Construction, Characterization, and Preliminary BAC-End Sequence Analysis of a Bacterial Artificial Chromosome Library of the Tea Plant (Camellia sinensis)

PubMed Central

Lin, Jinke; Kudrna, Dave; Wing, Rod A.

2011-01-01

We describe the construction and characterization of a publicly available BAC library for the tea plant, Camellia sinensis. Using modified methods, the library was constructed with the aim of developing public molecular resources to advance tea plant genomics research. The library consists of a total of 401,280 clones with an average insert size of 135 kb, providing an approximate coverage of 13.5 haploid genome equivalents. No empty vector clones were observed in a random sampling of 576 BAC clones. Further analysis of 182 BAC-end sequences from randomly selected clones revealed a GC content of 40.35% and low chloroplast and mitochondrial contamination. Repetitive sequence analyses indicated that LTR retrotransposons were the most predominant sequence class (86.93%–87.24%), followed by DNA retrotransposons (11.16%–11.69%). Additionally, we found 25 simple sequence repeats (SSRs) that could potentially be used as genetic markers. PMID:21234344

The August 2011 Virginia and Colorado Earthquake Sequences: Does Stress Drop Depend on Strain Rate?

NASA Astrophysics Data System (ADS)

Abercrombie, R. E.; Viegas, G.

2011-12-01

Our preliminary analysis of the August 2011 Virginia earthquake sequence finds the earthquakes to have high stress drops, similar to those of recent earthquakes in NE USA, while those of the August 2011 Trinidad, Colorado, earthquakes are moderate - in between those typical of interplate (California) and the east coast. These earthquakes provide an unprecedented opportunity to study such source differences in detail, and hence improve our estimates of seismic hazard. Previously, the lack of well-recorded earthquakes in the eastern USA severely limited our resolution of the source processes and hence the expected ground accelerations. Our preliminary findings are consistent with the idea that earthquake faults strengthen during longer recurrence times and intraplate faults fail at higher stress (and produce higher ground accelerations) than their interplate counterparts. We use the empirical Green's function (EGF) method to calculate source parameters for the Virginia mainshock and three larger aftershocks, and for the Trinidad mainshock and two larger foreshocks using IRIS-available stations. We select time windows around the direct P and S waves at the closest stations and calculate spectral ratios and source time functions using the multi-taper spectral approach (eg. Viegas et al., JGR 2010). Our preliminary results show that the Virginia sequence has high stress drops (~100-200 MPa, using Madariaga (1976) model), and the Colorado sequence has moderate stress drops (~20 MPa). These numbers are consistent with previous work in the regions, for example the Au Sable Forks (2002) earthquake, and the 2010 Germantown (MD) earthquake. We also calculate the radiated seismic energy and find the energy/moment ratio to be high for the Virginia earthquakes, and moderate for the Colorado sequence. We observe no evidence of a breakdown in constant stress drop scaling in this limited number of earthquakes. We extend our analysis to a larger number of earthquakes and stations. We calculate uncertainties in all our measurements, and also consider carefully the effects of variation in available bandwidth in order to improve our constraints on the source parameters.

An in-depth comparison of the porcine, murine and human inflammasomes; lessons from the porcine genome and transcriptome

USDA-ARS?s Scientific Manuscript database

Emerging evidence suggests that swine are a scientifically acceptable intermediate species between rodents and humans to model immune function relevant to humans. The swine genome has recently been sequenced and several preliminary structural and functional analysis of the porcine immunome have been...

MinION Analysis and Reference Consortium: Phase 1 data release and analysis

PubMed Central

Eccles, David A.; Zalunin, Vadim; Urban, John M.; Piazza, Paolo; Bowden, Rory J.; Paten, Benedict; Mwaigwisya, Solomon; Batty, Elizabeth M.; Simpson, Jared T.; Snutch, Terrance P.

2015-01-01

The advent of a miniaturized DNA sequencing device with a high-throughput contextual sequencing capability embodies the next generation of large scale sequencing tools. The MinION™ Access Programme (MAP) was initiated by Oxford Nanopore Technologies™ in April 2014, giving public access to their USB-attached miniature sequencing device. The MinION Analysis and Reference Consortium (MARC) was formed by a subset of MAP participants, with the aim of evaluating and providing standard protocols and reference data to the community. Envisaged as a multi-phased project, this study provides the global community with the Phase 1 data from MARC, where the reproducibility of the performance of the MinION was evaluated at multiple sites. Five laboratories on two continents generated data using a control strain of Escherichia coli K-12, preparing and sequencing samples according to a revised ONT protocol. Here, we provide the details of the protocol used, along with a preliminary analysis of the characteristics of typical runs including the consistency, rate, volume and quality of data produced. Further analysis of the Phase 1 data presented here, and additional experiments in Phase 2 of E. coli from MARC are already underway to identify ways to improve and enhance MinION performance. PMID:26834992

Illumina MiSeq Sequencing for Preliminary Analysis of Microbiome Causing Primary Endodontic Infections in Egypt

PubMed Central

Azab, Marwa Mohamed; Fayyad, Dalia Mukhtar

2018-01-01

The use of high throughput next generation technologies has allowed more comprehensive analysis than traditional Sanger sequencing. The specific aim of this study was to investigate the microbial diversity of primary endodontic infections using Illumina MiSeq sequencing platform in Egyptian patients. Samples were collected from 19 patients in Suez Canal University Hospital (Endodontic Department) using sterile # 15K file and paper points. DNA was extracted using Mo Bio power soil DNA isolation extraction kit followed by PCR amplification and agarose gel electrophoresis. The microbiome was characterized on the basis of the V3 and V4 hypervariable region of the 16S rRNA gene by using paired-end sequencing on Illumina MiSeq device. MOTHUR software was used in sequence filtration and analysis of sequenced data. A total of 1858 operational taxonomic units at 97% similarity were assigned to 26 phyla, 245 families, and 705 genera. Four main phyla Firmicutes, Bacteroidetes, Proteobacteria, and Synergistetes were predominant in all samples. At genus level, Prevotella, Bacillus, Porphyromonas, Streptococcus, and Bacteroides were the most abundant. Illumina MiSeq platform sequencing can be used to investigate oral microbiome composition of endodontic infections. Elucidating the ecology of endodontic infections is a necessary step in developing effective intracanal antimicrobials. PMID:29849646

