, LLNL-ABS-734470.

  11. The structure of biocoats based on TiO2 doped with nitrogen study

    NASA Astrophysics Data System (ADS)

    Boytsova, E. L.; Leonova, L. A.; Pichugin, V. F.

    2018-04-01

    Nitrogen-doped titanium dioxide (N-TiO2) nanofilms were deposited by reactive magnetron sputtering under different bias voltage. The mode of sputtering influences to formation and properties of titanium films. X-ray diffraction (XRD) was used to study the phase transition and crystallinity of the nanofilms. A technique of layer-by-layer measurement of Raman scattering from nanostructured titanium dioxide films based on a preliminary sputtering of the films by argon beam under an angle of 45° and less has been developed. Experimentally confirmed low dissolution rate of the coating in NaCl saline (0.9%).

  12. Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

    PubMed Central

    Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

    2014-01-01

    Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

  13. Toward in situ x-ray diffraction imaging at the nanometer scale

    NASA Astrophysics Data System (ADS)

    Zatsepin, Nadia A.; Dilanian, Ruben A.; Nikulin, Andrei Y.; Gable, Brian M.; Muddle, Barry C.; Sakata, Osami

    2008-08-01

    We present the results of preliminary investigations determining the sensitivity and applicability of a novel x-ray diffraction based nanoscale imaging technique, including simulations and experiments. The ultimate aim of this nascent technique is non-destructive, bulk-material characterization on the nanometer scale, involving three dimensional image reconstructions of embedded nanoparticles and in situ sample characterization. The approach is insensitive to x-ray coherence, making it applicable to synchrotron and laboratory hard x-ray sources, opening the possibility of unprecedented nanometer resolution with the latter. The technique is being developed with a focus on analyzing a technologically important light metal alloy, Al-xCu (where x is 2.0-5.0 %wt). The mono- and polycrystalline samples contain crystallographically oriented, weakly diffracting Al2Cu nanoprecipitates in a sparse, spatially random dispersion within the Al matrix. By employing a triple-axis diffractometer in the non-dispersive setup we collected two-dimensional reciprocal space maps of synchrotron x-rays diffracted from the Al2Cu nanoparticles. The intensity profiles of the diffraction peaks confirmed the sensitivity of the technique to the presence and orientation of the nanoparticles. This is a fundamental step towards in situ observation of such extremely sparse, weakly diffracting nanoprecipitates embedded in light metal alloys at early stages of their growth.

  14. Improving the diffraction of apoA-IV crystals through extreme dehydration.

    PubMed

    Deng, Xiaodi; Davidson, W Sean; Thompson, Thomas B

    2012-01-01

    Apolipoproteins are the protein component of high-density lipoproteins (HDL), which are necessary for mobilizing lipid-like molecules throughout the body. Apolipoproteins undergo self-association, especially at higher concentrations, making them difficult to crystallize. Here, the crystallization and diffraction of the core fragment of apolipoprotein A-IV (apoA-IV), consisting of residues 64-335, is presented. ApoA-IV(64-335) crystallized readily in a variety of hexagonal (P6) morphologies with similar unit-cell parameters, all containing a long axis of nearly 550 Å in length. Preliminary diffraction experiments with the different crystal morphologies all resulted in limited streaky diffraction to 3.5 Å resolution. Crystal dehydration was applied to the different morphologies with variable success and was also used as a quality indicator of crystal-growth conditions. The results show that the morphologies that withstood the most extreme dehydration conditions showed the greatest improvement in diffraction. One morphology in particular was able to withstand dehydration in 60% PEG 3350 for over 12 h, which resulted in well defined intensities to 2.7 Å resolution. These results suggest that the approach of integrating dehydration with variation in crystal-growth conditions might be a general technique to optimize diffraction. © 2012 International Union of Crystallography. All rights reserved.

  15. Modeling 3-D objects with planar surfaces for prediction of electromagnetic scattering

    NASA Technical Reports Server (NTRS)

    Koch, M. B.; Beck, F. B.; Cockrell, C. R.

    1992-01-01

    Electromagnetic scattering analysis of objects at resonance is difficult because low frequency techniques are slow and computer intensive, and high frequency techniques may not be reliable. A new technique for predicting the electromagnetic backscatter from electrically conducting objects at resonance is studied. This technique is based on modeling three dimensional objects as a combination of flat plates where some of the plates are blocking the scattering from others. A cube is analyzed as a simple example. The preliminary results compare well with the Geometrical Theory of Diffraction and with measured data.

  16. Mineralogy, Three Dimensional Structure, and Oxygen Isotope Ratios of Four Crystalline Particles from Comet 81P/Wild 2

    NASA Technical Reports Server (NTRS)

    Nakamura, T.; Noguchi, T.; Tsuchiyama, A.; Ushikubo, T.; Kita, N. T.; Valley, J. W.; Zolensky, M. E.; Kakazu, Y.; Sakamoto, K.; Mashio, E.; hide

    2008-01-01

    Preliminary examinations of small dust particles from comet 82P/Wild 2 revealed many expected and unexpected features. Among them the most striking feature is the presence of abundant crystalline material in the comet. Synchrotron radiation X-ray diffraction and microtomography are the most efficient methods to detect and describe bulk mineralogical features of crystalline cometary particles. In the present study, in addition to these two non-destructive techniques, electron microscopy and ion-probe mass spectrometry were carried out on the four crystalline particles.

  17. Non-destructive diagnostics of irradiated materials using neutron scattering from pulsed neutron sources

    NASA Astrophysics Data System (ADS)

    Korenev, Sergey; Sikolenko, Vadim

    2004-09-01

    The advantage of neutron-scattering studies as compared to the standard X-ray technique is the high penetration of neutrons that allow us to study volume effects. The high resolution of instrumentation on the basis neutron scattering allows measurement of the parameters of lattice structure with high precision. We suggest the use of neutron scattering from pulsed neutron sources for analysis of materials irradiated with pulsed high current electron and ion beams. The results of preliminary tests using this method for Ni foils that have been studied by neutron diffraction at the IBR-2 (Pulsed Fast Reactor at Joint Institute for Nuclear Research) are presented.

  18. X-ray Diffraction Studies of the Structure and Thermochemistry of Alkaline-Earth Oxide-Coated Thermionic Cathodes

    NASA Technical Reports Server (NTRS)

    Karikari, E. K.; Bassey, E.; Wintucky, Edwin G.

    1998-01-01

    NASA LeRC has a broad, active cathode technology development program in which both experimental and theoretical studies are being employed to further development of thermionic cathodes for use as electron sources in vacuum devices for communications and other space applications. One important type of thermionic cathode under development is the alkaline-earth oxide-coated (BaO, SrO, CaO) cathode. Significant improvements in the emission characteristics of this cathode have been obtained through modification of the chemical composition and morphology of the oxide coating, with the best result thus far coming from the addition of In2O3 and Sc2O3. Whereas the In2O3 produces a finer, more uniform particle structure, the exact chemical state and role of the Sc2O3 in the emission enhancement is unknown. The purpose of this cooperative agreement is to combine the studies of the surface chemistry and electron emission at NASA LeRC of chemically modified oxide coatings with a study of the thermochemistry and crystal structure using X-ray diffraction equipment and expertise at Clark Atlanta University (CAU). The study at CAU is intended to provide the description and understanding of the structure and thermochemistry needed for further improvement and optimization of the modified coatings. A description of the experimental procedure, preliminary X-ray diffraction test results, together with the design of an ultrahigh vacuum chamber necessary for high temperature thermochemistry studies will be presented.

  19. Purification, crystallization and preliminary X-ray diffraction analysis of the human mismatch repair protein MutS[beta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tseng, Quincy; Orans, Jillian; Hast, Michael A.

    2012-03-16

    MutS{beta} is a eukaryotic mismatch repair protein that preferentially targets extrahelical unpaired nucleotides and shares partial functional redundancy with MutS{alpha} (MSH2-MSH6). Although mismatch recognition by MutS{alpha} has been shown to involve a conserved Phe-X-Glu motif, little is known about the lesion-binding mechanism of MutS{beta}. Combined MSH3/MSH6 deficiency triggers a strong predisposition to cancer in mice and defects in msh2 and msh6 account for roughly half of hereditary nonpolyposis colorectal cancer mutations. These three MutS homologs are also believed to play a role in trinucleotide repeat instability, which is a hallmark of many neurodegenerative disorders. The baculovirus overexpression and purification ofmore » recombinant human MutS{beta} and three truncation mutants are presented here. Binding assays with heteroduplex DNA were carried out for biochemical characterization. Crystallization and preliminary X-ray diffraction analysis of the protein bound to a heteroduplex DNA substrate are also reported.« less

  20. Purification, crystallization and preliminary X-ray diffraction of SecDF, a translocon-associated membrane protein, from Thermus thermophilus

    PubMed Central

    Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki

    2006-01-01

    Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489

  1. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

    PubMed Central

    Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

    2008-01-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

  2. Focused ion beam direct micromachining of DOEs

    NASA Astrophysics Data System (ADS)

    Khan Malek, Chantal; Hartley, Frank T.; Neogi, Jayant

    2000-09-01

    We discuss here the capability of direct manufacture of various high- resolution diffractive optics, in particular regarding micromachining of DOEs in 3D. Preliminary demonstrations were made in 2-D using an automated FIB system operated at 30 KeV with a Gallium liquid metal ion source and equipped with a gas injection system (GIS). Gratings with a 20 nm line width and zone plates with 32 nm outer ring were milled in a reactive atmosphere (iodine) directly through 3.5 (mu) m and 800 nm of gold respectively. Plans for combining FIB and X-ray lithography to make diffractive optical elements (DOEs) for JPL are also mentioned.

  3. Crystallization and preliminary X-ray diffraction data of β-galactosidase from Aspergillus niger.

    PubMed

    Rico-Díaz, Agustín; Vizoso Vázquez, Ángel; Cerdán, M Esperanza; Becerra, Manuel; Sanz-Aparicio, Julia

    2014-11-01

    β-Galactosidase from Aspergillus niger (An-β-Gal), belonging to the family 35 glycoside hydrolases, hydrolyzes the β-galactosidase linkages in lactose and other galactosides. It is extensively used in industry owing to its high hydrolytic activity and safety. The enzyme has been expressed in yeasts and purified by immobilized metal-ion affinity chromatography for crystallization experiments. The recombinant An-β-Gal, deglycosylated to avoid heterogeneity of the sample, has a molecular mass of 109 kDa. Rod-shaped crystals grew using PEG 3350 as the main precipitant agent. A diffraction data set was collected to 1.8 Å resolution.

  4. Biological imaging by soft X-ray diffraction microscopy

    NASA Astrophysics Data System (ADS)

    Shapiro, David

    We have developed a microscope for soft x-ray diffraction imaging of dry or frozen hydrated biological specimens. This lensless imaging system does not suffer from the resolution or specimen thickness limitations that other short wavelength microscopes experience. The microscope, currently situated at beamline 9.0.1 of the Advanced Light Source, can collect diffraction data to 12 nm resolution with 750 eV photons and 17 nm resolution with 520 eV photons. The specimen can be rotated with a precision goniometer through an angle of 160 degrees allowing for the collection of nearly complete three-dimensional diffraction data. The microscope is fully computer controlled through a graphical user interface and a scripting language automates the collection of both two-dimensional and three-dimensional data. Diffraction data from a freeze-dried dwarf yeast cell, Saccharomyces cerevisiae carrying the CLN3-1 mutation, was collected to 12 run resolution from 8 specimen orientations spanning a total rotation of 8 degrees. The diffraction data was phased using the difference map algorithm and the reconstructions provide real space images of the cell to 30 nm resolution from each of the orientations. The agreement of the different reconstructions provides confidence in the recovered, and previously unknown, structure and indicates the three dimensionality of the cell. This work represents the first imaging of the natural complex refractive contrast from a whole unstained cell by the diffraction microscopy method and has achieved a resolution superior to lens based x-ray tomographic reconstructions of similar specimens. Studies of the effects of exposure to large radiation doses were also carried out. It was determined that the freeze-dried cell suffers from an initial collapse, which is followed by a uniform, but slow, shrinkage. This structural damage to the cell is not accompanied by a diminished ability to see small features in the specimen. Preliminary measurements on frozen-hydrated yeast indicate that the frozen specimens do not exhibit these changes even with doses as high as 5 x 109 Gray.

  5. Production, Purification, Crystallization and Preliminary X-ray Structural Studies of Adeno-Associated Virus Serotype 5

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    DiMattia,M.; Govindasamy, L.; Levy, H.

    2005-01-01

    Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Angstroms resolution using synchrotron radiation and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c =more » 629.7 Angstroms. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less

  6. Purification, identification and preliminary crystallographic studies of a 2S albumin seed protein from Lens culinaris

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gupta, Pankaj; Gaur, Vineet; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

    2008-08-01

    A 2S albumin from L. culinaris was purified and crystallized and preliminary crystallographic studies were carried out. Lens culinaris (lentil) is a widely consumed high-protein-content leguminous crop. A 2S albumin protein (26.5 kDa) has been identified using NH{sub 2}-terminal sequencing from a 90% ammonium sulfate saturation fraction of total L. culinaris seed protein extract. The NH{sub 2}-terminal sequence shows very high homology to PA2, an allergy-related protein from Pisum sativum. The 2S albumin protein was purified using a combination of size-exclusion and ion-exchange chromatography. Crystals of the 2S seed albumin obtained using the hanging-drop vapour-diffusion method diffracted to 2.5 Åmore » resolution and were indexed in space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 78.6, c = 135.2 Å.« less

  7. Crystallization and preliminary crystallographic analysis of the Clostridium perfringens enterotoxin

    PubMed Central

    Briggs, David C.; Smedley, James G.; McClane, Bruce A.; Basak, Ajit K.

    2010-01-01

    Clostridium perfringens is a Gram-positive anaerobic species of bacterium that is notable for its ability to produce a plethora of toxins, including membrane-active toxins (α-toxins), pore-forming toxins (∊-toxins) and binary toxins (ι-toxins). Here, the crystallization of the full-length wild-type C. perfringens enterotoxin is reported, which is the causative agent of the second most prevalent food-borne illness in the United States and has been implicated in many other gastrointestinal pathologies. Several crystal forms were obtained. However, only two of these optimized crystal forms (I and II) were useable for X-ray diffraction data collection. The form I crystals diffracted to d min = 2.7 Å and belonged to space group C2, while the form II crystals diffracted to d min = 4 Å and belonged to space group P213. PMID:20606275

  8. Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation

    PubMed Central

    Mohamed Abubakkar, M.; Saraboji, K.; Ponnuswamy, M. N.

    2013-01-01

    Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively. PMID:23385751

  9. Preliminary X-ray crystallographic analysis of glutathione transferase zeta 1 (GSTZ1a-1a)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boone, Christopher D.; Zhong, Guo; Smeltz, Marci

    2014-01-21

    Crystals of glutathione transferase zeta 1 were grown and shown to diffract X-rays to 3.1 Å resolution. They belonged to space group P1, with unit-cell parameters a = 42.0, b = 49.6, c = 54.6 Å, α = 82.9, β = 69.9, γ = 73.4°.

  10. Refolding, crystallization and preliminary X-ray crystallographic studies of the β-barrel domain of BamA, a membrane protein essential for outer membrane protein biogenesis.

    PubMed

    Ni, Dongchun; Yang, Kun; Huang, Yihua

    2014-03-01

    In Gram-negative bacteria, the assembly of outer membrane proteins (OMPs) requires a five-protein β-barrel assembly machinery (BAM) complex, of which BamA is an essential and evolutionarily conserved integral outer membrane protein. Here, the refolding, crystallization and preliminary X-ray crystallographic characterization of the β-barrel domain of BamA from Escherichia coli (EcBamA) are reported. Native and selenomethionine-substituted EcBamA proteins were crystallized at 16°C and X-ray diffraction data were collected to 2.6 and 3.7 Å resolution, respectively. The native crystals belonged to space group P21212, with unit-cell parameters a = 118.492, b = 159.883, c = 56.000 Å and two molecules in one asymmetric unit; selenomethionine-substituted protein crystals belonged to space group P4322, with unit-cell parameters a = b = 163.162, c = 46.388 Å and one molecule in one asymmetric unit. Initial phases for EcBamA β-barrel domain were obtained from a SeMet SAD data set. These preliminary X-ray crystallographic studies paved the way for further structural determination of the β-barrel domain of EcBamA.

  11. Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

    2008-04-01

    Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

  12. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  13. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  14. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of macrophage growth locus A (MglA) protein from Francisella tularensis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Subburaman, P.; Austin, B.P.; Shaw, G.X.

    2010-11-03

    Francisella tularensis, a potential bioweapon, causes a rare infectious disease called tularemia in humans and animals. The macrophage growth locus A (MglA) protein from F. tularensis associates with RNA polymerase to positively regulate the expression of multiple virulence factors that are required for its survival and replication within macrophages. The MglA protein was overproduced in Escherichia coli, purified and crystallized. The crystals diffracted to 7.5 {angstrom} resolution at the Advanced Photon Source, Argonne National Laboratory and belonged to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 125, c = 54 {angstrom}.

  15. Dependence of magnetic permeability on residual stresses in alloyed steels

    NASA Astrophysics Data System (ADS)

    Hristoforou, E.; Ktena, A.; Vourna, P.; Argiris, K.

    2018-04-01

    A method for the monitoring of residual stress distribution in steels has been developed based on non-destructive surface magnetic permeability measurements. In order to investigate the potential utilization of the magnetic method in evaluating residual stresses, the magnetic calibration curves of various ferromagnetic alloyed steels' grade (AISI 4140, TRIP and Duplex) were examined. X-Ray diffraction technique was used for determining surface residual stress values. The overall measurement results have shown that the residual stress determined by the magnetic method was in good agreement with the diffraction results. Further experimental investigations are required to validate the preliminary results and to verify the presence of a unique normalized magnetic stress calibration curve.

  16. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less

  17. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.

    2017-01-01

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  18. Detecting Negative Obstacles by Use of Radar

    NASA Technical Reports Server (NTRS)

    Mittskus, Anthony; Lux, James

    2006-01-01

    Robotic land vehicles would be equipped with small radar systems to detect negative obstacles, according to a proposal. The term "negative obstacles" denotes holes, ditches, and any other terrain features characterized by abrupt steep downslopes that could be hazardous for vehicles. Video cameras and other optically based obstacle-avoidance sensors now installed on some robotic vehicles cannot detect obstacles under adverse lighting conditions. Even under favorable lighting conditions, they cannot detect negative obstacles. A radar system according to the proposal would be of the frequency-modulation/ continuous-wave (FM/CW) type. It would be installed on a vehicle, facing forward, possibly with a downward slant of the main lobe(s) of the radar beam(s) (see figure). It would utilize one or more wavelength(s) of the order of centimeters. Because such wavelengths are comparable to the characteristic dimensions of terrain features associated with negative hazards, a significant amount of diffraction would occur at such features. In effect, the diffraction would afford a limited ability to see corners and to see around corners. Hence, the system might utilize diffraction to detect corners associated with negative obstacles. At the time of reporting the information for this article, preliminary analyses of diffraction at simple negative obstacles had been performed, but an explicit description of how the system would utilize diffraction was not available.

  19. Conceptual Design for Time-Resolved X-ray Diffraction in a Single Laser-Driven Compression Experiment

    NASA Astrophysics Data System (ADS)

    Benedetti, Laura Robin; Eggert, J. H.; Kilkenny, J. D.; Bradley, D. K.; Bell, P. M.; Palmer, N. E.; Rygg, J. R.; Boehly, T. R.; Collins, G. W.; Sorce, C.

    2017-06-01

    Since X-ray diffraction is the most definitive method for identifying crystalline phases of a material, it is an important technique for probing high-energy-density materials during laser-driven compression experiments. We are developing a design for collecting several x-ray diffraction datasets during a single laser-driven experiment, with a goal of achieving temporal resolution better than 1ns. The design combines x-ray streak cameras, for a continuous temporal record of diffraction, with fast x-ray imagers, to collect several diffraction patterns with sufficient solid angle range and resolution to identify crystalline texture. Preliminary experiments will be conducted at the Omega laser and then implemented at the National Ignition Facility. We will describe the status of the conceptual design, highlighting tradeoffs in the design process. We will also discuss the technical issues that must be addressed in order to develop a successful experimental platform. These include: Facility-specific geometric constraints such as unconverted laser light and target alignment; EMP issues when electronic diagnostics are close to the target; X-ray source requirements; and detector capabilities. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344, LLNL-ABS-725146.

  20. Crystallization and preliminary X-ray diffraction analysis of a novel Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murakami, Mário T.; Center for Applied Toxinology, CAT-CEPID, São Paulo, SP; Advanced Center for Genomics and Proteomics, UNESP-State University of São Paulo, São José do Rio Preto 15054-000

    2007-07-01

    A single crystal of zhaoermiatoxin with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å. Zhaoermiatoxin, an Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis (formerly Trimeresurus mangshanensis, Ermia mangshanensis) venom is a novel member of the PLA{sub 2}-homologue family that possesses an arginine residue at position 49, probably arising from a secondary Lys49→Arg substitution that does notmore » alter the catalytic inactivity towards phospholipids. Like other Lys49 PLA{sub 2} homologues, zhaoermiatoxin induces oedema and strong myonecrosis without detectable PLA{sub 2} catalytic activity. A single crystal with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å.« less

  1. Expression, purification, crystallization and preliminary X-ray diffraction analysis of α-11 giardin from Giardia lamblia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pathuri, Puja; Nguyen, Emily Tam; Luecke, Hartmut, E-mail: hudel@uci.edu

    2006-11-01

    α-11 giardin from the intestinal protozoan parasite, G. lamblia has been cloned, expressed, purified and crystallized under two different conditions and in two different space groups. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group and crystals obtained in the second condition diffracted to 2.93 Å and belong to a primitive monoclinic space group. α-11 Giardin, a protein from the annexin superfamily, is a 35.0 kDa protein from the intestinal protozoan parasite Giardia lamblia which triggers a form of diarrhea called giardiasis. Here, the cloning, expression, purification and the crystallization of α-11more » giardin under two different conditions and in two different space groups is reported. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group, while crystals from the second condition, which included calcium in the crystallization solution, diffracted to 2.93 Å and belong to a primitive monoclinic space group. Determination of the detailed atomic structure of α-11 giardin will provide a better insight into its biological function and might establish whether this class of proteins is a potential drug target against giardiasis.« less

  2. Preliminary crystallographic studies of four crystal forms of serum albumin

    NASA Technical Reports Server (NTRS)

    Carter, D. C.; Chang, B.; Ho, J. X.; Keeling, K.; Krishnasami, Z.

    1994-01-01

    Several crystal forms of serum albumin suitable for three-dimensional structure determination have been grown. These forms include crystals of recombinant and wild-type human serum albumin, baboon serum albumin, and canine serum albumin. The intrinsic limits of X-ray diffraction for these crystals are in the range 0.28-0.22 nm. Two of the crystal forms produced from human and canine albumin include incorporated long-chain fatty acids. Molecular replacement experiments have been successfully conducted on each crystal form using the previously determined atomic coordinates of human serum albumin illustrating the conserved tertiary structure.

  3. On the Use of Dynamical Diffraction Theory To Refine Crystal Structure from Electron Diffraction Data: Application to KLa5O5(VO4)2, a Material with Promising Luminescent Properties.

    PubMed

    Colmont, Marie; Palatinus, Lukas; Huvé, Marielle; Kabbour, Houria; Saitzek, Sébastien; Djelal, Nora; Roussel, Pascal

    2016-03-07

    A new lanthanum oxide, KLa5O5(VO4)2, was synthesized using a flux growth technique that involved solid-state reaction under an air atmosphere at 900 °C. The crystal structure was solved and refined using an innovative approach recently established and based on three-dimensional (3D) electron diffraction data, using precession of the electron beam and then validated against Rietveld refinement and denisty functional theory (DFT) calculations. It crystallizes in a monoclinic unit cell with space group C2/m and has unit cell parameters of a = 20.2282(14) Å, b = 5.8639(4) Å, c = 12.6060(9) Å, and β = 117.64(1)°. Its structure is built on Cresnel-like two-dimensional (2D) units (La5O5) of 4*3 (OLa4) tetrahedra, which run parallel to (001) plane, being surrounded by isolated VO4 tetrahedra. Four isolated vanadate groups create channels that host K(+) ions. Substitution of K(+) cations by another alkali metal is possible, going from lithium to rubidium. Li substitution led to a similar phase with a primitive monoclinic unit cell. A complementary selected area electron diffraction (SAED) study highlighted diffuse streaks associated with stacking faults observed on high-resolution electron microscopy (HREM) images of the lithium compound. Finally, preliminary catalytic tests for ethanol oxidation are reported, as well as luminescence evidence. This paper also describes how solid-state chemists can take advantages of recent progresses in electron crystallography, assisted by DFT calculations and powder X-ray diffraction (PXRD) refinements, to propose new structural types with potential applications to the physicist community.

  4. Comparative crystallization and preliminary X-ray diffraction studies of locked nucleic acid and RNA stems of a tenascin C-binding aptamer

    PubMed Central

    Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.

    2006-01-01

    The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P41212 or P43212, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°. PMID:16820689

  5. Crystallization and preliminary crystallographic study of the yeast Malassezia sympodialis allergen Mala s 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin

    2006-02-01

    Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less

  6. Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br

    2006-10-01

    Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less

  7. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the pectin methylesterase from the sugar cane weevil Sphenophorus levis.

    PubMed

    Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor

    2014-03-01

    Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.

  8. Crystallization and preliminary X-ray diffraction studies of NP24-I, an isoform of a thaumatin-like protein from ripe tomato fruits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Raka; Chakrabarti, Chandana, E-mail: chandana.chakrabarti@saha.ac.in

    2005-08-01

    A thaumatin-like antifungal protein, NP24-I, has been isolated from ripe tomato fruits. It was crystallized by the vapour-diffusion method and data were collected to 2.45 Å. The structure was solved by molecular replacement. NP24 is a 24 kDa (207-amino-acid) antifungal thaumatin-like protein (TLP) found in tomato fruits. An isoform of the protein, NP24-I, is reported to play a possible role in ripening of the fruit in addition to its antifungal properties. The protein has been isolated and purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the tetragonal space group P4{sub 3}, with unit-cell parameters a =more » b = 61.01, c = 62.90 Å and one molecule per asymmetric unit. X-ray diffraction data were processed to a resolution of 2.45 Å and the structure was solved by molecular replacement.« less

  9. Isolation, crystallization and preliminary crystallographic analysis of Salmonella typhimurium uridine phosphorylase crystallized with 2,2′-anhydrouridine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.

    2007-10-01

    S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding themore » catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.« less

  10. Characterizing single isolated radiation-damage events from molecular dynamics via virtual diffraction methods

    DOE PAGES

    Stewart, James A.; Brookman, G.; Price, Patrick Michael; ...

    2018-04-25

    In this study, the evolution and characterization of single-isolated-ion-strikes are investigated by combining atomistic simulations with selected-area electron diffraction (SAED) patterns generated from these simulations. Five molecular dynamics simulations are performed for a single 20 keV primary knock-on atom in bulk crystalline Si. The resulting cascade damage is characterized in two complementary ways. First, the individual cascade events are conventionally quantified through the evolution of the number of defects and the atomic (volumetric) strain associated with these defect structures. These results show that (i) the radiation damage produced is consistent with the Norgett, Robinson, and Torrens model of damage productionmore » and (ii) there is a net positive volumetric strain associated with the cascade structures. Second, virtual SAED patterns are generated for the resulting cascade-damaged structures along several zone axes. The analysis of the corresponding diffraction patterns shows the SAED spots approximately doubling in size, on average, due to broadening induced by the defect structures. Furthermore, the SAED spots are observed to exhibit an average radial outward shift between 0.33% and 0.87% depending on the zone axis. Finally, this characterization approach, as utilized here, is a preliminary investigation in developing methodologies and opportunities to link experimental observations with atomistic simulations to elucidate microstructural damage states.« less

  11. Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Edward B.; Gurda-Whitaker, Brittney; Govindasamy, Lakshmanan

    2006-12-01

    Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. The diffraction data were subsequently processed and reduced with an overall R{sub sym} of 12.3% and a completeness of 89.0%. Based on the unit-cellmore » volume, rotation-function and translation-function results and packing considerations, there is one virus capsid (60 viral proteins) per unit cell and there are ten viral proteins per crystallographic asymmetric unit. The AAV1 capsid shares both the twofold and threefold crystallographic symmetry operators. The AAV1 data have been initially phased using a polyalanine model (based on the crystal structure of AAV4) to 4.0 Å resolution and the structure determination and refinement is in progress using tenfold noncrystallographic symmetry electron-density averaging.« less

  12. Characterizing single isolated radiation-damage events from molecular dynamics via virtual diffraction methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stewart, James A.; Brookman, G.; Price, Patrick Michael

    In this study, the evolution and characterization of single-isolated-ion-strikes are investigated by combining atomistic simulations with selected-area electron diffraction (SAED) patterns generated from these simulations. Five molecular dynamics simulations are performed for a single 20 keV primary knock-on atom in bulk crystalline Si. The resulting cascade damage is characterized in two complementary ways. First, the individual cascade events are conventionally quantified through the evolution of the number of defects and the atomic (volumetric) strain associated with these defect structures. These results show that (i) the radiation damage produced is consistent with the Norgett, Robinson, and Torrens model of damage productionmore » and (ii) there is a net positive volumetric strain associated with the cascade structures. Second, virtual SAED patterns are generated for the resulting cascade-damaged structures along several zone axes. The analysis of the corresponding diffraction patterns shows the SAED spots approximately doubling in size, on average, due to broadening induced by the defect structures. Furthermore, the SAED spots are observed to exhibit an average radial outward shift between 0.33% and 0.87% depending on the zone axis. Finally, this characterization approach, as utilized here, is a preliminary investigation in developing methodologies and opportunities to link experimental observations with atomistic simulations to elucidate microstructural damage states.« less

  13. Crystallization and preliminary X-ray diffraction studies of the glutaminyl cyclase from Carica papaya latex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie

    2005-01-01

    The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less

  14. Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo

    2006-05-01

    The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less

  15. Crystallization and preliminary X-ray diffraction analysis of mouse galectin-4 N-terminal carbohydrate recognition domain in complex with lactose

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra

    2008-07-01

    Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less

  16. Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

    2007-11-01

    The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

    The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

  18. Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

    NASA Technical Reports Server (NTRS)

    Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

    1999-01-01

    Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

  19. Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

    PubMed

    Nanson, Jeffrey David; Forwood, Jade Kenneth

    2014-01-01

    The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

  20. Preparation, crystallization and preliminary X-ray diffraction analysis of two intestinal fatty-acid binding proteins in the presence of 11-(dansylamino)undecanoic acid

    PubMed Central

    Laguerre, Aisha; Wielens, Jerome; Parker, Michael W.; Porter, Christopher J. H.; Scanlon, Martin J.

    2011-01-01

    Fatty-acid binding proteins (FABPs) are abundantly expressed proteins that bind a range of lipophilic molecules. They have been implicated in the import and intracellular distribution of their ligands and have been linked with metabolic and inflammatory responses in the cells in which they are expressed. Despite their high sequence identity, human intestinal FABP (hIFABP) and rat intestinal FABP (rIFABP) bind some ligands with different affinities. In order to address the structural basis of this differential binding, diffraction-quality crystals have been obtained of hIFABP and rIFABP in complex with the fluorescent fatty-acid analogue 11-(dansylamino)undecanoic acid. PMID:21301109

  1. Thin film solar cell design based on photonic crystal and diffractive grating structures.

    PubMed

    Mutitu, James G; Shi, Shouyuan; Chen, Caihua; Creazzo, Timothy; Barnett, Allen; Honsberg, Christiana; Prather, Dennis W

    2008-09-15

    In this paper we present novel light trapping designs applied to multiple junction thin film solar cells. The new designs incorporate one dimensional photonic crystals as band pass filters that reflect short light wavelengths (400 - 867 nm) and transmit longer wavelengths(867 -1800 nm) at the interface between two adjacent cells. In addition, nano structured diffractive gratings that cut into the photonic crystal layers are incorporated to redirect incoming waves and hence increase the optical path length of light within the solar cells. Two designs based on the nano structured gratings that have been realized using the scattering matrix and particle swarm optimization methods are presented. We also show preliminary fabrication results of the proposed devices.

  2. Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

    DOE PAGES

    Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.; ...

    2017-03-29

    Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

  3. Crystallization, optimization and preliminary X-ray characterization of a metal-dependent PI-PLC from Streptomyces antibioticus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackson, Michael R.; Selby, Thomas L.

    2012-10-30

    A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.

  4. Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.

    Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

  5. High-level Expression Purification Crystallization and Preliminary X-ray Crystallographic Studies of the Receptor Binding Domain of botulinum neurotoxin Serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Y Zhang; X Gao; G Buchko

    2011-12-31

    Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less

  6. High-level expression, purification, crystallization and preliminary X-ray crystallographic studies of the receptor-binding domain of botulinum neurotoxin serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Y.; Robinson, H.; Gao, X.

    2010-12-01

    Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less

  7. Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika

    2007-08-01

    The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less

  8. A Preliminary Attempt at Sintering an Ultrafine Alumina Powder Using Microwaves

    DTIC Science & Technology

    1994-09-01

    and unusual properties [Ref. B4]. Dielectric properties of individual ceramic phases differ depending on parameters such as compositicn...useful parameter is an estimate of the amount of power dissipated into a dielectric with a known effective loss factor. For a high frequency electric...cavities, and their influence in ceramic samples must be considered. Therefore scattering, diffraction, interference, and reflection and refraction

  9. Preliminary neutron diffraction studies of Escherichia coli dihydrofolate reductase bound to the anticancer drug methotrexate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bennett, Brad C.; Meilleur, Flora; Myles, Dean A A

    2005-01-01

    The contribution of H atoms in noncovalent interactions and enzymatic reactions underlies virtually all aspects of biology at the molecular level, yet their 'visualization' is quite difficult. To better understand the catalytic mechanism of Escherichia coli dihydrofolate reductase (ecDHFR), a neutron diffraction study is under way to directly determine the accurate positions of H atoms within its active site. Despite exhaustive investigation of the catalytic mechanism of DHFR, controversy persists over the exact pathway associated with proton donation in reduction of the substrate, dihydrofolate. As the initial step in a proof-of-principle experiment which will identify ligand and residue protonation statesmore » as well as precise solvent structures, a neutron diffraction data set has been collected on a 0.3 mm{sup 3} D{sub 2}O-soaked crystal of ecDHFR bound to the anticancer drug methotrexate (MTX) using the LADI instrument at ILL. The completeness in individual resolution shells dropped to below 50% between 3.11 and 3.48 {angstrom} and the I/{sigma}(I) in individual shells dropped to below 2 at around 2.46 {angstrom}. However, reflections with I/{sigma}(I) greater than 2 were observed beyond these limits (as far out as 2.2 {angstrom}). To our knowledge, these crystals possess one of the largest primitive unit cells (P6{sub 1}, a = b = 92, c = 73 {angstrom}) and one of the smallest crystal volumes so far tested successfully with neutrons.« less

  10. The preparation and characterization of a lithium borate glass prepared by the gel technique

    NASA Technical Reports Server (NTRS)

    Weinberg, M. C.; Neilson, G. F.; Smith, G. L.; Dunn, B.; Moore, G. S.; Mackenzie, J. D.

    1985-01-01

    The preparation of an amorphous lithium borate gel by the metal organic procedure is described. In addition, a preliminary evaluation of the behavior of the gel upon heating is given. In particular the crystallization tendency of the gel is studied with the aid of DTA and X-ray diffraction, and the structural changes in the gel are monitored with the aid of IR spectroscopy. The glass produced from the lithium borate gel is compared to both the gel precursor material and a glass of similar composition prepared by conventional techniques. Specifically, the relevant water contents, crystallization behavior, and structural features are contrasted.

  11. Use of X-ray diffraction technique and chemometrics to aid soil sampling strategies in traceability studies.

    PubMed

    Bertacchini, Lucia; Durante, Caterina; Marchetti, Andrea; Sighinolfi, Simona; Silvestri, Michele; Cocchi, Marina

    2012-08-30

    Aim of this work is to assess the potentialities of the X-ray powder diffraction technique as fingerprinting technique, i.e. as a preliminary tool to assess soil samples variability, in terms of geochemical features, in the context of food geographical traceability. A correct approach to sampling procedure is always a critical issue in scientific investigation. In particular, in food geographical traceability studies, where the cause-effect relations between the soil of origin and the final foodstuff is sought, a representative sampling of the territory under investigation is certainly an imperative. This research concerns a pilot study to investigate the field homogeneity with respect to both field extension and sampling depth, taking also into account the seasonal variability. Four Lambrusco production sites of the Modena district were considered. The X-Ray diffraction spectra, collected on the powder of each soil sample, were treated as fingerprint profiles to be deciphered by multivariate and multi-way data analysis, namely PCA and PARAFAC. The differentiation pattern observed in soil samples, as obtained by this fast and non-destructive analytical approach, well matches with the results obtained by characterization with other costly analytical techniques, such as ICP/MS, GFAAS, FAAS, etc. Thus, the proposed approach furnishes a rational basis to reduce the number of soil samples to be collected for further analytical characterization, i.e. metals content, isotopic ratio of radiogenic element, etc., while maintaining an exhaustive description of the investigated production areas. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Dip-coated ZrO2-Y2O3 coatings tested in molten salts for CSP applications

    NASA Astrophysics Data System (ADS)

    Pérez, Francisco Javier; Encinas-Sánchez, Víctor; Lasanta, María Isabel; de Miguel, María Teresa; García-Martín, Gustavo

    2017-06-01

    In the present work, the behaviour of ZrO2 - Y2O3 coatings in contact with molten salts at 500 °C has been studied. The coatings were prepared by sol-gel and deposited by dip-coating on AISI 304 specimens previously prepared by sanding and polishing. The behaviour in contact with molten salt was studied through static corrosion tests by the immersion of the coated samples in an alkali-nitrate mixture with a composition of 60 wt.% NaNO3/40 wt.% KNO3 (commonly known as Solar Salt). Prior to test, the deposited coatings were characterized using Scanning Electron Microscopy and X-Ray Diffraction, showing a compacted, homogeneous and uniform aspect and t-YSZ as main component. After corrosion tests, the samples were characterized via gravimetric, Scanning Electron Microscopy and X-Ray Diffraction. The results show a good behaviour of the coated samples compared with the bare coupon samples. However after 1000 h of testing m-ZrO2 appears in the composition,. At this preliminary study, results confirm the suitability of ZrO2 - Y2O3 coatings in solar applications after those working hours, although it is necessary to optimize the coating and study its behaviour at longer times.

  13. Crystallization and preliminary X-ray analysis of alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamasaki, Masayuki; Ogura, Kohei; Moriwaki, Satoko

    The crystallization and preliminary characterization of the family PL-7 alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1 are presented. Alginate lyases depolymerize alginate, a heteropolysaccharide consisting of α-l-guluronate and β-d-mannuronate, through a β-elimination reaction. The alginate lyases A1-II (25 kDa) and A1-II′ (25 kDa) from Sphingomonas sp. A1, which belong to polysaccharide lyase family PL-7, exhibit 68% homology in primary structure but have different substrate specificities. To determine clearly the structural basis for substrate recognition in the depolymerization mechanism by alginate lyases, both proteins were crystallized at 293 K using the vapour-diffusion method. A crystal of A1-II belonged tomore » space group P2{sub 1} and diffracted to 2.2 Å resolution, with unit-cell parameters a = 51.3, b = 30.1, c = 101.6 Å, β = 100.2°, while a crystal of A1-II′ belonged to space group P2{sub 1}2{sub 1}2{sub 1} and diffracted to 1.0 Å resolution, with unit-cell parameters a = 34.6, b = 68.5, c = 80.3 Å.« less

  14. A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.

    The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less

  15. Expression, purification, crystallization and preliminary X-ray diffraction analysis of nurse shark β2-microglobulin.

    PubMed

    Lu, Shuangshuang; Yao, Shugang; Chen, Rong; Zhang, Nianzhi; Chen, Jianmin; Gao, Feng; Xia, Chun

    2012-04-01

    β(2)-Microglobulin (β(2)m) is an essential subunit of the major histocompatibility complex (MHC) class I molecule that helps to stabilize the structure of peptide-MHC I (pMHC I). It is also one of the typical immunoglobulin superfamily (IgSF) molecules in the adaptive immune system (AIS). Sharks belong to the cartilaginous fish, which are the oldest jawed vertebrate ancestors with an AIS to exist in the world. Thus, the study of cartilaginous fish β(2)m would help in understanding the evolution of IgSF molecules. In order to demonstrate this, β(2)m from a cartilaginous fish, nurse shark (Ginglymostoma cirratum), was expressed, refolded, purified and crystallized. Diffraction data were collected to a resolution of 2.3 Å. The crystal belonged to space group P3(2)21, with unit-cell parameters a = b = 88.230, c = 67.146 Å. The crystal structure contained two molecules in the asymmetric unit. The results will provide structural information for study of the evolution of β(2)m and IgSF in the AIS. © 2012 International Union of Crystallography. All rights reserved.

  16. Expression, crystallization and preliminary X-ray diffraction studies of recombinant Clostridium perfringens β2-toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gurjar, Abhijit A.; Yennawar, Neela H.; Yennawar, Hemant P.