Investigation of the protein osteocalcin of Camelops hesternus: Sequence, structure and phylogenetic implications

NASA Astrophysics Data System (ADS)

Humpula, James F.; Ostrom, Peggy H.; Gandhi, Hasand; Strahler, John R.; Walker, Angela K.; Stafford, Thomas W.; Smith, James J.; Voorhies, Michael R.; George Corner, R.; Andrews, Phillip C.

2007-12-01

Ancient DNA sequences offer an extraordinary opportunity to unravel the evolutionary history of ancient organisms. Protein sequences offer another reservoir of genetic information that has recently become tractable through the application of mass spectrometric techniques. The extent to which ancient protein sequences resolve phylogenetic relationships, however, has not been explored. We determined the osteocalcin amino acid sequence from the bone of an extinct Camelid (21 ka, Camelops hesternus) excavated from Isleta Cave, New Mexico and three bones of extant camelids: bactrian camel ( Camelus bactrianus); dromedary camel ( Camelus dromedarius) and guanaco ( Llama guanacoe) for a diagenetic and phylogenetic assessment. There was no difference in sequence among the four taxa. Structural attributes observed in both modern and ancient osteocalcin include a post-translation modification, Hyp 9, deamidation of Gln 35 and Gln 39, and oxidation of Met 36. Carbamylation of the N-terminus in ancient osteocalcin may result in blockage and explain previous difficulties in sequencing ancient proteins via Edman degradation. A phylogenetic analysis using osteocalcin sequences of 25 vertebrate taxa was conducted to explore osteocalcin protein evolution and the utility of osteocalcin sequences for delineating phylogenetic relationships. The maximum likelihood tree closely reflected generally recognized taxonomic relationships. For example, maximum likelihood analysis recovered rodents, birds and, within hominins, the Homo-Pan-Gorilla trichotomy. Within Artiodactyla, character state analysis showed that a substitution of Pro 4 for His 4 defines the Capra-Ovis clade within Artiodactyla. Homoplasy in our analysis indicated that osteocalcin evolution is not a perfect indicator of species evolution. Limited sequence availability prevented assigning functional significance to sequence changes. Our preliminary analysis of osteocalcin evolution represents an initial step towards a complete character analysis aimed at determining the evolutionary history of this functionally significant protein. We emphasize that ancient protein sequencing and phylogenetic analyses using amino acid sequences must pay close attention to post-translational modifications, amino acid substitutions due to diagenetic alteration and the impacts of isobaric amino acids on mass shifts and sequence alignments.

Preliminary report on the 29 July 2008 Mw 5.4 Chino Hills, Eastern Los Angeles Basin, California, Earthquake sequence

USGS Publications Warehouse

Hauksson, Egill; Felzer, Karen R.; Given, Doug; Giveon, Michal; Hough, Susan E.; Hutton, Kate; Kanamori, Hiroo; Sevilgen, Volkan; Wei, Shengji; Yong, Alan K.

2008-01-01

The 29 July 2008 Mw 5.4 Chino Hills earthquake was the largest event to occur within the greater Los Angeles metropolitan region since the Mw 6.7 1994 Northridge earthquake. The earthquake was widely felt in a metropolitan region with a population of more than 10 million people and was recorded by hundreds of broadband and strong-motion instruments. In this report we present preliminary analysis of the event and discuss its significance within the seismotectonic framework of the northern Los Angeles basin as revealed by previous moderate earthquakes.

MHC class I loci of the Bar-Headed goose (Anser indicus)

PubMed Central

2010-01-01

MHC class I proteins mediate functions in anti-pathogen defense. MHC diversity has already been investigated by many studies in model avian species, but here we chose the bar-headed goose, a worldwide migrant bird, as a non-model avian species. Sequences from exons encoding the peptide-binding region (PBR) of MHC class I molecules were isolated from liver genomic DNA, to investigate variation in these genes. These are the first MHC class I partial sequences of the bar-headed goose to be reported. A preliminary analysis suggests the presence of at least four MHC class I genes, which share great similarity with those of the goose and duck. A phylogenetic analysis of bar-headed goose, goose and duck MHC class I sequences using the NJ method supports the idea that they all cluster within the anseriforms clade. PMID:21637434

Manned space flight nuclear system safety. Volume 3: Reactor system preliminary nuclear safety analysis. Part 2A: Accident model document, appendix

NASA Technical Reports Server (NTRS)

1972-01-01

The detailed abort sequence trees for the reference zirconium hydride (ZrH) reactor power module that have been generated for each phase of the reference Space Base program mission are presented. The trees are graphical representations of causal sequences. Each tree begins with the phase identification and the dichotomy between success and failure. The success branch shows the mission phase objective as being achieved. The failure branch is subdivided, as conditions require, into various primary initiating abort conditions.

Interactive computer graphics system for structural sizing and analysis of aircraft structures

NASA Technical Reports Server (NTRS)

Bendavid, D.; Pipano, A.; Raibstein, A.; Somekh, E.

1975-01-01

A computerized system for preliminary sizing and analysis of aircraft wing and fuselage structures was described. The system is based upon repeated application of analytical program modules, which are interactively interfaced and sequence-controlled during the iterative design process with the aid of design-oriented graphics software modules. The entire process is initiated and controlled via low-cost interactive graphics terminals driven by a remote computer in a time-sharing mode.

Challenges in Whole-Genome Annotation of Pyrosequenced Eukaryotic Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuo, Alan; Grigoriev, Igor

2009-04-17

Pyrosequencing technologies such as 454/Roche and Solexa/Illumina vastly lower the cost of nucleotide sequencing compared to the traditional Sanger method, and thus promise to greatly expand the number of sequenced eukaryotic genomes. However, the new technologies also bring new challenges such as shorter reads and new kinds and higher rates of sequencing errors, which complicate genome assembly and gene prediction. At JGI we are deploying 454 technology for the sequencing and assembly of ever-larger eukaryotic genomes. Here we describe our first whole-genome annotation of a purely 454-sequenced fungal genome that is larger than a yeast (>30 Mbp). The pezizomycotine (filamentousmore » ascomycote) Aspergillus carbonarius belongs to the Aspergillus section Nigri species complex, members of which are significant as platforms for bioenergy and bioindustrial technology, as members of soil microbial communities and players in the global carbon cycle, and as agricultural toxigens. Application of a modified version of the standard JGI Annotation Pipeline has so far predicted ~;;10k genes. ~;;12percent of these preliminary annotations suffer a potential frameshift error, which is somewhat higher than the ~;;9percent rate in the Sanger-sequenced and conventionally assembled and annotated genome of fellow Aspergillus section Nigri member A. niger. Also,>90percent of A. niger genes have potential homologs in the A. carbonarius preliminary annotation. Weconclude, and with further annotation and comparative analysis expect to confirm, that 454 sequencing strategies provide a promising substrate for annotation of modestly sized eukaryotic genomes. We will also present results of annotation of a number of other pyrosequenced fungal genomes of bioenergy interest.« less

PAQ: Partition Analysis of Quasispecies.

PubMed

Baccam, P; Thompson, R J; Fedrigo, O; Carpenter, S; Cornette, J L

2001-01-01

The complexities of genetic data may not be accurately described by any single analytical tool. Phylogenetic analysis is often used to study the genetic relationship among different sequences. Evolutionary models and assumptions are invoked to reconstruct trees that describe the phylogenetic relationship among sequences. Genetic databases are rapidly accumulating large amounts of sequences. Newly acquired sequences, which have not yet been characterized, may require preliminary genetic exploration in order to build models describing the evolutionary relationship among sequences. There are clustering techniques that rely less on models of evolution, and thus may provide nice exploratory tools for identifying genetic similarities. Some of the more commonly used clustering methods perform better when data can be grouped into mutually exclusive groups. Genetic data from viral quasispecies, which consist of closely related variants that differ by small changes, however, may best be partitioned by overlapping groups. We have developed an intuitive exploratory program, Partition Analysis of Quasispecies (PAQ), which utilizes a non-hierarchical technique to partition sequences that are genetically similar. PAQ was used to analyze a data set of human immunodeficiency virus type 1 (HIV-1) envelope sequences isolated from different regions of the brain and another data set consisting of the equine infectious anemia virus (EIAV) regulatory gene rev. Analysis of the HIV-1 data set by PAQ was consistent with phylogenetic analysis of the same data, and the EIAV rev variants were partitioned into two overlapping groups. PAQ provides an additional tool which can be used to glean information from genetic data and can be used in conjunction with other tools to study genetic similarities and genetic evolution of viral quasispecies.

Vip3C, a Novel Class of Vegetative Insecticidal Proteins from Bacillus thuringiensis

PubMed Central

Palma, Leopoldo; Hernández-Rodríguez, Carmen Sara; Maeztu, Mireya; Hernández-Martínez, Patricia; Ruiz de Escudero, Iñigo; Escriche, Baltasar; Muñoz, Delia; Van Rie, Jeroen; Ferré, Juan

2012-01-01

Three vip3 genes were identified in two Bacillus thuringiensis Spanish collections. Sequence analysis revealed a novel Vip3 protein class (Vip3C). Preliminary bioassays of larvae from 10 different lepidopteran species indicated that Vip3Ca3 caused more than 70% mortality in four species after 10 days at 4 μg/cm2. PMID:22865065

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Treesearch

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

Strong-motion observations of the M 7.8 Gorkha, Nepal, earthquake sequence and development of the N-shake strong-motion network

USGS Publications Warehouse

Dixit, Amod; Ringler, Adam; Sumy, Danielle F.; Cochran, Elizabeth S.; Hough, Susan E.; Martin, Stacey; Gibbons, Steven; Luetgert, James H.; Galetzka, John; Shrestha, Surya; Rajaure, Sudhir; McNamara, Daniel E.

2015-01-01

We present and describe strong-motion data observations from the 2015 M 7.8 Gorkha, Nepal, earthquake sequence collected using existing and new Quake-Catcher Network (QCN) and U.S. Geological Survey NetQuakes sensors located in the Kathmandu Valley. A comparison of QCN data with waveforms recorded by a conventional strong-motion (NetQuakes) instrument validates the QCN data. We present preliminary analysis of spectral accelerations, and peak ground acceleration and velocity for earthquakes up to M 7.3 from the QCN stations, as well as preliminary analysis of the mainshock recording from the NetQuakes station. We show that mainshock peak accelerations were lower than expected and conclude the Kathmandu Valley experienced a pervasively nonlinear response during the mainshock. Phase picks from the QCN and NetQuakes data are also used to improve aftershock locations. This study confirms the utility of QCN instruments to contribute to ground-motion investigations and aftershock response in regions where conventional instrumentation and open-access seismic data are limited. Initial pilot installations of QCN instruments in 2014 are now being expanded to create the Nepal–Shaking Hazard Assessment for Kathmandu and its Environment (N-SHAKE) network.