    2007-06-01

    The cloning, expression, purification and crystallization of recombinant Clostridium perfringens β2-toxin is described. The crystals diffracted to 2.9 Å resolution. Clostridium perfringens is a Gram-positive sporulating anaerobic bacterium that is responsible for a wide spectrum of diseases in animals, birds and humans. The virulence of C. perfringens is associated with the production of several enterotoxins and exotoxins. β2-toxin is a 28 kDa exotoxin produced by C. perfringens. It is implicated in necrotic enteritis in animals and humans, a disease characterized by a sudden acute onset with lethal hemorrhagic mucosal ulceration. The recombinant expression, purification and crystallization of β2-toxin using themore » batch-under-oil technique are reported here. Native X-ray diffraction data were obtained to 2.9 Å resolution on a synchrotron beamline at the F2 station at Cornell High Energy Synchrotron Source (CHESS) using an ADSC Quantum-210 CCD detector. The crystals belong to space group R3, with a dimer in the asymmetric unit; the unit-cell parameters are a = b = 103.71, c = 193.48 Å, α = β = 90, γ = 120° using the hexagonal axis setting. A self-rotation function shows that the two molecules are related by a noncrystallographic twofold axis with polar angles ω = 90.0, ϕ = 210.3°.« less

  17. Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Sibani; Biswas, Sampa; Chakrabarti, Chandana

    2005-06-01

    Ervatamin A is a papain-family cysteine protease with high activity and stability. It has been isolated and purified from the latex of the medicinal flowering plant E. coronaria and crystallized by the vapour-diffusion technique. Crystals diffracted to 2.1 Å and the structure was solved by molecular replacement. The ervatamins are highly stable cysteine proteases that are present in the latex of the medicinal plant Ervatamia coronaria and belong to the papain family, members of which share similar amino-acid sequences and also a similar fold comprising two domains. Ervatamin A from this family, a highly active protease compared with others frommore » the same source, has been purified to homogeneity by ion-exchange chromatography and crystallized by the vapour-diffusion method. Needle-shaped crystals of ervatamin A diffract to 2.1 Å resolution and belong to space group C222{sub 1}, with unit-cell parameters a = 31.10, b = 144.17, c = 108.61 Å. The solvent content using an ervatamin A molecular weight of 27.6 kDa is 43.9%, with a V{sub M} value of 2.19 Å{sup 3} Da{sup −1} assuming one protein molecule in the asymmetric unit. A molecular-replacement solution has been found using the structure of ervatamin C as a search model.« less

  18. Type I and type II residual stress in iron meteorites determined by neutron diffraction measurements

    NASA Astrophysics Data System (ADS)

    Caporali, Stefano; Pratesi, Giovanni; Kabra, Saurabh; Grazzi, Francesco

    2018-04-01

    In this work we present a preliminary investigation by means of neutron diffraction experiment to determine the residual stress state in three different iron meteorites (Chinga, Sikhote Alin and Nantan). Because of the very peculiar microstructural characteristic of this class of samples, all the systematic effects related to the measuring procedure - such as crystallite size and composition - were taken into account and a clear differentiation in the statistical distribution of residual stress in coarse and fine grained meteorites were highlighted. Moreover, the residual stress state was statistically analysed in three orthogonal directions finding evidence of the existence of both type I and type II residual stress components. Finally, the application of von Mises approach allowed to determine the distribution of type II stress.

  19. Purification, crystallization and preliminary X-ray diffraction of the C-terminal bromodomain from human BRD2

    PubMed Central

    Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

    2007-01-01

    BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725

  20. Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

    2007-12-01

    The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

  1. Preliminary X-ray diffraction analysis of a thermophilic β-1,3-1,4-glucanase from Clostridium thermocellum.

    PubMed

    Zhang, Lilan; Zhao, Puya; Chen, Chun-Chi; Huang, Chun-Hsiang; Ko, Tzu-Ping; Zheng, Yingying; Guo, Rey-Ting

    2014-07-01

    β-1,3-1,4-Glucanases catalyze the specific hydrolysis of internal β-1,4-glycosidic bonds adjacent to the 3-O-substituted glucose residues in mixed-linked β-glucans. The thermophilic glycoside hydrolase CtGlu16A from Clostridium thermocellum exhibits superior thermal profiles, high specific activity and broad pH adaptability. Here, the catalytic domain of CtGlu16A was expressed in Escherichia coli, purified and crystallized in the trigonal space group P3121, with unit-cell parameters a=b=74.5, c=182.9 Å, by the sitting-drop vapour-diffusion method and diffracted to 1.95 Å resolution. The crystal contains two protein molecules in an asymmetric unit. Further structural determination and refinement are in progress.

  2. Crystallization and preliminary X-ray crystallographic analysis of two vascular apoptosis-inducing proteins (VAPs) from Crotalus atrox venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Igarashi, Tomoko; Oishi, Yuko; Araki, Satohiko

    Vascular apoptosis-inducing protein 1 (VAP1) and VAP2 from C. atrox venom were crystallized in variety of different crystal forms. Diffraction data sets were obtained to 2.5 and 2.15 Å resolution for VAP1 and VAP2, respectively. VAPs are haemorrhagic snake-venom toxins belonging to the reprolysin family of zinc metalloproteinases. In vitro, VAPs induce apoptosis specifically in cultured vascular endothelial cells. VAPs have a modular structure that bears structural homology to mammalian ADAMs (a disintegrin and metalloproteinases). VAP1 is a homodimer with a MW of 110 kDa in which the monomers are connected by a single disulfide bridge. VAP2 is homologous tomore » VAP1 and exists as a monomer with a MW of 55 kDa. In the current study, several crystal forms of VAP1 and VAP2 were obtained using the vapour-diffusion method and diffraction data sets were collected using SPring-8 beamlines. The best crystals of VAP1 and VAP2 generated data sets to 2.5 and 2.15 Å resolution, respectively.« less

  3. Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Molina, Rafael; González, Ana; Moscoso, Miriam

    2007-09-01

    The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-qualitymore » orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.« less

  4. Solvent and temperature effects on crambin, a hydrophobic protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Llinas, M.; Lecomte, J.T.J.; De Marco, A.

    1980-10-01

    Crambin, a 5000-mol. wt. water-insoluble protein found in crambe abyssinica seeds is presently being studied by x-ray diffraction to 0.9 A resolution and /sup 1/H-nuclear magnetic resonance (NMR) spectroscopy. Preliminary /sup 1/H-NMR data at 250 and 600 MHz have suggested that this hydrophobic protein retains a similar globular conformation in both glacial acetic acid (AA), a Bronsted acid, and dimethylformamide (DMF), a Lewis base. These observations suggest that the globular conformation observed in these organic solvents is most likely the native structure present in the crystalline state. As suggested by the high intrinsic resolution of the crystallographic x-ray diffraction pattern,more » and demonstrated by the NMR data, crambin is a very rigid protein. Work is in progress to assign the /sup 1/H-resonances and to correlate H and /sup 13/C NMR dynamic data with the crystallographic model. It is hoped that unravelling conformational features of this hydrophobic protein will provide clues to help us understand other membrane-bound functional proteins.« less

  5. Preliminary crystallographic analysis of avian infectious bronchitis virus main protease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Jun; Shen, Wei; Liao, Ming, E-mail: mliao@scau.edu.cn

    The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed inmore » Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.« less

  6. Mössbauer study of iron-based perovskite-type materials as potential catalysts for ethyl acetate oxidation

    NASA Astrophysics Data System (ADS)

    Paneva, D.; Dimitrov, M.; Velinov, N.; Kolev, H.; Kozhukharov, V.; Tsoncheva, T.; Mitov, I.

    2010-03-01

    La-Sr-Fe perovskite-type oxides were prepared by the nitrate-citrate method. The basic object of this study is layered Ruddlesden-Popper phase LaSr3Fe3O10. The phase composition and structural properties of the obtained materials are investigated by Mössbauer spectroscopy, X-ray diffraction (XRD), X-ray Photoelectron Spectroscopy (XPS) and temperature programmed reduction (TPR). The preliminary catalytic tests show a high potential of these materials for volatile organic compounds (VOCs) elimination as they possess high conversion ability and selectivity to total oxidation of ethyl acetate. Catalytic performance of LaSr3Fe3O10 is depended on the stability of structure and Fe4+-oxidation state.

  7. Crystallization and preliminary X-ray diffraction analysis of the periplasmic domain of the Escherichia coli aspartate receptor Tar and its complex with aspartate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mise, Takeshi; Matsunami, Hideyuki; Samatey, Fadel A.

    The periplasmic domain of the E. coli aspartate receptor Tar was cloned, expressed, purified and crystallized with and without bound ligand. The crystals obtained diffracted to resolutions of 1.58 and 1.95 Å, respectively. The cell-surface receptor Tar mediates bacterial chemotaxis toward an attractant, aspartate (Asp), and away from a repellent, Ni{sup 2+}. To understand the molecular mechanisms underlying the induction of Tar activity by its ligands, the Escherichia coli Tar periplasmic domain with and without bound aspartate (Asp-Tar and apo-Tar, respectively) were each crystallized in two different forms. Using ammonium sulfate as a precipitant, crystals of apo-Tar1 and Asp-Tar1 weremore » grown and diffracted to resolutions of 2.10 and 2.40 Å, respectively. Alternatively, using sodium chloride as a precipitant, crystals of apo-Tar2 and Asp-Tar2 were grown and diffracted to resolutions of 1.95 and 1.58 Å, respectively. Crystals of apo-Tar1 and Asp-Tar1 adopted space group P4{sub 1}2{sub 1}2, while those of apo-Tar2 and Asp-Tar2 adopted space groups P2{sub 1}2{sub 1}2{sub 1} and C2, respectively.« less

  8. Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

    2006-01-01

    The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

  9. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* carbohydrate-binding protein of the human rotavirus strain Wa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kraschnefski, Mark J.; Scott, Stacy A.; Holloway, Gavan

    2005-11-01

    The carbohydrate-binding component (VP8*{sub 64–223}) of the human Wa rotavirus spike protein has been overexpressed in E. coli, purified and crystallized in two different crystal forms. X-ray diffraction data have been collected that have enabled determination of the Wa VP8*{sub 64–223} structure by molecular replacement. Rotaviruses exhibit host-specificity and the first crystallographic information on a rotavirus strain that infects humans is reported here. Recognition and attachment to host cells, leading to invasion and infection, is critically linked to the function of the outer capsid spike protein of the rotavirus particle. In some strains the VP8* component of the spike proteinmore » is implicated in recognition and binding of sialic-acid-containing cell-surface carbohydrates, thereby enabling infection by the virus. The cloning, expression, purification, crystallization and initial X-ray diffraction analysis of the VP8* core from human Wa rotavirus is reported. Two crystal forms (trigonal P3{sub 2}21 and monoclinic P2{sub 1}) have been obtained and X-ray diffraction data have been collected, enabling determination of the VP8*{sub 64–223} structure by molecular replacement.« less

  10. Neutron detectors for the ESS diffractometers

    NASA Astrophysics Data System (ADS)

    Stefanescu, I.; Christensen, M.; Fenske, J.; Hall-Wilton, R.; Henry, P. F.; Kirstein, O.; Müller, M.; Nowak, G.; Pooley, D.; Raspino, D.; Rhodes, N.; Šaroun, J.; Schefer, J.; Schooneveld, E.; Sykora, J.; Schweika, W.

    2017-01-01

    The ambitious instrument suite for the future European Spallation Source whose civil construction started recently in Lund, Sweden, demands a set of diverse and challenging requirements for the neutron detectors. For instance, the unprecedented high flux expected on the samples to be investigated in neutron diffraction or reflectometry experiments requires detectors that can handle high counting rates, while the investigation of sub-millimeter protein crystals will only be possible with large-area detectors that can achieve a position resolution as low as 200 μm. This has motivated an extensive research and development campaign to advance the state-of-the-art detector and to find new technologies that can reach maturity by the time the ESS will operate at full potential. This paper presents the key detector requirements for three of the Time-of-Flight (TOF) diffraction instrument concepts selected by the Scientific Advisory Committee to advance into the phase of preliminary engineering design. We discuss the detector technologies commonly employed at the existing similar instruments and their major challenges for ESS. The detector technologies selected by the instrument teams to collect the diffraction patterns are also presented. Analytical calculations, Monte-Carlo simulations, and real experimental data are used to develop a generic method to estimate the event rate in the diffraction detectors. We apply this method to make predictions for the future diffraction instruments, and thus provide additional information that can help the instrument teams with the optimisation of the detector designs.

  11. Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

    2005-07-01

    Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

  12. Purification, crystallization and preliminary X-ray analysis of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).

    PubMed

    Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A

    2003-08-01

    UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.

  13. Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rong, Hui; Li, Yan; Lou, Xiao-hua

    2007-02-01

    A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

  14. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* sialic acid-binding domain of porcine rotavirus strain OSU

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yang-De, E-mail: zhangyd1960@yahoo.com.cn; Li, Hao; Liu, Hui

    2007-02-01

    Porcine rotavirus strain OSU VP8* domain has been expressed, purified and crystallized. X-ray diffraction data from different crystal forms of the VP8* domain have been collected to 2.65 and 2.2 Å resolution, respectively. The rotavirus outer capsid spike protein VP4 is utilized in the process of rotavirus attachment to and membrane penetration of host cells. VP4 is cleaved by trypsin into two domains: VP8* and VP5*. The VP8* domain is implicated in initial interaction with sialic acid-containing cell-surface carbohydrates and triggers subsequent virus invasion. The VP8* domain from porcine OSU rotavirus was cloned and expressed in Escherichia coli. Different crystalmore » forms (orthorhombic P2{sub 1}2{sub 1}2{sub 1} and tetragonal P4{sub 1}2{sub 1}2) were harvested from two distinct crystallization conditions. Diffraction data have been collected to 2.65 and 2.2 Å resolution and the VP8*{sub 65–224} structure was determined by molecular replacement.« less

  15. Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

    2006-12-01

    The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

  16. Off-plane x-ray reflection grating fabrication

    NASA Astrophysics Data System (ADS)

    Peterson, Thomas J.; DeRoo, Casey T.; Marlowe, Hannah; McEntaffer, Randall L.; Miles, Drew M.; Tutt, James H.; Schultz, Ted B.

    2015-09-01

    Off-plane X-ray diffraction gratings with precision groove profiles at the submicron scale will be used in next generation X-ray spectrometers. Such gratings will be used on a current NASA suborbital rocket mission, the Off-plane Grating Rocket Experiment (OGRE), and have application for future grating missions. The fabrication of these gratings does not come without challenges. High performance off-plane gratings must be fabricated with precise radial grating patterns, optically at surfaces, and specific facet angles. Such gratings can be made using a series of common micro-fabrication techniques. The resulting process is highly customizable, making it useful for a variety of different mission architectures. In this paper, we detail the fabrication method used to produce high performance off-plane gratings and report the results of a preliminary qualification test of a grating fabricated in this manner. The grating was tested in the off-plane `Littrow' configuration, for which the grating is most efficient for a given diffraction order, and found to achieve 42% relative efficiency in the blaze order with respect to all diffracted light.

  17. Crystallization and preliminary X-ray analysis of a low density lipoprotein from human plasma.

    PubMed

    Prassl, R; Chapman, J M; Nigon, F; Sara, M; Eschenburg, S; Betzel, C; Saxena, A; Laggner, P

    1996-11-15

    Single crystals of human plasma low density lipoprotein (LDL), the major transport vehicle for cholesterol in blood, have been produced with a view to analysis of the three-dimensional structure by x-ray crystallography. Crystals with dimensions of approximately 200 x 100 x 50 microm have been reproducibly obtained from highly homogeneous LDL particle subspecies, isolated in the density ranges d = 1.0271-1. 0297 g/ml and d = 1.0297-1.0327 g/ml. Electron microscopic imaging of ultrathin-sectioned preparations of the crystals confirmed the existence of a regular, quasihexagonal arrangement of spherical particles of approximately 18 nm in diameter, thereby resembling the dimensions characteristic of LDL after dehydration and fixation. X-ray diffraction with synchrotron radiation under cryogenic conditions revealed the presence of well resolved diffraction spots, to a resolution of about 29 A. The diffraction patterns are indexed in terms of a triclinic lattice with unit cell dimensions of a = 16. 1 nm, b = 39.0 nm, c = 43.9 nm; alpha = 96.2 degrees, beta = 92.1 degrees, gamma = 102 degrees, and with space group P1.

  18. Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

    2014-09-25

    A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

  19. OBSERVATIONS OF BINARY STARS WITH THE DIFFERENTIAL SPECKLE SURVEY INSTRUMENT. III. MEASURES BELOW THE DIFFRACTION LIMIT OF THE WIYN TELESCOPE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Horch, Elliott P.; Van Altena, William F.; Howell, Steve B.

    2011-06-15

    In this paper, we study the ability of CCD- and electron-multiplying-CCD-based speckle imaging to obtain reliable astrometry and photometry of binary stars below the diffraction limit of the WIYN 3.5 m Telescope. We present a total of 120 measures of binary stars, 75 of which are below the diffraction limit. The measures are divided into two groups that have different measurement accuracy and precision. The first group is composed of standard speckle observations, that is, a sequence of speckle images taken in a single filter, while the second group consists of paired observations where the two observations are taken onmore » the same observing run and in different filters. The more recent paired observations were taken simultaneously with the Differential Speckle Survey Instrument, which is a two-channel speckle imaging system. In comparing our results to the ephemeris positions of binaries with known orbits, we find that paired observations provide the opportunity to identify cases of systematic error in separation below the diffraction limit and after removing these from consideration, we obtain a linear measurement uncertainty of 3-4 mas. However, if observations are unpaired or if two observations taken in the same filter are paired, it becomes harder to identify cases of systematic error, presumably because the largest source of this error is residual atmospheric dispersion, which is color dependent. When observations are unpaired, we find that it is unwise to report separations below approximately 20 mas, as these are most susceptible to this effect. Using the final results obtained, we are able to update two older orbits in the literature and present preliminary orbits for three systems that were discovered by Hipparcos.« less

  20. Insect-cell expression, crystallization and X-ray data collection of the bradyzoite-specific antigen BSR4 from Toxoplasma gondii

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grujic, Ognjen; Grigg, Michael E.; Boulanger, Martin J., E-mail: mboulang@uvic.ca

    2008-05-01

    Preliminary X-ray diffraction studies of the bradyzoite-specific surface antigen BSR4 from T. gondii are described. Toxoplasma gondii is an important global pathogen that infects nearly one third of the world’s adult population. A family of developmentally expressed structurally related surface-glycoprotein adhesins (SRSs) mediate attachment to and are utilized for entry into host cells. The latent bradyzoite form of T. gondii persists for the life of the host and expresses a distinct family of SRS proteins, of which the bradyzoite-specific antigen BSR4 is a prototypical member. Structural studies of BSR4 were initiated by first recombinantly expressing BSR4 in insect cells, whichmore » was followed by crystallization and preliminary X-ray data collection to 1.95 Å resolution. Data processing showed that BSR4 crystallized with one molecule in the asymmetric unit of the P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2 space group, with a solvent content of 60% and a corresponding Matthews coefficient of 2.98 Å{sup 3} Da{sup −1}.« less

  1. Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jens, Jason; Raghunathan, Kannan; Vago, Frank

    2010-01-12

    EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.

  2. Preliminary joint X-ray and neutron protein crystallographic studies of endoxylanase II from the fungus Trichoderma longibrachiatum

    PubMed Central

    Kovalevsky, Andrey Y.; Hanson, B. Leif; Seaver, Sean; Fisher, S. Zoë; Mustyakimov, Marat; Langan, Paul

    2011-01-01

    Room-temperature X-ray and neutron diffraction data were measured from a family 11 endoxylanase holoenzyme (XynII) originating from the filamentous fungus Trichoderma longibrachiatum to 1.55 Å resolution using a home source and to 1.80 Å resolution using the Protein Crystallography Station at LANSCE. Crystals of XynII, which is an important enzyme for biofuel production, were grown at pH 8.5 in order to examine the effect of basic conditions on the protonation-state distribution in the active site and throughout the protein molecule and to provide insights for rational engineering of catalytically improved XynII for industrial applications. PMID:21301107

  3. Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

    PubMed Central

    Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

    2005-01-01

    This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108

  4. N-alkyl functionalised expanded ring N-heterocyclic carbene complexes of rhodium(I) and iridium(I): structural investigations and preliminary catalytic evaluation.

    PubMed

    Dunsford, Jay J; Tromp, Dorette S; Cavell, Kingsley J; Elsevier, Cornelis J; Kariuki, Benson M

    2013-05-28

    A series of new N-alkyl functionalised 6- and 7-membered expanded ring N-heterocyclic carbene (NHC) pro-ligands 3-6 and their corresponding complexes of rhodium(I) and iridium(I), [M(NHC)(COD)Cl] 7-14 and [M(NHC)(CO)2Cl] 15-22 are described. The complexes have been characterised by (1)H and (13)C{(1)H} NMR, mass spectrometry, IR and X-ray diffraction. It is noted from X-ray diffraction studies that the N-alkyl substituents are found to orientate themselves away from the metal centre due to unfavourable steric interactions resulting in low percent buried volume (%V(bur)) values in the solid state. The heterocycle ring size is also found to dictate the spatial orientation of the N-alkyl substituents in the neopentyl functionalised derivatives 10 and 14. The 7-membered derivative 14 allows for a conformational 'twist' of the heterocycle ring with the N-alkyl substituents adopting a mutually trans configuration with respect to each other, while the more rigid 6-membered system 10 does not allow for this conformational 'twist' and consequently the N-alkyl substituents adopt a mutually cis configuration. The σ-donor function of this new class of expanded ring NHC ligand has also been probed by measured IR stretching frequencies of the [M(NHC)(CO)2Cl] complexes 15-22. A preliminary catalytic survey of the hydrogenation of functionalised alkenes with molecular hydrogen under mild conditions has also been undertaken with complex , affording an insight into the application of large ring NHC ancillary ligands bearing N-alkyl substituents in hydrogenation transformations.

  5. Physico-chemical characteristics and antimicrobial studies of silver doped hydroxyapatite

    NASA Astrophysics Data System (ADS)

    Predoi, D.; Predoi, M. V.; Kettani, Moncef Ech Cherif El; Leduc, Damien; Iconaru, S. L.; Ciobanu, C. S.; Buton, N.; Petre, C. C.; Prodan, A. M.

    2018-02-01

    The present research is focused on the synthesis, structural and morphological characterization and antimicrobial evaluation of silver doped hydroxyapatite (AgHAp) in water. The preliminary ultrasonic characterizations of the AgHAp in water synthesized by an adapted co-precipitation method are also presented. X-ray diffraction result showed that silver ions were substituted in the hydroxyapatite structure. The lattice parameters increased when the silver substitution increased. The morphology of AgHAp were evaluated by Scanning Electron Microscopy (SEM). By EDX analysis the constituents elements of hydroxyapatite were detected in all analyzed samples. The silver was also found in the samples with xAg = 0.5 and 0.2. The colloidal properties of the resulted AgHAp (xAg = 0.0, 0.05 and 0.2) in water were analyzed by Dynamic Light Scattering (DLS) and zeta potential. On the other hand, the novelty of our research consists of preliminary ultrasonic measurements (US) conducted on AgHAp in water. Furthermore, the antimicrobial activity of AgHAp was evaluated and a decrease in the number of surviving cells was established.

  6. High-level expression, purification, crystallization and preliminary X-ray crystallographic studies of the receptor binding domain of botulinum neurotoxin serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanfeng; Gao, Xiaoli; Qin, Lin

    2010-12-01

    Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and can cause neuroparalytic disease botulism. Due to the limitations of production and manipulation of holoenzymes, expressing non-toxic heavy chain receptor binding domains (HCR) has become a common strategy for vaccine and antibody development. Meanwhile, large quantities and highly purified soluble proteins are required for research areas such as antibody maturation and structural biology. We present high level expression and purification of the BoNT serotype D HCR in E. coli using a codon-optimized cDNA. By varying expression conditions, especially at low temperature, the protein was expressed at a high level withmore » high solubility. About 150-200 mg protein was purified to >90% purity from 1 L cell culture. The recombinant D_HCR was crystallized and the crystals diffracted to 1.65 Å resolution. The crystals belong to space group P212121 with unit cell dimensions a = 60.8 Å, b = 89.7 Å, c = 93.9 Å. Preliminary crystallographic data analysis revealed one molecule in asymmetric unit.« less

  7. A numerical wave-optical approach for the simulation of analyzer-based x-ray imaging

    NASA Astrophysics Data System (ADS)

    Bravin, A.; Mocella, V.; Coan, P.; Astolfo, A.; Ferrero, C.

    2007-04-01

    An advanced wave-optical approach for simulating a monochromator-analyzer set-up in Bragg geometry with high accuracy is presented. The polychromaticity of the incident wave on the monochromator is accounted for by using a distribution of incoherent point sources along the surface of the crystal. The resulting diffracted amplitude is modified by the sample and can be well represented by a scalar representation of the optical field where the limitations of the usual ‘weak object’ approximation are removed. The subsequent diffraction mechanism on the analyzer is described by the convolution of the incoming wave with the Green-Riemann function of the analyzer. The free space propagation up to the detector position is well reproduced by a classical Fresnel-Kirchhoff integral. The preliminary results of this innovative approach show an excellent agreement with experimental data.

  8. Cloning, purification, crystallization and preliminary crystallographic analysis of SecA from Enterococcus faecalis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus

    2006-06-01

    SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less

  9. Toward Sodium X-Ray Diffraction in the High-Pressure Regime

    NASA Astrophysics Data System (ADS)

    Gong, X.; Polsin, D. N.; Rygg, J. R.; Boehly, T. R.; Crandall, L.; Henderson, B. J.; Hu, S. X.; Huff, M.; Saha, R.; Collins, G. W.; Smith, R.; Eggert, J.; Lazicki, A. E.; McMahon, M.

    2017-10-01

    We are working to quasi-isentropically compress sodium into the terapascal regime to test theoretical predictions that sodium transforms to an electride. A series of hydrodynamic simulations have been performed to design experiments to investigate the structure and optical properties of sodium at pressures up to 500 GPa. We show preliminary results where sodium samples, sandwiched between diamond plates and lithium-fluoride windows, are ramp compressed by a gradual increase in the drive-laser intensity. The low sound speed in sodium makes it particularly susceptible to forming a shock; therefore, it is difficult to compress without melting the sample. Powder x-ray diffraction is used to provide information on the structure of sodium at these high pressures. This material is based upon work supported by the Department of Energy National Nuclear Security Administration under Award Number DE-NA0001944.

  10. Crystallization and preliminary X-ray diffraction analysis of crotoxin B from Crotalus durissus collilineatus venom

    PubMed Central

    Salvador, G. H. M.; Fernandes, C. A. H.; Corrêa, L. C.; Santos-Filho, N. A.; Soares, A. M.; Fontes, M. R. M.

    2009-01-01

    Crotoxin B is a basic phospholipase A2 found in the venom of several Crotalus durissus ssp. rattlesnakes and is one of the subunits that constitute crotoxin, the main component of the venom of these snakes. This heterodimeric toxin is related to important envenomation effects such as neurological disorders, myotoxicity and renal failure. Although crotoxin was first crystallized in 1938, the first structural data only became available in 2007 (for crotoxin B from C. durissus terrificus) and showed an ambiguous result for the biological assembly, which could be either dimeric or tetrameric. In this work, the crystallization, X-ray diffraction data collection at 2.2 Å resolution and molecular-replacement solution of a dimeric complex formed by two crotoxin B isoforms from C. durissus collilineatus venom is presented. PMID:19851009

  11. Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

    2006-02-01

    D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

  12. Crystallization and Preliminary X-ray Diffraction Analysis of Hemextin A: A Unique Anticoagulant Protein from Hemachatus haemachatus Venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee,Y.; Kumar, S.; Jobichen, C.

    2007-01-01

    Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less

  13. Development of high-average-power DPSSL with high beam quality

    NASA Astrophysics Data System (ADS)

    Nakai, Sadao; Kanabe, Tadashi; Kawashima, Toshiyuki; Yamanaka, Masanobu; Izawa, Yasukazu; Nakatuka, Masahiro; Kandasamy, Ranganathan; Kan, Hirofumi; Hiruma, Teruo; Niino, Masayuki

    2000-08-01

    The recent progress of high power diode laser is opening new fields of laser and its application. We are developing high average power diode pumped solid state laser DPSSL for laser fusion power plant, for space propulsion and for various applications in industry. The common features or requirements of our High Average-power Laser for Nuclear-fusion Application (HALNA) are large pulse energy with relatively low repetition of few tens Hz, good beam quality of order of diffraction limit and high efficiency more than 10%. We constructed HALNA 10 (10J X 10 Hz) and tested the performance to clarify the scalability to higher power system. We have obtained in a preliminary experiment a 8.5 J output energy at 0.5 Hz with beam quality of 2 times diffraction limited far-field pattern.

  14. Center for Macromolecular Crystallography, University of Alabama in Birmingham

    NASA Technical Reports Server (NTRS)

    Navia, Manuel A.

    1991-01-01

    Porcine pancreatic elastase (PPE) crystals grown under microgravity conditions on mission STS-26 of the Space Shuttle Discovery were shown to diffract to considerably higher resolution than the best PPE crystals grown by us on the ground. We have now independently refined both the microgravity and ground-based data. Preliminary results of these refinements are summarized. These results show nearly a doubling of experimental diffraction data for this structure, exceeding 1.3 A resolution. Improved phase information derived from the refined structure of PPE based on this microgravity data has allowed us to interpret previously-uninterpretable electron density obtained from ground-based crystals of a complex of PPE with a chemically-reactive inhibitor. Intermediate stages in the enzyme-inhibitor reaction mechanism in the crystal can now be directly observed. Further refinement of PPE structures is in progress.

  15. Automated composite ellipsoid modelling for high frequency GTD analysis

    NASA Technical Reports Server (NTRS)

    Sze, K. Y.; Rojas, R. G.; Klevenow, F. T.; Scheick, J. T.

    1991-01-01

    The preliminary results of a scheme currently being developed to fit a composite ellipsoid to the fuselage of a helicopter in the vicinity of the antenna location are discussed under the assumption that the antenna is mounted on the fuselage. The parameters of the close-fit composite ellipsoid would then be utilized as inputs into NEWAIR3, a code programmed in FORTRAN 77 for high frequency Geometrical Theory of Diffraction (GTD) Analysis of the radiation of airborne antennas.

  16. Bunch length measurement at the Fermilab A0 photoinjector using a Martin-Puplett interferometer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thurman-Keup, Randy; Fliller, Raymond Patrick; Kazakevich, Grigory

    2008-05-01

    We present preliminary measurements of the electron bunch lengths at the Fermilab A0 Photoinjector using a Martin-Puplett interferometer on loan from DESY. The photoinjector provides a relatively wide range of bunch lengths through laser pulse width adjustment and compression of the beam using a magnetic chicane. We present comparisons of data with simulations that account for diffraction distortions in the signal and discuss future plans for improving the measurement.

  17. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Zhijie; Chakraborty, Sayan; Xu, Guozhou

    Does not respond to nucleotides 1 (DORN1) has recently been identified as the first membrane-integral plant ATP receptor, which is required for ATP-induced calcium response, mitogen-activated protein kinase activation and defense responses inArabidopsis thaliana. In order to understand DORN1-mediated ATP sensing and signal transduction, crystallization and preliminary X-ray studies were conducted on the extracellular domain of DORN1 (atDORN1-ECD) and that of an orthologous protein,Camelina sativalectin receptor kinase I.9 (csLecRK-I.9-ECD or csI.9-ECD). A variety of deglycosylation strategies were employed to optimize the glycosylated recombinant atDORN1-ECD for crystallization. In addition, the glycosylated csI.9-ECD protein was crystallized at 291 K. X-ray diffraction datamore » were collected at 4.6 Å resolution from a single crystal. The crystal belonged to space groupC222 orC222 1, with unit-cell parametersa= 94.7,b= 191.5,c= 302.8 Å. These preliminary studies have laid the foundation for structural determination of the DORN1 and I.9 receptor proteins, which will lead to a better understanding of the perception and function of extracellular ATP in plants.« less

  18. Crystallization and preliminary X-ray diffraction studies of delta-toxin from Clostridium perfringens.

    PubMed

    Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit

    2011-03-01

    Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.

  19. Crystallization and preliminary X-ray diffraction study of recombinant adenine phosphoribosyltransferase from the thermophilic bacterium Thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2017-07-01

    Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).

  20. Crystallization and preliminary X-ray crystallographic analysis of the heterodimeric crotoxin complex and the isolated subunits crotapotin and phospholipase A{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santos, K. F.; Murakami, M. T.; Cintra, A. C. O.

    2007-04-01

    Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained. Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained.more » The crotoxin complex crystal belongs to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 38.2, b = 68.7, c = 84.2 Å, and diffracted to 1.75 Å resolution. The crystal of the phospholipase A{sub 2} domain belongs to the hexagonal space group P6{sub 1}22 (or its enantiomorph P6{sub 5}22), with unit-cell parameters a = b = 38.7, c = 286.7 Å, and diffracted to 2.6 Å resolution. The crotapotin crystal diffracted to 2.3 Å resolution; however, the highly diffuse diffraction pattern did not permit unambiguous assignment of the unit-cell parameters.« less

  1. Crystallization and x-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase [Crysallization and preliminary x-ray diffraction analysis of a bacterial class I labdane-related diterpene synthase

    DOE PAGES

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...

    2015-08-25

    Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less

  2. High-frequency techniques for RCS prediction of plate geometries

    NASA Technical Reports Server (NTRS)

    Balanis, Constantine A.; Polka, Lesley A.

    1992-01-01

    The principal-plane scattering from perfectly conducting and coated strips and rectangular plates is examined. Previous reports have detailed Geometrical Theory of Diffraction/Uniform Theory of Diffraction (GTD/UTD) solutions for these geometries. The GTD/UTD solution for the perfectly conducting plate yields monostatic radar cross section (RCS) results that are nearly identical to measurements and results obtained using the Moment Method (MM) and the Extended Physical Theory of Diffraction (EPTD). This was demonstrated in previous reports. The previous analysis is extended to bistatic cases. GTD/UTD results for the principal-plane scattering from a perfectly conducting, infinite strip are compared to MM and EPTD data. A comprehensive overview of the advantages and disadvantages of the GTD/UTD and of the EPTD and a detailed analysis of the results from both methods are provided. Several previous reports also presented preliminary discussions and results for a GTD/UTD model of the RCS of a coated, rectangular plate. Several approximations for accounting for the finite coating thickness, plane-wave incidence, and far-field observation were discussed. Here, these approximations are replaced by a revised wedge diffraction coefficient that implicitly accounts for a coating on a perfect conductor, plane-wave incidence, and far-field observation. This coefficient is computationally more efficient than the previous diffraction coefficient because the number of Maliuzhinets functions that must be calculated using numerical integration is reduced by a factor of 2. The derivation and the revised coefficient are presented in detail for the hard polarization case. Computations and experimental data are also included. The soft polarization case is currently under investigation.

  3. Crystallization and preliminary X-ray diffraction studies of BmooPLA2-I, a platelet-aggregation inhibitor and hypotensive phospholipase A2 from Bothrops moojeni venom

    PubMed Central

    Salvador, Guilherme H. M.; Marchi-Salvador, Daniela P.; Silveira, Lucas B.; Soares, Andreimar M.; Fontes, Marcos R. M.

    2011-01-01

    Phospholipases A2 (PLA2s) are enzymes that cause the liberation of fatty acids and lysophospholipids by the hydrolysis of membrane phospholipids. In addition to their catalytic action, a wide variety of pharmacological activities have been described for snake-venom PLA2s. BmooPLA2-I is an acidic, nontoxic and catalytic PLA2 isolated from Bothrops moojeni snake venom which exhibits an inhibitory effect on platelet aggregation, an immediate decrease in blood pressure, inducing oedema at a low concentration, and an effective bactericidal effect. BmooPLA2-I has been crystallized and X-ray diffraction data have been collected to 1.6 Å resolution using a synchrotron-radiation source. The crystals belonged to space group C2221, with unit-cell parameters a = 39.7, b = 53.2, c = 89.2 Å. The molecular-replacement solution of BmooPLA2-I indicated a monomeric conformation, which is in agreement with nondenaturing electrophoresis and dynamic light-scattering experiments. A comparative study of this enzyme with the acidic PLA2 from B. jararacussu (BthA-I) and other toxic and nontoxic PLA2s may provide important insights into the functional aspects of this class of proteins. PMID:21821890

  4. Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module from family 64 (StX).

    PubMed

    Campos, Bruna Medeia; Liberato, Marcelo Vizona; Polikarpov, Igor; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

    2015-03-01

    In recent years, biofuels have attracted great interest as a source of renewable energy owing to the growing global demand for energy, the dependence on fossil fuels, limited natural resources and environmental pollution. However, the cost-effective production of biofuels from plant biomass is still a challenge. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases to polysaccharides, is crucial for enzyme development. Aiming at the structural and functional characterization of novel CBMs involved in plant polysaccharide deconstruction, an analysis of the CAZy database was performed and CBM family 64 was chosen owing to its capacity to bind with high specificity to microcrystalline cellulose and to the fact that is found in thermophilic microorganisms. In this communication, the CBM-encoding module named StX was expressed, purified and crystallized, and X-ray diffraction data were collected from native and derivatized crystals to 1.8 and 2.0 Å resolution, respectively. The crystals, which were obtained by the hanging-drop vapour-diffusion method, belonged to space group P3121, with unit-cell parameters a = b = 43.42, c = 100.96 Å for the native form. The phases were found using the single-wavelength anomalous diffraction method.

  5. Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus

    PubMed Central

    Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko

    2013-01-01

    Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P212121, with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å. PMID:23295485

  6. Crystallization and preliminary X-ray analysis of human MTH1 with a homogeneous N-terminus.

    PubMed

    Koga, Yukari; Inazato, Miyuki; Nakamura, Teruya; Hashikawa, Chie; Chirifu, Mami; Michi, Asuka; Yamashita, Taku; Toma, Sachiko; Kuniyasu, Akihiko; Ikemizu, Shinji; Nakabeppu, Yusaku; Yamagata, Yuriko

    2013-01-01

    Human MTH1 (hMTH1) is an enzyme that hydrolyses several oxidized purine nucleoside triphosphates to their corresponding nucleoside monophosphates. Crystallographic studies have shown that the accurate mode of interaction between 8-oxoguanine and hMTH1 cannot be understood without determining the positions of the H atoms, as can be observed in neutron and/or ultrahigh-resolution X-ray diffraction studies. The hMTH1 protein prepared in the original expression system from Escherichia coli did not appear to be suitable for obtaining high-quality crystals because the hMTH1 protein had heterogeneous N-termini of Met1 and Gly2 that resulted from N-terminal Met excision by methionine aminopeptidase from the E. coli host. To obtain homogeneous hMTH1, the Gly at the second position was replaced by Lys. As a result, mutant hMTH1 protein [hMTH1(G2K)] with a homogeneous N-terminus could be prepared and high-quality crystals which diffracted to near 1.1 Å resolution using synchrotron radiation were produced. The new crystals belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 46.36, b = 47.58, c = 123.89 Å.

  7. Cloning, expression, purification and preliminary crystallographic characterization of a shikimate dehydrogenase from Corynebacterium glutamicum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schoepe, Jan, E-mail: jschoepe@smail.uni-koeln.de; Niefind, Karsten; Chatterjee, Shivani

    2006-07-01

    The crystallization and preliminary X-ray characterization of a shikimate dehydrogenase from C. glutamicum is presented. The shikimate dehydrogenase from Corynebacterium glutamicum has been cloned into an Escherichia coli expression vector, overexpressed and purified. Native crystals were obtained by the vapour-diffusion technique using 2-methyl-2,4-pentanediol as a precipitant. The crystals belong to the centred monoclinic space group C2, with unit-cell parameters a = 118.77, b = 63.17, c = 35.67 Å, β = 92.26° (at 100 K), and diffract to 1.64 Å on a synchrotron X-ray source. The asymmetric unit is likely to contain one molecule, corresponding to a packing density ofmore » 2.08 Å{sup 3} Da{sup −1} and a solvent content of about 41%.« less

  8. Crystallization and preliminary crystallographic analysis of d-alanine-d-alanine ligase from Streptococcus mutans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Yong-Zhi; Sheng, Yu; Li, Lan-Fen

    2007-09-01

    A potential target for antibiotic drug design, d-alanine-d-alanine ligase from S. mutans, was expressed in E. coli, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. d-Alanine-d-alanine ligase is encoded by the gene ddl (SMU-599) in Streptococcus mutans. This ligase plays a very important role in cell-wall biosynthesis and may be a potential target for drug design. To study the structure and function of this ligase, the gene ddl was amplified from S. mutans genomic DNA and cloned into the expression vector pET28a. The protein was expressed in soluble form in Escherichia coli strain BL21 (DE3). Homogeneous proteinmore » was obtained using a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Purified protein was crystallized and the cube-shaped crystal diffracted to 2.4 Å. The crystal belongs to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 79.50, c = 108.97 Å. There is one molecule per asymmetric unit.« less

  9. Purification, crystallization and preliminary X-ray diffraction studies on goat (Capra hircus) hemoglobin - a low oxygen affinity species.