Preliminary Analysis of Aircraft Loss of Control Accidents: Worst Case Precursor Combinations and Temporal Sequencing

NASA Technical Reports Server (NTRS)

Belcastro, Christine M.; Groff, Loren; Newman, Richard L.; Foster, John V.; Crider, Dennis H.; Klyde, David H.; Huston, A. McCall

2014-01-01

Aircraft loss of control (LOC) is a leading cause of fatal accidents across all transport airplane and operational classes, and can result from a wide spectrum of hazards, often occurring in combination. Technologies developed for LOC prevention and recovery must therefore be effective under a wide variety of conditions and uncertainties, including multiple hazards, and their validation must provide a means of assessing system effectiveness and coverage of these hazards. This requires the definition of a comprehensive set of LOC test scenarios based on accident and incident data as well as future risks. This paper defines a comprehensive set of accidents and incidents over a recent 15 year period, and presents preliminary analysis results to identify worst-case combinations of causal and contributing factors (i.e., accident precursors) and how they sequence in time. Such analyses can provide insight in developing effective solutions for LOC, and form the basis for developing test scenarios that can be used in evaluating them. Preliminary findings based on the results of this paper indicate that system failures or malfunctions, crew actions or inactions, vehicle impairment conditions, and vehicle upsets contributed the most to accidents and fatalities, followed by inclement weather or atmospheric disturbances and poor visibility. Follow-on research will include finalizing the analysis through a team consensus process, defining future risks, and developing a comprehensive set of test scenarios with correlation to the accidents, incidents, and future risks. Since enhanced engineering simulations are required for batch and piloted evaluations under realistic LOC precursor conditions, these test scenarios can also serve as a high-level requirement for defining the engineering simulation enhancements needed for generating them.

Systematic Analysis of Primary Sequence Domain Segments for the Discrimination Between Class C GPCR Subtypes.

PubMed

König, Caroline; Alquézar, René; Vellido, Alfredo; Giraldo, Jesús

2018-03-01

G-protein-coupled receptors (GPCRs) are a large and diverse super-family of eukaryotic cell membrane proteins that play an important physiological role as transmitters of extracellular signal. In this paper, we investigate Class C, a member of this super-family that has attracted much attention in pharmacology. The limited knowledge about the complete 3D crystal structure of Class C receptors makes necessary the use of their primary amino acid sequences for analytical purposes. Here, we provide a systematic analysis of distinct receptor sequence segments with regard to their ability to differentiate between seven class C GPCR subtypes according to their topological location in the extracellular, transmembrane, or intracellular domains. We build on the results from the previous research that provided preliminary evidence of the potential use of separated domains of complete class C GPCR sequences as the basis for subtype classification. The use of the extracellular N-terminus domain alone was shown to result in a minor decrease in subtype discrimination in comparison with the complete sequence, despite discarding much of the sequence information. In this paper, we describe the use of Support Vector Machine-based classification models to evaluate the subtype-discriminating capacity of the specific topological sequence segments.

Community and gene composition of a human dental plaque microbiota obtained by metagenomic sequencing

PubMed Central

Xie, G.; Chain, P.S.G.; Lo, C.; Liu, K-L.; Gans, J.; Merritt, J.; Qi, F.

2010-01-01

SUMMARY Human dental plaque is a complex microbial community containing an estimated 700 to 19,000 species/phylotypes. Despite numerous studies analysing species richness in healthy and diseased human subjects, the true genomic composition of the human dental plaque microbiota remains unknown. Here we report a metagenomic analysis of a healthy human plaque sample using a combination of second-generation sequencing platforms. A total of 860 million base pairs of non-human sequences were generated. Various analysis tools revealed the presence of 12 well-characterized phyla, members of the TM-7 and BRC1 clade, and sequences that could not be classified. Both pathogens and opportunistic pathogens were identified, supporting the ecological plaque hypothesis for oral diseases. Mapping the metagenomic reads to sequenced reference genomes demonstrated that 4% of the reads could be assigned to the sequenced species. Preliminary annotation identified genes belonging to all known functional categories. Interestingly, although 73% of the total assembled contig sequences were predicted to code for proteins, only 51% of them could be assigned a functional role. Furthermore, ~ 2.8% of the total predicted genes coded for proteins involved in resistance to antibiotics and toxic compounds, suggesting that the oral cavity is an important reservoir for antimicrobial resistance. PMID:21040513

Community and gene composition of a human dental plaque microbiota obtained by metagenomic sequencing.

PubMed

Xie, G; Chain, P S G; Lo, C-C; Liu, K-L; Gans, J; Merritt, J; Qi, F

2010-12-01

Human dental plaque is a complex microbial community containing an estimated 700 to 19,000 species/phylotypes. Despite numerous studies analysing species richness in healthy and diseased human subjects, the true genomic composition of the human dental plaque microbiota remains unknown. Here we report a metagenomic analysis of a healthy human plaque sample using a combination of second-generation sequencing platforms. A total of 860 million base pairs of non-human sequences were generated. Various analysis tools revealed the presence of 12 well-characterized phyla, members of the TM-7 and BRC1 clade, and sequences that could not be classified. Both pathogens and opportunistic pathogens were identified, supporting the ecological plaque hypothesis for oral diseases. Mapping the metagenomic reads to sequenced reference genomes demonstrated that 4% of the reads could be assigned to the sequenced species. Preliminary annotation identified genes belonging to all known functional categories. Interestingly, although 73% of the total assembled contig sequences were predicted to code for proteins, only 51% of them could be assigned a functional role. Furthermore, ~2.8% of the total predicted genes coded for proteins involved in resistance to antibiotics and toxic compounds, suggesting that the oral cavity is an important reservoir for antimicrobial resistance. © 2010 John Wiley & Sons A/S.