    PubMed

    Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Balasubramanian, Moovarkumudalvan; Ponnuswamy, Mondikalipudur Nanjappa Gounder

    2009-01-01

    Hemoglobin is a vital protein present in almost all higher species. It is a transport protein involved in carrying oxygen from lungs to tissues and carbon dioxide back to lungs by an intrinsically coordinated manner. Even though a good amount of work has been carried out in this direction there exists scarcity of structural insight on low oxygen affinity species. Attempts are being made to unravel the structural insight of this low oxygen affinity species. Goat blood plasma was collected, treated with EDTA to avoid blood clotting and purification was accomplished using DEAE-anion chromatographic column. The goat hemoglobin was crystallized using 50mM of phosphate buffer at pH 6.7 with 1M NaCl and PEG 3350 as precipitant by hanging drop vapor diffusion method. Crystals obtained are screened and suitable crystals are taken for data collection using mar345dtb as image plate detector system. Goat hemoglobin crystal diffracted up to 2.61 A resolution. Goat hemoglobin crystallizes in orthorhombic space group P212(1)2(1) as a whole biological molecule in the asymmetric unit with cell dimensions a=53.568A, b=67.365A, c=154.183A.

  10. Crystallization and preliminary crystallographic studies of human kallikrein 7, a serine protease of the multigene kallikrein family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fernández, Israel S.; Ständker, Ludger; Hannover Medical School, Center of Pharmacology, 30625 Hannover

    2007-08-01

    The cloning, expression, purification and crystallization of recombinant human kallikrein 7, directly synthesized in the active form in E. coli, is described. Diffraction data were collected to 2.8 Å resolution from native crystals. Human kallikreins are a group of serine proteases of high sequence homology whose genes are grouped as a single cluster at chromosome 19. Although the physiological roles of kallikreins are generally still unknown, members of the kallikrein family have been clearly implicated in pathological situations such as cancer and psoriasis. Human kallikrein 7 (hK7) has been shown to be involved in pathological keratinization, psoriasis and ovarian cancer.more » In order to gain insight into the molecular structure of this protein, hK7 was crystallized after recombinant production in its folded and active form using a periplasmic secretion vector in Escherichia coli. The crystals belonged to the rhombohedral space group H32 and diffracted to 2.8 Å. The phase problem was solved by molecular replacement using the mouse kallikrein-related protein neuropsin. Completion of the model and structure refinement are under way.« less

  11. Micromorphology of sialoliths in submandibular salivary gland: a scanning electron microscope and X-ray diffraction analysis.

    PubMed

    Kasaboğlu, Oğuzcan; Er, Nuray; Tümer, Celal; Akkocaoğlu, Murat

    2004-10-01

    Sialoliths are common in the submandibular gland and its duct system. The exact cause of formation of a sialolith is still a matter of debate. The aim of this study was to analyze 6 sialoliths ultrastructurally to determine their development mechanism in the submandibular salivary glands. Six sialoliths retrieved from the hilus and duct of the submandibular salivary glands of 6 patients with sialadenitis were analyzed ultrastructurally by scanning electron microscope and x-ray diffractometer. Scanning electron microscope revealed mainly irregular, partly rudely hexagonal, needle-like and plate-shaped crystals. The cross-section from the surface to the inner part of the sialoliths showed no organic material. X-ray diffraction showed that the sialoliths were composed of hydroxyapatite crystals. Energy dispersive x-ray microanalysis showed that all of the samples contained high levels of Ca and P, and small amounts of Mg, Na, Cl, Si, Fe, and K. The main structures of the submandibular sialoliths were found to be hydroxyapatite crystals. No organic cores were observed in the central parts of the sialoliths. In accordance with these preliminary results, sialoliths in the submandibular salivary glands may arise secondary to sialadenitis, but not via a luminal organic nidus.

  12. Preliminary X-ray crystallographic studies of a tetrameric phospholipase A{sub 2} formed by two isoforms of crotoxin B from Crotalus durissus terrificus venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchi-Salvador, D. P.; Corrêa, L. C.; Salvador, G. H. M.

    2007-12-01

    Crotoxin B is a basic phospholipase A{sub 2} found in the venom of C. durissus terrificus and is one of the subunits that constitute crotoxin. Here, the crystallization, X-ray diffraction data collection and molecular-replacement solution of a novel tetrameric complex formed by two dimers of crotoxin B isoforms are presented. Crotoxin B is a basic phospholipase A{sub 2} found in the venom of Crotalus durissus terrificus and is one of the subunits that constitute crotoxin. This heterodimeric toxin, which is the main component of C. d. terrificus venom, is completed by an acidic, nontoxic and non-enzymatic component (crotoxin A) andmore » is involved in important envenomation effects, such as neurological disorders, myotoxicity and renal failure. Although crotoxin was first crystallized in 1938, no crystal structure is currently available for crotoxin, crotoxin A or crotoxin B. In this work, the crystallization, X-ray diffraction data collection to 2.28 Å resolution and molecular-replacement solution of a novel tetrameric complex formed by two dimers of crotoxin B isoforms (CB1 and CB2) is presented.« less

  13. Crystallization and preliminary X-ray characterization of the genetically encoded fluorescent calcium indicator protein GCaMP2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rodríguez Guilbe, María M.; Protein Research and Development Center, University of Puerto Rico; Alfaro Malavé, Elisa C.

    The genetically encoded fluorescent calcium-indicator protein GCaMP2 was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution and the structure was solved by molecular replacement. Fluorescent proteins and their engineered variants have played an important role in the study of biology. The genetically encoded calcium-indicator protein GCaMP2 comprises a circularly permuted fluorescent protein coupled to the calcium-binding protein calmodulin and a calmodulin target peptide, M13, derived from the intracellular calmodulin target myosin light-chain kinase and has been used to image calcium transients in vivo. To aid rational efforts to engineer improved variants of GCaMP2, thismore » protein was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 126.1, b = 47.1, c = 68.8 Å, β = 100.5° and one GCaMP2 molecule in the asymmetric unit. The structure was phased by molecular replacement and refinement is currently under way.« less

  14. Crystallization and preliminary X-ray analysis of the ergothioneine-biosynthetic methyltransferase EgtD.

    PubMed

    Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian Peter

    2014-05-01

    Ergothioneine is an amino-acid betaine derivative of histidine that was discovered more than one century ago. Despite significant research pointing to a function in oxidative stress defence, the exact mechanisms of action of ergothioneine remain elusive. Although both humans and bacterial pathogens such as Mycobacterium tuberculosis seem to depend on ergothioneine, humans are devoid of the corresponding biosynthetic enzymes. Therefore, its biosynthesis may emerge as potential drug target in the development of novel therapeutics against tuberculosis. The recent identification of ergothioneine-biosynthetic genes in M. smegmatis enables a more systematic study of its biology. The pathway is initiated by EgtD, a SAM-dependent methyltransferase that catalyzes a trimethylation reaction of histidine to give N(α),N(α),N(α)-trimethylhistidine. Here, the recombinant production, purification and crystallization of EgtD are reported. Crystals of native EgtD diffracted to 2.35 Å resolution at a synchrotron beamline, whereas crystals of seleno-L-methionine-labelled protein diffracted to 1.75 Å resolution and produced a significant anomalous signal to 2.77 Å resolution at the K edge. All of the crystals belonged to space group P212121, with two EgtD monomers in the asymmetric unit.

  15. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

    PubMed Central

    Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

    2009-01-01

    Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

  16. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

    PubMed

    Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

    2009-11-01

    Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

  17. Chemical vapor deposition growth

    NASA Technical Reports Server (NTRS)

    Ruth, R. P.; Manasevit, H. M.; Kenty, J. L.; Moudy, L. A.; Simpson, W. I.; Yang, J. J.

    1976-01-01

    A chemical vapor deposition (CVD) reactor system with a vertical deposition chamber was used for the growth of Si films on glass, glass-ceramic, and polycrystalline ceramic substrates. Silicon vapor was produced by pyrolysis of SiH4 in a H2 or He carrier gas. Preliminary deposition experiments with two of the available glasses were not encouraging. Moderately encouraging results, however, were obtained with fired polycrystalline alumina substrates, which were used for Si deposition at temperatures above 1,000 C. The surfaces of both the substrates and the films were characterized by X-ray diffraction, reflection electron diffraction, scanning electron microscopy optical microscopy, and surface profilometric techniques. Several experiments were conducted to establish baseline performance data for the reactor system, including temperature distributions on the sample pedestal, effects of carrier gas flow rate on temperature and film thickness, and Si film growth rate as a function of temperature.

  18. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

    2006-10-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

  19. Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Guan-Jing; Li, Lan-Fen; Li, Dan

    2007-09-01

    A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less

  20. Purification, crystallization and preliminary crystallographic analysis of Est25: a ketoprofen-specific hormone-sensitive lipase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, SeungBum; Joo, Sangbum; Yoon, Hyun C.

    2007-07-01

    Est25, a ketoprofen-specific hormone-sensitive lipase from a metagenomic library, was crystallized and diffraction data were collected to 1.49 Å resolution. Ketoprofen, a nonsteroidal anti-inflammatory drug, inhibits the synthesis of prostaglandin. A novel hydrolase (Est25) with high ketoprofen specificity has previously been identified using a metagenomic library from environmental samples. Recombinant Est25 protein with a histidine tag at the N-terminus was expressed in Escherichia coli and purified in a homogenous form. Est25 was crystallized from 2.4 M sodium malonate pH 7.0 and X-ray diffraction data were collected to 1.49 Å using synchrotron radiation. The crystals belong to the monoclinic space groupmore » C2, with unit-cell parameters a = 197.8, b = 95.2, c = 99.4 Å, β = 97.1°.« less

  1. Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Synechocystis sp. PCC 6803.

    PubMed

    Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song

    2013-11-01

    Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

    The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

  3. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei

    2007-07-01

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less

  4. Crystallization and preliminary X-ray diffraction analysis of the P3 RNA domain of yeast ribonuclease MRP in a complex with RNase P/MRP protein components Pop6 and Pop7.

    PubMed

    Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

    2010-01-01

    Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.

  5. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

    2006-01-01

    Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

  6. Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balasubramanian, Anuradha; Ponnuraj, Karthe, E-mail: pkarthe@hotmail.com

    Urease from pigeon pea was purified and crystallized and X-ray diffraction data were collected at 2.5 Å resolution. Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized andmore » the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å.« less

  7. Crystallization and preliminary X-ray data analysis of β-alanine synthase from Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lundgren, Stina; Andersen, Birgit; Piškur, Jure

    2007-10-01

    β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less

  8. Crystallization and preliminary crystallographic analysis of two Streptococcus agalactiae proteins: the family II inorganic pyrophosphatase and the serine/threonine phosphatase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rantanen, Mika K.; Lehtiö, Lari; Rajagopal, Lakshmi

    Two S. agalactiae proteins, the inorganic pyrophosphatase and the serine/threonine phosphatase, were crystallized and diffraction data were collected and processed from these crystals. The data from the two protein crystals extended to 2.80 and 2.65 Å, respectively. Streptococcus agalactiae, which infects human neonates and causes sepsis and meningitis, has recently been shown to possess a eukaryotic-like serine/threonine protein phosphorylation signalling cascade. Through their target proteins, the S. agalactiae Ser/Thr kinase and Ser/Thr phosphatase together control the growth as well as the morphology and virulence of this organism. One of the targets is the S. agalactiae family II inorganic pyrophosphatase. Themore » inorganic pyrophosphatase and the serine/threonine phosphatase have therefore been purified and crystallized and diffraction data have been collected from their crystals. The data were processed using XDS. The inorganic pyrosphosphatase crystals diffracted to 2.80 Å and the Ser/Thr phosphatase crystals to 2.65 Å. Initial structure-solution experiments indicate that structure solution will be successful in both cases. Solving the structure of the proteins involved in this cascade is the first step towards understanding this phenomenon in atomic detail.« less

  9. Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

    2007-08-01

    Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

  10. Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan

    2008-05-01

    A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less

  11. Expression, crystallization and preliminary crystallographic studies of a novel bifunctional N-­acetylglutamate synthase/kinase from Xanthomonas campestris homologous to vertebrate N-acetylglutamate synthase

    PubMed Central

    Shi, Dashuang; Caldovic, Ljubica; Jin, Zhongmin; Yu, Xiaolin; Qu, Qiuhao; Roth, Lauren; Morizono, Hiroki; Hathout, Yetrib; Allewell, Norma M.; Tuchman, Mendel

    2006-01-01

    A novel N-acetylglutamate synthase/kinase bifunctional enzyme of arginine biosynthesis that was homologous to vertebrate N-acetylglutamate synthases was identified in Xanthomonas campestris. The protein was overexpressed, purified and crystallized. The crystals belong to the hexagonal space group P6222, with unit-cell parameters a = b = 134.60, c = 192.11 Å, and diffract to about 3.0 Å resolution. Selenomethionine-substituted recombinant protein was produced and selenomethionine substitution was verified by mass spectroscopy. Multiple anomalous dispersion (MAD) data were collected at three wavelengths at SER-CAT, Advanced Photon Source, Argonne National Laboratory. Structure determination is under way using the MAD phasing method. PMID:17142901

  12. Overexpression, crystallization and preliminary X-­ray crystallographic analysis of the RNA polymerase domain of primase from Streptococcus mutans strain UA159

    PubMed Central

    Im, Dong-Won; Kim, Tae-O; Jung, Ha Yun; Oh, Ji Eun; Lee, Se Jin; Heo, Yong-Seok

    2012-01-01

    Primase is the enzyme that synthesizes RNA primers on single-stranded DNA during normal DNA replication. In this study, the catalytic core domain of primase from Streptococcus mutans UA159 was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 1.60 Å resolution using a synchrotron-radiation source. The crystal belonged to space group P41 or P43, with unit-cell parameters a = b = 52.63, c = 110.31 Å. The asymmetric unit is likely to contain one molecule, with a corresponding V M of 1.77 Å3 Da−1 and a solvent content of 30.7%. PMID:22232183

  13. Expression, Purification, Crystallization And Preliminary X-Ray Studies of a Prolyl-4-Hydroxylase Protein From Bacillus Anthracis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, M.A.; Scott, E.E.; Limburg, J.

    2009-05-26

    Collagen prolyl-4-hydroxylase (C-P4H) catalyzes the hydroxylation of specific proline residues in procollagen, which is an essential step in collagen biosynthesis. A new form of P4H from Bacillus anthracis (anthrax-P4H) that shares many characteristics with the type I C-P4H from human has recently been characterized. The structure of anthrax-P4H could provide important insight into the chemistry of C-P4Hs and into the function of this unique homodimeric P4H. X-ray diffraction data of selenomethionine-labeled anthrax-P4H recombinantly expressed in Escherichia coli have been collected to 1.4 {angstrom} resolution.

  14. Design and analysis of multilayer x ray/XUV microscope

    NASA Technical Reports Server (NTRS)

    Shealy, David L.

    1990-01-01

    The design and analysis of a large number of normal incidence multilayer x ray microscopes based on the spherical mirror Schwarzschild configuration is examined. Design equations for the spherical mirror Schwarzschild microscopes are summarized and used to evaluate mirror parameters for microscopes with magnifications ranging from 2 to 50x. Ray tracing and diffraction analyses are carried out for many microscope configurations to determine image resolution as a function of system parameters. The results are summarized in three publication included herein. A preliminary study of advanced reflecting microscope configurations, where aspherics are used in place of the spherical microscope mirror elements, has indicated that the aspherical elements will improve off-axis image resolution and increase the effective field of view.

  15. Atomic pair distribution function at the Brazilian Synchrotron Light Laboratory: application to the Pb 1–x La xZr 0.40Ti 0.60O 3 ferroelectric system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saleta, M. E.; Eleotério, M.; Mesquita, A.

    2017-07-29

    This work reports the setting up of the X-ray diffraction and spectroscopy beamline at the Brazilian Synchrotron Light Laboratory for performing total scattering experiments to be analyzed by atomic pair distribution function (PDF) studies. The results of a PDF refinement for Al 2O 3 standard are presented and compared with data acquired at a beamline of the Advanced Photon Source, where it is common to perform this type of experiment. A preliminary characterization of the Pb 1–xLa xZr 0.40Ti 0.60O 3 ferroelectric system, withx= 0.11, 0.12 and 0.15, is also shown.

  16. Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

    PubMed Central

    Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis

    2009-01-01

    EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 Å and belonged to space group P21, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 Å. PMID:19478449

  17. Structural studies on Pax-8 Prd domain/DNA complex.

    PubMed

    Campagnolo, M; Pesaresi, A; Zelezetsky, I; Geremia, S; Randaccio, L; Bisca, A; Tell, G

    2007-04-01

    Pax-8 is a member of the Pax family of transcription factors and is essential in the development of thyroid follicular cells. Pax-8 has two DNA-binding domains: the paired domain and the homeo domain. In this study, a preliminary X-ray diffraction analysis of the mammalian Pax-8 paired domain in complex with the C-site of the thyroglobulin promoter was achieved. The Pax-8 paired domain was crystallized by the hanging-drop vapor-diffusion method in complex with both a blunt-ended 26 bp DNA fragment and with a sticky-ended 24 bp DNA fragment with two additional overhanging bases. Crystallization experiments make clear that the growth of transparent crystals with large dimensions and regular shape is particularly influenced by ionic strength. The crystals of Pax-8 complex with blunt-ended and sticky-ended DNA, diffracted synchrotron radiation to 6.0 and 8.0 A resolution and belongs both to the C centered monoclinic system with cell dimensions: a = 89.88 A, b = 80.05 A, c = 67.73 A, and beta = 124.3 degrees and a = 256.56, b = 69.07, c = 99.32 A, and beta = 98.1 degrees , respectively. Fluorescence experiments suggest that the crystalline disorder, deduced by the poor diffraction, can be attributed to the low homogeneity of the protein-DNA sample. The theoretical comparative model of the Pax-8 paired domain complexed with the C-site of the thyroglobulin promoter shows the probable presence of some specific protein-DNA interactions already observed in other Pax proteins and the important role of the cysteine residues of PAI subdomain in the redox control of the DNA recognition.

  18. Crystallization and preliminary X-ray diffraction studies of Seneca Valley Virus-001, a new member of the Picornaviridae family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie

    2008-04-01

    Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less

  19. SU-E-I-44: Some Preliminary Analysis of Angular Distribution of X-Ray Scattered On Soft Tissues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ganezer, K; Krmar, M; Cvejic, Z

    2015-06-15

    Purpose: The angular distribution of x-radiation scattered at small angles (up to 16 degrees) from several different animal soft tissue (skin, fat, muscle, retina, etc) were measured using standard equipment devoted to study of crystal structure which provides excellent geometry conditions of measurements. showed measurable differences for different tissues. In the simplest possible case when measured samples do not differ in structure (different concentration solutions) it can be seen that intensity of scattered radiation is decreasing function of the concentration and the peak of the maximum of scattering distribution depends on the concentration as well. Methods: An x-ray scattering profilemore » usually consists of sharp diffraction peak; however some properties of the spatial profiles of scattered radiation as intensity, the peak position, height, area, FWHM, the ratio of peak heights, etc. Results: The data contained measurable differences for different tissues. In the simplest possible case when measured samples do not differ in structure (different concentration solutions) it can be seen that intensity of scattered radiation is decreasing function of the concentration and the peak of the maximum of scattering distribution depends on the concentration as well. Measurements of different samples in the very preliminary phase showed that simple biological material used in study showed slightly different scattering pattern, especially at higher angles (around 10degrees). Intensity of radiation scattered from same tissue type is very dependent on water content and several more parameters. Conclusion: This preliminary study using animal soft tissues on the angular distributions of scattered x-rays suggests that angular distributions of X-rays scattered off of soft tissues might be useful in distinguishing healthy tissue from malignant soft tissue.« less

  20. Fabrication and characterization of graphene hydrogel via hydrothermal approach as a scaffold for preliminary study of cell growth

    PubMed Central

    Lim, HN; Huang, NM; Lim, SS; Harrison, I; Chia, CH

    2011-01-01

    Background Three-dimensional assembly of graphene hydrogel is rapidly attracting the interest of researchers because of its wide range of applications in energy storage, electronics, electrochemistry, and waste water treatment. Information on the use of graphene hydrogel for biological purposes is lacking, so we conducted a preliminary study to determine the suitability of graphene hydrogel as a substrate for cell growth, which could potentially be used as building blocks for biomolecules and tissue engineering applications. Methods A three-dimensional structure of graphene hydrogel was prepared via a simple hydrothermal method using two-dimensional large-area graphene oxide nanosheets as a precursor. Results The concentration and lateral size of the graphene oxide nanosheets influenced the structure of the hydrogel. With larger-area graphene oxide nanosheets, the graphene hydrogel could be formed at a lower concentration. X-ray diffraction patterns revealed that the oxide functional groups on the graphene oxide nanosheets were reduced after hydrothermal treatment. The three-dimensional graphene hydrogel matrix was used as a scaffold for proliferation of a MG63 cell line. Conclusion Guided filopodia protrusions of MG63 on the hydrogel were observed on the third day of cell culture, demonstrating compatibility of the graphene hydrogel structure for bioapplications. PMID:21931479

  1. Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es

    2014-02-19

    The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less

  2. Preliminary evaluation of the diffraction behind the PROBA 3/ASPIICS optimized occulter

    NASA Astrophysics Data System (ADS)

    Baccani, Cristian; Landini, Federico; Romoli, Marco; Taccola, Matteo; Schweitzer, Hagen; Fineschi, Silvano; Bemporad, Alessandro; Loreggia, Davide; Capobianco, Gerardo; Pancrazzi, Maurizio; Focardi, Mauro; Noce, Vladimiro; Thizy, Cédric; Servaye, Jean-Sébastien; Renotte, Etienne

    2016-07-01

    PROBA-3 is a technological mission of the European Space Agency (ESA), devoted to the in-orbit demon- stration of formation flying (FF) techniques and technologies. ASPIICS is an externally occulted coronagraph approved by ESA as payload in the framework of the PROBA-3 mission and is currently in its C/D phase. FF offers a solution to investigate the solar corona close the solar limb using a two-component space system: the external occulter on one spacecraft and the optical instrument on the other, separated by a large distance and kept in strict alignment. ASPIICS is characterized by an inter-satellite distance of ˜144 m and an external occulter diameter of 1.42 m. The stray light due to the diffraction by the external occulter edge is always the most critical offender to a coronagraph performance: the designer work is focused on reducing the stray light and carefully evaluating the residuals. In order to match this goal, external occulters are usually characterized by an optimized shape along the optical axis. Part of the stray light evaluation process is based on the diffraction calculation with the optimized occulter and with the whole solar disk as a source. We used the field tracing software VirtualLabTM Fusion by Wyrowski Photonics [1] to simulate the diffraction. As a first approach and in order to evaluate the software, we simulated linear occulters, through as portions of the flight occulter, in order to make a direct comparison with the Phase-A measurements [2].

  3. Cloning, purification, crystallization and preliminary structural studies of penicillin V acylase from Bacillus subtilis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rathinaswamy, Priya; Pundle, Archana V.; Prabhune, Asmita A.

    An unannotated protein reported from B. subtilis has been expressed in E. coli and identified as possessing penicillin V acylase activity. The crystallization and preliminary crystallographic analysis of this penicillin V acylase is presented. Penicillin acylase proteins are amidohydrolase enzymes that cleave penicillins at the amide bond connecting the side chain to their β-lactam nucleus. An unannotated protein from Bacillus subtilis has been expressed in Escherichia coli, purified and confirmed to possess penicillin V acylase activity. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 4 M sodium formate in 100 mM Tris–HCl buffer pH 8.2.more » Diffraction data were collected under cryogenic conditions to a spacing of 2.5 Å. The crystals belonged to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 111.0, b = 308.0, c = 56.0 Å. The estimated Matthews coefficient was 3.23 Å{sup 3} Da{sup −1}, corresponding to 62% solvent content. The structure has been solved using molecular-replacement methods with B. sphaericus penicillin V acylase (PDB code 2pva) as the search model.« less

  4. Characterization of a bent Laue double-crystal beam-expanding monochromator

    DOE PAGES

    Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo; ...

    2017-10-19

    A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less

  5. Characterization of a bent Laue double-crystal beam-expanding monochromator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo

    A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less

  6. Purification, crystallization and preliminary X-ray crystallographic analysis of rice Bowman–Birk inhibitor from Oryza sativa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan

    2006-06-01

    Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less

  7. Crystallization and Preliminary X-ray Analysis of the Human Long Myosin Light-Chain Kinase 1-Specific Domain IgCAM3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    W Vallen Graham; A Magis; K Bailey

    2011-12-31

    Myosin light-chain kinase-dependent tight junction regulation is a critical event in inflammatory cytokine-induced increases in epithelial paracellular permeability. MLCK is expressed in human intestinal epithelium as two isoforms, long MLCK1 and long MLCK2, and MLCK1 is specifically localized to the tight junction, where it regulates paracellular permeability. The sole difference between these long MLCK splice variants is the presence of an immunoglobulin-like cell-adhesion molecule domain, IgCAM3, in MLCK1. To gain insight into the structure of the IgCAM3 domain, the IgCAM3 domain of MLCK1 has been expressed, purified and crystallized. Preliminary X-ray diffraction data were collected to 2.0 {angstrom} resolution andmore » were consistent with the primitive trigonal space group P2{sub 1}2{sub 1}2{sub 1}.« less

  8. Experimental Studies of Elementary Particle Interactions at High Energies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goulianos, Konstantin

    This is the final report of a program of research on "Experimental Studies of Elementary Particle Interactions at High Energies'' of the High Energy Physics (HEP) group of The Rockefeller University. The research was carried out using the Collider Detector at Fermilab (CDF) and the Compact Muon Solenoid (CMS) detector at the Large Hadron Collider (LHC) at CERN. Three faculty members, two research associates, and two postdoctoral associates participated in this project. At CDF, we studied proton-antiproton collisions at an energy of 1.96 TeV. We focused on diffractive interactions, in which the colliding antiproton loses a small fraction of itsmore » momentum, typically less than 1%, while the proton is excited into a high mass state retaining its quantum numbers. The study of such collisions provides insight into the nature of the diffractive exchange, conventionally referred to as Pomeron exchange. In studies of W and Z production, we found results that point to a QCD-based interpretation of the diffractive exchange, as predicted in a data-driven phenomenology developed within the Rockefeller HEP group. At CMS, we worked on diffraction, supersymmetry (SUSY), dark matter, large extra dimensions, and statistical applications to data analysis projects. In diffraction, we extended our CDF studies to higher energies working on two fronts: measurement of the single/double diffraction and of the rapidity gap cross sections at 7 TeV, and development of a simulation of diffractive processes along the lines of our successful model used at CDF. Working with the PYTHIA8 Monte Carlo simulation authors, we implemented our model as a PYTHIA8-MBR option in PYTHIA8 and used it in our data analysis. Preliminary results indicate good agreement. We searched for SUSY by measuring parameters in the Constrained Minimal Supersymmetric extension of the Standard Model (CMSSM) and found results which, combined with other experimental constraints and theoretical considerations, indicate that the CMSSM is not a viable model. Expressing our results in terms of simple topologies, we exclude squark masses below 0.75 TeV and gluino masses below 1.1 TeV. Astrophysical measurements suggest that about 80% of the matter density of the Universe is non-luminous. One of the theories on dark matter attributes it to Weakly Interacting Massive Particles (WIMPs). We searched for WIMPs in 7 TeV and 8 TeV collisions at CMS and set limits on WIMP production rates, which are competitive and complementary to those of direct detection experiments. Searching for monojets (events with only one jet), which in a popular model could be produced by a jet paired by a gravitino that escapes into extra dimensions, we significantly improved the previously set limit. Our results have been used to set limits on Higgs decay to invisible particles and on production of top squarks in compressed SUSY scenarios. Statistics. We computed Bayesian reference priors for several types of measurement and used them in the analysis of CMS data; investigated the applicability of bootstrap methods to HEP measurements; studied several issues associated with simple-versus-simple hypothesis testing and applied the resulting methods to the measurement of some properties of the top quark and Higgs boson.« less

  9. A diffraction correction for storage and loss moduli imaging using radiation force based elastography.

    PubMed

    Budelli, Eliana; Brum, Javier; Bernal, Miguel; Deffieux, Thomas; Tanter, Mickaël; Lema, Patricia; Negreira, Carlos; Gennisson, Jean-Luc

    2017-01-07

    Noninvasive evaluation of the rheological behavior of soft tissues may provide an important diagnosis tool. Nowadays, available commercial ultrasound systems only provide shear elasticity estimation by shear wave speed assessment under the hypothesis of a purely elastic model. However, to fully characterize the rheological behavior of tissues, given by its storage (G') and loss (G″) moduli, it is necessary to estimate both: shear wave speed and shear wave attenuation. Most elastography techniques use the acoustic radiation force to generate shear waves. For this type of source the shear waves are not plane and a diffraction correction is needed to properly estimate the shear wave attenuation. The use of a cylindrical wave approximation to evaluate diffraction has been proposed by other authors before. Here the validity of such approximation is numerically and experimentally revisited. Then, it is used to generate images of G' and G″ in heterogeneous viscoelastic mediums. A simulation algorithm based on the anisotropic and viscoelastic Green's function was used to establish the validity of the cylindrical approximation. Moreover, two experiments were carried out: a transient elastography experiment where plane shear waves were generated using a vibrating plate and a SSI experiment that uses the acoustic radiation force to generate shear waves. For both experiments the shear wave propagation was followed with an ultrafast ultrasound scanner. Then, the shear wave velocity and shear wave attenuation were recovered from the phase and amplitude decay versus distance respectively. In the SSI experiment the cylindrical approximation was applied to correct attenuation due to diffraction effects. The numerical and experimental results validate the use of a cylindrical correction to assess shear wave attenuation. Finally, by applying the cylindrical correction G' and G″ images were generated in heterogeneous phantoms and a preliminary in vivo feasibility study was carried out in the human liver.

  10. Expression, purification, crystallization and preliminary crystallographic study of isolated modules of the mouse coactivator-associated arginine methyltransferase 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Troffer-Charlier, Nathalie; Cura, Vincent; Hassenboehler, Pierre

    2007-04-01

    Isolated modules of mouse coactivator-associated arginine methyltransferase 1 encompassing the protein arginine N-methyltransferase catalytic domain have been overexpressed, purified and crystallized. X-ray diffraction data have been collected and have enabled determination of the structures by multiple isomorphous replacement using anomalous scattering. Coactivator-associated arginine methyltransferase 1 (CARM1) plays a crucial role in gene expression as a coactivator of several nuclear hormone receptors and also of non-nuclear receptor systems. Its recruitment by the transcriptional machinery induces protein methylation, leading to chromatin remodelling and gene activation. CARM1{sub 28–507} and two structural states of CARM1{sub 140–480} were expressed, purified and crystallized. Crystals of CARM1{submore » 28–507} belong to space group P6{sub 2}22, with unit-cell parameters a = b = 136.0, c = 125.3 Å; they diffract to beyond 2.5 Å resolution using synchrotron radiation and contain one monomer in the asymmetric unit. The structure of CARM1{sub 28–507} was solved by multiple isomorphous replacement and anomalous scattering methods. Crystals of apo CARM1{sub 140–480} belong to space group I222, with unit-cell parameters a = 74.6, b = 99.0, c = 207.4 Å; they diffract to beyond 2.7 Å resolution and contain two monomers in the asymmetric unit. Crystals of CARM1{sub 140–480} in complex with S-adenosyl-l-homocysteine belong to space P2{sub 1}2{sub 1}2, with unit-cell parameters a = 74.6, b = 98.65, c = 206.08 Å; they diffract to beyond 2.6 Å resolution and contain four monomers in the asymmetric unit. The structures of apo and holo CARM1{sub 140–480} were solved by molecular-replacement techniques from the structure of CARM1{sub 28–507}.« less

  11. A diffraction correction for storage and loss moduli imaging using radiation force based elastography

    NASA Astrophysics Data System (ADS)

    Budelli, Eliana; Brum, Javier; Bernal, Miguel; Deffieux, Thomas; Tanter, Mickaël; Lema, Patricia; Negreira, Carlos; Gennisson, Jean-Luc

    2017-01-01

    Noninvasive evaluation of the rheological behavior of soft tissues may provide an important diagnosis tool. Nowadays, available commercial ultrasound systems only provide shear elasticity estimation by shear wave speed assessment under the hypothesis of a purely elastic model. However, to fully characterize the rheological behavior of tissues, given by its storage (G‧) and loss (G″) moduli, it is necessary to estimate both: shear wave speed and shear wave attenuation. Most elastography techniques use the acoustic radiation force to generate shear waves. For this type of source the shear waves are not plane and a diffraction correction is needed to properly estimate the shear wave attenuation. The use of a cylindrical wave approximation to evaluate diffraction has been proposed by other authors before. Here the validity of such approximation is numerically and experimentally revisited. Then, it is used to generate images of G‧ and G″ in heterogeneous viscoelastic mediums. A simulation algorithm based on the anisotropic and viscoelastic Green’s function was used to establish the validity of the cylindrical approximation. Moreover, two experiments were carried out: a transient elastography experiment where plane shear waves were generated using a vibrating plate and a SSI experiment that uses the acoustic radiation force to generate shear waves. For both experiments the shear wave propagation was followed with an ultrafast ultrasound scanner. Then, the shear wave velocity and shear wave attenuation were recovered from the phase and amplitude decay versus distance respectively. In the SSI experiment the cylindrical approximation was applied to correct attenuation due to diffraction effects. The numerical and experimental results validate the use of a cylindrical correction to assess shear wave attenuation. Finally, by applying the cylindrical correction G‧ and G″ images were generated in heterogeneous phantoms and a preliminary in vivo feasibility study was carried out in the human liver.

  12. Non-destructive Quantitative Phase Analysis and Microstructural Characterization of Zirconium Coated U-10Mo Fuel Foils via Neutron Diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cummins, Dustin Ray; Vogel, Sven C.; Hollis, Kendall Jon

    2016-10-18

    This report uses neutron diffraction to investigate the crystal phase composition of uranium-molybdenum alloy foils (U-10Mo) for the CONVERT MP-1 Reactor Conversion Project, and determines the effect on alpha-uranium contamination following the deposition of a Zr metal diffusion layer by various methods: plasma spray deposition of Zr powders at LANL and hot co-rolling with Zr foils at BWXT. In summary, there is minimal decomposition of the gamma phase U-10Mo foil to alpha phase contamination following both plasma spraying and hot co-rolling. The average unit cell volume, i.e. lattice spacing, of the Zr layer can be mathematically extracted from the diffractionmore » data; co-rolled Zr matches well with literature values of bulk Zr, while plasma sprayed Zr shows a slight increase in the lattice spacing, indicative of interstitial oxygen in the lattice. Neutron diffraction is a beneficial alternative to conventional methods of phase composition, i.e. x ray diffraction (XRD) and destructive metallography. XRD has minimal penetration depth in high atomic number materials, particularly uranium, and can only probe the first few microns of the fuel plate; neutrons pass completely through the foil, allowing for bulk analysis of the foil composition and no issues with addition of cladding layers, as in the final, aluminum-clad reactor fuel plates. Destructive metallography requires skilled technicians, cutting of the foil into small sections, hazardous etching conditions, long polishing and microscopy times, etc.; the neutron diffraction system has an automated sample loader and can fit larger foils, so there is minimal analysis preparation; the total spectrum acquisition time is ~ 1 hour per sample. The neutron diffraction results are limited by spectra refinement/calculation times and the availability of the neutron beam source. In the case of LANSCE at Los Alamos, the beam operates ~50% of the year. Following the lessons learned from these preliminary results, optimizations to the process and analysis can be made, and neutron diffraction can become a viable and efficient technique for gamma/alpha phase composition determination for nuclear fuels.« less

  13. Ruthenium(II) piano stool coordination compounds with aminomethylphosphanes: Synthesis, characterisation and preliminary biological study in vitro.

    PubMed

    Płotek, Michał; Starosta, Radosław; Komarnicka, Urszula K; Skórska-Stania, Agnieszka; Kołoczek, Przemysław; Kyzioł, Agnieszka

    2017-05-01

    Reaction of {[Ru(η 6 -p-cymene)Cl] 2 (μ-Cl) 2 } (1) with aminomethylphosphane derived from morpholine (P{CH 2 N(CH 2 CH 2 ) 2 O} 3 (A), PPh 2 {CH 2 N(CH 2 CH 2 ) 2 O} (B)) or piperazine (P{CH 2 N(CH 2 CH 2 ) 2 NCH 2 CH 3 } 3 (C), PPh 2 {CH 2 N(CH 2 CH 2 ) 2 NCH 2 CH 3 } (D)) results in four new piano stool ruthenium(II) coordination compounds: [Ru(η 6 -p-cymene)Cl 2 (A)] (2A), [Ru(η 6 -p-cymene)Cl 2 (B)] (2B), [Ru(η 6 -p-cymene)Cl 2 (C)] (2C) and [Ru(η 6 -p-cymene)Cl 2 (D)] (2D). Every complex was fully characterized using spectroscopic methods ( 1 H, 13 C{ 1 H}, 31 P{ 1 H} NMR and ESI-MS), elemental analysis, X-ray single crystal diffraction and DFT calculations. Preliminary studies of in vitro cytotoxicity on the A549 (human lung adenocarcinoma) and MCF7 (human breast adenocarcinoma) cell lines revealed 2A-2D activity in the same order of magnitude as in the case of cisplatin. Additionally, the study confirmed the ability of 2A-2D to interact with DNA helix and transferrin. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Size Effects on Deformation and Fracture of Scandium Deuteride Films.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Teresi, C. S.; Hintsala, E.; Adams, David P.

    Metal hydride films have been observed to crack during production and use, prompting mechanical property studies of scandium deuteride films. The following focuses on elastic modulus, fracture, and size effects observed in the system for future film mechanical behavior modeling efforts. Scandium deuteride films were produced through the deuterium charging of electron beam evaporated scandium films using X-ray diffraction, scanning Auger microscopy, and electron backscatter diffraction to monitor changes in the films before and after charging. Scanning electron microscopy, nanoindentation, and focused ion beam machined micropillar compression tests were used for mechanical characterization of the scandium deuteride films. The micropillarsmore » showed a size effect for flow stress, indicating that film thickness is a relevant tuning parameter for film performance, and that fracture was controlled by the presence of grain boundaries. Elastic modulus was determined by both micropillar compression and nanoindentation to be approximately 150 GPa, Fracture studies of bulk film channel cracking as well as compression induced cracks in some of the pillars yielded a fracture toughness around 1.0 MPa-m1/2. Preliminary Weibull distributions of fracture in the micropillars are provided. Despite this relatively low value of fracture toughness, scandium deuteride micropillars can undergo a large degree of plasticity in small volumes and can harden to some degree, demonstrating the ductile and brittle nature of this material« less

  15. Expression, Purification And Preliminary X-Ray Analysis of the C-Terminal Domain of An Arginine Repressor Protein From Mycobacterium Tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, G.J.; Garen, C.R.; Cherney, M.M.

    2009-06-03

    The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less

  16. Cloning, expression, purification and preliminary crystallographic studies of the adenylate/uridylate-rich element-binding protein HuR complexed with its target RNA

    PubMed Central

    Iyaguchi, Daisuke; Yao, Min; Tanaka, Isao; Toyota, Eiko

    2009-01-01

    Adenylate/uridylate-rich elements (AREs), which are found in the 3′-untrans­lated region (UTR) of many mRNAs, influence the stability of cytoplasmic mRNA. HuR (human antigen R) binds to AREs and regulates various genes. In order to reveal the RNA-recognition mechanism of HuR protein, an RNA-binding region of human HuR containing two N-terminal RNA-recognition motif domains bound to an 11-­base RNA fragment has been crystallized. The crystals belonged to space group P212121, with unit-cell parameters a = 42.4, b = 44.9, c = 91.1 Å. X-­ray diffraction data were collected to 1.8 Å resolution. PMID:19255485

  17. Synthesis and physico-chemical characterization of a polysialate-hydroxyapatite composite for potential biomedical application

    NASA Astrophysics Data System (ADS)

    Zoulgami, M.; Lucas-Girot, A.; Michaud, V.; Briard, P.; Gaudé, J.; Oudadesse, H.

    2002-09-01

    New composite materials based on aluminosilicate materials were developed to be used in orthopaedic or maxillo-facial surgery. They are called geopolymers or polysialate-siloxo (PSS) and were studied alone or mixed with hydroxyapatite (HAP). The properties of these materials were investigated for potential use in biological or surgery applications. In this work, the chemistry involved in materials preparation was described. Samples were characterized by some physico-chemical methods like X-ray diffraction (XRD), infrared spectrometry (IR) and electron dispersion X-ray spectrometry (EDX). Results indicate that the mixing hydroxyapatite-geopolymer (PSS) leads to a neutral porous composite material with interesting physico-chemical properties. A preliminary evaluation of its cytotoxicity reveals an harmlessness towards fibroblasts. These properties allow to envisage this association as a potential biomaterial.