Preliminary consideration on the seismic actions recorded during the 2016 Central Italy seismic sequence

NASA Astrophysics Data System (ADS)

Carlo Ponzo, Felice; Ditommaso, Rocco; Nigro, Antonella; Nigro, Domenico S.; Iacovino, Chiara

2017-04-01

After the Mw 6.0 mainshock of August 24, 2016 at 03.36 a.m. (local time), with the epicenter located between the towns of Accumoli (province of Rieti), Amatrice (province of Rieti) and Arquata del Tronto (province of Ascoli Piceno), several activities were started in order to perform some preliminary evaluations on the characteristics of the recent seismic sequence in the areas affected by the earthquake. Ambient vibration acquisitions have been performed using two three-directional velocimetric synchronized stations, with a natural frequency equal to 0.5Hz and a digitizer resolution of equal to 24bit. The activities are continuing after the events of the seismic sequence of October 26 and October 30, 2016. In this paper, in order to compare recorded and code provision values in terms of peak (PGA, PGV and PGD), spectral and integral (Housner Intensity) seismic parameters, several preliminary analyses have been performed on accelerometric time-histories acquired by three near fault station of the RAN (Italian Accelerometric Network): Amatrice station (station code AMT), Norcia station (station code NRC) and Castelsantangelo sul Nera station (station code CNE). Several comparisons between the elastic response spectra derived from accelerometric recordings and the elastic demand spectra provided by the Italian seismic code (NTC 2008) have been performed. Preliminary results retrieved from these analyses highlight several apparent difference between experimental data and conventional code provision. Then, the ongoing seismic sequence appears compatible with the historical seismicity in terms of integral parameters, but not in terms of peak and spectral values. It seems appropriate to reconsider the necessity to revise the simplified design approach based on the conventional spectral values. Acknowledgements This study was partially funded by the Italian Department of Civil Protection within the project DPC-RELUIS 2016 - RS4 ''Seismic observatory of structures and health monitoring'' and by the "Centre of Integrated Geomorphology for the Mediterranean Area - CGIAM" within the Framework Agreement with the University of Basilicata "Study, Research and Experimentation in the Field of Analysis and Monitoring of Seismic Vulnerability of Strategic and Relevant Buildings for the purposes of Civil Protection and Development of Innovative Strategies of Seismic Reinforcement".

Confirmation of a novel siadenovirus species detected in raptors: partial sequence and phylogenetic analysis.

PubMed

Kovács, Endre R; Benko, Mária

2009-03-01

Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.

Gene Scanning of an Internalin B Gene Fragment Using High-Resolution Melting Curve Analysis as a Tool for Rapid Typing of Listeria monocytogenes

PubMed Central

Pietzka, Ariane T.; Stöger, Anna; Huhulescu, Steliana; Allerberger, Franz; Ruppitsch, Werner

2011-01-01

The ability to accurately track Listeria monocytogenes strains involved in outbreaks is essential for control and prevention of listeriosis. Because current typing techniques are time-consuming, cost-intensive, technically demanding, and difficult to standardize, we developed a rapid and cost-effective method for typing of L. monocytogenes. In all, 172 clinical L. monocytogenes isolates and 20 isolates from culture collections were typed by high-resolution melting (HRM) curve analysis of a specific locus of the internalin B gene (inlB). All obtained HRM curve profiles were verified by sequence analysis. The 192 tested L. monocytogenes isolates yielded 15 specific HRM curve profiles. Sequence analysis revealed that these 15 HRM curve profiles correspond to 18 distinct inlB sequence types. The HRM curve profiles obtained correlated with the five phylogenetic groups I.1, I.2, II.1, II.2, and III. Thus, HRM curve analysis constitutes an inexpensive assay and represents an improvement in typing relative to classical serotyping or multiplex PCR typing protocols. This method provides a rapid and powerful screening tool for simultaneous preliminary typing of up to 384 samples in approximately 2 hours. PMID:21227395

Preliminary crystallographic examination of a novel fungal lysozyme from Chalaropsis

NASA Technical Reports Server (NTRS)

Carter, Daniel C.; He, Xiao-Min; Lyne, James E.; Stubbs, Gerald; Hash, John H.

1990-01-01

The lysozyme from the fungus of the Chalaropsis species has been crystallized. This lysozyme displays no sequence homology with avian, phage, or mammalian lysozymes, however, preliminary studies indicate significant sequence homology with the bacterial lysozyme from Streptomyces. Both enzymes are unusual in possessing beta-1,4-N-acetylmuramidase and beta-1,4-N,6-O-diacetylmuramidase activity. The crystals grow from solutions of ammonium sulfate during growth periods from several months to a year. The space group is P2(1)2(1)2(1) with a = 34.0 A, b = 42.6 A, c = 122.1 A. Preliminary data indicate that there is 1 molecule/asymmetric unit.

Integrated Genomic Characterization Reveals Novel, Therapeutically Relevant Drug Targets in FGFR and EGFR Pathways in Sporadic Intrahepatic Cholangiocarcinoma

PubMed Central

Liang, Winnie S.; Fonseca, Rafael; Bryce, Alan H.; McCullough, Ann E.; Barrett, Michael T.; Hunt, Katherine; Patel, Maitray D.; Young, Scott W.; Collins, Joseph M.; Silva, Alvin C.; Condjella, Rachel M.; Block, Matthew; McWilliams, Robert R.; Lazaridis, Konstantinos N.; Klee, Eric W.; Bible, Keith C.; Harris, Pamela; Oliver, Gavin R.; Bhavsar, Jaysheel D.; Nair, Asha A.; Middha, Sumit; Asmann, Yan; Kocher, Jean-Pierre; Schahl, Kimberly; Kipp, Benjamin R.; Barr Fritcher, Emily G.; Baker, Angela; Aldrich, Jessica; Kurdoglu, Ahmet; Izatt, Tyler; Christoforides, Alexis; Cherni, Irene; Nasser, Sara; Reiman, Rebecca; Phillips, Lori; McDonald, Jackie; Adkins, Jonathan; Mastrian, Stephen D.; Placek, Pamela; Watanabe, Aprill T.; LoBello, Janine; Han, Haiyong; Von Hoff, Daniel; Craig, David W.; Stewart, A. Keith; Carpten, John D.