  18. Expression, purification, crystallization and preliminary X-ray crystallographic data from TktA, a transketolase from the lactic acid bacterium Lactobacillus salivarius

    PubMed Central

    Horsham, Matt; Saxby, Harriet; Blake, James; Isaacs, Neil W.; Mitchell, Tim J.; Riboldi-Tunnicliffe, Alan

    2010-01-01

    The enzyme transketolase from the lactic acid bacterium Lactobacillus salivarius (subsp. salivarius UCC118) has been recombinantly expressed and purified using an Escherichia coli expression system. Purified transketolase from L. salivarius has been crystallized using the vapour-diffusion technique. The crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 75.43, c = 184.11 Å, and showed diffraction to 2.3 Å resolution. PMID:20693662

  19. Instrumentation progress at the Giant Magellan Telescope project

    NASA Astrophysics Data System (ADS)

    Jacoby, George H.; Bernstein, R.; Bouchez, A.; Colless, M.; Crane, Jeff; DePoy, D.; Espeland, B.; Hare, Tyson; Jaffe, D.; Lawrence, J.; Marshall, J.; McGregor, P.; Shectman, Stephen; Sharp, R.; Szentgyorgyi, A.; Uomoto, Alan; Walls, B.

    2016-08-01

    Instrument development for the 24m Giant Magellan Telescope (GMT) is described: current activities, progress, status, and schedule. One instrument team has completed its preliminary design and is currently beginning its final design (GCLEF, an optical 350-950 nm, high-resolution and precision radial velocity echelle spectrograph). A second instrument team is in its conceptual design phase (GMACS, an optical 350-950 nm, medium resolution, 6-10 arcmin field, multi-object spectrograph). A third instrument team is midway through its preliminary design phase (GMTIFS, a near-IR YJHK diffraction-limited imager/integral-field-spectrograph), focused on risk reduction prototyping and design optimization. A fourth instrument team is currently fabricating the 5 silicon immersion gratings needed to begin its preliminary design phase (GMTNIRS, a simultaneous JHKLM high-resolution, AO-fed, echelle spectrograph). And, another instrument team is focusing on technical development and prototyping (MANIFEST, a facility robotic, multifiber feed, with a 20 arcmin field of view). In addition, a medium-field (6 arcmin, 0.06 arcsec/pix) optical imager will support telescope and AO commissioning activities, and will excel at narrow-band imaging. In the spirit of advancing synergies with other groups, the challenges of running an ELT instrument program and opportunities for cross-ELT collaborations are discussed.

  20. Preliminary neutron crystallographic analysis of selectively CH3-protonated, deuterated rubredoxin from Pyrococcus furiosus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weiss, Kevin L; Meilleur, Flora; Blakeley, Matthew

    2008-01-01

    Neutron crystallography is used to locate hydrogen atoms in biological materials and can distinguish between negatively scattering hydrogen and positively scattering deuterium substituted positions in isomorphous neutron structures. Recently, Hauptman and Langs (2003) have shown that neutron diffraction data can be used to solve macromolecular structures by direct methods and that solution is aided by the presence of negatively scattering hydrogen atoms in the structure. Selective labeling protocols allow the design and production of H/D-labeled macromolecular structures in which the ratio of hydrogen to deuterium atoms can be precisely controlled. We have applied methyl-selective labeling protocols to introduce (1H-delta methyl)-leucinemore » and (1H-gamma methyl)-valine into deuterated rubredoxin from Pyrococcus furiosus (PfRd). Here we report on the production, crystallization, and preliminary neutron analysis of the selectively CH3-protonated, deuterated PfRd sample, which provided a high quality neutron data set extending to 1.75 resolution at the new LADI-III instrument at the Insititut Laue-Langevin. Preliminary analysis of neutron density maps allows unambiguous assignment of the positions of hydrogen atoms at the methyl groups of the valine and leucine residues in the otherwise deuterated rubredoxin structure.« less

  1. Fluorescence and diffusive wave diffraction tomographic probes in turbid media

    NASA Astrophysics Data System (ADS)

    Li, Xingde

    1998-10-01

    Light transport over long distances in tissue-like highly scattering media is well approximated as a diffusive process. Diffusing photons can be used to detect, localize and characterize non-invasively optical inhomogeneities such as tumors and hematomas embedded in thick biological tissue. Most of the contrast relies on the endogenous optical property differences between the inhomogeneities and the surrounding media. Recently exogenous fluorescent contrast agents have been considered as a means to enhance the sensitivity and specificity for tumor detection. In the first part of the thesis (Chapter 2 and 3), a theoretical basis is established for modeling the transport, of fluorescent photons in highly scattering media. Fluorescent Diffuse Photon Density Waves (FDPDW) are used to describe the transport of fluorescent photons. A detailed analysis based upon a practical signal-to-noise model was used to access the utility of the fluorescent method. The analysis reveals that a small heterogeneity, embedded in deep tissue-like turbid media with biologically relevant parameters, and with a practically achievable 5-fold fluorophore concentration contrast, can be detected and localized when its radius is greater than 0.2 cm, and can be characterized when its radius is greater than 0.7 cm. In vivo and preliminary clinical studies demonstrate the feasibility of using FDPDW's for tumor diagnosis. Optical imaging with diffusing photons is challenging. Many of the imaging algorithms developed so far are either fundamentally incorrect as in the case of back- projection approach, or require a huge amount of computational resources and CPU time. In the second part of the thesis (Chapter 4), a fast, K-space diffraction tomographic imaging algorithm based upon spatial angular spectrum analysis is derived and applied. Absolute optical properties of thin inhomogeneities and relative optical properties of spatially extended inhomogeneities are reconstructed within a sub-second time scale. Phantom experiments have demonstrated the power of the K-space algorithm and preliminary clinical investigations have exhibited its potential for real time optical diagnosis and imaging of breast cancer.

  2. Strategies for the crystallization of viruses: using phase diagrams and gels to produce 3D crystals of Grapevine fanleaf virus.

    PubMed

    Schellenberger, Pascale; Demangeat, Gérard; Lemaire, Olivier; Ritzenthaler, Christophe; Bergdoll, Marc; Oliéric, Vincent; Sauter, Claude; Lorber, Bernard

    2011-05-01

    The small icosahedral plant RNA nepovirus Grapevine fanleaf virus (GFLV) is specifically transmitted by a nematode and causes major damage to vineyards worldwide. To elucidate the molecular mechanisms underlying the recognition between the surface of its protein capsid and cellular components of its vector, host and viral proteins synthesized upon infection, the wild type GFLV strain F13 and a natural mutant (GFLV-TD) carrying a Gly₂₉₇Asp mutation were purified, characterized and crystallized. Subsequently, the geometry and volume of their crystals was optimized by establishing phase diagrams. GFLV-TD was twice as soluble as the parent virus in the crystallization solution and its crystals diffracted X-rays to a resolution of 2.7 Å. The diffraction limit of GFLV-F13 crystals was extended from 5.5 to 3 Å by growth in agarose gel. Preliminary crystallographic analyses indicate that both types of crystals are suitable for structure determination. Keys for the successful production of GFLV crystals include the rigorous quality control of virus preparations, crystal quality improvement using phase diagrams, and crystal lattice reinforcement by growth in agarose gel. These strategies are applicable to the production of well-diffracting crystals of other viruses and macromolecular assemblies. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Characterizing single isolated radiation-damage events from molecular dynamics via virtual diffraction methods

    NASA Astrophysics Data System (ADS)

    Stewart, J. A.; Brookman, G.; Price, P.; Franco, M.; Ji, W.; Hattar, K.; Dingreville, R.

    2018-04-01

    The evolution and characterization of single-isolated-ion-strikes are investigated by combining atomistic simulations with selected-area electron diffraction (SAED) patterns generated from these simulations. Five molecular dynamics simulations are performed for a single 20 keV primary knock-on atom in bulk crystalline Si. The resulting cascade damage is characterized in two complementary ways. First, the individual cascade events are conventionally quantified through the evolution of the number of defects and the atomic (volumetric) strain associated with these defect structures. These results show that (i) the radiation damage produced is consistent with the Norgett, Robinson, and Torrens model of damage production and (ii) there is a net positive volumetric strain associated with the cascade structures. Second, virtual SAED patterns are generated for the resulting cascade-damaged structures along several zone axes. The analysis of the corresponding diffraction patterns shows the SAED spots approximately doubling in size, on average, due to broadening induced by the defect structures. Furthermore, the SAED spots are observed to exhibit an average radial outward shift between 0.33% and 0.87% depending on the zone axis. This characterization approach, as utilized here, is a preliminary investigation in developing methodologies and opportunities to link experimental observations with atomistic simulations to elucidate microstructural damage states.

  4. Compact high-resolution spectrographs for large and extremely large telescopes: using the diffraction limit

    NASA Astrophysics Data System (ADS)

    Robertson, J. Gordon; Bland-Hawthorn, Joss

    2012-09-01

    As telescopes get larger, the size of a seeing-limited spectrograph for a given resolving power becomes larger also, and for ELTs the size will be so great that high resolution instruments of simple design will be infeasible. Solutions include adaptive optics (but not providing full correction for short wavelengths) or image slicers (which give feasible but still large instruments). Here we develop the solution proposed by Bland-Hawthorn and Horton: the use of diffraction-limited spectrographs which are compact even for high resolving power. Their use is made possible by the photonic lantern, which splits a multi-mode optical fiber into a number of single-mode fibers. We describe preliminary designs for such spectrographs, at a resolving power of R ~ 50,000. While they are small and use relatively simple optics, the challenges are to accommodate the longest possible fiber slit (hence maximum number of single-mode fibers in one spectrograph) and to accept the beam from each fiber at a focal ratio considerably faster than for most spectrograph collimators, while maintaining diffraction-limited imaging quality. It is possible to obtain excellent performance despite these challenges. We also briefly consider the number of such spectrographs required, which can be reduced by full or partial adaptive optics correction, and/or moving towards longer wavelengths.

  5. Effect of heat treatment on the efficient adsorption of Cd2+ ions by nanosized SiO2, TiO2 and their composite

    NASA Astrophysics Data System (ADS)

    Waseem, M.; Muntha, S. T.; Nawaz, M.; Rehman, W.; Rehman, M. A.; Shah, K. H.

    2017-01-01

    In this study nanosized SiO2, TiO2 and their composite were synthesized via the oil in water (o/w) microemulsion method and their thermal treatment was performed at 378, 573, 973 and 1273 K. The physicochemical properties of the samples were studied by surface area measurements, scanning electron microscopy, Fourier transform infra-red spectroscopy and x-ray diffraction analysis. The Brunauer, Emmett and Teller surface area of all the adsorbents increases from 378 to 573 K, while it decreases upon further heat treatment. The average crystallite size decreases by heating the samples from 378 to 573 K while it increases when the adsorbents were thermally heat treated at 973 and 1273 K. The intensity of a few IR bands was reduced along with the disappearance of most of the bands at higher temperatures. The appearance of the beta-cristobalite phase in SiO2 and the rutile phase in TiO2 was confirmed from the diffraction data. The heat treated samples were subjected to preliminary adsorption of Cd2+ ions from aqueous solution at 293 K. Based on the preliminary adsorption experiments, SiO2, TiO2 and their composite heat treated at 573 K were selected for further adsorption studies. The Langmuir model was found to be fitted to the sorption data of TiO2 and the nanocomposite while the adsorption of Cd2+ ions by the SiO2 nanoparticles was explained well based on the Freundlich model. In the present study, the maximum Cd2+ adsorption capacity of SiO2, TiO2 and their composite was found to be 79.72, 98.55 and 107.17 mg g-1, respectively. The q m and K f values obtained in the present study were found to be far better than those reported in the literature. The negative values of ΔG confirm the feasibility of an adsorption process at higher temperatures. The positive values of ΔH and ΔS represent the endothermic and physical nature of the adsorption process with the increased randomness of Cd2+ ions at the solid/solution interface.

  6. Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia).

    PubMed

    Sathya Moorthy, Pon; Neelagandan, K; Balasubramanian, M; Ponnuswamy, M N

    2009-02-01

    Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 A resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 A, alpha = 78.742, beta = 89.819, gamma = 65.320 degrees .

  7. Production, crystallization and preliminary X-ray diffraction of the Gαs α-helical domain in complex with a nanobody.

    PubMed

    Triest, Sarah; Wohlkönig, Alexandre; Pardon, Els; Steyaert, Jan

    2014-11-01

    GPCR-G-protein complexes are one of the most important components of cell-signalling cascades. Extracellular signals are sensed by membrane-associated G-protein-coupled receptors (GPCRs) and transduced via G proteins towards intracellular effector molecules. Structural studies of these transient complexes are crucial to understand the molecular details of these interactions. Although a nucleotide-free GPCR-G-protein complex is stable, it is not an ideal sample for crystallization owing to the intrinsic mobility of the Gαs α-helical domain (AHD). To stabilize GPCR-G-protein complexes in a nucleotide-free form, nanobodies were selected that target the flexible GαsAHD. One of these nanobodies, CA9177, was co-crystallized with the GαsAHD. Initial crystals were obtained using the sitting-drop method in a sparse-matrix screen and further optimized. The crystals diffracted to 1.59 Å resolution and belonged to the monoclinic space group P2₁, with unit-cell parameters a=44.07, b=52.55, c=52.66 Å, α=90.00, β=107.89, γ=90.00°. The structure of this specific nanobody reveals its binding epitope on GαsAHD and will help to determine whether this nanobody could be used as crystallization chaperone for GPCR-G-protein complexes.

  8. Crystallization and preliminary X-ray analysis of the ergothioneine-biosynthetic methyltransferase EgtD

    PubMed Central

    Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian Peter

    2014-01-01

    Ergothioneine is an amino-acid betaine derivative of histidine that was discovered more than one century ago. Despite significant research pointing to a function in oxidative stress defence, the exact mechanisms of action of ergothioneine remain elusive. Although both humans and bacterial pathogens such as Mycobacterium tuberculosis seem to depend on ergothioneine, humans are devoid of the corresponding biosynthetic enzymes. Therefore, its biosyn­thesis may emerge as potential drug target in the development of novel therapeutics against tuberculosis. The recent identification of ergothioneine-biosynthetic genes in M. smegmatis enables a more systematic study of its biology. The pathway is initiated by EgtD, a SAM-dependent methyltransferase that catalyzes a trimethylation reaction of histidine to give N(α),N(α),N(α)-trimethylhistidine. Here, the recombinant production, purification and crystallization of EgtD are reported. Crystals of native EgtD diffracted to 2.35 Å resolution at a synchrotron beamline, whereas crystals of seleno-l-methionine-labelled protein diffracted to 1.75 Å resolution and produced a significant anomalous signal to 2.77 Å resolution at the K edge. All of the crystals belonged to space group P212121, with two EgtD monomers in the asymmetric unit. PMID:24817736

  9. Characterization, crystallization and preliminary X-ray diffraction analysis of an (S)-specific esterase (pfEstA) from Pseudomonas fluorescens KCTC 1767: enantioselectivity for potential industrial applications.

    PubMed

    Kim, Seulgi; Ngo, Tri Duc; Kim, Kyeong Kyu; Kim, T Doohun

    2012-11-01

    The structures and reaction mechanisms of enantioselective hydrolases, which can be used in industrial applications such as biotransformations, are largely unknown. Here, the X-ray crystallographic study of a novel (S)-specific esterase (pfEstA) from Pseudomonas fluorescens KCTC 1767, which can be used in the production of (S)-ketoprofen, is described. Multiple sequence alignments with other hydrolases revealed that pfEstA contains a conserved Ser67 within the S-X-X-K motif as well as a highly conserved Tyr156. Recombinant protein containing an N-terminal His tag was expressed in Escherichia coli, purified to homogeneity and characterized using SDS-PAGE, MALDI-TOF MS and enantioselective analysis. pfEstA was crystallized using a solution consisting of 1 M sodium citrate, 0.1 M CHES pH 9.5, and X-ray diffraction data were collected to a resolution of 1.9 Å with an Rmerge of 7.9%. The crystals of pfEstA belonged to space group P2(1)2(1)2(1), with unit-cell parameters a=65.31, b=82.13, c=100.41 Å, α=β=γ=90°.

  10. Purification, crystallization and preliminary crystallographic study of an IDS-epimerase from Agrobacterium tumefaciens BY6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bäuerle, Bettina; Sandalova, Tatyana; Schneider, Gunter

    2006-08-01

    This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH{sub 4}){sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space groupmore » P2{sub 1}, with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na{sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 8.5.« less

  11. Crystallization and preliminary X-ray crystallographic studies of Drep-3, a DFF-related protein from Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Hyun Ho; Tookes, Hansel Emory; Wu, Hao, E-mail: haowu@med.cornell.edu

    2006-06-01

    The D. melanogaster Drep-3 protein has been crystallized. Crystals were obtained at 293 K that diffracted to 2.8 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}. During apoptosis, DNA fragmentation is mainly mediated by the caspase-activated DFF40 nuclease. DFF40 exists as a heterodimeric complex with its inhibitor DFF45. Upon apoptosis induction, DFF45 is cleaved by caspases to allow DFF40 activation. Drep-3 is a recently identified regulator of the DFF40 system in Drosophila melanogaster. Here, Drep-3 was expressed with a C-terminal His tag in Escherichia coli and the protein was purified to homogeneity. Multi-angle light-scattering analysis showed thatmore » Drep-3 is a homotetramer in solution. Native and selenomethionine-substituted Drep-3 proteins were crystallized at 293 K and X-ray diffraction data were collected to 2.8 and 3.0 Å resolution, respectively. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 56.9, b = 125.4, c = 168.7 Å. The asymmetric unit is estimated to contain one homotetramer.« less

  12. Crystallization and preliminary X-ray diffraction studies of trypsin-like proteases from the gastric fluid of the marine crab Cancer pagurus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hehemann, Jan-Hendrik; Redecke, Lars; Perbandt, Markus

    2007-03-01

    Two trypsins from the gastric fluid of the marine crab C. pagurus were purified and crystallized and X-ray data were collected to 0.97 and 3.2 Å resolution. The digestive fluid of the marine crab Cancer pagurus (Decapoda, Brachyura) contains highly stable proteases which display enhanced activity in aqueous mixtures of organic solvents. Three trypsins were isolated from the gastric fluid and two of them, C.p.TryII and C.p.TryIII, were purified to homogeneity by anion-exchange chromatography and crystallized by hanging-drop vapour diffusion. Diffraction data were collected at a synchrotron to 0.97 and 3.2 Å resolution, respectively. The crystal of C.p.TryII belongs tomore » the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.06, b = 62.00, c = 71.66 Å. Based on the Matthews coefficient, one protein molecule per asymmetric unit is suggested. In contrast, crystals of C.p.TryIII, which belong to the cubic space group P2{sub 1}3 with unit-cell parameters a = b = c = 215.4 Å, are assumed to contain 12 molecules per asymmetric unit.« less

  13. Low dimensional CH3NH3PbBr3 cubes for persistent luminescence: Energy variation of electron excitation

    NASA Astrophysics Data System (ADS)

    Besral, N.; Paul, T.; Thakur, S.; Sarkar, S.; Sardar, K.; Chanda, K.; Das, A.; Chattopadhyay, K. K.

    2018-04-01

    The impact of varying electron beam voltage upon room temperature CL (cathodoluminescence) properties of crystalline organic-inorganic lead halide perovskite CH3NH3PbBr3 (Methylammonium lead tribromide) microcubes have been studied. CH3NH3PbBr3 microcubes were synthesized at room temperature by a very straight forward wet chemical route. After preliminary characterizations like XRD (X-ray diffraction), FESEM (Field emission scanning electron microscopy), UV-Vis spectroscopy, CL study at three different beam voltages i.e. 5 kV, 10 kV and 15 kV respectively was performed at room temperature. Prominent emission signals were obtained with emission peaks at 2.190 eV (FWHM 0.120 eV), 2.222 eV (FWHM 0.108 eV) and 2.242 eV (FWHM 0.095 eV) for electron beam voltages 5 kV, 10 kV and 15 kV respectively.

  14. Acceleration from short-duration blast

    NASA Astrophysics Data System (ADS)

    Ritzel, D. V.; Van Albert, S.; Sajja, V.; Long, J.

    2018-01-01

    The blast-induced motion of spheres has been studied experimentally where the shock wave is rapidly decaying during the period that quasi-steady acceleration would be developed in the case of a step-function shock wave as considered in most shock-tube studies. The motion of sphere models ranging from 39 to 251 mm in diameter and having a range of densities was assessed using the "free-flight" method in a simulator specially designed to replicate the decaying shock wave profile of spherical blast including negative phase and positive entropy gradient. A standardized blast-wave simulation of 125 kPa and 6-ms positive-phase duration was applied for all experiments. In all cases, there are three phases to the motion: a relatively low "kickoff" velocity from the shock diffraction, acceleration or deceleration during the positive duration, then deceleration through the negative phase and subsequent quiescent air. The unexpected deceleration of larger spheres after their kickoff velocity during the decaying yet high-speed flow of the blast wave seems associated with the persistence of a ring vortex on the downstream side of the sphere. The flow is entirely unsteady with initial forces dominated by the shock diffraction; therefore, the early motion of spheres under such conditions is not governed by quasi-steady drag as in classical aerodynamics. The work will help establish scaling rules for model studies of blast-induced motion relevant to improvised explosive devices, and preliminary results are shown for motion imparted to a human skull surrogate.

  15. Purification, crystallization and preliminary X-ray diffraction analysis of a novel keto-deoxy-d-galactarate (KDG) dehydratase from Agrobacterium tumefaciens

    PubMed Central

    Taberman, Helena; Andberg, Martina; Parkkinen, Tarja; Richard, Peter; Hakulinen, Nina; Koivula, Anu; Rouvinen, Juha

    2014-01-01

    d-Galacturonic acid is the main component of pectin. It could be used to produce affordable renewable fuels, chemicals and materials through biotechnical conversion. Keto-deoxy-d-galactarate (KDG) dehydratase is an enzyme in the oxidative pathway of d-galacturonic acid in Agrobacterium tumefaciens (At). It converts 3-deoxy-2-keto-l-threo-hexarate to α-ketoglutaric semialdehyde. At KDG dehydratase was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 169.1, b = 117.8, c = 74.3 Å, β = 112.4° and an asymmetric unit of four monomers. X-ray diffraction data were collected to 1.9 Å resolution using synchrotron radiation. The three-dimensional structure of At KDG dehydratase will provide valuable information on the function of the enzyme and will allow it to be engineered for biorefinery-based applications. PMID:24419616

  16. Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

    2006-11-01

    Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less

  17. Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy

    2005-08-01

    Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less

  18. Design and fabrication of a miniature objective consisting of high refractive index zinc sulfide lenses for laser surgery

    PubMed Central

    Shadfan, Adam; Pawlowski, Michal; Wang, Ye; Subramanian, Kaushik; Gabay, Ilan; Ben-Yakar, Adela; Tkaczyk, Tomasz

    2016-01-01

    A miniature laser ablation probe relying on an optical fiber to deliver light requires a high coupling efficiency objective with sufficient magnification in order to provide adequate power and field for surgery. A diffraction-limited optical design is presented that utilizes high refractive index zinc sulfide to meet specifications while reducing the miniature objective down to two lenses. The design has a hypercentric conjugate plane on the fiber side and is telecentric on the tissue end. Two versions of the objective were built on a diamond lathe—a traditional cylindrical design and a custom-tapered mount. Both received an antireflective coating. The objectives performed as designed in terms of observable resolution and field of view as measured by imaging a 1951 USAF resolution target. The slanted edge technique was used to find Strehl ratios of 0.75 and 0.78, respectively, indicating nearly diffraction-limited performance. Finally, preliminary ablation experiments indicated threshold fluence of gold film was comparable to similar reported probes. PMID:28579656

  19. Time-resolved x-ray diffraction and electrical resistance measurements of structural phase transitions in zirconium

    DOE PAGES

    Velisavljevic, N.; Sinogeikin, S.; Saavedra, R.; ...

    2014-05-07

    Here, we have designed a portable pressure controller module to tune compression rates and maximum pressures attainable in a standard gas-membrane diamond anvil cell (DAC). During preliminary experiments, performed on zirconium (Zr) metal sample, pressure jumps of up to 80 GPa were systematically obtained in less than 0.2s (resulting in compression rate of few GPa/s up to more than 400 GPa/s). In-situ x-ray diffraction and electrical resistance measurements were performed simultaneously during this rapid pressure increase to provide the first time resolved data on α → ω → β structural evolution in Zr at high pressures. Direct control of compressionmore » rates and peak pressures, which can be held for prolonged time, allows for investigation of structural evolution and kinetics of structural phase transitions of materials under previously unexplored compression rate-pressure conditions that bridge traditional static and shock/dynamic experimental platforms.« less

  20. Crystallization and preliminary X-ray diffraction analysis of ScrY, a specific bacterial outer membrane porin.

    PubMed

    Forst, D; Schülein, K; Wacker, T; Diederichs, K; Kreutz, W; Benz, R; Welte, W

    1993-01-05

    The sucrose-specific outer membrane porin ScrY of Salmonella typhimurium was isolated from Escherichia coli K-12 strain KS 26 containing the plasmid pPSO112. The protein was purified to homogeneity by differential extraction of the cell envelope in the presence of the detergents sodium dodecyl sulfate and lauryl (dimethyl)-amine oxide (LDAO). The porin had apparent molecular weights of 58 kDa and 120 kDa for the monomer and for the trimer, respectively, on SDS/PAGE. The purified trimers were crystallized using poly(ethylene glycol) 2000 and the detergents octylglucoside (OG) and hexyl-(dimethyl)-amine oxide (C6DAO). X-ray diffraction of the crystals showed reflections to 2.3 A. The space group of the crystals was R3 and the lattice constants of the hexagonal axes were a = b = 112.85 A and c = 149.9 A. The crystal volume per unit of protein molecular weight was 3.47 A3/Da.

  1. Purification, crystallization and preliminary X-ray diffraction analysis of a soluble variant of the monoglyceride lipase Yju3p from the yeast Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rengachari, Srinivasan; Aschauer, Philipp; Sturm, Christian

    A soluble variant of the monoglyceride lipase Yju3p was successfully expressed, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. The protein Yju3p is the orthologue of monoglyceride lipases in the yeast Saccharomyces cerevisiae. A soluble variant of this lipase termed s-Yju3p (38.3 kDa) was generated and purified to homogeneity by affinity and size-exclusion chromatography. s-Yju3p was crystallized in a vapour-diffusion setup at 293 K and a complete data set was collected to 2.4 Å resolution. The crystal form was orthorhombic (space group P2{sub 1}2{sub 1}2{sub 1}), with unit-cell parameters a = 77.2, b = 108.6, c =more » 167.7 Å. The asymmetric unit contained four molecules with a solvent content of 46.4%.« less

  2. Crystallization and preliminary X-ray crystallographic analysis of the tRNA-specific adenosine deaminase from Streptococcus pyogenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ku, Min-Je; Lee, Won-Ho; Biotechnology and Genetic Engineering, Korea University, Seoul 136-701

    2005-04-01

    The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn{sup 2+} ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. Themore » asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V{sub M}) of 3.3 Å{sup 3} Da{sup −1} and a solvent content of 62.7%.« less

  3. Design and fabrication of a miniature objective consisting of high refractive index zinc sulfide lenses for laser surgery

    NASA Astrophysics Data System (ADS)

    Shadfan, Adam; Pawlowski, Michal; Wang, Ye; Subramanian, Kaushik; Gabay, Ilan; Ben-Yakar, Adela; Tkaczyk, Tomasz

    2016-02-01

    A miniature laser ablation probe relying on an optical fiber to deliver light requires a high coupling efficiency objective with sufficient magnification in order to provide adequate power and field for surgery. A diffraction-limited optical design is presented that utilizes high refractive index zinc sulfide to meet specifications while reducing the miniature objective down to two lenses. The design has a hypercentric conjugate plane on the fiber side and is telecentric on the tissue end. Two versions of the objective were built on a diamond lathe-a traditional cylindrical design and a custom-tapered mount. Both received an antireflective coating. The objectives performed as designed in terms of observable resolution and field of view as measured by imaging a 1951 USAF resolution target. The slanted edge technique was used to find Strehl ratios of 0.75 and 0.78, respectively, indicating nearly diffraction-limited performance. Finally, preliminary ablation experiments indicated threshold fluence of gold film was comparable to similar reported probes.

  4. Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

    PubMed Central

    Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

    2010-01-01

    A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

  5. Crystallization and preliminary X-ray diffraction analysis of a class II phospholipase D from Loxosceles intermedia venom

    PubMed Central

    Ullah, Anwar; de Giuseppe, Priscila Oliveira; Murakami, Mario Tyago; Trevisan-Silva, Dilza; Wille, Ana Carolina Martins; Chaves-Moreira, Daniele; Gremski, Luiza Helena; da Silveira, Rafael Bertoni; Sennf-Ribeiro, Andrea; Chaim, Olga Meiri; Veiga, Silvio Sanches; Arni, Raghuvir Krishnaswamy

    2011-01-01

    Phospholipases D are the major dermonecrotic component of Loxosceles venom and catalyze the hydrolysis of phospholipids, resulting in the formation of lipid mediators such as ceramide-1-phosphate and lysophosphatidic acid which can induce pathological and biological responses. Phospholipases D can be classified into two classes depending on their catalytic efficiency and the presence of an additional disulfide bridge. In this work, both wild-type and H12A-mutant forms of the class II phospholipase D from L. intermedia venom were crystallized. Wild-type and H12A-mutant crystals were grown under very similar conditions using PEG 200 as a precipitant and belonged to space group P1211, with unit-cell parameters a = 50.1, b = 49.5, c = 56.5 Å, β = 105.9°. Wild-type and H12A-mutant crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively. PMID:21301094

  6. Crystallization, X-ray diffraction analysis and preliminary structure determination of the polygalacturonase PehA from Agrobacterium vitis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu

    2008-07-01

    The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less

  7. Expression, crystallization and preliminary X-ray diffraction analysis of the CMM2 region of the Arabidopsis thaliana Morpheus’ molecule 1 protein

    PubMed Central

    Petty, Tom J.; Nishimura, Taisuke; Emamzadah, Soheila; Gabus, Caroline; Paszkowski, Jerzy; Halazonetis, Thanos D.; Thore, Stéphane

    2010-01-01

    Of the known epigenetic control regulators found in plants, the Morpheus’ molecule 1 (MOM1) protein is atypical in that the deletion of MOM1 does not affect the level of epigenetic marks controlling the transcriptional status of the genome. A short 197-amino-acid fragment of the MOM1 protein sequence can complement MOM1 deletion when coupled to a nuclear localization signal, suggesting that this region contains a functional domain that compensates for the loss of the full-length protein. Numerous constructs centred on the highly conserved MOM1 motif 2 (CMM2) present in these 197 residues have been generated and expressed in Escherichia coli. Following purification and crystallization screening, diamond-shaped single crystals were obtained that diffracted to ∼3.2 Å resolution. They belonged to the trigonal space group P3121 (or P3221), with unit-cell parameters a = 85.64, c = 292.74 Å. Structure determination is ongoing. PMID:20693667

  8. Expression, crystallization and preliminary X-ray diffraction analysis of the CMM2 region of the Arabidopsis thaliana Morpheus' molecule 1 protein.

    PubMed

    Petty, Tom J; Nishimura, Taisuke; Emamzadah, Soheila; Gabus, Caroline; Paszkowski, Jerzy; Halazonetis, Thanos D; Thore, Stéphane

    2010-08-01

    Of the known epigenetic control regulators found in plants, the Morpheus' molecule 1 (MOM1) protein is atypical in that the deletion of MOM1 does not affect the level of epigenetic marks controlling the transcriptional status of the genome. A short 197-amino-acid fragment of the MOM1 protein sequence can complement MOM1 deletion when coupled to a nuclear localization signal, suggesting that this region contains a functional domain that compensates for the loss of the full-length protein. Numerous constructs centred on the highly conserved MOM1 motif 2 (CMM2) present in these 197 residues have been generated and expressed in Escherichia coli. Following purification and crystallization screening, diamond-shaped single crystals were obtained that diffracted to approximately 3.2 A resolution. They belonged to the trigonal space group P3(1)21 (or P3(2)21), with unit-cell parameters a=85.64, c=292.74 A. Structure determination is ongoing.

  9. Magnetic and magnetoresistance properties of La0.7Sr0.3(Mn,Сo)O3

    NASA Astrophysics Data System (ADS)

    Troyanchuk, I. O.; Karpinsky, D. V.; Bushinsky, M. V.; Sikolenko, V. V.; Gavrilov, S. A.; Silibin, M. V.

    2017-11-01

    Magnetic and magnetotransport properties of La0.7Sr0.3Mn1-xCoxO3 ceramics have been investigated by neutron powder diffraction, magnetization and electrical measurements. It is shown that substitution by cobalt ions leads to a decrease of magnetic transition temperature down to 140 K for the compound with x = 0.33. The compounds with cobalt content 0.4 < x < 0.6 are characterized by a presence of small ferromagnetic component due to exchange interactions between cobalt and manganese ions with maximal transition temperature of about 190 K observed for x = 0.5. Further increase of the dopant concentration diminishes ferromagnetic interactions. An evolution of electronic configuration of manganese and cobalt ions upon chemical substitution as well as related changes in the exchange interactions which determine the type of the magnetic state are discussed. Based on the neutron diffraction results and magnetometry data the preliminary magnetic phase diagram has been constructed.

  10. Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

    2005-11-01

    The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

  11. Purification, crystallization, small-angle X-ray scattering and preliminary X-ray diffraction analysis of the SH2 domain of the Csk-homologous kinase.

    PubMed

    Gunn, Natalie J; Gorman, Michael A; Dobson, Renwick C J; Parker, Michael W; Mulhern, Terrence D

    2011-03-01

    The C-terminal Src kinase (Csk) and Csk-homologous kinase (CHK) are endogenous inhibitors of the proto-oncogenic Src family of protein tyrosine kinases (SFKs). Phosphotyrosyl peptide binding to their Src-homology 2 (SH2) domains activates Csk and CHK, enhancing their ability to suppress SFK signalling; however, the detailed mechanistic basis of this activation event is unclear. The CHK SH2 was expressed in Escherichia coli and the purified protein was characterized as monomeric by synchrotron small-angle X-ray scattering in-line with size-exclusion chromatography. The CHK SH2 crystallized in 0.2 M sodium bromide, 0.1 M bis-Tris propane pH 6.5 and 20% polyethylene glycol 3350 and the best crystals diffracted to ∼1.6 Å resolution. The crystals belonged to space group P2, with unit-cell parameters a=25.8, b=34.6, c=63.2 Å, β=99.4°.

  12. Purification, crystallization and preliminary X-ray diffraction analysis of the glyoxalase II from Leishmania infantum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trincão, José; Sousa Silva, Marta; Barata, Lídia

    2006-08-01

    A glyoxalase II from L. infantum was cloned, purified and crystallized and its structure was solved by X-ray crystallography. In trypanosomatids, trypanothione replaces glutathione in all glutathione-dependent processes. Of the two enzymes involved in the glyoxalase pathway, glyoxalase I and glyoxalase II, the latter shows absolute specificity towards trypanothione thioester, making this enzyme an excellent model to understand the molecular basis of trypanothione binding. Cloned glyoxalase II from Leishmania infantum was overexpressed in Escherichia coli, purified and crystallized. Crystals belong to space group C222{sub 1} (unit-cell parameters a = 65.6, b = 88.3, c = 85.2 Å) and diffract beyondmore » 2.15 Å using synchrotron radiation. The structure was solved by molecular replacement using the human glyoxalase II structure as a search model. These results, together with future detailed kinetic characterization using lactoyltrypanothione, should shed light on the evolutionary selection of trypanothione instead of glutathione by trypano-somatids.« less

  13. Path-separated electron interferometry in a scanning transmission electron microscope

    NASA Astrophysics Data System (ADS)

    Yasin, Fehmi S.; Harvey, Tyler R.; Chess, Jordan J.; Pierce, Jordan S.; McMorran, Benjamin J.

    2018-05-01

    We report a path-separated electron interferometer within a scanning transmission electron microscope. In this setup, we use a nanofabricated grating as an amplitude-division beamsplitter to prepare multiple spatially separated, coherent electron probe beams. We achieve path separations of 30 nm. We pass the  +1 diffraction order probe through amorphous carbon while passing the 0th and  ‑1 orders through vacuum. The probes are then made to interfere via imaging optics, and we observe an interference pattern at the CCD detector with up to 39.7% fringe visibility. We show preliminary experimental results in which the interference pattern was recorded during a 1D scan of the diffracted probes across a test phase object. These results qualitatively agree with a modeled interference predicted by an independent measurement of the specimen thickness. This experimental design can potentially be applied to phase contrast imaging and fundamental physics experiments, such as an exploration of electron wave packet coherence length.

  14. MEMS-based tunable gratings and their applications

    NASA Astrophysics Data System (ADS)

    Yu, Yiting; Yuan, Weizheng; Qiao, Dayong

    2015-03-01

    The marriage of optics and MEMS has resulted in a new category of optical devices and systems that have unprecedented advantages compared with their traditional counterparts. As an important spatial light modulating technology, diffractive optical MEMS obtains a wide variety of successful commercial applications, e.g. projection displays, optical communication and spectral analysis, due to its features of highly compact, low-cost, IC-compatible, excellent performance, and providing possibilities for developing totally new, yet smart devices and systems. Three most successful MEMS diffraction gratings (GLVs, Polychromator and DMDs) are briefly introduced and their potential applications are analyzed. Then, three different MEMS tunable gratings developed by our group, named as micro programmable blazed gratings (μPBGs) and micro pitch-tunable gratings (μPTGs) working in either digital or analog mode, are demonstrated. The strategies to largely enhance the maximum blazed angle and grating period are described. Some preliminary application explorations based on the developed grating devices are also shown. For our ongoing research focus, we will further improve the device performance to meet the engineering application requirements.

  15. Crystallization and preliminary X-ray diffraction data of an LNA 7-mer duplex derived from a ricin aptamer

    PubMed Central

    Förster, Charlotte; Oberthuer, Dominik; Gao, Jiang; Eichert, André; Quast, Frederick G.; Betzel, Christian; Nitsche, Andreas; Erdmann, Volker A.; Fürste, Jens P.

    2009-01-01

    Locked nucleic acids (LNAs) are modified nucleic acids which contain a modified sugar such as β-d-2′-O,4′-C methylene-bridged ribofuranose or other sugar derivatives in LNA analogues. The β-d-2′-O,4′-C methylene ribofuranose LNAs in particular possess high stability and melting temperatures, which makes them of interest for stabilizing the structure of different nucleic acids. Aptamers, which are DNAs or RNAs targeted against specific ligands, are candidates for substitution with LNAs in order to increase their stability. A 7-­mer helix derived from the terminal part of an aptamer that was targeted against ricin was chosen. The ricin aptamer originally consisted of natural RNA building blocks and showed high affinity in ricin binding. For future stabilization of the aptamer, the terminal helix has been constructed as an ‘all-locked’ LNA and was successfully crystallized in order to investigate its structural properties. Optimization of crystal growth succeeded by the use of different metal salts as additives, such as CuCl2, MgCl2, MnCl2, CaCl2, CoCl2 and ZnSO4. Preliminary X-ray diffraction data were collected and processed to 2.8 Å resolution. The LNA crystallized in space group P65, with unit-cell parameters a = 50.11, b = 50.11, c = 40.72 Å. The crystals contained one LNA helix per asymmetric unit with a Matthews coefficient of 3.17 Å3 Da−1, which implies a solvent content of 70.15%. PMID:19724123

  16. Single Crystal Synthesis and STM Studies of High Temperature Superconductors

    NASA Technical Reports Server (NTRS)

    Barrientos, Alfonso

    1997-01-01

    This is a final report for the work initiated in September of 1994 under the grant NAG8-1085 - NASA/OMU, on the fabrication of bulk and single crystal synthesis, specific heat measuring and STM studies of high temperature superconductors. Efforts were made to fabricate bulk and single crystals of mercury based superconducting material. A systematic thermal analysis on the precursors for the corresponding oxides and carbonates were carried out to synthesized bulk samples. Bulk material was used as seed in an attempt to grow single crystals by a two-step self flux process. On the other hand bulk samples were characterized by x-ray diffraction, electrical resistivity and magnetic susceptibility, We studied the specific heat behavior in the range from 80 to 300 K. Some preliminary attempts were made to study the atomic morphology of our samples. As part of our efforts we built an ac susceptibility apparatus for measuring the transition temperature of our sintered samples.

  17. In-situ Diffraction Study of Magnetite at Simultaneous High Pressure and High Temperature Using Synchrotron Radiation

    NASA Astrophysics Data System (ADS)

    Wang, L.; Zhang, J.; Wang, S.; Chen, H.; Zhao, Y.

    2014-12-01

    Magnetite intertwined with the evolution of human civilizations, and remains so today. It is technologically and scientifically important by virtue of its unique magnetic and electrical properties. Magnetite is a common mineral found in a variety of geologic environments, and plays an important role in deciphering the oxygen evolution in the Earth's atmosphere and its deep interiors. The latter application asks for the knowledge of the thermal and elastic properties of magnetite at high pressures and temperatures, which is currently not available in literature. We have carried out a few in-situ diffraction experiments on magnetite using white synchrotron radiation at beamline X17B2 of National Synchrotron Light Source (NSLS). A DIA module in an 1100-ton press and WC anvils were employed for compression, and diffraction spectra were collected at simultaneous high pressures (P) and temperatures (T) (up to 9 GPa and 900 oC). Mixture of amorphous boron and epoxy resin was used as pressure medium, and NaCl as pressure marker. Temperature was recorded by W-Re thermocouples. Commercially purchased magnetite powder and a mixture of the said powder and NaCl (1:1) were used as starting material in separate experiments. Preliminary data analyses have yielded following observations: (1) Charge disordering seen at ambient pressure remains active in current experiments, especially at lower pressures (< 6 GPa); (2) Though at each condition potentially complicated by charge disordering process, isothermal compression curves remains simple and reproducible; (3) During cooling, the reversibility and degree of cation disordering depend on the starting material and/or experimental P-T path; and (4) cation disordering notably reduces the apparent bulk moduli of magnetite.

  18. Studies on scaling of flow noise received at the stagnation point of an axisymmetric body

    NASA Astrophysics Data System (ADS)

    Arakeri, V. H.; Satyanarayana, S. G.; Mani, K.; Sharma, S. D.

    1991-05-01

    A description of the studies related to the problem of scaling of flow noise received at the stagnation point of axisymmetric bodies is provided. The source of flow noise under consideration is the transitional/turbulent regions of the boundary layer flow on the axisymmetric body. Lauchle has recently shown that the noise measured in the laminar region (including the stagnation point) corresponds closely to the noise measured in the transition region, provided that the acoustic losses due to diffraction are accounted for. The present study includes experimental measurement of flow noise at the stagnation point of three different shaped axisymmetric headforms. One of the body shapes chosen is that used by Lauchle in similar studies. This was done to establish the effect of body size on flow noise. The results of the experimental investigations clearly show that the flow noise received at the stagnation point is a strong function of free stream velocity, a moderately strong function of body scale but a weak function of boundary layer thickness. In addition, there is evidence that when body scale change is involved, flow noise amplitude scales but no frequency shift is involved. A scaling procedure is proposed based on the present observations along with those of Lauchle. At a given frequency, the amplitude of noise level obtained under model testing conditions is first scaled to account for differences in the velocity and size corresponding to the prototype conditions; then a correction to this is applied to account for losses due to diffraction, which are estimated on the basis of the geometric theory of diffraction (GTD) with the source being located at the predicted position of turbulent transition. Use of the proposed scaling law to extrapolate presently obtained noise levels to two other conditions involving larger-scale bodies show good agreement with actually measured levels, in particular at higher frequencies. Since model scale results have been used successfully to predict levels on larger-sized bodies tested in a totally different environment, the present data along with the proposed scaling procedure can be used to predict the expected flow noise levels at prototype scales during preliminary design studies.

  19. Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6

    PubMed Central

    Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

    2013-01-01

    (2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567

  20. Grafting of 4-aminomethylbenzensulfonamide-lipoic acid conjugate on gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Stiti, M.; Bouzit, H.; Abdaoui, M.; Winum, J. Y.

    2012-02-01

    In this paper, we describe the synthesis of goldnanoparticles bearing aminomethylbenzensulfonamide via a lipoyl moiety. The resulting stable nanoparticles with an average size of 4.0 nm have been achieved by a facile and high-yielding one phase method, by the action of 4-aminomethylbenzensulfonamide-lipoic acid bioconjugate on chloroauric acide, using dimethylsulfoxide (DMSO) as the solvent and sodium tetrahydridoborate (NaBH4) as the reducing agent. UV-vis absorption, transmission electron microscopy (TEM) and X-ray diffraction were used to analyse the morphology and the structure of the obtained nanoparticles. Preliminary study shows that these new nanoparticles are endowed with highly and specific inhibitory activity for the isoform (IX) of carbonic anhydrase over expressed in many cancers, and are therefore attractive candidate to be used both in diagnosis and in treatment of tumours.

  1. Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6.

    PubMed

    Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

    2013-10-01

    (2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.

  2. Isolation, purification, crystallization and preliminary X-ray studies of two 30 kDa proteins from silkworm haemolymph.

    PubMed

    Pietrzyk, Agnieszka J; Bujacz, Anna; Łochyńska, Małgorzata; Jaskólski, Mariusz; Bujacz, Grzegorz

    2011-03-01

    Juvenile hormone-binding protein (JHBP) and the low-molecular-mass lipoprotein PBMHP-12 belong to a group of 30 kDa proteins that comprise the major protein component of the haemolymph specific to the fifth-instar larvae stage of the mulberry silkworm Bombyx mori L. Proteins from this group are often essential for the development of the insect. In a project aimed at crystallographic characterization of B. mori JHBP (BmJHBP), it was copurified together with PBMHP-12. Eventually, the two proteins were isolated and crystallized separately. The BmJHBP crystals were orthorhombic (space group C222(1)) and the PBMHP-12 crystals were triclinic. The crystals diffracted X-rays to 2.9 Å (BmJHBP) and 1.3 Å (PBMHP-12) resolution.

  3. Design and environmentally benign synthesis of novel thiophene appended pyrazole analogues as anti-inflammatory and radical scavenging agents: Crystallographic, in silico modeling, docking and SAR characterization.

    PubMed

    Prabhudeva, Malledevarapura Gurumurthy; Bharath, Srinivasan; Kumar, Achutha Dileep; Naveen, Shivalingegowda; Lokanath, Neratur Krishnappagowda; Mylarappa, Bantaganahalli Ningappa; Kumar, Kariyappa Ajay

    2017-08-01

    Oxidative-stress induces inflammatory diseases and infections caused by drug-resistant microbial strains are on the rise necessitating the discovery of novel small-molecules for intervention therapy. The current study presents an effective and new green protocol for the synthesis of thiophene-appended pyrazoles through 3+2 annulations method. Chalcones 3(a-g) were prepared from 5-chloro-2-acetylthiophene and aromatic aldehydes by Claisen-Schmidt approach. The reaction of chalcones 3(a-g) with phenylhydrazine hydrochlorides 4(a-b) in acetic acid (30%) medium and also with freshly prepared citrus extract medium under reflux conditions produced the thiophene appended pyrazoles 5(a-l) in moderate yields. Structures of synthesized new pyrazoles were confirmed by spectral studies, elemental analysis and single crystal X-ray diffraction studies. Further, preliminary assessment of the anti-inflammatory properties of the compounds showed that, amongst the series, compounds 5d, 5e and 5l have excellent anti-inflammatory activities. Further, compounds 5c, 5d, 5g, and 5i exhibited excellent DPPH radical scavenging abilities in comparison with the standard ascorbic acid. Furthermore, using detailed structural modeling and docking efforts, combined with preliminary SAR, we show possible structural and chemical features on both the small-molecules and the protein that might contribute to the binding and inhibition. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Crystallization and preliminary X-ray crystallographic analysis of strictosidine synthase from Rauvolfia: the first member of a novel enzyme family.

    PubMed

    Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim

    2004-10-01

    Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.

  5. Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase.

    PubMed

    Bamford, Vicki A; Armour, Maria; Mitchell, Sue A; Cartron, Michaël; Andrews, Simon C; Watson, Kimberly A

    2008-09-01

    YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

  6. Structure and interactions of human respiratory mucin

    NASA Astrophysics Data System (ADS)

    Purdy, Kirstin; Sheehan, John; Rubinstein, Michael; Wong, Gerard

    2006-03-01

    Human respiratory mucin plays a crucial role in the pathology of Cystic Fibrosis lung infections. Mucin is a flexible, linear polyelectrolyte, characterized by its many charged oligo-carbohydrate side chains that give it its bottle-brush structure. The macroscopic properties of a mucin suspension are known to change drastically with changes in ion concentration and solution pH, but little is known about the effect of these variables on individual mucin structure. We present preliminary results on the structural response of individual human respiratory mucin molecules to variations in concentration of ions of different valences via small angle x-ray diffraction.

  7. Design and implementation of a beam-waveguide mirror control system for vernier pointing of the DSS-13 antenna

    NASA Technical Reports Server (NTRS)

    Alvarez, L. S.; Moore, M.; Veruttipong, W.; Andres, E.

    1994-01-01

    The design and implementation of an antenna beam-waveguide (BWG) mirror position control system at the DSS-13 34-m antenna is presented. While it has several potential applications, a positioner on the last flat-plate BWG mirror (M6) at DSS 13 is installed to demonstrate the conical scan (conscan) angle-tracking technique at the Ka-band (32-GHz) operating frequency. Radio frequency (RF) beam-scanning predictions for the M6 mirror, computed from a diffraction analysis, are presented. From these predictions, position control system requirements are then derived. The final mechanical positioner and servo system designs, as implemented at DSS 13, are illustrated with detailed design descriptions given in the appendices. Preliminary measurements of antenna Ka-band beam scan versus M6 mirror tilt made at DSS 13 in December 1993 are presented. After reduction, the initial measurements are shown to be in agreement with the RF predicts. Plans for preliminary conscan experimentation at DSS 13 are summarized.

  8. Preliminary X-ray characterization of a novel type of anchoring cohesin from the cellulosome of Ruminococcus flavefaciens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alber, Orly; Noach, Ilit; Lamed, Raphael

    2008-02-01

    The cloning, expression, purification, crystallization and preliminary X-ray characterization of a novel class of cohesin module (type III) from the R. flavefaciens ScaE anchoring scaffoldin are described. Ruminococcus flavefaciens is an anaerobic bacterium that resides in the gastrointestinal tract of ruminants. It produces a highly organized multi-enzyme cellulosome complex that plays a key role in the degradation of plant cell walls. ScaE is one of the critical structural components of its cellulosome that serves to anchor the complex to the cell wall. The seleno-l-methionine-labelled derivative of the ScaE cohesin module has been cloned, expressed, purified and crystallized. The crystals belongmore » to space group C2, with unit-cell parameters a = 155.6, b = 69.3, c = 93.0 Å, β = 123.4°, and contain four molecules in the asymmetric unit. Diffraction data were phased to 1.95 Å using the anomalous signal from the Se atoms.« less

  9. Preliminary report on the clay mineralogy of the Upper Devonian Shales in the southern and middle Appalachian Basin

    USGS Publications Warehouse

    Hosterman, John W.; Loferski, Patricia J.

    1978-01-01

    The distribution of kaolinite in parts of the Devonian shale section is the most significant finding of this work. These shales are composed predominately of 2M illite and illitic mixed-layer clay with minor amounts of chlorite and kaolinite. Preliminary data indicate that kaolinite, the only allogenic clay mineral, is present in successively older beds of the Ohio Shale from south to north in the southern and middle parts of the Appalachian basin. This trend in the distribution of kaolinite shows a paleocurrent direction to the southwest. Three well-known methods of preparing the clay fraction for X-ray diffraction analysis were tested and evaluated. Kaolinite was not identified in two of the methods because of layering due to differing settling rates of the clay minerals. It is suggested that if one of the two settling methods of sample preparation is used, the clay film be thin enough for the X-ray beam to penetrate the entire thickness of clay.

  10. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of bacterioferritin A from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gupta, Vibha; Gupta, Rakesh K.; Ram Lal Anand College, University of Delhi, Benito Juarez Road, New Delhi 110021

    2008-05-01

    The cloning, purification and crystallization of a bacterioferritin from M. tuberculosis together with preliminary X-ray characterization of its crystals are reported. Bacterioferritins (Bfrs) comprise a subfamily of the ferritin superfamily of proteins that play an important role in bacterial iron storage and homeostasis. Bacterioferritins differ from ferritins in that they have additional noncovalently bound haem groups. To assess the physiological role of this subfamily of ferritins, a greater understanding of the structural details of bacterioferritins from various sources is required. The gene encoding bacterioferritin A (BfrA) from Mycobacterium tuberculosis was cloned and expressed in Escherichia coli. The recombinant protein productmore » was purified by affinity chromatography on a Strep-Tactin column and crystallized with sodium chloride as a precipitant at pH 8.0 using the vapour-diffusion technique. The crystals diffracted to 2.1 Å resolution and belonged to space group P4{sub 2}, with unit-cell parameters a = 123.0, b = 123.0, c = 174.6 Å.« less

  11. Expression, crystallization and preliminary crystallographic analysis of the extracellular IgV-like domain of the human natural killer cell inhibitory receptor p75/AIRM1.

    PubMed

    Dimasi, Nazzareno; Moretta, Lorenzo; Biassoni, Roberto; Mariuzza, Roy A

    2003-10-01

    p75/AIRM1 (Siglec-7) is a sialic acid-binding Ig-like lectin recently identified as an inhibitory receptor on natural killer cells. The expression, in vitro folding, circular-dichroism spectroscopy, crystallization and preliminary X-ray characterization of the Ig-V like domain of p75/AIRM1 are reported. X-ray data were collected from a single crystal at 100 K, with a maximum useful diffraction pattern extending to 1.45 A resolution on a synchrotron source. The crystal belongs to a primitive monoclinic space group, with unit-cell parameters a = 32.65, b = 49.72, c = 39.79 A, alpha = gamma = 90, beta = 113 degrees. The systematic absences indicate that the space group is P2(1). Assuming one molecule per asymmetric unit, V(M) (the Matthews coefficient) was calculated to be 1.879 A(3) Da(-1) and the solvent content was estimated to be 32.01%.

  12. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less

  13. Crystallization and preliminary crystallographic investigation of a low-pH native insulin monomer with flexible behaviour.

    PubMed

    Zhang, Youshang; Whittingham, Jean L; Turkenburg, Johan P; Dodson, Eleanor J; Brange, Jens; Dodson, G Guy

    2002-01-01

    Insulin naturally aggregates as dimers and hexamers, whose structures have been extensively analysed by X-ray crystallography. Structural determination of the physiologically relevant insulin monomer, however, is an unusual challenge owing to the difficulty in finding solution conditions in which the concentration of insulin is high enough for crystallization yet the molecule remains monomeric. By utilizing solution conditions known to inhibit insulin assembly, namely 20% acetic acid, crystals of insulin in the monomeric state have been obtained. The crystals are strongly diffracting and a data set extending to 1.6 A has recently been collected. The crystals nominally belong to the space group I422, with unit-cell parameters a = b = 57.80, c = 54.61 A, giving rise to one molecule in the asymmetric unit. Preliminary electron-density maps show that whilst most of the insulin monomer is well ordered and similar in conformation to other insulin structures, parts of the B-chain C-terminus main chain adopt more than one conformation.

  14. Ultrasonic promoted synthesis of novel s-triazine-Schiff base derivatives; molecular structure, spectroscopic studies and their preliminary anti-proliferative activities

    NASA Astrophysics Data System (ADS)

    El-Faham, Ayman; Soliman, Saied M.; Ghabbour, Hazem A.; Elnakady, Yasser A.; Mohaya, Talal A.; Siddiqui, Mohammed R. H.; Albericio, Fernando

    2016-12-01

    Novel series of s-triazine-Schiff base derivatives were synthesized employing ultrasonic irradiation and characterized by NMR (1H and 13C), FT-IR, and elemental analysis. The use of ultrasonic irradiation has allowed the preparation of the target products with better yields in shorter reaction time and excellent purities compared to the conventional heating. X-ray single crystal diffraction experiments verified the molecular structure of four from the new prepared s-triaizne-Schiff base derivatives. The molecular structures of the studied compounds are computerized using DFT/B3LYP method. The effects of substituent at the triazine and phenyl ring on the electronic and spectroscopic properties of the studied compounds were also investigated. The natural atomic charges showed that pipridino-s-triazine derivatives are richer in electrons than those having morpholino derivatives. The anti-proliferative effects for the prepared compounds were tested against three different cancer cell lines.

  15. Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module (CBM_E1) derived from sugarcane soil metagenome.

    PubMed

    Campos, Bruna Medeia; Alvarez, Thabata Maria; Liberato, Marcelo Vizona; Polikarpov, Igor; Gilbert, Harry J; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

    2014-09-01

    In recent years, owing to the growing global demand for energy, dependence on fossil fuels, limited natural resources and environmental pollution, biofuels have attracted great interest as a source of renewable energy. However, the production of biofuels from plant biomass is still considered to be an expensive technology. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases for polysaccharide degradation, is attracting growing attention. Aiming at the identification of new CBMs, a sugarcane soil metagenomic library was analyzed and an uncharacterized CBM (CBM_E1) was identified. In this study, CBM_E1 was expressed, purified and crystallized. X-ray diffraction data were collected to 1.95 Å resolution. The crystals, which were obtained by the sitting-drop vapour-diffusion method, belonged to space group I23, with unit-cell parameters a = b = c = 88.07 Å.

  16. Crystallization and preliminary X-ray crystallographic analysis of agkicetin-C from Deinagkistrodon acutus venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Gufeng; Departments of Molecular and Cell Biology, School of Life Sciences, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026; Huang, Qingqiu

    2005-01-01

    The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. Crystals of agkicetin-C suitable for structure determination were obtained from 1.8 M ammonium sulfate, 40 mM MES pH 6.5 with 2%(v/v) PEG 400. Interestingly, low buffer concentrations of MES seem to be necessary for crystal growth. The crystals of agkicetin-C belong tomore » space group C2, with unit-cell parameters a = 177.5, b = 97.7, c = 106.8 Å, β = 118.5°, and diffract to 2.4 Å resolution. Solution of the phase problem by the molecular-replacement method shows that there are four agkicetin-C molecules in the asymmetric unit, with a V{sub M} value of 3.4 Å{sup 3} Da{sup −1}, which corresponds to a high solvent content of approximately 64%. Self-rotation function calculations show a single well defined non-crystallographic twofold axis with features that may represent additional elements of non-crystallographic symmetry.« less

  17. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain

    PubMed Central

    Rodamilans, Bernardo; Montoya, Guillermo

    2007-01-01

    DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P21, with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 Å, α = γ = 90, β = 101.02°, and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 Å using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS). PMID:17401195

  18. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain.

    PubMed

    Rodamilans, Bernardo; Montoya, Guillermo

    2007-04-01

    DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P2(1), with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 A, alpha = gamma = 90, beta = 101.02 degrees , and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 A using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS).

  19. Study of Crystallinity Index (CrI) of Oil Palm Frond Pretreatment using Aqueous [EMIM][OAc] in a Closed System

    NASA Astrophysics Data System (ADS)

    Abu Darim, R.; Azizan, A.; Salihon, J.

    2018-05-01

    The objective of this preliminary study is to identify the Crystalinity Index (CrI) of Oil Palm Frond (OPF) pretreated with 40% concentration of 1-ethyl-3-methylimidazolium acetate ionic liquid ([EMIM][OAc]) in a closed system. The morphology and structural changes of the pretreated OPF were examined by using Fourier Transform Infrared Spectrometer (FTIR) and X-Ray Diffraction (XRD). The pretreatment process was carried out in triplicates by loading 40% of [EMIM][OAc] concentration with 10 wt% of OPF loading in the Bio-ionic liquid-reactor. The pretreatment process was conducted for 3 hours with working volume of 70 mL and temperature of 110°C. A Bio-ionic liquid reactor was purposely designed for the lignocellulosic pretreatment by using aqueous ionic liquid at high temperature (higher than boiling point of water). The CrI of OPF pretreated with 40% concentration of [EMM][OAc] in a closed system observed was 9% lower from the untreated OPF and the result showed significant difference with 95% confidence level. Further examination of the untreated and pretreated OPF by using XRD showed that the diffraction pattern of the pretreated OPF samples was decreasing compared to the untreated OPF. The characteristic of the FTIR spectra of the pretreated OPF showed the presence of the cellulose I and occurrence of amorphous cellulosic in the samples. The findings from this study are expected to improve knowledge on pretreatment of OPF by using aqueous [EMIM][OAc] as a green economically viable process for future renewable energy.

  20. Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia)

    PubMed Central

    Sathya Moorthy, Pon.; Neelagandan, K.; Balasubramanian, M.; Ponnuswamy, M. N.

    2009-01-01

    Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 Å resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 Å, α = 78.742, β = 89.819, γ = 65.320°. PMID:19194000

  1. Crystallization and preliminary X-ray diffraction analysis of central structure domains from mumps virus F protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing

    2005-09-01

    Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less

  2. Crystallization and preliminary X-ray diffraction analysis of the two distinct types of zebrafish β2-microglobulin

    PubMed Central

    Chen, Zhaosan; Zhang, Nianzhi; Lu, Shuangshuang; Tariq, Mansoor; Wang, Junya; Xia, Chun

    2015-01-01

    β2-Microglobulin (β2m) noncovalently associates with the heavy chain of major histocompatibility complex class I (MHC I) molecules, which bind foreign antigen peptides to control the cytotoxic T lymphocyte (CTL) immune response. In contrast to mammals, there are distinct types of β2ms derived from two loci in a number of teleost species. In order to clarify the structures of the β2ms, the zebrafish (Danio rerio) β2ms Dare-β2m-I and Dare-β2m-II were expressed in Escherichia coli, purified and crystallized, and diffraction data were collected to 1.6 and 1.9 Å resolution, respectively. Both crystals belonged to space group P212121. The unit-cell parameters were determined to be a = 38.2, b = 50.4, c = 50.9 Å for Dare-β2m-I and a = 38.9, b = 52.7, c = 65.8 Å for Dare-β2m-II. Each asymmetric unit was constituted of one molecule, with Matthews coefficients of 2.22 and 3.01 Å3 Da−1 and solvent contents of 45 and 59% for Dare-β2m-I and Dare-β2m-II, respectively. These two β2m structures will provide relevant information for further studies of the structures of the MHC I complex. PMID:26057815

  3. Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz

    2008-07-01

    Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less

  4. Crystallization and preliminary X-ray diffraction studies of the lipopolysaccharide core biosynthetic enzyme ADP-L-glycero-D-mannoheptose 6-epimerase from Escherichia coli K-12.

    PubMed

    Ding, L; Zhang, Y; Deacon, A M; Ealick, S E; Ni, Y; Sun, P; Coleman, W G

    1999-03-01

    ADP-L-glycero-D-mannoheptose 6-epimerase is a 240 kDa NAD-dependent nucleotide diphosphosugar epimerase from Escherichia coli K12 which catalyzes the interconversion of ADP-D-glycero-D-mannoheptose and ADP-L-glycero-D-mannoheptose. ADP-L-glycero-D-mannoheptose is a required intermediate for lipopolysaccharide inner-core and outer-membrane biosynthesis in several genera of pathogenic and non-pathogenic Gram-negative bacteria. ADP-L-glycero-D-mannoheptose 6-epimerase was overexpressed in E. coli and purified to apparent homogeneity by chromatographic methods. Three crystal forms of the epimerase were obtained by a hanging-drop vapor-diffusion method. A native data set for crystal form III was collected in-house on a Rigaku R-AXIS-IIC image plate at 3.0 A resolution. The form III crystals belong to the monoclinic space group P21. The unit-cell parameters are a = 98.94, b = 110.53, c = 180.68 A and beta = 90.94 degrees. Our recent results show that these crystals diffract to 2.0 A resolution at the Cornell High Energy Synchrotron Source. The crystal probably contains six 40 kDa monomers per asymmetric unit, with a corresponding volume per protein mass (Vm) of 4.11 A3 Da-1 and a solvent fraction of 70%.

  5. The purification, crystallization and preliminary structural characterization of FAD-dependent monooxygenase PhzS, a phenazine-modifying enzyme from Pseudomonas aeruginosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gohain, Neelakshi; Thomashow, Linda S.; USDA Agricultural Research Service, Root Disease and Biological Control Research Unit, Pullman, Washington 99164-6430

    2006-10-01

    PhzS, an FAD-dependent monooxygenase that catalyzes a reaction involved in the biosynthesis of the virulence factor pyocyanin in P. aeruginosa, was cloned, overexpressed and crystallized. Data collection from native and seleno-l-methionine-labelled crystals is reported. The blue chloroform-soluble bacterial metabolite pyocyanin (1-hydroxy-5-methyl-phenazine) contributes to the survival and virulence of Pseudomonas aeruginosa, an important Gram-negative opportunistic pathogen of humans and animals. Little is known about the two enzymes, designated PhzM and PhzS, that function in the synthesis of pyocyanin from phenazine-1-carboxylic acid. In this study, the FAD-dependent monooxygenase PhzS was purified and crystallized from lithium sulfate/ammonium sulfate/sodium citrate pH 5.5. Native crystalsmore » belong to space group C2, with unit-cell parameters a = 144.2, b = 96.2, c = 71.7 Å, α = γ = 90, β = 110.5°. They contain two monomers of PhzS in the asymmetric unit and diffract to a resolution of 2.4 Å. Seleno-l-methionine-labelled PhzS also crystallizes in space group C2, but the unit-cell parameters change to a = 70.6, b = 76.2, c = 80.2 Å, α = γ = 90, β = 110.5° and the diffraction limit is 2.7 Å.« less

  6. Preliminary X-ray crystallographic studies of BthTX-II, a myotoxic Asp49-phospholipase A{sub 2} with low catalytic activity from Bothrops jararacussu venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Corrêa, L. C.; Marchi-Salvador, D. P.; Cintra, A. C. O.

    2006-08-01

    A myotoxic Asp49-PLA{sub 2} with low catalytic activity from B. jararacussu (BthTX-II) was crystallized in the monoclinic crystal system; a complete X-ray diffraction data set was collected and a molecular-replacement solution was obtained. The oligomeric structure of BthTX-II resembles those of the Asp49-PLA{sub 2} PrTX-III and all bothropic Lys49-PLA{sub 2}s. For the first time, a complete X-ray diffraction data set has been collected from a myotoxic Asp49-phospholipase A{sub 2} (Asp49-PLA{sub 2}) with low catalytic activity (BthTX-II from Bothrops jararacussu venom) and a molecular-replacement solution has been obtained with a dimer in the asymmetric unit. The quaternary structure of BthTX-II resemblesmore » the myotoxin Asp49-PLA{sub 2} PrTX-III (piratoxin III from B. pirajai venom) and all non-catalytic and myotoxic dimeric Lys49-PLA{sub 2}s. In contrast, the oligomeric structure of BthTX-II is different from the highly catalytic and non-myotoxic BthA-I (acidic PLA{sub 2} from B. jararacussu). Thus, comparison between these structures should add insight into the catalytic and myotoxic activities of bothropic PLA{sub 2}s.« less

  7. Crystallization and preliminary X-ray study of the common edible mushroom (Agaricus bisporus) lectin.

    PubMed

    Carrizo, Maria E; Irazoqui, Fernando J; Lardone, Ricardo D; Nores, Gustavo A; Curtino, Juan A; Capaldi, Stefano; Perduca, Massimiliano; Monaco, Hugo L

    2004-04-01

    The lectin from the common edible mushroom Agaricus bisporus (ABL) belongs to the group of proteins that have the property of binding the Thomsen-Friedenreich antigen (T-antigen) selectively and with high affinity, but does not show any sequence similarity to the other proteins that share this property. The ABL sequence is instead similar to those of members of the saline-soluble fungal lectins, a protein family with pesticidal properties. The presence of different isoforms has been reported. It has been found that in order to be able to grow diffraction-quality crystals of the lectin, it is essential to separate the isoforms, which was performed by preparative isoelectric focusing. Using standard procedures, it was possible to crystallize the most basic of the forms by either vapour diffusion or equilibrium dialysis, but attempts to grow crystals of the other more acidic forms were unsuccessful. The ABL crystals belong to the orthorhombic space group C222(1), with unit-cell parameters a = 93.06, b = 98.16, c = 76.38 A, and diffract to a resolution of 2.2 A on a conventional source at room temperature. It is expected that the solution of this structure will yield further valuable information on the differences in the T-antigen-binding folds and will perhaps help to clarify the details of the ligand binding to the protein.

  8. Structural Transitions in Nanosized Zn0.97Al0.03O Powders under High Pressure Analyzed by in Situ Angle-Dispersive X-ray Diffraction

    PubMed Central

    Lin, Chih-Ming; Liu, Hsin-Tzu; Zhong, Shi-Yao; Hsu, Chia-Hung; Chiu, Yi-Te; Tai, Ming-Fong; Juang, Jenh-Yih; Chuang, Yu-Chun; Liao, Yen-Fa

    2016-01-01

    Nanosized aluminum-doped zinc oxide Zn1−xAlxO (AZO) powders (AZO-NPs) with x = 0.01, 0.03, 0.06, 0.09 and 0.11 were synthesized by chemical precipitation method. The thermogravimetric analysis (TGA) indicated that the precursors were converted to oxides from hydroxides near 250 °C, which were then heated to 500 °C for subsequent thermal processes to obtain preliminary powders. The obtained preliminary powders were then calcined at 500 °C for three hours. The structure and morphology of the products were measured and characterized by angle-dispersive X-ray diffraction (ADXRD) and scanning electron microscopy (SEM). ADXRD results showed that AZO-NPs with Al content less than 11% exhibited würtzite zinc oxide structure and there was no other impurity phase in the AZO-NPs, suggesting substitutional doping of Al on Zn sites. The Zn0.97Al0.03O powders (A3ZO-NPs) with grain size of about 21.4 nm were used for high-pressure measurements. The in situ ADXRD measurements revealed that, for loading run, the pressure-induced würtzite (B4)-to-rocksalt (B1) structural phase transition began at 9.0(1) GPa. Compared to the predicted phase-transition pressure of ~12.7 GPa for pristine ZnO nanocrystals of similar grain size (~21.4 nm), the transition pressure for the present A3ZO-NPs exhibited a reduction of ~3.7 GPa. The significant reduction in phase-transition pressure is attributed to the effects of highly selective site occupation, namely Zn2+ and Al3+, were mainly found in tetrahedral and octahedral sites, respectively. PMID:28773683

  9. Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

    2006-02-01

    PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

  10. Crystallization and preliminary X-ray characterization of arylamine N-acetyltransferase C (BanatC) from Bacillus anthracis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pluvinage, Benjamin; Li de la Sierra-Gallay, Inés; Martins, Marta

    2007-10-01

    Bacillus anthracis arylamine N-acetyltransferase C (BanatC) is an enzyme that metabolizes the drug sulfamethoxazole. Crystals of the purified enzyme that diffract at 1.95 Å are reported. The arylamine N-acetyltransferase (NAT) enzymes are xenobiotic metabolizing enzymes that have been found in a large range of eukaryotes and prokaryotes. These enzymes catalyse the acetylation of arylamine drugs and/or pollutants. Recently, a Bacillus anthracis NAT isoform (BanatC) has been cloned and shown to acetylate the sulfonamide antimicrobial sulfamethoxazole (SMX). Subsequently, it was shown that BanatC contributes to the resistance of this bacterium to SMX. Here, the crystallization and the X-ray characterization of BanatCmore » (Y38F mutant) are reported. The crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 53.70, c = 172.40 Å, and diffract to 1.95 Å resolution on a synchrotron source.« less

  11. Developments in the application of the geometrical theory of diffraction and computer graphics to aircraft inter-antenna coupling analysis

    NASA Astrophysics Data System (ADS)

    Bogusz, Michael

    1993-01-01

    The need for a systematic methodology for the analysis of aircraft electromagnetic compatibility (EMC) problems is examined. The available computer aids used in aircraft EMC analysis are assessed and a theoretical basis is established for the complex algorithms which identify and quantify electromagnetic interactions. An overview is presented of one particularly well established aircraft antenna to antenna EMC analysis code, the Aircraft Inter-Antenna Propagation with Graphics (AAPG) Version 07 software. The specific new algorithms created to compute cone geodesics and their associated path losses and to graph the physical coupling path are discussed. These algorithms are validated against basic principles. Loss computations apply the uniform geometrical theory of diffraction and are subsequently compared to measurement data. The increased modelling and analysis capabilities of the newly developed AAPG Version 09 are compared to those of Version 07. Several models of real aircraft, namely the Electronic Systems Trainer Challenger, are generated and provided as a basis for this preliminary comparative assessment. Issues such as software reliability, algorithm stability, and quality of hardcopy output are also discussed.

  12. Crystallization and preliminary X-ray analysis of ginkbilobin-2 from Ginkgo biloba seeds: a novel antifungal protein with homology to the extracellular domain of plant cysteine-rich receptor-like kinases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi

    Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less

  13. Mössbauer, TEM/SAED and XRD investigation on waste dumps of the Valea lui Stan gold mines

    NASA Astrophysics Data System (ADS)

    Constantinescu, Serban Grigore; Udubasa, Sorin S.; Udubasa, Gheorghe; Kuncser, Victor; Popescu-Pogrion, Nicoleta; Mercioniu, Ionel; Feder, Marcel

    2012-03-01

    The complementary investigation techniques, Mössbauer spectroscopy, transmission electron microscopy with selected area electron diffraction (TEM/SAED), X-ray diffraction (XRD) have been used to investigate the fate of the Valea lui Stan, Romania, gold-ore nanoscale-minerals during the long time of residence in the waste dumps. The preliminary investigations showed such waste dumps to contain significant amount of metals which cannot be identified by conventional methods. An intense research activity started up in order to evaluate the possibilities to recycle Valea lui Stan waste dumps and to recover metals by chemical or phytoextraction procedures. The waste dumps naturally show different mineral constituents with clay minerals as major phases, observed by XRD-technique. Although the waste dumps materials have whitish-yellowish colours, MÖSSBAUER technique evidences the presence of the finely dispersed iron bearing minerals. The authors are focusing to inspect and analyze Fe-compounds in the samples collected from Valea lui Stan's waste dumps in order to identify the magnetic phases by Mössbauer technique.

  14. Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Logsdon, Naomi J.; Allen, Christopher E.; Rajashankar, Kanagalaghatta R.

    2012-02-08

    Interleukin-20 (IL-20) is an IL-10-family cytokine that regulates innate and adaptive immunity in skin and other tissues. In addition to protecting the host from various external pathogens, dysregulated IL-20 signaling has been shown to contribute to the pathogenesis of human psoriasis. IL-20 signals through two cell-surface receptor heterodimers, IL-20R1-IL-20R2 and IL-22R1-IL-20R2. In this report, crystals of the IL-20-IL-20R1-IL-20R2 ternary complex have been grown from polyethylene glycol solutions. The crystals belonged to space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = 111, c = 135 {angstrom}, and diffracted X-rays to 3 {angstrom} resolution. The crystallographic asymmetricmore » unit contains one IL-20-IL-20R1-IL-20R2 complex, corresponding to a solvent content of approximately 54%.« less

  15. Crystallization and preliminary X-ray diffraction analysis of three myotoxic phospholipases A2 from Bothrops brazili venom

    PubMed Central

    Fernandes, Carlos A. H.; Gartuzo, Elaine C. G.; Pagotto, Ivan; Comparetti, Edson J.; Huancahuire-Vega, Salomón; Ponce-Soto, Luis Alberto; Costa, Tássia R.; Marangoni, Sergio; Soares, Andreimar M.; Fontes, Marcos R. M.

    2012-01-01

    Two myotoxic and noncatalytic Lys49-phospholipases A2 (braziliantoxin-II and MT-II) and a myotoxic and catalytic phospholipase A2 (braziliantoxin-III) from the venom of the Amazonian snake Bothrops brazili were crystallized. The crystals diffracted to resolutions in the range 2.56–2.05 Å and belonged to space groups P3121 (braziliantoxin-II), P6522 (braziliantoxin-III) and P21 (MT-II). The structures were solved by molecular-replacement techniques. Both of the Lys49-phospholipases A2 (braziliantoxin-II and MT-II) contained a dimer in the asymmetric unit, while the Asp49-phospholipase A2 braziliantoxin-III contained a monomer in its asymmetric unit. Analysis of the quaternary assemblies of the braziliantoxin-II and MT-II structures using the PISA program indicated that both models have a dimeric conformation in solution. The same analysis of the braziliantoxin-III structure indicated that this protein does not dimerize in solution and probably acts as a monomer in vivo, similar to other snake-venom Asp49-phospholipases A2. PMID:22869126

  16. Low Copy Numbers of DC-SIGN in Cell Membrane Microdomains: Implications for Structure and Function

    PubMed Central

    Liu, Ping; Wang, Xiang; Itano, Michelle S.; Neumann, Aaron K.; de Silva, Aravinda M.; Jacobson, Ken; Thompson, Nancy L.

    2014-01-01

    Presently, there are few estimates of the number of molecules occupying membrane domains. Using a total internal reflection fluorescence microscopy (TIRFM) imaging approach, based on comparing the intensities of fluorescently labeled microdomains with those of single fluorophores, we measured the occupancy of DC-SIGN, a C-type lectin, in membrane microdomains. DC-SIGN or its mutants were labeled with primary monoclonal antibodies (mAbs) in either dendritic cells (DCs) or NIH3T3 cells, or expressed as GFP fusions in NIH3T3 cells. The number of DC-SIGN molecules per microdomain ranges from only a few to over 20, while microdomain dimensions range from the diffraction limit to > 1μm. The largest fraction of microdomains, appearing at the diffraction limit, in either immature DCs or 3T3 cells contains only 4-8 molecules of DC-SIGN, consistent with our preliminary super-resolution Blink microscopy estimates. We further show that these small assemblies are sufficient to bind and efficiently internalize a small (~50nm) pathogen, dengue virus, leading to infection of host cells. PMID:24313910

  17. Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

    2005-08-01

    This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

  18. Crystallization and preliminary X-ray diffraction analysis of an endo-1,4-β-D-glucanase from Aspergillus aculeatus F-50.

    PubMed

    Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting

    2015-04-01

    Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.

  19. Operation of the Australian Store.Synchrotron for macromolecular crystallography

    PubMed Central

    Meyer, Grischa R.; Aragão, David; Mudie, Nathan J.; Caradoc-Davies, Tom T.; McGowan, Sheena; Bertling, Philip J.; Groenewegen, David; Quenette, Stevan M.; Bond, Charles S.; Buckle, Ashley M.; Androulakis, Steve

    2014-01-01

    The Store.Synchrotron service, a fully functional, cloud computing-based solution to raw X-ray data archiving and dissemination at the Australian Synchrotron, is described. The service automatically receives and archives raw diffraction data, related metadata and preliminary results of automated data-processing workflows. Data are able to be shared with collaborators and opened to the public. In the nine months since its deployment in August 2013, the service has handled over 22.4 TB of raw data (∼1.7 million diffraction images). Several real examples from the Australian crystallographic community are described that illustrate the advantages of the approach, which include real-time online data access and fully redundant, secure storage. Discoveries in biological sciences increasingly require multidisciplinary approaches. With this in mind, Store.Synchrotron has been developed as a component within a greater service that can combine data from other instruments at the Australian Synchrotron, as well as instruments at the Australian neutron source ANSTO. It is therefore envisaged that this will serve as a model implementation of raw data archiving and dissemination within the structural biology research community. PMID:25286837

  20. Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans

    PubMed Central

    Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

    2013-01-01

    YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570

  1. Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans.

    PubMed

    Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

    2013-05-01

    YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.

  2. Operation of the Australian Store.Synchrotron for macromolecular crystallography.

    PubMed

    Meyer, Grischa R; Aragão, David; Mudie, Nathan J; Caradoc-Davies, Tom T; McGowan, Sheena; Bertling, Philip J; Groenewegen, David; Quenette, Stevan M; Bond, Charles S; Buckle, Ashley M; Androulakis, Steve

    2014-10-01

    The Store.Synchrotron service, a fully functional, cloud computing-based solution to raw X-ray data archiving and dissemination at the Australian Synchrotron, is described. The service automatically receives and archives raw diffraction data, related metadata and preliminary results of automated data-processing workflows. Data are able to be shared with collaborators and opened to the public. In the nine months since its deployment in August 2013, the service has handled over 22.4 TB of raw data (∼1.7 million diffraction images). Several real examples from the Australian crystallographic community are described that illustrate the advantages of the approach, which include real-time online data access and fully redundant, secure storage. Discoveries in biological sciences increasingly require multidisciplinary approaches. With this in mind, Store.Synchrotron has been developed as a component within a greater service that can combine data from other instruments at the Australian Synchrotron, as well as instruments at the Australian neutron source ANSTO. It is therefore envisaged that this will serve as a model implementation of raw data archiving and dissemination within the structural biology research community.

  3. Confined detection volume of fluorescence correlation spectroscopy by bare fiber probes.

    PubMed

    Lu, Guowei; Lei, Franck H; Angiboust, Jean-François; Manfait, Michel

    2010-04-01

    A fiber-tip-based near-field fluorescence correlation spectroscopy (FCS) has been developed for confining the detection volume to sub-diffraction-limited dimensions. This near-field FCS is based on near-field illumination by coupling a scanning near-field optical microscope (SNOM) to a conventional confocal FCS. Single-molecule FCS analysis at 100 nM Rhodamine 6G has been achieved by using bare chemically etched, tapered fiber tips. The detection volume under control of the SNOM system has been reduced over one order of magnitude compared to that of the conventional confocal FCS. Related factors influencing the near-field FCS performance are investigated and discussed in detail. In this proof-of-principle study, the preliminary experimental results suggest that the fiber-tip-based near-field FCS might be a good alternative to realize localized analysis at the single-molecule level.

  4. Preparation, crystallization and preliminary X-ray crystallographic studies of diadenosine tetraphosphate hydrolase from Shigella flexneri 2a.

    PubMed

    Hu, Wenxin; Wang, Qihai; Bi, Ruchang

    2005-12-01

    Diadenosine tetraphosphate (Ap4A) hydrolase (EC 3.6.1.41) hydrolyzes Ap4A symmetrically in prokaryotes. It plays a potential role in organisms by regulating the concentration of Ap4A in vivo. To date, no three-dimensional structures of proteins with significant sequence homology to this protein have been determined. The 31.3 kDa Ap4A hydrolase from Shigella flexneri 2a has been cloned, expressed and purified using an Escherichia coli expression system. Crystals of Ap4A hydrolase have been obtained by the hanging-drop technique at 291 K using PEG 550 MME as precipitant. Ap4A hydrolase crystals diffract X-rays to 3.26 A and belong to space group P2(1), with unit-cell parameters a = 118.9, b = 54.6, c = 128.5 A, beta = 95.7 degrees.