2014-01-01

Advanced cholangiocarcinoma continues to harbor a difficult prognosis and therapeutic options have been limited. During the course of a clinical trial of whole genomic sequencing seeking druggable targets, we examined six patients with advanced cholangiocarcinoma. Integrated genome-wide and whole transcriptome sequence analyses were performed on tumors from six patients with advanced, sporadic intrahepatic cholangiocarcinoma (SIC) to identify potential therapeutically actionable events. Among the somatic events captured in our analysis, we uncovered two novel therapeutically relevant genomic contexts that when acted upon, resulted in preliminary evidence of anti-tumor activity. Genome-wide structural analysis of sequence data revealed recurrent translocation events involving the FGFR2 locus in three of six assessed patients. These observations and supporting evidence triggered the use of FGFR inhibitors in these patients. In one example, preliminary anti-tumor activity of pazopanib (in vitro FGFR2 IC50≈350 nM) was noted in a patient with an FGFR2-TACC3 fusion. After progression on pazopanib, the same patient also had stable disease on ponatinib, a pan-FGFR inhibitor (in vitro, FGFR2 IC50≈8 nM). In an independent non-FGFR2 translocation patient, exome and transcriptome analysis revealed an allele specific somatic nonsense mutation (E384X) in ERRFI1, a direct negative regulator of EGFR activation. Rapid and robust disease regression was noted in this ERRFI1 inactivated tumor when treated with erlotinib, an EGFR kinase inhibitor. FGFR2 fusions and ERRFI mutations may represent novel targets in sporadic intrahepatic cholangiocarcinoma and trials should be characterized in larger cohorts of patients with these aberrations. PMID:24550739

Mining biological databases for candidate disease genes

NASA Astrophysics Data System (ADS)

Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

2001-07-01

The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

Preliminary report for analysis of genome wide mutations from four ciprofloxacin resistant B. anthracis Sterne isolates generated by Illumina, 454 sequencing and microarrays for DHS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaing, Crystal; Vergez, Lisa; Hinckley, Aubree

2011-06-21

The objective of this project is to provide DHS a comprehensive evaluation of the current genomic technologies including genotyping, Taqman PCR, multiple locus variable tandem repeat analysis (MLVA), microarray and high-throughput DNA sequencing in the analysis of biothreat agents from complex environmental samples. As the result of a different DHS project, we have selected for and isolated a large number of ciprofloxacin resistant B. anthracis Sterne isolates. These isolates vary in the concentrations of ciprofloxacin that they can tolerate, suggesting multiple mutations in the samples. In collaboration with University of Houston, Eureka Genomics and Oak Ridge National Laboratory, we analyzedmore » the ciprofloxacin resistant B. anthracis Sterne isolates by microarray hybridization, Illumina and Roche 454 sequencing to understand the error rates and sensitivity of the different methods. The report provides an assessment of the results and a complete set of all protocols used and all data generated along with information to interpret the protocols and data sets.« less

Molecular analysis of the AGXT gene in Italian patients with primary hyperoxaluria type 1 (PH1).

PubMed

Ferrettini, C; Pirulli, D; Cosseddu, D; Marangella, M; Petrarulo, M; Mazzola, G; Vatta, S; Amoroso, A

1998-01-01

Specimens were collected from 22 Italian patients with primary hyperoxaluria type 1 (PH1). Ten of them had already been analyzed by molecular biology. To clarify the molecular characteristics of the AGXT gene disease responsible for PH1, DNA samples were examined for known mutations by hybridisation of PCR products with Sequence Specific Oligonucleotides (PCR-SSO). We planned to identify new mutations of the AGXT gene by heteroduplex analysis followed by direct sequencing. We had already standardized a) the conditions for the amplification of the 11 exons of AGXT, b) the PCR-SSO technique and c) the heteroduplex analysis of amplified products. Preliminary results demonstrated that the AGXT mutations described in previous studies were found only in 40% of the examined Italian patients with PH1. The remaining 60% of mutations should be characterised in future studies.

Influence of solar flares on the X-ray corona

NASA Technical Reports Server (NTRS)

Rust, D. M.; Batchelor, D. A.

1986-01-01

Sequences of X-ray images of solar flares, obtained with the Hard X-ray Imaging Spectrometer on the SMM spacecraft, reveal many dynamical phenomena. Movies of 20 flares recorded with 6-sec time resolution were examined. A preliminary analysis of the events as a group are presented, and some new aspects of the well-studied May 21, 1980 flare and a November 6, 1980 flare are discussed.