  5. Dielectric and electrical characteristics of Sr modified Ca1Cu3Ti4O12

    NASA Astrophysics Data System (ADS)

    Sahu, M.; Choudhary, R. N. P.; Roul, B. K.

    2018-05-01

    This paper mainly reports on the effect of Sr substitution on dielectric and electrical properties of CaCu3Ti4O12 at different temperature and frequency. Preliminary analysis of X-ray diffraction data of sintered samples confirms the reported cubic structure. Study of surface morphology shows that the surface of the samples contains well-defined and uniformly distributed grains. Some electrical parameters (permittivity, tangent loss and impedance) of the materials were measured and analyzed over a wide range of temperature (25 to 315 °C) and frequency (50 to 2x106 Hz). The ultra high dielectric constant and low energy dissipation have been observed in the said experimental conditions of phase-pure prepared compounds. It is expected that the addition of nano-size compounds or oxide will help to enhance the above properties useful for fabrication of super-capacitor.

  6. Crystallization and preliminary crystallographic studies of the Pasteurella multocida toxin catalytic domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyazawa, Masayuki; Kitadokoro, Kengo; Kamitani, Shigeki

    2006-09-01

    The C-terminal catalytic domain of P. multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. The C-terminal catalytic domain of Pasteurella multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. Native diffraction data to 1.9 Å resolution were obtained at the BL44XU beamline of SPring-8 from a flash-frozen crystal at 100 K. The crystals belong to space group C2, with unit-cell parameters a = 111.0, b = 150.4,more » c = 77.1 Å, β = 105.5°, and are likely to contain one C-PMT (726 residues) per asymmetric unit.« less

  7. Preparation, crystallization and preliminary crystallographic analysis of old yellow enzyme from Trypanosoma cruzi

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko

    2007-10-01

    Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less

  8. Rare earth ions doped ZnO: Synthesis, characterization and preliminary photoactivity assessment

    NASA Astrophysics Data System (ADS)

    Cerrato, Erik; Gionco, Chiara; Berruti, Ilaria; Sordello, Fabrizio; Calza, Paola; Paganini, Maria Cristina

    2018-08-01

    This work reports the effect of doping zinc oxide with lanthanide ions on structural, EPR and UV visible properties. Bare and doped samples were synthesized using the simple and green hydrothermal process. Different rare earth ions (RE = La, Ce, Pr, Er and Yb) with 1% molar ratio RE/Zn were used. The samples have been studied using X Ray Diffraction, Scanning Electron Microscopy (SEM), Transmission Electron Microscopy (TEM) and UV visible diffuse reflectance spectroscopy. Finally, electron paramagnetic resonance (EPR) spectroscopy, was used to assess the materials photoactivity under UV irradiation, both in solid state, to see the charge carriers' generation and in solution, evaluating the OH• radical formation using the DMPO (5,5-Dimethyl-1-Pyrroline-N-Oxide) spin trapping technique. The results suggest that the synthesized materials could be interesting systems for the photocatalytic abatement of emerging organic persistent pollutants in wastewater treatment plants.

  9. When is an imine not an imine? Unusual reactivity of a series of Cu(II) imine-pyridine complexes and their exploitation for the Henry reaction.

    PubMed

    Cooper, Christine J; Jones, Matthew D; Brayshaw, Simon K; Sonnex, Benjamin; Russell, Mark L; Mahon, Mary F; Allan, David R

    2011-04-14

    In this paper we report the synthesis and solid-state structures for a series of pyridine based Cu(II) complexes and preliminary data for the asymmetric Henry reaction. Interestingly, the solid-state structures indicate the incorporation of an alcohol into one of the imine groups of the ligand, forming a rare α-amino ether group. The complexes have been studied via single crystal X-ray diffraction, EPR spectroscopy and mass spectrometry. Intriguingly, it has been observed that the alcohol only adds to one of the imine moieties. Density functional theory (DFT) calculations have also been employed to rationalise the observed structures. The Cu(II) complexes have been tested in the asymmetric Henry reaction (benzaldehyde + nitromethane or nitroethane) with ee's up to 84% being achieved as well as high conversions and modest diastereoselectivities. © The Royal Society of Chemistry 2011

  10. Ternary and quaternary oxides of Bi, Sr and Cu

    NASA Technical Reports Server (NTRS)

    Casais, M. T.; Millan, P.; Rasines, I.; Campa, J. A.

    1991-01-01

    Before the discovery of superconductivity in an oxide of Bi, Sr, and Cu, the system Bi-Sr-Cu-O had not been studied, although several solid phases had been identified in the two-component regions of the ternary system Bi2O3-Si-O-CuO. The oxides Sr2CuO3, SrCu2O2, SrCuO2, and Bi2CuO4 were then well known and characterized, and the phase diagram of the binary system Bi2O3-SrO had been established in the temperature range 620 to 1000 C. Besides nine solutions of compositions Bi(2-2x) Sr(x) O(3-2x) and different symmetries, this diagram includes three definite compounds of stoichiometries Bi(2)BrO4. Bi2Sr2O5, and Bi2Sr3O6 (x - 0.50, 0.67 and 0.75 respectively), only the second of which with known unit-cell of orthorhombic symmetry, dimensions (A) a = 14.293(2), b = 7.651(2), c = 6.172(1), and z = 4. The first superconducting oxide in the system Bi-Sr-Cu-O was initially formulated as Bi2Sr2Cu2O(7+x), with an orthorhombic unit-cell of parameters (A) a = 5.32, b = 26.6, c = 48.8. In a preliminary study the same oxide was formulated with half the copper content, Bi(2)Sr(2)CuO(6+x), and index its reflections assuming an orthorhombic unit-cell of dimensions (A) a = 5.390(2), b = 26.973(8), c = 24.69(4). Subsequent studies by diffraction techniques have confirmed the composition 2:2:1. A new family of oxygen-deficient perovskites, was characterized, after identifying by x ray diffraction the phases present in the products of thermal treatments of about 150 mixtures of analytical grade Bi2O3, Sr(OH)2-8H2O and CuO at different molar ratios. X ray diffraction data are presented for some other oxides of Bi and Sr, as well as for various quaternary oxides, among them an oxide of Bi, Sr, and Cu.

  11. T-Shaped Indan-1,3-dione derivatives as promising electron donors for bulk heterojunction small molecule solar cell

    NASA Astrophysics Data System (ADS)

    Adhikari, Tham; Solanke, Parmeshwar; Pathak, Dinesh; Wagner, Tomas; Bureš, Filip; Reed, Tyler; Nunzi, Jean-Michel

    2017-07-01

    We report on the photovoltaic performance of novel T-Shaped Indan-1,3-dione derivatives as donors in a solution processed bulk heterojunction solar cells. Small molecule bulk heterojunction solar cells of these molecules with [6,6]-phenyl-C61-butyric acid methyl ester (PC61BM) were fabricated and characterized. The preliminary characterization of these devices yielded a PCE of 0.24% and 0.33% for two separate derivatives. These low power conversion efficiencies were attributed to a high surface roughness with a large number of dewetting spots. Doping with 10% Polystyrene in the Indan-1,3-dione derivatives decreases surface roughness and dewetting spots thereby improving the efficiency of the devices. Efficiency of the devices was found as 0.39% and 0.51% for two derivatives after doping with polystyrene. The charge transfer mechanism was studied with photoluminescence quenching. The morphology and packing behavior of molecules were further studied using Atomic Force Microscopy (AFM) and X-ray diffraction (XRD).

  12. OSL studies of alkali fluoroperovskite single crystals for radiation dosimetry

    NASA Astrophysics Data System (ADS)

    Daniel, D. Joseph; Raja, A.; Madhusoodanan, U.; Annalakshmi, O.; Ramasamy, P.

    2016-08-01

    This paper presents a preliminary investigation of the optically stimulated luminescence (OSL) of alkali fluoroperovskite single crystals for radiation dosimetry. The perovskite-like KMgF3, NaMgF3 and LiBaF3 polycrystalline compounds doped with rare earths (Eu2+ and Ce3+) were synthesized by standard solid state reaction technique. Phase purity of the synthesized compounds was analyzed by powder X-ray diffraction technique. Single crystals of these compounds have been grown from melt by using vertical Bridgman-Stockbarger method. The Linearly Modulated OSL and Continuous Wave OSL measurements were performed in these alkali fluorides using blue light stimulation. Thermal bleaching experiments have shown that OSL signals originate from traps which are unstable near 200 °C, thus proving the suitability of the signals for dosimetric purposes. Optical bleaching measurements were also performed for these fluoride samples. OSL dose response was studied as a function of dose which was found to increase with beta dose.

  13. Spectral diffraction efficiency characterization of broadband diffractive optical elements.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Junoh; Cruz-Cabrera, Alvaro Augusto; Tanbakuchi, Anthony

    Diffractive optical elements, with their thin profile and unique dispersion properties, have been studied and utilized in a number of optical systems, often yielding smaller and lighter systems. Despite the interest in and study of diffractive elements, the application has been limited to narrow spectral bands. This is due to the etch depths, which are optimized for optical path differences of only a single wavelength, consequently leading to rapid decline in efficiency as the working wavelength shifts away from the design wavelength. Various broadband diffractive design methodologies have recently been developed that improve spectral diffraction efficiency and expand the workingmore » bandwidth of diffractive elements. We have developed diffraction efficiency models and utilized the models to design, fabricate, and test two such extended bandwidth diffractive designs.« less

  14. Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

    PubMed Central

    Bamford, Vicki A.; Armour, Maria; Mitchell, Sue A.; Cartron, Michaël; Andrews, Simon C.; Watson, Kimberly A.

    2008-01-01

    YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 Å resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily. PMID:18765906

  15. Characteristics of Volcanic Soils in Landslide during the 2016 Kumamoto Earthquake, Japan

    NASA Astrophysics Data System (ADS)

    Hazarika, H.; Fukuoka, H.; Kokusho, T.; Sumartini, O.; Bhoopendra, D.

    2017-12-01

    There were many seismic subsidence, debris flows, landslides and slope failures, which occurred in Aso area due to the 2016 Kumamoto earthquake, Japan. This research aims to determine the failure mechanism of many mild slopes, and elucidate the strength characteristics of volcanic soils collected from the sites. A series of undrained static and cyclic triaxial tests, ring shear tests and direct shear tests were performed. Also, for further understanding of volcanic soils' material strength, X-ray powder diffraction analysis (XRD), X-ray fluorescence analysis (XRF), and Scanning electron microscope analysis (SEM) were performed. In this paper, preliminary results of the experimental testing program are discussed.

  16. Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajaj,M.; Moriyama, H.

    2007-01-01

    The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

  17. Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis.

    PubMed

    Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

    2006-03-01

    Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.

  18. Enhanced expression of the Escherichia coli serA gene in a plasmid vector. Purification, crystallization, and preliminary X-ray data of D-3 phosphoglycerate dehydrogenase.

    PubMed

    Schuller, D J; Fetter, C H; Banaszak, L J; Grant, G A

    1989-02-15

    The serA gene of Escherichia coli strain K-12, which codes for the cooperative allosteric enzyme D-3-phosphoglycerate dehydrogenase, was inserted into an inducible expression vector which produced phosphoglycerate dehydrogenase as 8% of the soluble protein of E. coli. The purified protein was used to grow several different single crystal forms. One of these, with space group P2(1), appears to contain all four subunits of the tetrameric enzyme in the asymmetric unit and diffracts to sufficient resolution to allow determination of the structure of phosphoglycerate dehydrogenase.

  19. Preparation of theophylline-hydroxypropylmethylcellulose matrices using supercritical antisolvent precipitation: a preliminary study.

    PubMed

    Moneghini, M; Perissutti, B; Kikic, I; Grassi, M; Cortesi, A; Princivalle, F

    2006-01-01

    Several controlled release systems of drugs have been elaborated using a supercritical fluid process. Indeed, recent techniques using a supercritical fluid as a solvent or as an antisolvent are considered to be useful alternatives to produce fine powders. In this preliminary study, the effect of Supercritical Anti Solvent process (SAS) on the release of theophylline from matrices manufactured with hydroxypropylmethylcellulose (HPMC) was investigated. Two grades of HPMC (HPMC E5 and K100) as carriers were considered in order to prepare a sustained delivery system for theophylline which was used as a model drug. The characterization of the drug before and after SAS treatment, and the coprecipitates with carriers, was performed by X-ray Diffraction (XRD) and Differential Scanning Calorimetry (DSC). The dissolution rate of theophylline, theophylline-coprecipitates, and matricial tablets prepared with coprecipitates were determined. The physical characterizations revealed a substantial correspondence of the drug solid state before and after supercritical fluid treatment while drug-polymer interactions in the SAS-coprecipitates were attested. The dissolution studies of the matrices prepared compressing the coprecipitated systems showed that the matrices based on HPMC K100 were able to promote a sustained release of the drug. Further, this advantageous dissolution performance was found to be substantially independent of the pH of the medium. The comparison with the matrices prepared with untreated substances demonstrated that matrices obtained with SAS technique can provide a slower theophylline release rate. A new mathematical model describing the in vitro dissolution kinetics was proposed and successfully tested on these systems.

  20. Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.

    2006-10-01

    The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccasemore » structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.« less

  1. Cloning, overexpression, crystallization and preliminary X-ray crystallographic analysis of a slow-processing mutant of penicillin G acylase from Kluyvera citrophila.

    PubMed

    Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G

    2013-08-01

    Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.

  2. Preliminary results on the influence of mineralogy on the turnover rates of SOM from different Hungarian soils

    NASA Astrophysics Data System (ADS)

    Zacháry, Dóra; Szalai, Zoltán; Jakab, Gergely; Németh, Tibor; Sipos, Péter; Filep, Tibor

    2016-04-01

    Fine textured soils generally considered containing more microbial biomass, and having a lower rate of biomass turnover and organic matter decomposition than coarse textured soils. In spite of this, several recent studies have shown contradicting trends. For example, the relative importance of different clay minerals for stabilizing SOM remains an open question. The aim of this study is to evaluate soil mineralological effect on the turnover of SOM by identifying and quantifying soil phyllosilicates. Our samples are derived from C3 forests and C3 croplands from different sites of Hungary. C4 maize residues are added to the soils in order to get natural 13C enrichment as tracer for the young carbon. Bulk samples of the soils from 0 to 20 cm depth were collected. The samples were dried at room temperature and preincubated in the dark for 4 months at 20 °C. The basic soil properties (pH, cation exchange capacity) were analysed after 2 mm sieving and homogenization. The amount of total C and N in the soils and maize residues were analysed using NDIR-chemiluminescent analyzer (Tekmar Dohrman Apollo 9000N). Particle size distribution was determined by laser diffraction (Fritsch Analysette MicroTec 22 plus) and particle imaging method (Malvern Morphologi G3-ID). The mineralological composition of the samples was determined by X-ray diffraction (Philips PW 1730 X-ray diffractometer). Moist soil equivalent to 400 g dry soil mixed with 2 g maize leaves is kept in air tight glass chambers for 183 days at 20°C. The leaves had previously been dried at 60 °C, were cut into pieces and sieved through a 2 mm mesh. The evolved CO2 is trapped by 10 mL 2 M NaOH, which is exchanged on day 1, 3, 5, 7, 10, 14, 21, 28 and subsequently every 31 days. The fractional abundance of 13C of the soils, the plant material and the evolved CO2 is measured with isotope ratio mass spectrometer (Thermo Scientific Delta V IRMS). Our work show the preliminary results on the link between phyllosilicate mineralogy and soil C dynamic by reporting a quantified phyllosilicate data in connection with SOM turnover and stabilization. Acknowledgement This research was supported by the Hungarian Scientific National Fund (OTKA K100180).

  3. Optical fiber endface biosensor based on resonances in dielectric waveguide gratings

    NASA Astrophysics Data System (ADS)

    Wawro, Debra D.; Tibuleac, Sorin; Magnusson, Robert; Liu, Hanli

    2000-05-01

    A new fiber optic sensor integrating dielectric diffraction gratings and thin films on optical fiber endfaces is prosed for biomedical sensing applications. This device utilizes a resonant dielectric waveguide grating structure fabricated on an optical fiber endface to probe reactions occurring in a sensing layer deposited on its surface. The operation of this sensor is based upon a fundamental resonance effect that occurs in waveguide gratings. An incident broad- spectrum signal is guided within an optical fiber and is filtered to reflect or transmit a desired spectral band by the diffractive thin film structure on its endface. Slight changes in one or more parameters of the waveguide grating, such as refractive index or thickness, can result in a responsive shift of the reflected or transmitted spectral peak that can be detected with spectroscopic instruments. This new sensor concept combines improved sensitivity and accuracy with attractive features found separately in currently available fiber optic sensors, such as large dynamic range, small sensing proximity, real time operation, and remote sensing. Diffractive elements of this type consisting of a photoresist grating on a Si3N4 waveguide have been fabricated on multimode optical fiber endfaces with 100 micrometers cores. Preliminary experimental tests using a tunable Ti:sapphire laser indicate notches of 18 percent in the transmission spectrum of the fiber endface guided-mode resonance devices. A theoretical analysis of the device performance capabilities is presented and applied to evaluate the feasibility and potential advantages of this bioprobe.

  4. Fast tunable blazed MEMS grating for external cavity lasers

    NASA Astrophysics Data System (ADS)

    Tormen, Maurizio; Niedermann, Philippe; Hoogerwerf, Arno; Shea, Herbert; Stanley, Ross

    2017-11-01

    Diffractive MEMS are interesting for a wide range of applications, including displays, scanners or switching elements. Their advantages are compactness, potentially high actuation speed and in the ability to deflect light at large angles. We have designed and fabricated deformable diffractive MEMS grating to be used as tuning elements for external cavity lasers. The resulting device is compact, has wide tunability and a high operating speed. The initial design is a planar grating where the beams are free-standing and attached to each other using leaf springs. Actuation is achieved through two electrostatic comb drives at either end of the grating. To prevent deformation of the free-standing grating, the device is 10 μm thick made from a Silicon on Insulator (SOI) wafer in a single mask process. At 100V a periodicity tuning of 3% has been measured. The first resonant mode of the grating is measured at 13.8 kHz, allowing high speed actuation. This combination of wide tunability and high operating speed represents state of the art in the domain of tunable MEMS filters. In order to improve diffraction efficiency and to expand the usable wavelength range, a blazed version of the deformable MEMS grating has been designed. A key issue is maintaining the mechanical properties of the original device while providing optically smooth blazed beams. Using a process based on anisotropic KOH etching, blazed gratings have been obtained and preliminary characterization is promising.

  5. EFFECT OF ACTIVE ACCUMULATION OF CALCIUM AND PHOSPHATE IONS ON THE STRUCTURE OF RAT LIVER MITOCHONDRIA

    PubMed Central

    Greenawalt, John W.; Rossi, Carlo S.; Lehninger, Albert L.

    1964-01-01

    Rat liver mitochondria allowed to accumulate maximal amounts of Ca++ and HPO4 = ions from the suspending medium in vitro during respiration have a considerably higher specific gravity than normal mitochondria and may be easily separated from the latter by isopycnic centrifugation in density gradients of sucrose or cesium chloride. When the mitochondria are allowed to accumulate less than maximal amounts of Ca++ and HPO4 = from the medium, they have intermediate specific gravities which are roughly proportional to their content of calcium phosphate. Maximally "loaded" mitochondria are relatively homogeneous with respect to specific gravity. Correlated biochemical and electron microscopic studies show that Ca++-loaded mitochondria contain numerous dense granules, of which some 85 per cent are over 500 A in diameter. These granules are electron-opaque not only following fixation and staining with heavy metal reagents, but also following fixation with formaldehyde, demonstrating that the characteristic granules in Ca++-loaded mitochondria have intrinsic electron-opacity. The dense granules are almost always located within the inner compartment of the mitochondria and not in the space between the inner and outer membranes. They are frequently located at or near the cristae and they often show electron-transparent "cores." Such granules appear to be made up of clusters of smaller dense particles, but preliminary x-ray diffraction analysis and electron diffraction studies have revealed no evidence of crystallinity in the deposits. The electron-opaque granules decrease in number when the Ca++-loaded mitochondria are incubated with 2,4-dinitrophenol; simultaneously there is discharge of Ca++ and phosphate from the mitochondria into the medium. PMID:14228516

  6. Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei, E-mail: xlyang@scripps.edu

    2006-12-01

    Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4{sub 3}2{sub 1}2 or its enantiomorphic space group P4{sub 1}2{sub 1}2, with unit-cell parameters a =more » b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%.« less

  7. Quantitative analysis of thoria phase in Th-U alloys using diffraction studies

    NASA Astrophysics Data System (ADS)

    Thakur, Shital; Krishna, P. S. R.; Shinde, A. B.; Kumar, Raj; Roy, S. B.

    2017-05-01

    In the present study the quantitative phase analysis of Th-U alloys in bulk form namely Th-52 wt% U and Th-3wt%U has been performed over the data obtained from both X ray diffraction and neutron diffraction technique using Rietveld method of FULLPROF software. Quantifying thoria (ThO2) phase present in bulk of the sample is limited due to surface oxidation and low penetration of x rays in high Z material. Neutron diffraction study probing bulk of the samples has been presented in comparison with x-ray diffraction study.

  8. The Growth of Protein Crystals Using McDUCK

    NASA Technical Reports Server (NTRS)

    Ewing, Felicia; Wilson, Lori; Nadarajah, Arunan; Pusey, Marc

    1998-01-01

    Most of the current microgravity crystal growth hardware is optimized to produce crystals within the limited time available on orbit. This often results in the actual nucleation and growth process being rushed or the system not coming to equilibrium within the limited time available. Longer duration hardware exists, but one cannot readily pick out crystals grown early versus those which nucleated and grew more slowly. We have devised a long duration apparatus, the Multi-chamber Dialysis Unit for Crystallization Kinetics, or McDUCK. This apparatus-is a series of protein chambers, stacked upon a precipitant reservoir chamber. All chambers are separated by a dialysis membrane, which serves to pass small molecules while retaining the protein. The volume of the Precipitant chamber is equal to the sum of the volumes of the protein chamber. In operation, the appropriate chambers are filled with precipitant solution or protein solution, and the McDUCK is placed standing upright, with the precipitant chamber on the bottom. The precipitant diffuses upwards over time, with the time to reach equilibration a function of the diffusivity of the precipitant and the overall length of the diffusion pathway. Typical equilibration times are approximately 2-4 months, and one can readily separate rapid from slow nucleation and growth crystals. An advantage on Earth is that the vertical precipitant concentration gradient dominates that of the solute, thus dampening out solute density gradient driven convective flows. However, large Earth-grown crystals have so far tended to be more two dimensional. Preliminary X-ray diffraction analysis of lysozyme crystals grown in McDUCK have indicated that the best, and largest, come from the middle chambers, suggesting that there is an optimal growth rate. Further, the improvements in diffraction resolution have been better signal to noise ratios in the low resolution data, not an increase in resolution overall. Due to the persistently large crystals grown we are currently proposing McDUCK for the growth of macromolecule crystals for use in neutron diffraction studies.

  9. Mask fabrication and its applications to extreme ultra-violet diffractive optics

    NASA Astrophysics Data System (ADS)

    Cheng, Yang-Chun

    Short-wavelength radiation around 13nm of wavelength (Extreme Ultra-Violet, EUV) is being considered for patterning microcircuits, and other electronic chips with dimensions in the nanometer range. Interferometric Lithography (IL) uses two beams of radiation to form high-resolution interference fringes, as small as half the wavelength of the radiation used. As a preliminary step toward manufacturing technology, IL can be used to study the imaging properties of materials in a wide spectral range and at nanoscale dimensions. A simple implementation of IL uses two transmission diffraction gratings to form the interference pattern. More complex interference patterns can be created by using different types of transmission gratings. In this thesis, I describe the development of a EUV lithography system that uses diffractive optical elements (DOEs), from simple gratings to holographic structures. The exposure system is setup on a EUV undulator beamline at the Synchrotron Radiation Center, in the Center for NanoTechnology clean room. The setup of the EUV exposure system is relatively simple, while the design and fabrication of the DOE "mask" is complex, and relies on advanced nanofabrication techniques. The EUV interferometric lithography provides reliable EUV exposures of line/space patterns and is ideal for the development of EUV resist technology. In this thesis I explore the fabrication of these DOE for the EUV range, and discuss the processes I have developed for the fabrication of ultra-thin membranes. In addition, I discuss EUV holographic lithography and generalized Talbot imaging techniques to extend the capability of our EUV-IL system to pattern arbitrary shapes, using more coherent sources than the undulator. In a series of experiments, we have demonstrated the use of a soft X-ray (EUV) laser as effective source for EUV lithography. EUV-IL, as implemented at CNTech, is being used by several companies and research organizations to characterize photoresist materials.

  10. Optical Technologies for UV Remote Sensing Instruments

    NASA Technical Reports Server (NTRS)

    Keski-Kuha, R. A. M.; Osantowski, J. F.; Leviton, D. B.; Saha, T. T.; Content, D. A.; Boucarut, R. A.; Gum, J. S.; Wright, G. A.; Fleetwood, C. M.; Madison, T. J.

    1993-01-01

    Over the last decade significant advances in technology have made possible development of instruments with substantially improved efficiency in the UV spectral region. In the area of optical coatings and materials, the importance of recent developments in chemical vapor deposited (CVD) silicon carbide (SiC) mirrors, SiC films, and multilayer coatings in the context of ultraviolet instrumentation design are discussed. For example, the development of chemically vapor deposited (CVD) silicon carbide (SiC) mirrors, with high ultraviolet (UV) reflectance and low scatter surfaces, provides the opportunity to extend higher spectral/spatial resolution capability into the 50-nm region. Optical coatings for normal incidence diffraction gratings are particularly important for the evolution of efficient extreme ultraviolet (EUV) spectrographs. SiC films are important for optimizing the spectrograph performance in the 90 nm spectral region. The performance evaluation of the flight optical components for the Solar Ultraviolet Measurements of Emitted Radiation (SUMER) instrument, a spectroscopic instrument to fly aboard the Solar and Heliospheric Observatory (SOHO) mission, designed to study dynamic processes, temperatures, and densities in the plasma of the upper atmosphere of the Sun in the wavelength range from 50 nm to 160 nm, is discussed. The optical components were evaluated for imaging and scatter in the UV. The performance evaluation of SOHO/CDS (Coronal Diagnostic Spectrometer) flight gratings tested for spectral resolution and scatter in the DGEF is reviewed and preliminary results on resolution and scatter testing of Space Telescope Imaging Spectrograph (STIS) technology development diffraction gratings are presented.

  11. Crystallization and X-ray data analysis of the 10 kDa C-terminal lid subdomain from Caenorhabditis elegans Hsp70

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Worrall, Liam; Walkinshaw, Malcolm D., E-mail: m.walkinshaw@ed.ac.uk

    Crystals of the C-terminal 10 kDa lid subdomain from the C. elegans chaperone Hsp70 have been obtained that diffract X-rays to ∼3.5 Å and belong to space group I2{sub 1}2{sub 1}2{sub 1}. Analysis of X-ray data and initial heavy-atom phasing reveals 24 monomers in the asymmetric unit related by 432 non-crystallographic symmetry. Hsp70 is an important molecular chaperone involved in the regulation of protein folding. Crystals of the C-terminal 10 kDa helical lid domain (residues 542–640) from a Caenorhabditis elegans Hsp70 homologue have been produced that diffract X-rays to ∼3.4 Å. Crystals belong to space group I2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = b = 197, c = 200 Å. The Matthews coefficient, self-rotation function and Patterson map indicate 24 monomers in the asymmetric unit, showing non-crystallographic 432 symmetry. Molecular-replacement studies using the corresponding domain from rat, the only eukaryotic homologue with a known structure, failed and a mercury derivative was obtained. Preliminary MAD phasing using SHELXD and SHARP for location and refinement of the heavy-atom substructure and SOLOMON for density modification produced interpretable maps with a clear protein–solvent boundary. Further density-modification, model-building and refinement are currently under way.« less

  12. In vitro feasibility study of the use of a magnetic electrospun chitosan nanofiber composite for hyperthermia treatment of tumor cells.

    PubMed

    Lin, Ta-Chun; Lin, Feng-Huei; Lin, Jui-Che

    2012-07-01

    Hyperthermia has been reported to be an effective cancer treatment modality, as tumor cells are more temperature-sensitive than their normal counterparts. Since the ambient temperature can be increased by placing magnetic nanoparticles in an alternating magnetic field it has become of interest to incorporate these magnetic nanoparticles into biodegradable nanofibers for possible endoscopic hyperthermia treatment of malignant tumors. In this preliminary investigation we have explored various characteristics of biodegradable electrospun chitosan nanofibers containing magnetic nanoparticles prepared by different methods. These methods included: (1) E-CHS-Fe(3)O(4), with electrospun chitosan nanofibers directly immersed in a magnetic nanoparticle solution; (2) E-CHS-Fe(2+), with the electrospun chitosan nanofibers initially immersed in Fe(+2)/Fe(+3) solution, followed by chemical co-precipitation of the magnetic nanoparticles. The morphology and crystalline phase of the magnetic electrospun nanofiber matrices were determined by scanning electron microscopy, transmission electron microscopy, selected area electron diffraction, and X-ray diffraction spectroscopy. The magnetic characteristics were measured using a superconducting quantum interference device. The heating properties of these magnetic electrospun nanofiber matrices in an alternating magnetic field were investigated at a frequency of 750 kHz and magnetic intensity of 6.4 kW. In vitro cell incubation experiments indicated that these magnetic electrospun nanofiber matrices are non-cytotoxic and can effectively reduce tumor cell proliferation upon application of a magnetic field. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  13. Heavy Metal Contamination and Salt Efflorescence Associated With Decorative Landscaping Rocks, Las Vegas, Nevada: The Need for Regulations

    NASA Astrophysics Data System (ADS)

    Mrozek, S. A.; Buck, B. J.; Brock, A. L.

    2004-12-01

    Las Vegas, Nevada is one of the fastest growing cities in the United States. Faced with water restrictions, decorative rock xeroscaping has become a very popular form of landscaping. Currently, there are no regulations controlling the geochemistry of the decorative rocks that can be used for these purposes. In this study, we examined three sites containing two different decorative rock products. The landscaping rocks, underlying soil, and surface salt crusts were analyzed to determine their mineralogy and chemistry. Methods of analysis include scanning electron microscopy (SEM), energy dispersive X-ray spectrometry (EDS), X-ray diffraction (XRD), inductively coupled plasma atomic emission spectroscopy (ICP), thin section analysis, and laser particle size analysis (LPSA). Preliminary results indicate the presence of halite (NaCl), bloedite (Na2Mg(SO4)2 4H2O), a hydrated magnesium sulfate, and possibly copper sulfate and copper chloride mineral phases in the surface salt crusts. Both copper minerals are regarded as hazardous substances by the Occupational Safety and Health Administration (OSHA) and the Environmental Protection Agency (EPA); these agencies have established minimum exposure limits for human contact with these substances. Copper sulfate and copper chloride are not naturally occurring minerals in the soils of the Las Vegas Valley, and analyses indicate that their formation may be attributed to the mineralogy of the decorative landscaping rocks. Further testing is needed to characterize this potential health hazard; however the preliminary results of this study demonstrate the need for regulations controlling the geochemistry of decorative rocks used for urban landscaping.

  14. Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis

    PubMed Central

    Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

    2006-01-01

    Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316

  15. Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yin, Lei; Zhu, De-Yu; Yang, Na

    2005-04-01

    The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.

  16. Heteroepitaxial growth of Cd(1-x)Mn(x)Te on GaAs by metalorganic chemical vapor deposition

    NASA Technical Reports Server (NTRS)

    Nouhi, Akbar; Stirn, Richard J.

    1987-01-01

    In this letter, preliminary results are reported of heteroepitaxial growth of the dilute magnetic semiconductor alloy Cd(1-x)Mn(x)Te on GaAs by metalorganic chemical vapor deposition. Dimethylcadmium (DMCd), diethyltellurium (DETe), and tricarbonyl (methylcyclopentadienyl) manganese (TCPMn) were used as source materials. The TCPMn had to be heated to as high as 140 C to provide the required vapor pressure. Films with Mn atomic fractions up to 30 percent have been grown over the temperature range 410-450 C. Results of optical absorption/transmission, photoluminescence, and X-ray diffraction measurements are presented along with a scanning electron micrograph showing good surface morphology of the grown layers.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shin, Kyung -Wook; Karim, Karim S.

    Direct conversion crystalline silicon X-ray imagers are used for low-energy X-ray photon (4-20 keV) detection in scientific research applications such as protein crystallography. In this paper, we demonstrate a novel pixel architecture that integrates a crystalline silicon X-ray detector with a thin-film transistor amorphous silicon pixel readout circuit. We describe a simplified two-mask process to fabricate a complete imaging array and present preliminary results that show the fabricated pixel to be sensitive to 5.89-keV photons from a low activity Fe-55 gamma source. Furthermore, this paper presented can expedite the development of high spatial resolution, low cost, direct conversion imagers formore » X-ray diffraction and crystallography applications.« less

  18. Wavelet-based tracking of bacteria in unreconstructed off-axis holograms.

    PubMed

    Marin, Zach; Wallace, J Kent; Nadeau, Jay; Khalil, Andre

    2018-03-01

    We propose an automated wavelet-based method of tracking particles in unreconstructed off-axis holograms to provide rough estimates of the presence of motion and particle trajectories in digital holographic microscopy (DHM) time series. The wavelet transform modulus maxima segmentation method is adapted and tailored to extract Airy-like diffraction disks, which represent bacteria, from DHM time series. In this exploratory analysis, the method shows potential for estimating bacterial tracks in low-particle-density time series, based on a preliminary analysis of both living and dead Serratia marcescens, and for rapidly providing a single-bit answer to whether a sample chamber contains living or dead microbes or is empty. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Increasing EUV source efficiency via recycling of radiation power

    NASA Astrophysics Data System (ADS)

    Hassanein, Ahmed; Sizyuk, Valeryi; Sizyuk, Tatyana; Johnson, Kenneth C.

    2018-03-01

    EUV source power is critical for advanced lithography, for achieving economical throughput performance and also for minimizing stochastic patterning effects. Power conversion efficiency can be increased by recycling plasma-scattered laser radiation and other out-of-band radiation back to the plasma via retroreflective optics. Radiation both within and outside of the collector light path can potentially be recycled. For recycling within the collector path, the system uses a diffractive collection mirror that concomitantly filters all laser and out-of-band radiation out of the EUV output. In this paper we review the optical design concept for power recycling and present preliminary plasma-physics simulation results showing a potential gain of 60% in EUV conversion efficiency.

  20. Scientific management of Space Telescope

    NASA Technical Reports Server (NTRS)

    Odell, C. R.

    1981-01-01

    A historical summay is given on the science management of the Space Telescope, the inception of which began in 1962, when scientists and engineers first recommended the development of a nearly diffraction limited substantial-size optical telescope. Phase A, the feasibility requirements generation phase, began in 1971 and consisted largely of NASA scientists and a NASA design. Phase B, the preliminary design phase, established a tiered structure of scientists, led by the Large Space Telescope operations and Management Work Group. A Mission Operations Working Group headed six instrument definition teams to develop the essential instrument definitions. Many changes took place during Phase B, before design and development, which began in 1978 and still continues today.

  1. Synchrotron X-Ray Diffraction Study of Structure and Growth of Adsorbed Layers

    NASA Astrophysics Data System (ADS)

    Dai, Pengcheng

    Synchrotron x-ray diffraction and scanning-tunneling -microscopy (STM) experiments reveal a new commensurate monolayer structure of 10CB (decylcyanobiphenyl) molecules adsorbed on the (0001) graphite surface. Our results are consistent with two generic structures for nCB monolayers on surfaces of hexagonal symmetry. The monolayer d spacing of the new phase inferred by STM is 10% layer than that obtained by x-ray diffraction on the same sample. We suggest that part of this discrepancy results from a systematic error introduced in calibration of the STM length scale against the graphite substrate. For multilayer nCB films, we find that a polycrystalline structure is formed and most of the adsorbed molecules are aligned with their long axis perpendicular to the graphite surface. Synchrotron x-ray scattering has been used to investigate the structure and growth of xenon physisorbed on the Ag(111) surface using a specially designed ultra -high vacuum (UHV) chamber. For growth under quasi-equilibrium conditions, the bulk Xe-Xe spacing is reached at monolayer completion and solid films of thickness >= 220 A are observed in which an 'ABC' stacking sequence predominates. Under kinetic growth conditions, intensity oscillations at the Xe anti-Bragg position of the specular rod are observed as a function of time, indicating layer -by-layer growth. Analysis of the specular reflectivity at different coverages yields the fractional layer occupancies and the spacing between the Ag(111) surface and first Xe layer. We have conducted a series of low-energy electron diffraction (LEED) 'kinetic isotherm' experiments on both xenon and hexane rm(C_6H_{14 }) films adsorbed on the Ag(111) surface. Our preliminary results show that under the pressure and temperature range accessible to the experiments, all of the Xe kinetic isotherms fall on a universal curve which is concave upward. However, the hexane kinetic isotherms have a qualitatively different shape (S-like) at the higher temperatures while being similar to Xe at low temperatures. From these experiments, we determine that the growth of xenon from submonolayer to 0.9 monolayer is 'zero-order'. However, the growth of hexane is more complicated. It follows the 'first-order' at low temperatures, and changes to S-like shape at high temperatures which we do not yet understand.

  2. Cloning, expression, purification and preliminary crystallographic analysis of the short-chain dehydrogenase enzymes WbmF, WbmG and WbmH from Bordetella bronchiseptica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harmer, Nicholas J., E-mail: nic@cryst.bioc.cam.ac.uk; King, Jerry D.; Department of Veterinary Medicine, Cambridge CB3 0ES

    2007-08-01

    The expression, purification, and crystallisation of the short-chain dehydrogenases WbmF, WbmG and WbmH from B. bronchiseptica are described. Native diffraction data to 1.5, 2.0, and 2.2 Å were obtained for the three proteins, together with complexes with nucleotides. The short-chain dehydrogenase enzymes WbmF, WbmG and WbmH from Bordetella bronchiseptica were cloned into Escherichia coli expression vectors, overexpressed and purified to homogeneity. Crystals of all three wild-type enzymes were obtained using vapour-diffusion crystallization with high-molecular-weight PEGs as a primary precipitant at alkaline pH. Some of the crystallization conditions permitted the soaking of crystals with cofactors and nucleotides or nucleotide sugars, whichmore » are possible substrate compounds, and further conditions provided co-complexes of two of the proteins with these compounds. The crystals diffracted to resolutions of between 1.50 and 2.40 Å at synchrotron X-ray sources. The synchrotron data obtained were sufficient to determine eight structures of the three enzymes in complex with a variety of cofactors and substrate molecules.« less

  3. Crystallization and preliminary X-ray crystallographic analysis of YfcM: an important factor for EF-P hydroxylation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kobayashi, Kan; RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198; Suzuki, Takehiro

    2014-08-27

    E. coli YfcM was expressed, purified and crystallized. Crystals of YfcM were obtained by the in situ proteolysis crystallization method. Using these crystals, an X-ray diffraction data set was collected at 1.45 Å resolution. Elongation factor P (EF-P) plays an essential role in the translation of polyproline-containing proteins in bacteria. It becomes functional by the post-translational modification of its highly conserved lysine residue. It is first β-lysylated by PoxA and then hydroxylated by YfcM. In this work, the YfcM protein from Escherichia coli was overexpressed, purified and crystallized. The crystal of YfcM was obtained by the in situ proteolysis crystallizationmore » method and diffracted X-rays to 1.45 Å resolution. It belonged to space group C2, with unit-cell parameters a = 124.4, b = 37.0, c = 37.6 Å, β = 101.2°. The calculated Matthews coefficient (V{sub M}) of the crystal was 1.91 Å{sup 3} Da{sup −1}, indicating that one YfcM molecule is present in the asymmetric unit with a solvent content of 35.7%.« less

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Altenfeld, Anika; Wohlgemuth, Sabine; Wehenkel, Annemarie

    The 800 kDa complex of the human Rod, Zwilch and ZW10 proteins (the RZZ complex) was reconstituted in insect cells, purified, crystallized and subjected to preliminary X-ray diffraction analysis. The spindle-assembly checkpoint (SAC) monitors kinetochore–microtubule attachment during mitosis. In metazoans, the three-subunit Rod–Zwilch–ZW10 (RZZ) complex is a crucial SAC component that interacts with additional SAC-activating and SAC-silencing components, including the Mad1–Mad2 complex and cytoplasmic dynein. The RZZ complex contains two copies of each subunit and has a predicted molecular mass of ∼800 kDa. Given the low abundance of the RZZ complex in natural sources, its recombinant reconstitution was attempted bymore » co-expression of its subunits in insect cells. The RZZ complex was purified to homogeneity and subjected to systematic crystallization attempts. Initial crystals containing the entire RZZ complex were obtained using the sitting-drop method and were subjected to optimization to improve the diffraction resolution limit. The crystals belonged to space group P3{sub 1} (No. 144) or P3{sub 2} (No. 145), with unit-cell parameters a = b = 215.45, c = 458.7 Å, α = β = 90.0, γ = 120.0°.« less

  5. Overexpression, crystallization and preliminary X-ray crystallographic analysis of phosphopantetheine adenylyltransferase from Enterococcus faecalis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Ji Yong; Lee, Hyung Ho; Yoon, Hye Jin

    2006-11-01

    Phosphopantetheine adenylyltransferase from En. faecalis was crystallized and X-ray diffraction data were collected to 2.70 Å resolution. Phosphopantetheine adenylyltransferase, an essential enzyme in the coenzyme A biosynthetic pathway, catalyzes the reversible transfer of an adenylyl group from ATP to 4′-phosphopantetheine, yielding 3′-dephospho-CoA and pyrophosphate. Enterococcus faecalis PPAT has been overexpressed in Escherichia coli as a fusion with a C-terminal purification tag and crystallized at 297 K using a reservoir solution consisting of 0.1 M sodium HEPES pH 7.5, 0.8 M sodium dihydrogen phosphate and 0.8 M potassium dihydrogen phosphate. X-ray diffraction data were collected to 2.70 Å at 100 K.more » The crystals belong to the primitive tetragonal space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 160.81, c = 225.68 Å. Four copies of the hexameric molecule are likely to be present in the asymmetric unit, giving a crystal volume per protein weight (V{sub M}) of 3.08 Å{sup 3} Da{sup −1} and a solvent content of 60.1%.« less

  6. Expression and crystallization of SeDsbA, SeDsbL and SeSrgA from Salmonella enterica serovar Typhimurium.

    PubMed

    Jarrott, R; Shouldice, S R; Guncar, G; Totsika, M; Schembri, M A; Heras, B

    2010-05-01

    Pathogens require protein-folding enzymes to produce functional virulence determinants. These foldases include the Dsb family of proteins, which catalyze oxidative folding in bacteria. Bacterial disulfide catalytic processes have been well characterized in Escherichia coli K-12 and these mechanisms have been extrapolated to other organisms. However, recent research indicates that the K-12 complement of Dsb proteins is not common to all bacteria. Importantly, many pathogenic bacteria have an extended arsenal of Dsb catalysts that is linked to their virulence. To help to elucidate the process of oxidative folding in pathogens containing a wide repertoire of Dsb proteins, Salmonella enterica serovar Typhimurium has been focused on. This Gram-negative bacterium contains three DsbA proteins: SeDsbA, SeDsbL and SeSrgA. Here, the expression, purification, crystallization and preliminary diffraction analysis of these three proteins are reported. SeDsbA, SeDsbL and SeSrgA crystals diffracted to resolution limits of 1.55, 1.57 and 2.6 A and belonged to space groups P2(1), P2(1)2(1)2 and C2, respectively.

  7. Crystallization and preliminary crystallographic analysis of a flavoprotein NADH oxidase from Lactobacillus brevis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuzu, Mutlu; Niefind, Karsten; Hummel, Werner

    2005-05-01

    The water-forming flavoenzyme NADH oxidase was crystallized successfully for the first time. The crystals diffract X-rays to at least 4.0 Å resolution. NADH oxidase (NOX) from Lactobacillus brevis is a homotetrameric flavoenzyme composed of 450 amino acids per subunit. The molecular weight of each monomer is 48.8 kDa. The enzyme catalyzes the oxidation of two equivalents of NADH and reduces one equivalent of oxygen to yield two equivalents of water, without releasing hydrogen peroxide after the reduction of the first equivalent of NADH. Crystals of this protein were grown in the presence of 34% polyethylene glycol monomethyl ether 2000, 0.1more » M sodium acetate and 0.2 M ammonium sulfate at pH 5.4. They belong to the tetragonal space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 74.8, b = 95.7, c = 116.9 Å, α = γ = 90, β = 103.8°. The current diffraction limit is 4.0 Å. The self-rotation function of the native data set is consistent with a NOX tetramer in the asymmetric unit.« less

  8. Diffraction-based optical sensor detection system for capture-restricted environments

    NASA Astrophysics Data System (ADS)

    Khandekar, Rahul M.; Nikulin, Vladimir V.

    2008-04-01

    The use of digital cameras and camcorders in prohibited areas presents a growing problem. Piracy in the movie theaters results in huge revenue loss to the motion picture industry every year, but still image and video capture may present even a bigger threat if performed in high-security locations. While several attempts are being made to address this issue, an effective solution is yet to be found. We propose to approach this problem using a very commonly observed optical phenomenon. Cameras and camcorders use CCD and CMOS sensors, which include a number of photosensitive elements/pixels arranged in a certain fashion. Those are photosites in CCD sensors and semiconductor elements in CMOS sensors. They are known to reflect a small fraction of incident light, but could also act as a diffraction grating, resulting in the optical response that could be utilized to identify the presence of such a sensor. A laser-based detection system is proposed that accounts for the elements in the optical train of the camera, as well as the eye-safety of the people who could be exposed to optical beam radiation. This paper presents preliminary experimental data, as well as the proof-of-concept simulation results.

  9. The purification, crystallization and preliminary diffraction of a glycerophosphodiesterase from Enterobacter aerogenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackson, Colin J.; Carr, Paul D.; Kim, Hye-Kyung

    2006-07-01

    The metallo-glycerophosphodiesterase from E. aerogenes (GpdQ) has been cloned, expressed in E. coli and purified. Initial screening of crystallization conditions for this enzyme resulted in the identification of needles from one condition in a sodium malonate grid screen. Removal of the metals from the enzyme and subsequent optimization of these conditions led to crystals. The metallo-glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) has been cloned, expressed in Escherichia coli and purified. Initial screening of crystallization conditions for this enzyme resulted in the identification of needles from one condition in a sodium malonate grid screen. Removal of the metals from the enzyme andmore » subsequent optimization of these conditions led to crystals that diffracted to 2.9 Å and belonged to space group P2{sub 1}3, with unit-cell parameter a = 164.1 Å. Self-rotation function analysis and V{sub M} calculations indicated that the asymmetric unit contains two copies of the monomeric enzyme, corresponding to a solvent content of 79%. It is intended to determine the structure of this protein utilizing SAD phasing from transition metals or molecular replacement.« less

  10. Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji

    Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less

  11. Single-crystal films of a combination of materials (co-crystal) involving DAST and IR-125 for electro-optic applications

    NASA Astrophysics Data System (ADS)

    Narayanan, A.; Titus, J.; Rajagopalan, H.; Vippa, P.; Thakur, M.

    2006-03-01

    Single-crystal film of DAST (4'-dimethylamino-N-methyl-4-stilbazolium tosylate) has been shown [1] to have exceptionally large electro-optic coefficients (r11 ˜ 770 pm/V at 633 nm). In this report, single crystal film of a combination of materials (co-crystal) involving DAST and a dye molecule IR-125 will be discussed. Modified shear method was used to prepare the co-crystal films. The film has been characterized using polarized optical microscopy, optical absorption spectroscopy and x-ray diffraction. The optical absorption spectrum has two major bands: one at about 350--600 nm corresponding to DAST and the other at about 600-900 nm corresponding to IR-125. The x-ray diffraction results show peaks involving the presence of DAST and IR-125 within the co-crystal film. Since the co-crystal has strong absorption at longer wavelengths it is expected to show higher electro-optic coefficients at longer wavelengths. Preliminary measurements at 1.55 μm indicate a high electro-optic coefficient of the co-crystal film. [1] Swamy, Kutty, Titus, Khatavkar, Thakur, Appl. Phys. Lett. 2004, 85, 4025; Kutty, Thakur, Appl. Phys. Lett. 2005, 87, 191111.

  12. Superoxide reductase from the syphilis spirochete Treponema pallidum: crystallization and structure determination using soft X-rays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santos-Silva, Teresa; Trincão, José; Carvalho, Ana L.

    2005-11-01

    Superoxide reductase is a non-haem iron-containing protein involved in resistance to oxidative stress. The oxidized form of the protein has been crystallized and its three-dimensional structure solved. A highly redundant X-ray diffraction data set was collected on a rotating-anode generator using Cu Kα X-ray radiation. Four Fe atoms were located in the asymmetric unit corresponding to four protein molecules arranged as a dimer of homodimers. Superoxide reductase is a 14 kDa metalloprotein containing a catalytic non-haem iron centre [Fe(His){sub 4}Cys]. It is involved in defence mechanisms against oxygen toxicity, scavenging superoxide radicals from the cell. The oxidized form of Treponemamore » pallidum superoxide reductase was crystallized in the presence of polyethylene glycol and magnesium chloride. Two crystal forms were obtained depending on the oxidizing agents used after purification: crystals grown in the presence of K{sub 3}Fe(CN){sub 6} belonged to space group P2{sub 1} (unit-cell parameters a = 60.3, b = 59.9, c = 64.8 Å, β = 106.9°) and diffracted beyond 1.60 Å resolution, while crystals grown in the presence of Na{sub 2}IrCl{sub 6} belonged to space group C2 (a = 119.4, b = 60.1, c = 65.6 Å, β = 104.9°) and diffracted beyond 1.55 Å. A highly redundant X-ray diffraction data set from the C2 crystal form collected on a copper rotating-anode generator (λ = 1.542 Å) clearly defined the positions of the four Fe atoms present in the asymmetric unit by SAD methods. A MAD experiment at the iron absorption edge confirmed the positions of the previously determined iron sites and provided better phases for model building and refinement. Molecular replacement using the P2{sub 1} data set was successful using a preliminary trace as a search model. A similar arrangement of the four protein molecules could be observed.« less

  13. UV-laser-based longitudinal illuminated diffuser (LID) incorporating diffractive and Lambertian reflectance for the disinfection of beverages

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd

    2010-08-01

    A novel laser beam shaping system was designed to demonstrate the potential of using high power UV laser sources for large scale disinfection of liquids used in the production of food products, such as juices, beer, milk and other beverage types. The design incorporates a patented assembly of optical components including a diffractive beam splitting/shaping element and a faceted pyramidal or conically shaped Lambertian diffuser made from a compression molded PTFE compounds. When properly sintered to an appropriate density, as an example between 1.10 and 1.40 grams per cubic centimeter, the compressed PTFE compounds show a ~99% reflectance at wavelengths ranging from 300 nm to 1500 nm, and a ~98.5% refection of wavelengths from 250 nm to 2000 nm [1]. The unique diffuser configuration also benefits from the fact that the PTFE compounds do not degrade when exposed to ultraviolet radiation as do barium sulfate materials and silver or aluminized mirror coatings [2]. These components are contained within a hermetically sealed quartz tube. Once assembled a laser beam is directed through one end of the tube. This window takes the form of a computer generated diffractive splitter or other diffractive shaper element to split the laser beam into a series of spot beamlets, circular rings or other geometric shapes. As each of the split beamlets or rings cascade downward, they illuminate various points along the tapered PTFE cone or faceted pyramidal form. As they strike the surface they each diffuse in a Lambertian reflectance pattern creating a pseudo-uniform circumferential illuminator along the length of the quartz tube enclosing the assembly. The compact tubular structure termed Longitudinal Illuminated Diffuser (LID) provides a unique UV disinfection source that can be placed within a centrifugal reactor or a pipe based reactor chamber. This paper will review the overall design principle, key component design parameters, preliminary analytic and bench operational testing results.

  14. Purification, crystallization and preliminary X-ray diffraction of human S100A15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boeshans, Karen M.; Wolf, Ronald; Voscopoulos, Christopher

    2006-05-01

    S100 proteins are differentially expressed during epithelial cell maturation, tumorigenesis and inflammation. The novel human S100A15 protein has been cloned, expressed, purified and crystallized in two crystal forms, a triclinic and a monoclinic form, which diffract to 1.7 and 2.0 Å, respectively. Human S100A15 is a novel member of the S100 family of EF-hand calcium-binding proteins and was recently identified in psoriasis, where it is significantly upregulated in lesional skin. The protein is implicated as an effector in calcium-mediated signal transduction pathways. Although its biological function is unclear, the association of the 11.2 kDa S100A15 with psoriasis suggests that itmore » contributes to the pathogenesis of the disease and could provide a molecular target for therapy. To provide insight into the function of S100A15, the protein was crystallized to visualize its structure and to further the understanding of how the many similar calcium-binding mediator proteins in the cell distinguish their cognate target molecules. The S100A15 protein has been cloned, expressed and purified to homogeneity and produced two crystal forms. Crystals of form I are triclinic, with unit-cell parameters a = 33.5, b = 44.3, c = 44.8 Å, α = 71.2, β = 68.1, γ = 67.8° and an estimated two molecules in the asymmetric unit, and diffract to 1.7 Å resolution. Crystals of form II are monoclinic, with unit-cell parameters a = 82.1, b = 33.6, c = 52.2 Å, β = 128.2° and an estimated one molecule in the asymmetric unit, and diffract to 2.0 Å resolution. This structural analysis of the human S100A15 will further aid in the phylogenic comparison between the other members of the S100 protein family, especially the highly homologous paralog S100A7.« less

  15. Angle-resolved diffraction grating biosensor based on porous silicon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lv, Changwu; Li, Peng; Jia, Zhenhong, E-mail: jzhh@xju.edu.cn

    2016-03-07

    In this study, an optical biosensor based on a porous silicon composite structure was fabricated using a simple method. This structure consists of a thin, porous silicon surface diffraction grating and a one-dimensional porous silicon photonic crystal. An angle-resolved diffraction efficiency spectrum was obtained by measuring the diffraction efficiency at a range of incident angles. The angle-resolved diffraction efficiency of the 2nd and 3rd orders was studied experimentally and theoretically. The device was sensitive to the change of refractive index in the presence of a biomolecule indicated by the shift of the diffraction efficiency spectrum. The sensitivity of this sensormore » was investigated through use of an 8 base pair antifreeze protein DNA hybridization. The shifts of the angle-resolved diffraction efficiency spectrum showed a relationship with the change of the refractive index, and the detection limit of the biosensor reached 41.7 nM. This optical device is highly sensitive, inexpensive, and simple to fabricate. Using shifts in diffraction efficiency spectrum to detect biological molecules has not yet been explored, so this study establishes a foundation for future work.« less

  16. Light diffraction studies of single muscle fibers as a function of fiber rotation.

    PubMed Central

    Gilliar, W G; Bickel, W S; Bailey, W F

    1984-01-01

    Light diffraction patterns from single glycerinated frog semitendinosus muscle fibers were examined photographically and photoelectrically as a function of diffraction angle and fiber rotation. The total intensity diffraction pattern indicates that the order maxima change both position and intensity periodically as a function of rotation angle. The total diffracted light, light diffracted above and below the zero-order plane, and light diffracted into individual orders gives information about the fiber's longitudinal and rotational structure and its noncylindrical symmetry. Images FIGURE 2 PMID:6611174

  17. Structural characterization and physicochemical features of new hybrid compound containing chlorate anions of cadmate (II)

    NASA Astrophysics Data System (ADS)

    Lassoued, Mohamed Saber; Abdelbaky, Mohammed S. M.; Lassoued, Abdelmajid; Gadri, Abdellatif; Ammar, Salah; Ben Salah, Abdelhamid; García-Granda, Santiago

    2017-08-01

    The present paper reports the synthesis of a single crystal of a new organic-inorganic hybrid compound, with the formula (C6H14N2) CdCl4·H2O, by slow evaporation method at room temperature. It was characterized by single crystal X-ray diffraction (SCXRD), powder X-ray diffraction (PXRD), Hirshfeld surface, spectroscopy measurement, thermal study and photoluminescence (PL) properties. A preliminary SCXRD structural analysis revealed that it crystallized in the monoclinic system (space group P21/c) with the following unit cell parameters: a = 12.95823(16) Å, b = 14.92449(16) Å, c = 7.13838(9) Å and β = 103.2108(12)° with Z = 4. The refinement converged to R = 0.0164 and ωR = 0.0393. Its atomic arrangement can be described as an alternation of organic and inorganic layers along the a-axis. The crystal packing was governed by the N-H⋯Cl and O-H⋯Cl hydrogen bonding interaction between the 1.2-diammoniumcyclohexane cations, the [CdCl42n-]n anions and water molecule. The Hirshfeld surface analysis was conducted to investigate intermolecular interactions and associated 2D fingerprint plots, revealing the relative contribution of these interactions in the crystal structure quantitatively. Furthermore, the room temperature infrared (IR) spectrum of the title compound was recorded and analyzed on the basis of data found in the literature. Besides, the thermal analysis studies were performed, but no phase transition was found in the temperature range between 30 and 450 °C. The optical and PL properties of the compound were investigated in the solid state at room temperature and exhibited three bands at 225, 268 and 315 nm and a strong fluorescence at 443 nm.

  18. Adjustable Focus Optical Correction Lens (AFOCL)

    NASA Technical Reports Server (NTRS)

    Peters, Bruce R.

    2001-01-01

    This report describes the activities and accomplishments along with the status of the characterization of a PLZT-based Adjustable Focus Optical Correction Lens (AFOCL) test device. The activities described in this report were undertaken by members of the Center for Applied Optics (CAO) at the University of Alabama in Huntsville (UAH) under NASA Contract NAS8-00188. The effort was led by Dr. Bruce Peters as the Principal Investigator and supported by Dr. Patrick Reardon, Ms. Deborah Bailey, and graduate student Mr. Jeremy Wong. The activities outlined for the first year of the contract were to identify vendors and procure a test device along with performing the initial optical characterization of the test device. This activity has been successfully executed and test results are available and preliminary information was published at the SPIE Photonics West Conference in San Jose, January 2001. The paper, "Preliminary investigation of an active PLZT lens," was well received and generated response with several questions from the audience. A PLZT test device has been commercially procured from an outside vendor: The University of California in San Diego (UCSD) in partnership with New Interconnect Packaging Technologies (NIPT) Inc. The device has been subjected to several tests to characterize the optical performance of the device at wavelengths of interest. The goal was to evaluate the AFOCL similar to a conventional lens and measure any optical aberrations present due to the PLZT material as a deviation in the size of the diffraction limited spot (blur), the presence of diffracted energy into higher orders surrounding the focused spot (a variation in Strehl), and/or a variation or spread in the location of the focused energy away from the optical axis (a bias towards optical wedge, spherical, comma, or other higher order aberrations). While data has been collected indicative of the imaging quality of the AFOCL test device, it was not possible to fully characterize the optical performance of the AFOCL alone because there were significant optical distortions due to fabrication related issues.

  19. A preliminary study on the potency of nanofluids as the electro-active materials for nanoelectrofuel flow batteries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kristiawan, B., E-mail: budi-k@uns.ac.id; Wijayanta, A. T., E-mail: agungtw@uns.ac.id; Juwana, W. E., E-mail: wibawa.ej@gmail.com

    2016-03-29

    This study presents a characterization of nanofluids as electroactive materials with dispersing metal oxide nanoparticles into aqueous polyelectrolytes of 20 wt.%, in particular, their electrochemical activites. The fundamental characterizations including X-ray diffraction, transmission electron microscopy, and Fourier ttransform iinfrared measurement were performed to ensure metal oxide component used in this work. Alumina (Al{sub 2}O{sub 3}) and copper oxide (CuO) nanoparticles of 0.5 vol.% in volume fraction were dispersed into Poly(diallyldimethylammonium chloride) solution (PDADMAC) and Poly(sodium 4-styrenesulfonate) (PSS), respectively. Alumina and copper oxide nanoparticles were dispersed into ionic solution with volume fraction of 0.5 vol.% by using two-step method. The generalmore » cyclic voltammetry measurement was used to analyze electrochemical behavior within three-electrode cell setup. The results show that PSS-based nanofluids demonstrate redox process. However, unclearly redox phenomenon was depicted PDADMAC-based nanofluids. Dispersing nanoparticles could shift pure ionic solution’s cyclic profile. It is clear that a significant impact on electrochemical behavior can be provided because of the existence metal oxide nanoparticles into polyelectrolyte solution.« less

  20. Facile approach to synthesize magnesium oxide nanoparticles by using Clitoria ternatea—characterization and in vitro antioxidant studies

    NASA Astrophysics Data System (ADS)

    John Sushma, N.; Prathyusha, D.; Swathi, G.; Madhavi, T.; Deva Prasad Raju, B.; Mallikarjuna, K.; Kim, Hak-Sung

    2016-03-01

    Facile approach to synthesize the metal oxide nanoparticles is getting an increased attention in various biomedical applications such as, to treat antibiotic resistant diseases. Magnesium oxide nanoparticles (MgO·NPs) were synthesized by using Clitoria ternatea as the stabilizer in a green synthesis approach. The preliminary screening of MgO·NPs in the presence of C. ternatea extract was observed by UV-visible spectrophotometer. X-ray diffraction (XRD) pattern have proved the crystalline nature of the MgO·NPs; Photoluminescence (PL) measurement studies are used to identify the quality and defects in the crystal structure. FE-SEM with EDS has showed the size of 50-400 nm with specific binding energies. FT-IR has revealed the functional groups present in the plant extract and the peak at 521 cm-1 indicated the characteristic absorption bands of MgO·NPs. The DPPH activity and reducing power assay of biologically synthesized MgO·NPs could reach 65 % at a concentration of 150 µg/ml, respectively. From the results it was concluded that the biologically synthesized MgO·NPs exhibit good antioxidant activity.

  1. Generation of conductivity through transfer charge properties, for polyesters and polyamides with characteristic functional groups

    NASA Astrophysics Data System (ADS)

    Gonzalez, Carmen; Tagle, Luis Hernan; Terraza, Claudio A.; Barriga, Andres; Cabrera, A. L.; Volkmann, Ulrich G.

    2011-03-01

    Electro-optic properties of σ -conjugated polymers, as polysilylene; are associated with electron conjugation in the silicon atom, which allows a significant delocalization of electrons along of the chain. Thus, the conductivity is intimately connected to the mobility of charge carriers, which in turn depends on the structure and morphology of the system. We report the characterization of polyesters (PEFs) and polyamides (PAFs). Film thicknesses were obtained by ellipsometry. The vibration frequencies of the groups were determined by FT-IR and corroborated by Raman spectroscopy. Structural information was obtained from X-Ray diffraction (XRD). The structural and surface morphology were studied by scanning electron microscope (SEM). Electrical conductivity of the polymers was measured before and after exposure to iodine vapor, for films of different thicknesses. Morphological differentiation was studied by energy dispersive microscopy (EDX), showing a regular distribution of iodine within the polymer. Preliminary conductivity measurements showed adverse effects when oxidation of the polymer films is induced These effects are related to a certain grade of disorder within the system

  2. Experimental determination of thermal turbulence effects on a propagating laser beam

    NASA Astrophysics Data System (ADS)

    Ndlovu, Sphumelele C.; Chetty, Naven

    2015-08-01

    The effect of turbulence on propagating laser beams has been a subject of interest since the evolution of lasers back in 1959. In this work, an inexpensive and reliable technique for producing interferograms using a point diffraction interferometer (PDI) was considered to experimentally study the turbulence effects on a laser beam propagating through air. The formed interferograms from a propagating beamwere observed and digitally processed to study the strength of atmospheric turbulence. This technique was found to be sensitive enough to detect changes in applied temperature with distance between the simulated turbulence and laser path. These preliminary findings indicated that we can use a PDI method to detect and localise atmospheric turbulence parameters. Such parameters are very important for use in the military (defence laser weapons) and this is vital for South Africa (SA) since it has natural resources, is involved in peace keeping and mediation for other countries, and hence must have a strong defence system that will be able to locate, detect and destroy incoming missiles and other threatening atmospheric systems in order to protect its environment and avoid the initiation of countermeasures on its land.

  3. High pressure studies using two-stage diamond micro-anvils grown by chemical vapor deposition

    DOE PAGES

    Vohra, Yogesh K.; Samudrala, Gopi K.; Moore, Samuel L.; ...

    2015-06-10

    Ultra-high static pressures have been achieved in the laboratory using a two-stage micro-ball nanodiamond anvils as well as a two-stage micro-paired diamond anvils machined using a focused ion-beam system. The two-stage diamond anvils’ designs implemented thus far suffer from a limitation of one diamond anvil sliding past another anvil at extreme conditions. We describe a new method of fabricating two-stage diamond micro-anvils using a tungsten mask on a standard diamond anvil followed by microwave plasma chemical vapor deposition (CVD) homoepitaxial diamond growth. A prototype two stage diamond anvil with 300 μm culet and with a CVD diamond second stage ofmore » 50 μm in diameter was fabricated. We have carried out preliminary high pressure X-ray diffraction studies on a sample of rare-earth metal lutetium sample with a copper pressure standard to 86 GPa. Furthermore, the micro-anvil grown by CVD remained intact during indentation of gasket as well as on decompression from the highest pressure of 86 GPa.« less

  4. Crystallization and preliminary crystallographic studies of Hyp-1, a St John’s wort protein implicated in the biosynthesis of hypericin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fernandes, Humberto; Konieczna, Malgorzata; Kolodziejczyk, Robert

    2008-05-01

    The Hyp-1 protein suggested to be a phenolic oxidative-coupling enzyme involved in the biosynthesis of hypericin, a medicinally important natural compound found in St John’s wort (H. perforatum), has been expressed, purified and prepared in single-crystal form. According to a debated hypothesis, the biosynthesis from emodin of the medicinally important natural compound hypericin is catalyzed in St John’s wort (Hypericum perforatum) by the phenolic oxidative-coupling protein Hyp-1. Recombinant St John’s wort Hyp-1 has been overexpressed in Escherichia coli and obtained in single-crystal form. The crystals belong to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters amore » = 37.5, b = 76.7, c = 119.8 Å, contain two protein molecules in the asymmetric unit and diffract X-rays to 1.73 Å resolution.« less

  5. Production and characterization of europium doped sol-gel yttrium oxide

    NASA Astrophysics Data System (ADS)

    Krebs, J. K.; Hobson, Christopher; Silversmith, Ann

    2004-03-01

    Sol-gel produced materials have recently gained attention for their use in producing nanoscale dielectric materials for confinement studies. Lanthanide impurities in the dielectric enable experimenters to optically probe the structure and dynamic properties of the nanoparticle hosts. We report on an alkoxide sol-gel production method used to produce trivalent europium doped yttrium oxide. Our process follows the standard hydrolysis of an alkoxide precursor with water containing the lanthanide ions. The sol is then aged and calcined at 800 ^oC to produce the powder samples. X-ray diffraction confirms the structure of the powder is that of Y_2O_3. The emission and excitation of the europium impurities is consistent with that of europium doped single crystal yttrium oxide, where it is known that the europium ions substitute for yttrium in the lattice. We therefore conclude that the sol-gel process enables the incorporation of europium ions into the yttrium oxide structure at temperatures far below the melting temperature. The results of preliminary dynamics measurements will also be discussed.

  6. Purification, characterization and preliminary crystallographic studies of a cysteine protease from Pachyrrhizus erosus seeds.

    PubMed

    Chang, Shaojie; Song, Xiaomin; Yan, Ming; Zhou, Zhaocai; Wu, Fang; Gong, Weimin

    2004-01-01

    The proteins Spe31 and Spe32, named after their respective molecular weights of about 31 and 32 kDa, were purified simultaneously from the seeds of Pachyrrhizus erosus. They cannot be separated from each other by column chromatography. N-terminal sequence analysis indicated that they belonged to the papain family of cysteine proteases. An in-gel activity assay revealed that Spe31 possesses proteolytic activity while Spe32 only displays very weak activity for protein degradation. Both of them are glycoproteins as detected by the periodic acid and Schiff's reagent method. Crystals were obtained from the protein mixture by the hanging-drop vapour-diffusion method; they diffracted to a resolution of 2.61 A on an in-house X-ray source. The crystals belong to space group P4(1(3))2(1)2, with unit-cell parameters a = b = 61.96, c = 145.61 A. Gel electrophoresis under non-denaturing conditions showed that the protein crystallized was Spe31.

  7. Expression, purification, crystallization and preliminary X-ray crystallographic analysis of a resuscitation-promoting factor from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ruggiero, Alessia; Tizzano, Barbara; Geerlof, Arie

    2007-10-01

    The first crystallization of a resuscitation-promoting factor has been performed. Multiwavelength anomalous dispersion experiments have been carried out to obtain experimental phases using data at 2.9 Å resolution from a selenomethionine derivative. The resuscitation-promoting factor RpfB, the most complex of the five resuscitation-promoting factors produced by M. tuberculosis, is devoted to bacterial reactivation from the dormant state. RpfB consists of 362 residues predicted to form five domains. An RpfB fragment containing the protein catalytic domain and a G5 domain has been successfully crystallized using vapour-diffusion methods. This is the first crystallographic study of a resuscitation-promoting factor. Crystals of this proteinmore » belong to space group I422, with unit-cell parameters a = 97.63, b = 97.63, c = 114.87 Å. Diffraction data have also been collected from a selenomethionine derivative at 2.9 Å resolution. Model building using the phases derived from the multiwavelength anomalous dispersion experiment is in progress.« less

  8. Purification, crystallization and preliminary X-ray analysis of the inverse F-BAR domain of the human srGAP2 protein.

    PubMed

    Wang, Hongpeng; Zhang, Yan; Zhang, Zhenyi; Jin, Wei Lin; Wu, Geng

    2014-01-01

    Bin-Amphiphysin-Rvs (BAR) domain proteins play essential roles in diverse cellular processes by inducing membrane invaginations or membrane protrusions. Among the BAR superfamily, the `classical' BAR and Fes/CIP4 homology BAR (F-BAR) subfamilies of proteins usually promote membrane invaginations, whereas the inverse BAR (I-BAR) subfamily generally incur membrane protrusions. Despite possessing an N-terminal F-BAR domain, the srGAP2 protein regulates neurite outgrowth and neuronal migration by causing membrane protrusions reminiscent of the activity of I-BAR domain proteins. In this study, the inverse F-BAR (IF-BAR) domain of human srGAP2 was overexpressed, purified and crystallized. The crystals of the srGAP2 IF-BAR domain protein diffracted to 3.50 Å resolution and belonged to space group P2(1). These results will facilitate further structural determination of the srGAP2 IF-BAR domain and the ultimate elucidation of its peculiar behaviour of inducing membrane protrusions rather than membrane invaginations.

  9. Expression, purification and preliminary X-ray analysis of the C-terminal domain of an arginine repressor protein from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, George J.; Garen, Craig R.; Cherney, Maia M.

    2007-11-01

    The C-terminal portion of the arginine repressor protein from M. tuberculosis H37Rv has been crystallized. The complete transcriptional factor regulates arginine biosynthesis by binding operator DNA when arginine is bound at the C-terminal domain. The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 Å. The crystals belong to space group P1 and themore » Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of six molecules per unit cell.« less

  10. Crystallization and preliminary X-ray analysis of membrane-bound pyrophosphatases.

    PubMed

    Kellosalo, Juho; Kajander, Tommi; Honkanen, Riina; Goldman, Adrian

    2013-02-01

    Membrane-bound pyrophosphatases (M-PPases) are enzymes that enhance the survival of plants, protozoans and prokaryotes in energy constraining stress conditions. These proteins use pyrophosphate, a waste product of cellular metabolism, as an energy source for sodium or proton pumping. To study the structure and function of these enzymes we have crystallized two membrane-bound pyrophosphatases recombinantly produced in Saccharomyces cerevisae: the sodium pumping enzyme of Thermotoga maritima (TmPPase) and the proton pumping enzyme of Pyrobaculum aerophilum (PaPPase). Extensive crystal optimization has allowed us to grow crystals of TmPPase that diffract to a resolution of 2.6 Å. The decisive step in this optimization was in-column detergent exchange during the two-step purification procedure. Dodecyl maltoside was used for high temperature solubilization of TmPPase and then exchanged to a series of different detergents. After extensive screening, the new detergent, octyl glucose neopentyl glycol, was found to be the optimal for TmPPase but not PaPPase.

  11. High-contrast Imager for Complex Aperture Telescopes (HICAT): II. Design overview and first light results

    NASA Astrophysics Data System (ADS)

    N'Diaye, Mamadou; Choquet, Elodie; Egron, Sylvain; Pueyo, Laurent; Leboulleux, Lucie; Levecq, Olivier; Perrin, Marshall D.; Elliot, Erin; Wallace, J. Kent; Hugot, Emmanuel; Marcos, Michel; Ferrari, Marc; Long, Chris A.; Anderson, Rachel; DiFelice, Audrey; Soummer, Rémi

    2014-08-01

    We present a new high-contrast imaging testbed designed to provide complete solutions in wavefront sensing, control and starlight suppression with complex aperture telescopes. The testbed was designed to enable a wide range of studies of the effects of such telescope geometries, with primary mirror segmentation, central obstruction, and spiders. The associated diffraction features in the point spread function make high-contrast imaging more challenging. In particular the testbed will be compatible with both AFTA-like and ATLAST-like aperture shapes, respectively on-axis monolithic, and on-axis segmented telescopes. The testbed optical design was developed using a novel approach to define the layout and surface error requirements to minimize amplitude­ induced errors at the target contrast level performance. In this communication we compare the as-built surface errors for each optic to their specifications based on end-to-end Fresnel modelling of the testbed. We also report on the testbed optical and optomechanical alignment performance, coronagraph design and manufacturing, and preliminary first light results.

  12. Preliminary study on the mode of occurrence of arsenic in high arsenic coals from southwest Guizhou Province

    USGS Publications Warehouse

    Ding, Z.; Zheng, B.; Zhang, Jiahua; Belkin, H.E.; Finkelman, R.B.; Zhao, F.; Zhou, D.; Zhou, Y.; Chen, C.

    1999-01-01

    Coal samples from high arsenic coal areas have been analyzed by electron microprobe analyzer (EMPA), scanning electron microscopy with an energy dispersive X-ray analyzer (SEM-EDX), X-ray diffraction analysis (XRD), low temperature ashing (LTA), transmission electron microscopy (TEM), X-ray absorption fine structure (XAFS), instrument neutron activation analysis (INAA) and wet chemical analysis. Although some As-bearing minerals such as pyrite, arsenopyrite, realgar (?), As-bearing sulfate, and As-bearing clays are found in the high arsenic coals, their contents do not account for the abundance of arsenic in the some coals. Analysis of the coal indicates that arsenic exists mainly in the form of As5+ and As3+, combined with compounds in the organic matrix. The occurrence of such exceptionally high arsenic contents in coal and the fact that the arsenic is dominantly organically associated are unique observations. The modes of occurrence of arsenic in high As-coals are discussed.

  13. The infrared imaging spectrograph (IRIS) for TMT: latest science cases and simulations

    NASA Astrophysics Data System (ADS)

    Wright, Shelley A.; Walth, Gregory; Do, Tuan; Marshall, Daniel; Larkin, James E.; Moore, Anna M.; Adamkovics, Mate; Andersen, David; Armus, Lee; Barth, Aaron; Cote, Patrick; Cooke, Jeff; Chisholm, Eric M.; Davidge, Timothy; Dunn, Jennifer S.; Dumas, Christophe; Ellerbroek, Brent L.; Ghez, Andrea M.; Hao, Lei; Hayano, Yutaka; Liu, Michael; Lopez-Rodriguez, Enrique; Lu, Jessica R.; Mao, Shude; Marois, Christian; Pandey, Shashi B.; Phillips, Andrew C.; Schoeck, Matthias; Subramaniam, Annapurni; Subramanian, Smitha; Suzuki, Ryuji; Tan, Jonathan C.; Terai, Tsuyoshi; Treu, Tommaso; Simard, Luc; Weiss, Jason L.; Wincentsen, James; Wong, Michael; Zhang, Kai

    2016-07-01

    The Thirty Meter Telescope (TMT) first light instrument IRIS (Infrared Imaging Spectrograph) will complete its preliminary design phase in 2016. The IRIS instrument design includes a near-infrared (0.85 - 2.4 micron) integral field spectrograph (IFS) and imager that are able to conduct simultaneous diffraction-limited observations behind the advanced adaptive optics system NFIRAOS. The IRIS science cases have continued to be developed and new science studies have been investigated to aid in technical performance and design requirements. In this development phase, the IRIS science team has paid particular attention to the selection of filters, gratings, sensitivities of the entire system, and science cases that will benefit from the parallel mode of the IFS and imaging camera. We present new science cases for IRIS using the latest end-to-end data simulator on the following topics: Solar System bodies, the Galactic center, active galactic nuclei (AGN), and distant gravitationally-lensed galaxies. We then briefly discuss the necessity of an advanced data management system and data reduction pipeline.

  14. The predicted secondary structures of class I fructose-bisphosphate aldolases.

    PubMed Central

    Sawyer, L; Fothergill-Gilmore, L A; Freemont, P S

    1988-01-01

    The results of several secondary-structure prediction programs were combined to produce an estimate of the regions of alpha-helix, beta-sheet and reverse turns for fructose-bisphosphate aldolases from human and rat muscle and liver, from Trypanosoma brucei and from Drosophila melanogaster. All the aldolase sequences gave essentially the same pattern of secondary-structure predictions despite having sequences up to 50% different. One exception to this pattern was an additional strongly predicted helix in the rat liver and Drosophila enzymes. Regions of relatively high sequence variation generally were predicted as reverse turns, and probably occur as surface loops. Most of the positions corresponding to exon boundaries are located between regions predicted to have secondary-structural elements consistent with a compact structure. The predominantly alternating alpha/beta structure predicted is consistent with the alpha/beta-barrel structure indicated by preliminary high-resolution X-ray diffraction studies on rabbit muscle aldolase [Sygusch, Beaudry & Allaire (1986) Biophys. J. 49, 287a]. Images Fig. 1. (cont.) Fig. 1. PMID:3128269

  15. Crystallization and preliminary X-ray characterization of the genetically encoded fluorescent calcium indicator protein GCaMP2

    PubMed Central

    Rodríguez Guilbe, María M.; Alfaro Malavé, Elisa C.; Akerboom, Jasper; Marvin, Jonathan S.; Looger, Loren L.; Schreiter, Eric R.

    2008-01-01

    Fluorescent proteins and their engineered variants have played an important role in the study of biology. The genetically encoded calcium-indicator protein GCaMP2 comprises a circularly permuted fluorescent protein coupled to the calcium-binding protein calmodulin and a calmodulin target peptide, M13, derived from the intracellular calmodulin target myosin light-chain kinase and has been used to image calcium transients in vivo. To aid rational efforts to engineer improved variants of GCaMP2, this protein was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 126.1, b = 47.1, c = 68.8 Å, β = 100.5° and one GCaMP2 molecule in the asymmetric unit. The structure was phased by molecular replacement and refinement is currently under way. PMID:18607093

  16. Crystallization and preliminary X-ray crystallographic analysis of a highly specific serpin from the beetle Tenebrio molitor

    PubMed Central

    Park, Sun Hee; Piao, Shunfu; Kwon, Hyun-Mi; Kim, Eun-Hye; Lee, Bok Luel; Ha, Nam-Chul

    2010-01-01

    The Toll signalling pathway, which is crucial for innate immunity, is transduced in insect haemolymph via a proteolytic cascade consisting of three serine proteases. The proteolytic cascade is downregulated by a specific serine protease inhibitor (serpin). Recently, the serpin SPN48 was found to show an unusual specific reactivity towards the terminal serine protease, Spätzle-processing enzyme, in the beetle Tenebrio molitor. In this study, the mature form of SPN48 was overexpressed in Escherichia coli and purified. The purified SPN48 protein was crystallized using 14% polyethylene glycol 8000 and 0.1 M 2-(N-morpho­lino)ethanesulfonic acid pH 6.0 as the precipitant. The crystals diffracted X-rays to 2.1 Å resolution and were suitable for structure determination. The crystals belonged to space group P21. The crystal structure will provide information regarding how SPN48 achieves its unusual specificity for its target protease. PMID:20124722

  17. Structural analysis and antimicrobial activity of 2[1H]-pyrimidinethione/selenone derivatives

    NASA Astrophysics Data System (ADS)

    Żesławska, Ewa; Korona-Głowniak, Izabela; Szczesio, Małgorzata; Olczak, Andrzej; Żylewska, Alicja; Tejchman, Waldemar; Malm, Anna

    2017-08-01

    Four new crystal structures of sulfur and selenium analogues of 2[1H]-pyrimidinone derivatives were determined with the use of X-ray diffraction method. The molecular geometry and intermolecular interactions of the investigated molecules were analyzed in order to find the structural features and geometrical parameters, which can be responsible for antimicrobial activities. The influence of chalcogen substituents (sulfur and selenium) on the crystal packing was also studied. The main differences in the molecular structures exist in mutual arrangement of two aromatic rings. The intermolecular interactions in all investigated compounds are similar. Furthermore, the in vitro antibacterial and antifungal activities for these compounds were evaluated. Preliminary investigations have identified two highly potent antibacterial compounds containing selenium atom, which display selectivity towards staphylococci and micrococci. This selectivity was not observed for a control compound used as a drug, namely vancomycin. These compounds possess also good antifungal activity. This is the first report of biological activities of 2[1H]-pyrimidineselenone derivatives.

  18. Ultrafast electron diffraction optimized for studying structural dynamics in thin films and monolayers

    PubMed Central

    Badali, D. S.; Gengler, R. Y. N.; Miller, R. J. D.