Phytoene Desaturase from Oryza sativa: Oligomeric Assembly, Membrane Association and Preliminary 3D-Analysis

PubMed Central

Koschmieder, Julian; Brausemann, Anton; Drepper, Friedel; Rodriguez-Franco, Marta; Ghisla, Sandro; Warscheid, Bettina; Einsle, Oliver; Beyer, Peter

2015-01-01

Recombinant phytoene desaturase (PDS-His6) from rice was purified to near-homogeneity and shown to be enzymatically active in a biphasic, liposome-based assay system. The protein contains FAD as the sole protein-bound redox-cofactor. Benzoquinones, not replaceable by molecular oxygen, serve as a final electron acceptor defining PDS as a 15-cis-phytoene (donor):plastoquinone oxidoreductase. The herbicidal PDS-inhibitor norflurazon is capable of arresting the reaction by stabilizing the intermediary FADred, while an excess of the quinone acceptor relieves this blockage, indicating competition. The enzyme requires its homo-oligomeric association for activity. The sum of data collected through gel permeation chromatography, non-denaturing polyacrylamide electrophoresis, chemical cross-linking, mass spectrometry and electron microscopy techniques indicate that the high-order oligomers formed in solution are the basis for an active preparation. Of these, a tetramer consisting of dimers represents the active unit. This is corroborated by our preliminary X-ray structural analysis that also revealed similarities of the protein fold with the sequence-inhomologous bacterial phytoene desaturase CRTI and other oxidoreductases of the GR2-family of flavoproteins. This points to an evolutionary relatedness of CRTI and PDS yielding different carotene desaturation sequences based on homologous protein folds. PMID:26147209

Breath-held MR Cholangiopancreatography (MRCP) using a 3D Dixon fat–water separated balanced steady state free precession sequence

PubMed Central

Glockner, James F.; Saranathan, Manojkumar; Bayram, Ersin; Lee, Christine U.

2014-01-01

A novel 3D breath-held Dixon fat–water separated balanced steady state free precession (b-SSFP) sequence for MR cholangiopancreatography (MRCP) is described and its potential clinical utility assessed in a series of patients. The main motivation is to develop a robust breath-held alternative to the respiratory gated 3D Fast Spin Echo (FSE) sequence, the current clinical sequence of choice for MRCP. Respiratory gated acquisitions are susceptible to motion artifacts and blurring in patients with significant diaphragmatic drift, erratic respiratory rhythms or sleep apnea. A two point Dixon fat–water separation scheme was developed which eliminates signal loss arising from B0 inhomogeneity effects and minimizes artifacts from perturbation of the b-SSFP steady state. Preliminary results from qualitative analysis of 49 patients demonstrate robust performance of the 3D Dixon b-SSFP sequence with diagnostic image quality acquired in a 20–24 s breath-hold. PMID:23876262

Crystallization and preliminary X-ray analysis of Leishmania major glyoxalase I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ariza, Antonio; Vickers, Tim J.; Greig, Neil

2005-08-01

The detoxification enzyme glyoxalase I from L. major has been crystallized. Preliminary molecular-replacement calculations indicate the presence of three glyoxalase I dimers in the asymmetric unit. Glyoxalase I (GLO1) is a putative drug target for trypanosomatids, which are pathogenic protozoa that include the causative agents of leishmaniasis. Significant sequence and functional differences between Leishmania major and human GLO1 suggest that it may make a suitable template for rational inhibitor design. L. major GLO1 was crystallized in two forms: the first is extremely disordered and does not diffract, while the second, an orthorhombic form, produces diffraction to 2.0 Å. Molecular-replacement calculationsmore » indicate that there are three GLO1 dimers in the asymmetric unit, which take up a helical arrangement with their molecular dyads arranged approximately perpendicular to the c axis. Further analysis of these data are under way.« less

The utility of DNA sequences of an intron from the beta-fibrinogen gene in phylogenetic analysis of woodpeckers (Aves: Picidae).

PubMed

Prychitko, T M; Moore, W S

1997-10-01

Estimating phylogenies from DNA sequence data has become the major methodology of molecular phylogenetics. To date, molecular phylogenetics of the vertebrates has been very dependent on mtDNA, but studies involving mtDNA are limited because the several genes comprising the mt-genome are inherited as a single linkage group. The only apparent solution to this problem is to sequence additional genes, each representing a distinct linkage group, so that the resultant gene trees provide independent estimates of the species tree. There exists the need to find novel gene sequences which contain enough phylogenetic information to resolve relationships between closely related species. A possible source is the nuclear-encoded introns, because they evolve more rapidly than exons. We designed primers to amplify and sequence the 7 intron from the beta-fibrinogen gene for a recently evolved group, the woodpeckers. We sequenced the entire intron for 10 specimens representing five species. Nucleotide substitutions are randomly distributed along the length of the intron, suggesting selective neutrality. A preliminary analysis indicates that the phylogenetic signal in the intron is as strong as that in the mitochondrial encoded cytochrome b (cyt b) gene. The topology of the beta-fibrinogen tree is identical to that of the cyt b tree. This analysis demonstrates the ability of the 7 intron of beta-fibrinogen to provide well resolved, independent gene trees for recently evolved groups and establishes it as a source of sequences to be used in other phylogenetic studies. Copyright 1997 Academic Press

The Nature of Red-Sequence Cluster Spiral Galaxies

NASA Astrophysics Data System (ADS)

Kashur, Lane; Barkhouse, Wayne; Sultanova, Madina; Kalawila Vithanage, Sandanuwa; Archer, Haylee; Foote, Gregory; Mathew, Elijah; Rude, Cody; Lopez-Cruz, Omar

2017-01-01

Preliminary analysis of the red-sequence galaxy population from a sample of 57 low-redshift galaxy clusters observed using the KPNO 0.9m telescope and 74 clusters from the WINGS dataset, indicates that a small fraction of red-sequence galaxies have a morphology consistent with spiral systems. For spiral galaxies to acquire the color of elliptical/S0s at a similar luminosity, they must either have been stripped of their star-forming gas at an earlier epoch, or contain a larger than normal fraction of dust. To test these ideas we have compiled a sample of red-sequence spiral galaxies and examined their infrared properties as measured by 2MASS, WISE, Spitzer, and Herschel. These IR data allows us to estimate the amount of dust in each of our red-sequence spiral galaxies. We compare the estimated dust mass in each of these red-sequence late-type galaxies with spiral galaxies located in the same cluster field but having colors inconsistent with the red-sequence. We thus provide a statistical measure to discriminate between purely passive spiral galaxy evolution and dusty spirals to explain the presence of these late-type systems in cluster red-sequences.