    2016-01-01

    A compact electron source specifically designed for time-resolved diffraction studies of free-standing thin films and monolayers is presented here. The sensitivity to thin samples is achieved by extending the established technique of ultrafast electron diffraction to the “medium” energy regime (1–10 kV). An extremely compact design, in combination with low bunch charges, allows for high quality diffraction in a lensless geometry. The measured and simulated characteristics of the experimental system reveal sub-picosecond temporal resolution, while demonstrating the ability to produce high quality diffraction patterns from atomically thin samples. PMID:27226978

  19. Trace elemental analysis of Indian natural moonstone gems by PIXE and XRD techniques.

    PubMed

    Venkateswara Rao, R; Venkateswarulu, P; Kasipathi, C; Sivajyothi, S

    2013-12-01

    A selected number of Indian Eastern Ghats natural moonstone gems were studied with a powerful nuclear analytical and non-destructive Proton Induced X-ray Emission (PIXE) technique. Thirteen elements, including V, Co, Ni, Zn, Ga, Ba and Pb, were identified in these moonstones and may be useful in interpreting the various geochemical conditions and the probable cause of their inceptions in the moonstone gemstone matrix. Furthermore, preliminary XRD studies of different moonstone patterns were performed. The PIXE technique is a powerful method for quickly determining the elemental concentration of a substance. A 3MeV proton beam was employed to excite the samples. The chemical constituents of moonstones from parts of the Eastern Ghats geological formations of Andhra Pradesh, India were determined, and gemological studies were performed on those gems. The crystal structure and the lattice parameters of the moonstones were estimated using X-Ray Diffraction studies, trace and minor elements were determined using the PIXE technique, and major compositional elements were confirmed by XRD. In the present work, the usefulness and versatility of the PIXE technique for research in geo-scientific methodology is established. © 2013 Elsevier Ltd. All rights reserved.

  20. Resolution enhancement by extrapolation of coherent diffraction images: a quantitative study on the limits and a numerical study of nonbinary and phase objects.

    PubMed

    Latychevskaia, T; Chushkin, Y; Fink, H-W

    2016-10-01

    In coherent diffractive imaging, the resolution of the reconstructed object is limited by the numerical aperture of the experimental setup. We present here a theoretical and numerical study for achieving super-resolution by postextrapolation of coherent diffraction images, such as diffraction patterns or holograms. We demonstrate that a diffraction pattern can unambiguously be extrapolated from only a fraction of the entire pattern and that the ratio of the extrapolated signal to the originally available signal is linearly proportional to the oversampling ratio. Although there could be in principle other methods to achieve extrapolation, we devote our discussion to employing iterative phase retrieval methods and demonstrate their limits. We present two numerical studies; namely, the extrapolation of diffraction patterns of nonbinary and that of phase objects together with a discussion of the optimal extrapolation procedure. © 2016 The Authors Journal of Microscopy © 2016 Royal Microscopical Society.

  1. Dynamic diffraction artefacts in Bragg coherent diffractive imaging

    DOE PAGES

    Hu, Wen; Huang, Xiaojing; Yan, Hanfei

    2018-02-01

    This article reports a theoretical study on the reconstruction artefacts in Bragg coherent diffractive imaging caused by dynamical diffraction effects. It is shown that, unlike the absorption and refraction effects that can be corrected after reconstruction, dynamical diffraction effects have profound impacts on both the amplitude and the phase of the reconstructed complex object, causing strong artefacts. At the dynamical diffraction limit, the reconstructed shape is no longer correct, as a result of the strong extinction effect. Simulations for hemispherical particles of different sizes show the type, magnitude and extent of the dynamical diffraction artefacts, as well as the conditionsmore » under which they are negligible.« less

  2. Dynamic diffraction artefacts in Bragg coherent diffractive imaging.

    PubMed

    Hu, Wen; Huang, Xiaojing; Yan, Hanfei

    2018-02-01

    This article reports a theoretical study on the reconstruction artefacts in Bragg coherent diffractive imaging caused by dynamical diffraction effects. It is shown that, unlike the absorption and refraction effects that can be corrected after reconstruction, dynamical diffraction effects have profound impacts on both the amplitude and the phase of the reconstructed complex object, causing strong artefacts. At the dynamical diffraction limit, the reconstructed shape is no longer correct, as a result of the strong extinction effect. Simulations for hemispherical particles of different sizes show the type, magnitude and extent of the dynamical diffraction artefacts, as well as the conditions under which they are negligible.

  3. Dynamic diffraction artefacts in Bragg coherent diffractive imaging

    PubMed Central

    Yan, Hanfei

    2018-01-01

    This article reports a theoretical study on the reconstruction artefacts in Bragg coherent diffractive imaging caused by dynamical diffraction effects. It is shown that, unlike the absorption and refraction effects that can be corrected after reconstruction, dynamical diffraction effects have profound impacts on both the amplitude and the phase of the reconstructed complex object, causing strong artefacts. At the dynamical diffraction limit, the reconstructed shape is no longer correct, as a result of the strong extinction effect. Simulations for hemispherical particles of different sizes show the type, magnitude and extent of the dynamical diffraction artefacts, as well as the conditions under which they are negligible. PMID:29507549

  4. X-ray diffraction on radioactive materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schiferl, D.; Roof, R.B.

    1978-01-01

    X-ray diffraction studies on radioactive materials are discussed with the aim of providing a guide to new researchers in the field. Considerable emphasis is placed on the safe handling and loading of not-too-exotic samples. Special considerations such as the problems of film blackening by the gamma rays and changes induced by the self-irradiation of the sample are covered. Some modifications of common diffraction techniques are presented. Finally, diffraction studies on radioactive samples under extreme conditions are discussed, with primary emphasis on high-pressure studies involving diamond-anvil cells.

  5. First global next-to-leading order determination of diffractive parton distribution functions and their uncertainties within the xFitter framework

    NASA Astrophysics Data System (ADS)

    Goharipour, Muhammad; Khanpour, Hamzeh; Guzey, Vadim

    2018-04-01

    We present GKG18-DPDFs, a next-to-leading order (NLO) QCD analysis of diffractive parton distribution functions (diffractive PDFs) and their uncertainties. This is the first global set of diffractive PDFs determined within the xFitter framework. This analysis is motivated by all available and most up-to-date data on inclusive diffractive deep inelastic scattering (diffractive DIS). Heavy quark contributions are considered within the framework of the Thorne-Roberts (TR) general mass variable flavor number scheme (GM-VFNS). We form a mutually consistent set of diffractive PDFs due to the inclusion of high-precision data from H1/ZEUS combined inclusive diffractive cross sections measurements. We study the impact of the H1/ZEUS combined data by producing a variety of determinations based on reduced data sets. We find that these data sets have a significant impact on the diffractive PDFs with some substantial reductions in uncertainties. The predictions based on the extracted diffractive PDFs are compared to the analyzed diffractive DIS data and with other determinations of the diffractive PDFs.

  6. Preliminary X-ray diffraction analysis of CfaA, a molecular chaperone essential for the assembly of CFA/I fimbriae of human enterotoxigenic Escherichia coli.

    PubMed

    Bao, Rui; Esser, Lothar; Poole, Steven; McVeigh, Annette; Chen, Yu Xing; Savarino, Stephen J; Xia, Di

    2014-02-01

    Understanding of pilus bioassembly in Gram-negative bacteria stems mainly from studies of P pili and type 1 fimbriae of uropathogenic Escherichia coli, which are mediated by the classic chaperone-usher pathway (CUP). However, CFA/I fimbriae, a class 5 fimbria and intestinal colonization factor for enterotoxigenic E. coli (ETEC), are proposed to assemble via the alternate chaperone pathway (ACP). Both CUP and ACP fimbrial bioassembly pathways require the function of a periplasmic chaperone, but their corresponding proteins share very low similarity in primary sequence. Here, the crystallization of the CFA/I periplasmic chaperone CfaA by the hanging-drop vapor-diffusion method is reported. X-ray diffraction data sets were collected from a native CfaA crystal to 2 Å resolution and to 1.8 and 2.8 Å resolution, respectively, from a lead and a platinum derivative. These crystals displayed the symmetry of space group C2, with unit-cell parameters a = 103.6, b = 28.68, c = 90.60 Å, β = 119.7°. Initial phases were derived from multiple isomorphous replacement with anomalous scattering experiments using the data from the platinum and lead derivatives. This resulted in an interpretable electron-density map showing one CfaA molecule in an asymmetric unit. Sequence assignments were aided by anomalous signals from the heavy-atom derivatives. Refinement of the atomic model of CfaA is ongoing, which is expected to further understanding of the essential aspects and allowable variations in tertiary structure of the greater family of chaperones involved in chaperone-usher mediated bioassembly.

  7. Electron paramagnetic resonance, scanning electron microscopy with energy dispersion X-ray spectrometry, X-ray powder diffraction, and NMR characterization of iron-rich fired clays.

    PubMed

    Presciutti, Federica; Capitani, Donatella; Sgamellotti, Antonio; Brunetti, Brunetto Giovanni; Costantino, Ferdinando; Viel, Stéphane; Segre, Annalaura

    2005-12-01

    The aim of this study is to clarify the structure of an iron-rich clay and the structural changes involved in the firing process as a preliminary step to get information on ancient ceramic technology. To this purpose, illite-rich clay samples fired at different temperatures were characterized using a multitechnique approach, i.e., by electron paramagnetic resonance, scanning electron microscopy with electron dispersion X-ray spectrometry, X-ray powder diffraction, magic angle spinning and multiple quantum magic angle spinning NMR. During firing, four main reaction processes occur: dehydration, dehydroxylation, structural breakdown, and recrystallization. When the results are combined from all characterization methods, the following conclusions could be obtained. Interlayer H2O is located close to aluminum in octahedral sites and is driven off at temperatures lower than 600 degrees C. Between 600 and 700 degrees C dehydroxylation occurs whereas, between 800 and 900 degrees C, the aluminum in octahedral sites disappears, due to the breakdown of the illite structure, and all iron present is oxidized to Fe3+. In samples fired at 1000 and 1100 degrees C iron clustering was observed as well as large single crystals of iron with the occurrence of ferro- or ferrimagnetic effects. Below 900 degrees C the aluminum in octahedral sites presents a continuous distribution of chemical shift, suggesting the presence of slightly distorted sites. Finally, over the whole temperature range, the presence of at least two tetrahedral aluminum sites was revealed, characterized by different values of the quadrupolar coupling constant.

  8. Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan).

    PubMed

    Balasubramanian, Anuradha; Ponnuraj, Karthe

    2008-07-01

    Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 A resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 A.

  9. Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella

    PubMed Central

    Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.

    2013-01-01

    Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835

  10. One-step, low-temperature fabrication of CdS quantum dots by watermelon rind: a green approach

    PubMed Central

    Lakshmipathy, Rajasekhar; Sarada, Nallani Chakravarthula; Chidambaram, K; Pasha, Sk Khadeer

    2015-01-01

    We investigated the one-step synthesis of CdS nanoparticles via green synthesis that used aqueous extract of watermelon rind as a capping and stabilizing agent. Preliminary phytochemical analysis depicted the presence of carbohydrates which can act as capping and stabilizing agents. Synthesized CdS nanoparticles were characterized using UV-visible, Fourier transform infrared spectroscopy, X-ray diffraction, EDX, dynamic light scattering, transmission electron microscopy, and atomic force microscopy techniques. The CdS nanoparticles were found to be size- and shape-controlled and were stable even after 3 months of synthesis. The results suggest that watermelon rind, an agro-waste, can be used for synthesis of CdS nanoparticles without any addition of stabilizing and capping agents. PMID:26491319

  11. Suitability of holographic beam scanning in high resolution applications

    NASA Astrophysics Data System (ADS)

    Kalita, Ranjan; Goutam Buddha, S. S.; Boruah, Bosanta R.

    2018-02-01

    The high resolution applications of a laser scanning imaging system very much demand the accurate positioning of the illumination beam. The galvanometer scanner based beam scanning imaging systems, on the other hand, suffer from both short term and long term beam instability issues. Fortunately Computer generated holography based beam scanning offers extremely accurate beam steering, which can be very useful for imaging in high-resolution applications in confocal microscopy. The holographic beam scanning can be achieved by writing a sequence of holograms onto a spatial light modulator and utilizing one of the diffracted orders as the illumination beam. This paper highlights relative advantages of such a holographic beam scanning based confocal system and presents some of preliminary experimental results.

  12. Crystallization and preliminary X-ray analysis of native and selenomethionyl vinorine synthase from Rauvolfia serpentina.

    PubMed

    Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim

    2005-06-01

    Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.

  13. Crystallization and preliminary crystallographic analysis of an Enterococcus faecalis repressor protein, CylR2, involved in regulating cytolysin production through quorum-sensing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ni, Shuisong; McAteer, Kathleen; Bussiere, Dirksen E.

    2004-06-01

    CylR2 is one of the two regulatory proteins associated with the quorum-sensing-dependent synthesis of cytolysin for the common pathogen Enterococcus faecalis. The protein was expressed with a C-terminal 6-histidine tag and purified to homogeneity with a cobalt affinity column followed by another size exclusion column. Both native and SeMet proteins were crystallized. A complete X-ray diffraction data set from the native crystal was collected to 2.3 resolution. The crystal was tetragonal, belonging to space group P41/43, with unit-cell dimensions a=b=66.2 , c=40.9 and a=b=g=90. The asymmetric unit contained two molecules of CylR2.

  14. Theory and experimental technique for nondestructive evaluation of ceramic composites

    NASA Technical Reports Server (NTRS)

    Generazio, Edward R.

    1990-01-01

    The important ultrasonic scattering mechanisms for SiC and Si3N4 ceramic composites were identified by examining the interaction of ultrasound with individual fibers, pores, and grains. The dominant scattering mechanisms were identified as asymmetric refractive scattering due to porosity gradients in the matrix material, and symmetric diffractive scattering at the fiber-to-matrix interface and at individual pores. The effect of the ultrasonic reflection coefficient and surface roughness in the ultrasonic evaluation was highlighted. A new nonintrusive ultrasonic evaluation technique, angular power spectrum scanning (APSS), was presented that is sensitive to microstructural variations in composites. Preliminary results indicate that APSS will yield information on the composite microstructure that is not available by any other nondestructive technique.

  15. a-Si:H TFT-silicon hybrid low-energy x-ray detector

    DOE PAGES

    Shin, Kyung -Wook; Karim, Karim S.

    2017-03-15

    Direct conversion crystalline silicon X-ray imagers are used for low-energy X-ray photon (4-20 keV) detection in scientific research applications such as protein crystallography. In this paper, we demonstrate a novel pixel architecture that integrates a crystalline silicon X-ray detector with a thin-film transistor amorphous silicon pixel readout circuit. We describe a simplified two-mask process to fabricate a complete imaging array and present preliminary results that show the fabricated pixel to be sensitive to 5.89-keV photons from a low activity Fe-55 gamma source. Furthermore, this paper presented can expedite the development of high spatial resolution, low cost, direct conversion imagers formore » X-ray diffraction and crystallography applications.« less

  16. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    PubMed Central

    Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

    2006-01-01

    Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268

  17. Optical track width measurements below 100 nm using artificial neural networks

    NASA Astrophysics Data System (ADS)

    Smith, R. J.; See, C. W.; Somekh, M. G.; Yacoot, A.; Choi, E.

    2005-12-01

    This paper discusses the feasibility of using artificial neural networks (ANNs), together with a high precision scanning optical profiler, to measure very fine track widths that are considerably below the conventional diffraction limit of a conventional optical microscope. The ANN is trained using optical profiles obtained from tracks of known widths, the network is then assessed by applying it to test profiles. The optical profiler is an ultra-stable common path scanning interferometer, which provides extremely precise surface measurements. Preliminary results, obtained with a 0.3 NA objective lens and a laser wavelength of 633 nm, show that the system is capable of measuring a 50 nm track width, with a standard deviation less than 4 nm.

  18. Expression, purification, crystallization and preliminary X-ray diffraction analysis of Bifidobacterium adolescentis xylose isomerase

    PubMed Central

    dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor

    2013-01-01

    Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585

  19. Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

    PubMed Central

    Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

    2006-01-01

    A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

  20. Evolution of diffraction and self-diffraction phenomena in thin films of Gelite Bloom/Hibiscus Sabdariffa

    NASA Astrophysics Data System (ADS)

    Cano-Lara, Miroslava; Severiano-Carrillo, Israel; Trejo-Durán, Mónica; Alvarado-Méndez, Edgar

    2017-09-01

    In this work, we present a study of non-linear optical response in thin films elaborated with Gelite Bloom and extract of Hibiscus Sabdariffa. Non-linear refraction and absorption effects were studied experimentally (Z-scan technique) and numerically, by considering the transmittance as non-linear absorption and refraction contribution. We observe large phase shifts to far field, and diffraction due to self-phase modulation of the sample. Diffraction and self-diffraction effects were observed as time function. The aim of studying non-linear optical properties in thin films is to eliminate thermal vortex effects that occur in liquids. This is desirable in applications such as non-linear phase contrast, optical limiting, optics switches, etc. Finally, we find good agreement between experimental and theoretical results.

  1. Diffraction of V-point singularities through triangular apertures.

    PubMed

    Ram, B S Bhargava; Sharma, Anurag; Senthilkumaran, P

    2017-05-01

    In this paper we present experimental studies on diffraction of V-point singularities through equilateral and isosceles right triangular apertures. When V-point index, also called Poincare-Hopf index (η), of the optical field is +1, the diffraction disintegrates it into two monstars/lemons. When V-point index η is -1, diffraction produces two stars. The diffraction pattern, unlike phase singularity, is insensitive to polarity of the polarization singularity and the intensity pattern remains invariant. Higher order V-point singularities are generated using Sagnac interferometer and it is observed that the diffraction disintegrates them into lower order C-points.

  2. Preliminary study of raw material for calcium silicate/PVA coating on Ti-6Al-4V alloy

    NASA Astrophysics Data System (ADS)

    Azam, Farah Atiqah bt Abdul; Shamsudin, Roslinda

    2015-09-01

    Calcium silicate bioceramic was prepared from the rice husk and limestone resources using the sol gel method. The preparations of CaSiO3 formulation were differ from the previous study due CaO/SiO2 amount with 45:55 ratio. X-Ray Fluorescence analysis was carried out to clarify the amount of SiO2 and CaO content in the limestone and rice husk ash. The high amount of CaO was found in the limestone with the percentages of 97.22%, whereby 89% of SiO2 content of the rice husk ash. Several milling time were studied to obtain the optimized milling ti me and speed in progress to obtain nano size particle. The particle size analysis result confirms that increase in milling time does not certainly reduce the size of particle. The addition of 0.05% polyvinyl alcohol as a binder did not change the phases or composition of calcium silicates after examined by X-Ray diffraction analysis which make it suitable to be used as a binder for calcium silicate coating without changing the chemical structure.

  3. Studying Solid-Phase Processes in Metakaoline-Sodium Hydroxide Mixtures by Means of Isoconversion Analysis

    NASA Astrophysics Data System (ADS)

    Gordina, N. E.; Prokof'ev, V. Yu.; Khramtsova, A. P.; Cherednikova, D. S.; Konstantinova, E. M.

    2018-05-01

    Processes of the thermal treatment of 6Al2Si4O7: 12NaOH mixtures for the synthesis of zeolites are studied. The mixtures are subjected to ultrasonic treatment and mechanochemical activation, after which the suspensions are evaporated, granulated, and dried. The study is performed using X-ray diffraction, synchronous thermal analysis, and electron microscopy. It is established that calcination below 500°C leads to the dehydration of the LTA zeolite and sodium hydroaluminates formed earlier, and Al2Si4O7 reacts with LTA and NaOH in the range of 500-800°C to form Na6Al4Si4O17 and Na8Al4Si4O18. Using the Ozawa-Flynn-Wall and Kissinger-Akahira-Sunose methods, the apparent activation energies (E) are calculated for this range. The two methods yield close results. It is found that E grows from 30-80 to 240-300 kJ/mol as conversion increases. It is shown that preliminary ultrasonic treatment and mechanochemical activation reduce apparent energy of activation E due to changes in the morphology of particles.

  4. DNA-binding studies and biological activities of new nitrosubstituted acyl thioureas

    NASA Astrophysics Data System (ADS)

    Tahir, Shaista; Badshah, Amin; Hussain, Raja Azadar; Tahir, Muhammad Nawaz; Tabassum, Saira; Patujo, Jahangir Ali; Rauf, Muhammad Khawar

    2015-11-01

    Four new nitrosubstituted acylthioureas i.e. 1-acetyl-3-(4-nitrophenyl)thiourea (TU1), 1-acetyl-3-(2-methyl-4-nitrophenyl)thiourea (TU2), 1-acetyl-3-(2-methoxy-4-nitrophenyl)thiourea (TU3) and 1-acetyl-3-(4-chloro-3-nitrophenyl)thiourea (TU4) have been synthesized and characterized (by C13 and H1 nuclear magnetic resonance, Fourier transform infrared spectroscopy and single crystal X-ray diffraction). As a preliminary investigation of the anti-cancer potencies of the said compounds, DNA interaction studies have been carried out using cyclic voltammetry and UV-vis spectroscopy along with verification from computational studies. The drug-DNA binding constants are found to be in the order, KTU3 9.04 × 106 M-1 > KTU4 8.57 × 106 M-1 > KTU2 6.05 × 106 M-1 > KTU1 1.16 × 106 M-1. Furthermore, the antioxidant, cytotoxic, antibacterial and antifungal activities have been carried out against DPPH (1,1-diphenyl-2-dipicrylhydrazyl), Brine shrimp eggs, gram positive (Micrococcus luteus, Staphylococcus aureus) and gram negative (Bordetella bronchiseptica, Salmonella typhimurium, Enterobacter aerogens) and fungal cultures (Aspergillus fumigatus, Mucor species, Aspergillus niger, Aspergillus flavus) respectively.

  5. Clifford G. Shull, Neutron Diffraction, Hydrogen Atoms, and Neutron

    Science.gov Websites

    Analysis of NaH and NaD, DOE Technical Report, April 1947 The Diffraction of Neutrons by Crystalline Powders; DOE Technical Report; 1948 Neutron Diffraction Studies, DOE Technical Report, 1948 Laue Structure of Thorium and Zirconium Dihydrides by X-ray and Neutron Diffraction, DOE Technical Report, April

  6. Study on High Resolution Membrane-Based Diffractive Optical Imaging on Geostationary Orbit

    NASA Astrophysics Data System (ADS)

    Jiao, J.; Wang, B.; Wang, C.; Zhang, Y.; Jin, J.; Liu, Z.; Su, Y.; Ruan, N.

    2017-05-01

    Diffractive optical imaging technology provides a new way to realize high resolution earth observation on geostationary orbit. There are a lot of benefits to use the membrane-based diffractive optical element in ultra-large aperture optical imaging system, including loose tolerance, light weight, easy folding and unfolding, which make it easy to realize high resolution earth observation on geostationary orbit. The implementation of this technology also faces some challenges, including the configuration of the diffractive primary lens, the development of high diffraction efficiency membrane-based diffractive optical elements, and the correction of the chromatic aberration of the diffractive optical elements. Aiming at the configuration of the diffractive primary lens, the "6+1" petal-type unfold scheme is proposed, which consider the compression ratio, the blocking rate and the development complexity. For high diffraction efficiency membrane-based diffractive optical element, a self-collimating method is proposed. The diffraction efficiency is more than 90 % of the theoretical value. For the chromatic aberration correction problem, an optimization method based on schupmann is proposed to make the imaging spectral bandwidth in visible light band reach 100 nm. The above conclusions have reference significance for the development of ultra-large aperture diffractive optical imaging system.

  7. DynAMITe: a prototype large area CMOS APS for breast cancer diagnosis using x-ray diffraction measurements

    NASA Astrophysics Data System (ADS)

    Konstantinidis, A.; Anaxagoras, T.; Esposito, M.; Allinson, N.; Speller, R.

    2012-03-01

    X-ray diffraction studies are used to identify specific materials. Several laboratory-based x-ray diffraction studies were made for breast cancer diagnosis. Ideally a large area, low noise, linear and wide dynamic range digital x-ray detector is required to perform x-ray diffraction measurements. Recently, digital detectors based on Complementary Metal-Oxide- Semiconductor (CMOS) Active Pixel Sensor (APS) technology have been used in x-ray diffraction studies. Two APS detectors, namely Vanilla and Large Area Sensor (LAS), were developed by the Multidimensional Integrated Intelligent Imaging (MI-3) consortium to cover a range of scientific applications including x-ray diffraction. The MI-3 Plus consortium developed a novel large area APS, named as Dynamically Adjustable Medical Imaging Technology (DynAMITe), to combine the key characteristics of Vanilla and LAS with a number of extra features. The active area (12.8 × 13.1 cm2) of DynaMITe offers the ability of angle dispersive x-ray diffraction (ADXRD). The current study demonstrates the feasibility of using DynaMITe for breast cancer diagnosis by identifying six breast-equivalent plastics. Further work will be done to optimize the system in order to perform ADXRD for identification of suspicious areas of breast tissue following a conventional mammogram taken with the same sensor.

  8. Simulation and modeling of silicon pore optics for the ATHENA x-ray telescope

    NASA Astrophysics Data System (ADS)

    Spiga, D.; Christensen, F. E.; Bavdaz, M.; Civitani, M. M.; Conconi, P.; Della Monica Ferreira, D.; Knudsen, E. B.; Massahi, S.; Pareschi, G.; Salmaso, B.; Shortt, B.; Tayabaly, K.; Westergaard, N. J.; Wille, E.

    2016-07-01

    The ATHENA X-ray observatory is a large-class ESA approved mission, with launch scheduled in 2028. The technology of silicon pore optics (SPO) was selected as baseline to assemble ATHENA's optic with more than 1000 mirror modules, obtained by stacking wedged and ribbed silicon wafer plates onto silicon mandrels to form the Wolter-I configuration. Even if the current baseline design fulfills the required effective area of 2 m2 at 1 keV on-axis, alternative design solutions, e.g., privileging the field of view or the off-axis angular resolution, are also possible. Moreover, the stringent requirement of a 5 arcsec HEW angular resolution at 1 keV entails very small profile errors and excellent surface smoothness, as well as a precise alignment of the 1000 mirror modules to avoid imaging degradation and effective area loss. Finally, the stray light issue has to be kept under control. In this paper we show the preliminary results of simulations of optical systems based on SPO for the ATHENA X-ray telescope, from pore to telescope level, carried out at INAF/OAB and DTU Space under ESA contract. We show ray-tracing results, including assessment of the misalignments of mirror modules and the impact of stray light. We also deal with a detailed description of diffractive effects expected in an SPO module from UV light, where the aperture diffraction prevails, to X-rays where the surface diffraction plays a major role. Finally, we analyze the results of X-ray tests performed at the BESSY synchrotron, we compare them with surface finishing measurements, and we estimate the expected HEW degradation caused by the X-ray scattering.

  9. Macromolecular Topography Leaps into the Digital Age

    NASA Technical Reports Server (NTRS)

    Lovelace, J.; Bellamy, H.; Snell, E. H.; Borgstahl, G.

    2003-01-01

    A low-cost, real-time digital topography system is under development which will replace x-ray film and nuclear emulsion plates. The imaging system is based on an inexpensive surveillance camera that offers a 1000x1000 array of 8 im square pixels, anti-blooming circuitry, and very quick read out. Currently, the system directly converts x-rays to an image with no phosphor. The system is small and light and can be easily adapted to work with other crystallographic equipment. Preliminary images have been acquired of cubic insulin at the NSLS x26c beam line. NSLS x26c was configured for unfocused monochromatic radiation. Six reflections were collected with stills spaced from 0.002 to 0.001 degrees apart across the entire oscillation range that the reflections were in diffracting condition. All of the reflections were rotated to the vertical to reduce Lorentz and beam related effects. This particular CCD is designed for short exposure applications (much less than 1 sec) and so has a relatively high dark current leading to noisy raw images. The images are processed to remove background and other system noise with a multi-step approach including the use of wavelets, histogram, and mean window filtering. After processing, animations were constructed with the corresponding reflection profile to show the diffraction of the crystal volume vs. the oscillation angle as well as composite images showing the parts of the crystal with the strongest diffraction for each reflection. The final goal is to correlate features seen in reflection profiles captured with fine phi slicing to those seen in the topography images. With this development macromolecular topography finally comes into the digital age.

  10. Three NiAs-Ni 2In Type Structures in the Mn-Sn System

    NASA Astrophysics Data System (ADS)

    Elding-Pontén, Margareta; Stenberg, Lars; Larsson, Ann-Kristin; Lidin, Sven; Ståhl, Kenny

    1997-03-01

    TheB8-type structure field of the Mn-Sn system has been investigated. Two high temperature phases (HTP1 and HTP2) and one low temperature phase (Mn3Sn2) were found. They all crystallize with the NiAs structure type with part of the trigonal bipyramidal interstices filled by manganese atoms in an ordered manner. The ordering as well as the manganese content is different for the three phases, giving rise to three different orthorhombic superstructures. Mn3Sn2seems to have the lowest manganese content, since the corresponding basal unit cell is smaller than for HTP1-2. Structural models of the phases are based on selected area electron diffraction, X-ray powder diffraction, and preliminary single crystal X-ray measurements. The ideal cell parameters found are (a=7ahex,b=3ahex,c=chex), (a=5ahex,b=3ahex,c=chex), and (a=2ahex,b=3ahex,c=chex) for HTP1, HTP2, and Mn3Sn2, respectively. The crystal structure of Mn3Sn2has been refined by means of the Rietveld method from X-ray powder diffraction data. Mn3Sn2is orthorhombic,Pnma,a=7.5547(2),b=5.4994(2),c=8.5842(2) Å,Z=4. (Pbnmin the setting above.) The compound is isostructural with Ni3Sn2andγ‧-Co3Sn2(H. Fjellvåg and A. Kjekshus,Acta Chem. Scand.A40, 23-30 (1986)). FinalRp=8.97%,Rwp=11.44%, GOF=2.86, andRBragg=4.11% using 43 parameters and 5701 observations and 330 Bragg reflections.

  11. Membrane protein structure determination by SAD, SIR, or SIRAS phasing in serial femtosecond crystallography using an iododetergent

    PubMed Central

    Nakane, Takanori; Hanashima, Shinya; Suzuki, Mamoru; Saiki, Haruka; Hayashi, Taichi; Kakinouchi, Keisuke; Sugiyama, Shigeru; Kawatake, Satoshi; Matsuoka, Shigeru; Matsumori, Nobuaki; Nango, Eriko; Kobayashi, Jun; Shimamura, Tatsuro; Kimura, Kanako; Mori, Chihiro; Kunishima, Naoki; Sugahara, Michihiro; Takakyu, Yoko; Inoue, Shigeyuki; Masuda, Tetsuya; Hosaka, Toshiaki; Tono, Kensuke; Joti, Yasumasa; Kameshima, Takashi; Hatsui, Takaki; Inoue, Tsuyoshi; Nureki, Osamu; Iwata, So; Murata, Michio; Mizohata, Eiichi

    2016-01-01

    The 3D structure determination of biological macromolecules by X-ray crystallography suffers from a phase problem: to perform Fourier transformation to calculate real space density maps, both intensities and phases of structure factors are necessary; however, measured diffraction patterns give only intensities. Although serial femtosecond crystallography (SFX) using X-ray free electron lasers (XFELs) has been steadily developed since 2009, experimental phasing still remains challenging. Here, using 7.0-keV (1.771 Å) X-ray pulses from the SPring-8 Angstrom Compact Free Electron Laser (SACLA), iodine single-wavelength anomalous diffraction (SAD), single isomorphous replacement (SIR), and single isomorphous replacement with anomalous scattering (SIRAS) phasing were performed in an SFX regime for a model membrane protein bacteriorhodopsin (bR). The crystals grown in bicelles were derivatized with an iodine-labeled detergent heavy-atom additive 13a (HAD13a), which contains the magic triangle, I3C head group with three iodine atoms. The alkyl tail was essential for binding of the detergent to the surface of bR. Strong anomalous and isomorphous difference signals from HAD13a enabled successful phasing using reflections up to 2.1-Å resolution from only 3,000 and 4,000 indexed images from native and derivative crystals, respectively. When more images were merged, structure solution was possible with data truncated at 3.3-Å resolution, which is the lowest resolution among the reported cases of SFX phasing. Moreover, preliminary SFX experiment showed that HAD13a successfully derivatized the G protein-coupled A2a adenosine receptor crystallized in lipidic cubic phases. These results pave the way for de novo structure determination of membrane proteins, which often diffract poorly, even with the brightest XFEL beams. PMID:27799539

  12. Membrane protein structure determination by SAD, SIR, or SIRAS phasing in serial femtosecond crystallography using an iododetergent.

    PubMed

    Nakane, Takanori; Hanashima, Shinya; Suzuki, Mamoru; Saiki, Haruka; Hayashi, Taichi; Kakinouchi, Keisuke; Sugiyama, Shigeru; Kawatake, Satoshi; Matsuoka, Shigeru; Matsumori, Nobuaki; Nango, Eriko; Kobayashi, Jun; Shimamura, Tatsuro; Kimura, Kanako; Mori, Chihiro; Kunishima, Naoki; Sugahara, Michihiro; Takakyu, Yoko; Inoue, Shigeyuki; Masuda, Tetsuya; Hosaka, Toshiaki; Tono, Kensuke; Joti, Yasumasa; Kameshima, Takashi; Hatsui, Takaki; Yabashi, Makina; Inoue, Tsuyoshi; Nureki, Osamu; Iwata, So; Murata, Michio; Mizohata, Eiichi

    2016-11-15

    The 3D structure determination of biological macromolecules by X-ray crystallography suffers from a phase problem: to perform Fourier transformation to calculate real space density maps, both intensities and phases of structure factors are necessary; however, measured diffraction patterns give only intensities. Although serial femtosecond crystallography (SFX) using X-ray free electron lasers (XFELs) has been steadily developed since 2009, experimental phasing still remains challenging. Here, using 7.0-keV (1.771 Å) X-ray pulses from the SPring-8 Angstrom Compact Free Electron Laser (SACLA), iodine single-wavelength anomalous diffraction (SAD), single isomorphous replacement (SIR), and single isomorphous replacement with anomalous scattering (SIRAS) phasing were performed in an SFX regime for a model membrane protein bacteriorhodopsin (bR). The crystals grown in bicelles were derivatized with an iodine-labeled detergent heavy-atom additive 13a (HAD13a), which contains the magic triangle, I3C head group with three iodine atoms. The alkyl tail was essential for binding of the detergent to the surface of bR. Strong anomalous and isomorphous difference signals from HAD13a enabled successful phasing using reflections up to 2.1-Å resolution from only 3,000 and 4,000 indexed images from native and derivative crystals, respectively. When more images were merged, structure solution was possible with data truncated at 3.3-Å resolution, which is the lowest resolution among the reported cases of SFX phasing. Moreover, preliminary SFX experiment showed that HAD13a successfully derivatized the G protein-coupled A2a adenosine receptor crystallized in lipidic cubic phases. These results pave the way for de novo structure determination of membrane proteins, which often diffract poorly, even with the brightest XFEL beams.

  13. Light distribution in diffractive multifocal optics and its optimization.

    PubMed

    Portney, Valdemar

    2011-11-01

    To expand a geometrical model of diffraction efficiency and its interpretation to the multifocal optic and to introduce formulas for analysis of far and near light distribution and their application to multifocal intraocular lenses (IOLs) and to diffraction efficiency optimization. Medical device consulting firm, Newport Coast, California, USA. Experimental study. Application of a geometrical model to the kinoform (single focus diffractive optical element) was expanded to a multifocal optic to produce analytical definitions of light split between far and near images and light loss to other diffraction orders. The geometrical model gave a simple interpretation of light split in a diffractive multifocal IOL. An analytical definition of light split between far, near, and light loss was introduced as curve fitting formulas. Several examples of application to common multifocal diffractive IOLs were developed; for example, to light-split change with wavelength. The analytical definition of diffraction efficiency may assist in optimization of multifocal diffractive optics that minimize light loss. Formulas for analysis of light split between different foci of multifocal diffractive IOLs are useful in interpreting diffraction efficiency dependence on physical characteristics, such as blaze heights of the diffractive grooves and wavelength of light, as well as for optimizing multifocal diffractive optics. Disclosure is found in the footnotes. Copyright © 2011 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  14. Study for the dispersion of double-diffraction spectrometers

    NASA Astrophysics Data System (ADS)

    Pang, Yajun; Zhang, Yinxin; Yang, Huaidong; Huang, Zhanhua; Xu, Mingming; Jin, Guofan

    2018-01-01

    Double-cascade spectrometers and double-pass spectrometers can be uniformly called double-diffraction spectrometers. In current double-diffraction spectrometers design theory, the differences of the incident angles in the second diffraction are ignored. There is a significant difference between the design in theory and the actual result. In this study, based on the geometries of the double-diffraction spectrometers, we strictly derived the theoretical formulas of their dispersion. By employing the ZEMAX simulation software, verification of our theoretical model is implemented, and the simulation results show big agreement with our theoretical formulas. Based on the conclusions, a double-pass spectrometer was set up and tested, and the experiment results agree with the theoretical model and the simulation.

  15. Changes in diffraction efficiency of gratings with high fructose corn syrup by aging

    NASA Astrophysics Data System (ADS)

    Mejias-Brizuela, Nildia Y.; Olivares-Pérez, Arturo

    2017-03-01

    High fructose corn syrup was used for preparation of holographic gratings photosensitized with potassium bichromated, for to analyze the behavior of diffraction efficiency to first order. The behavior of diffraction efficiency to first order was analyzed at time intervals different: 24, 48, 72 and 96 hours, because to the recorded gratings showed instability 24 hours after of record. For this reason, we decided to study in the time the evolution of diffraction efficiency parameter for to determine the maximum modulation of material holographic (HFCS-bichromated). The study realized showed that after of 72 hours, the photosensitized material reaches its maximum modulation, with a diffraction efficiency to first order of 4 percent.

  16. Resolving power of diffraction imaging with an objective: a numerical study.

    PubMed

    Wang, Wenjin; Liu, Jing; Lu, Jun Qing; Ding, Junhua; Hu, Xin-Hua

    2017-05-01

    Diffraction imaging in the far-field can detect 3D morphological features of an object for its coherent nature. We describe methods for accurate calculation and analysis of diffraction images of scatterers of single and double spheres by an imaging unit based on microscope objective at non-conjugate positions. A quantitative study of the calculated diffraction imaging in spectral domain has been performed to assess the resolving power of diffraction imaging. It has been shown numerically that with coherent illumination of 532 nm in wavelength the imaging unit can resolve single spheres of 2 μm or larger in diameters and double spheres separated by less than 300 nm between their centers.

  17. Shock Induced Phase Changes in Forsterite and Iron Silicide

    NASA Astrophysics Data System (ADS)

    Newman, M.; Asimow, P.; Kraus, R. G.; Smith, R.; Coppari, F.; Eggert, J. H.; Wicks, J.; Tracy, S.; Duffy, T.

    2017-06-01

    The equation of state of magnesium silicates and iron alloys at the pressures and temperatures near the melt curve is important for understanding the thermal evolution and interior structure of rocky planets. Here, we present a series of laser driven shock experiments on single crystal Mg2SiO4 and textured polycrystalline iron silicide (Fe-15Si), conducted at LLE. In situ x-ray diffraction measurements were used to probe the melting transition and investigate the potential decomposition of forsterite into solid MgO and silica rich liquid and Fe-15Si in to silicon rich B2 and iron rich hcp structures. This work examines kinetic effects of chemical decomposition due to the short time scale of laser-shock experiments. Preliminary results demonstrate solid-solid and solid-liquid phase transitions on both the forsterite and Fe-15Si Hugoniots. For Fe-15Si, we observe a texture preserving martensitic transformation of D03 Fe-15Si into an hcp structure and melting at 318 GPa. For forsterite, we observe diffraction consistent with B1 MgO and melting at 215 GPa. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  18. Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vivian, J. P.; Porter, C.; Wilce, J. A.

    2006-11-01

    A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

  19. Multi-kernel deconvolution for contrast improvement in a full field imaging system with engineered PSFs using conical diffraction

    NASA Astrophysics Data System (ADS)

    Enguita, Jose M.; Álvarez, Ignacio; González, Rafael C.; Cancelas, Jose A.

    2018-01-01

    The problem of restoration of a high-resolution image from several degraded versions of the same scene (deconvolution) has been receiving attention in the last years in fields such as optics and computer vision. Deconvolution methods are usually based on sets of images taken with small (sub-pixel) displacements or slightly different focus. Techniques based on sets of images obtained with different point-spread-functions (PSFs) engineered by an optical system are less popular and mostly restricted to microscopic systems, where a spot of light is projected onto the sample under investigation, which is then scanned point-by-point. In this paper, we use the effect of conical diffraction to shape the PSFs in a full-field macroscopic imaging system. We describe a series of simulations and real experiments that help to evaluate the possibilities of the system, showing the enhancement in image contrast even at frequencies that are strongly filtered by the lens transfer function or when sampling near the Nyquist frequency. Although results are preliminary and there is room to optimize the prototype, the idea shows promise to overcome the limitations of the image sensor technology in many fields, such as forensics, medical, satellite, or scientific imaging.

  20. Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

    PubMed

    Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen

    2008-07-09

    The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.

Top