Partial Gene Sequencing of CYP1A, Vitellogenin, and Metallothionein in Mosquitofish Gambusia yucatana and Gambusia sexradiata.

PubMed

Vázquez-Euán, Roberto; Escalante-Herrera, Karla S; Rodríguez-Fuentes, Gabriela

2017-01-01

Ground characteristics in the Yucatan Peninsula make recovery and treatment of wastewater very expensive. This situation has contributed to an increase of pollutants in the aquifer. Unfortunately, studies related to the effects of those pollutants in native organisms are scarce. The aim of this work was to obtain partial sequences of widely known genes used as biomarkers of pollutant effect in Gambusia yucatana and Gambusia sexradiata. The studied genes were: cytochrome P450 1A (CYP1A); vitellogenin (VTG); metallothionein (MT), and two housekeeping genes, 18S and β-actin. From reported sequences of Gambusia affinis, primers were designed and amplification was done in the local Gambusia species exposed for 48 h to gasoline (100 µL/L, stirred for 24 h pre-exposure). Preliminary results revealed partial sequences of all genes with an approximate average length of 200 bp. BLAST analysis of found sequences indicated a minimum of 97% identity with reported sequences for G. affinis or Gambusia holbrooki showing great similarity.

Mammary Cancer and Activation of Transposable Elements

DTIC Science & Technology

2015-03-01

regularly hold meetings. • Completed Y1 4-6 6. • Preliminary Methyl-MAPS analysis of pilot virgin samples • This material was never received. Based...construct the libraries for sequencing. A strategic decision was made to hold the material for validation, rather than attempt library construction. Y2 10...derived adipo- cytes and ADS-derived induced pluripotent stem cells (ADS-iPSCs) (19) and primary mouse ES cells to isolated sperm and oocytes (20). We

Draft Genome Sequence of Janthinobacterium sp. Strain ROICE36, a Putative Secondary Metabolite-Synthesizing Bacterium Isolated from Antarctic Snow

PubMed Central

Chiriac, Cecilia; Baricz, Andreea

2018-01-01

ABSTRACT The draft genome assembly of Janthinobacterium sp. strain ROICE36 has 207 contigs, with a total genome size of 5,977,006 bp and a G+C content of 62%. Preliminary genome analysis identified 5,363 protein-coding genes and a total of 7 secondary metabolic gene clusters (encoding bacteriocins, nonribosomal peptide-synthetase [NRPS], terpene, hserlactone, and other ketide synthases). PMID:29650588

Aspergillus tubingensis and Aspergillus niger as the dominant black Aspergillus, use of simple PCR-RFLP for preliminary differentiation.

PubMed

Mirhendi, H; Zarei, F; Motamedi, M; Nouripour-Sisakht, S

2016-03-01

This work aimed to identify the species distribution of common clinical and environmental isolates of black Aspergilli based on simple restriction fragment length polymorphism (RFLP) analysis of the β-tubulin gene. A total of 149 clinical and environmental strains of black Aspergilli were collected and subjected to preliminary morphological examination. Total genomic DNAs were extracted, and PCR was performed to amplify part of the β-tubulin gene. At first, 52 randomly selected samples were species-delineated by sequence analysis. In order to distinguish the most common species, PCR amplicons of 117 black Aspergillus strains were identified by simple PCR-RFLP analysis using the enzyme TasI. Among 52 sequenced isolates, 28 were Aspergillus tubingensis, 21 Aspergillus niger, and the three remaining isolates included Aspergillus uvarum, Aspergillus awamori, and Aspergillus acidus. All 100 environmental and 17 BAL samples subjected to TasI-RFLP analysis of the β-tubulin gene, fell into two groups, consisting of about 59% (n=69) A. tubingensis and 41% (n=48) A. niger. Therefore, the method successfully and rapidly distinguished A. tubingensis and A. niger as the most common species among the clinical and environmental isolates. Although tardy, the Ehrlich test was also able to differentiate A. tubingensis and A. niger according to the yellow color reaction specific to A. niger. A. tubingensis and A. niger are the most common black Aspergillus in both clinical and environmental isolates in Iran. PCR-RFLP using TasI digestion of β-tubulin DNA enables rapid screening for these common species. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Preliminary Identification and Typing of Pathogenic and Toxigenic Fusarium Species Using Restriction Digestion of ITS1-5.8S rDNA-ITS2 Region.

PubMed

Mirhendi, H; Ghiasian, A; Vismer, Hf; Asgary, Mr; Jalalizand, N; Arendrup, Mc; Makimura, K

2010-01-01

Fusarium species are capable of causing a wide range of crop plants infections as well as uncommon human infections. Many species of the genus produce mycotoxins, which are responsible for acute or chronic diseases in animals and humans. Identification of Fusaria to the species level is necessary for biological, epidemiological, pathological, and toxicological purposes. In this study, we undertook a computer-based analysis of ITS1-5.8SrDNA-ITS2 in 192 GenBank sequences from 36 Fusarium species to achieve data for establishing a molecular method for specie-specific identification. Sequence data and 610 restriction enzymes were analyzed for choosing RFLP profiles, and subsequently designed and validated a PCR-restriction enzyme system for identification and typing of species. DNA extracted from 32 reference strains of 16 species were amplified using ITS1 and ITS4 universal primers followed by sequencing and restriction enzyme digestion of PCR products. The following 3 restriction enzymes TasI, ItaI and CfoI provide the best discriminatory power. Using ITS1 and ITS4 primers a product of approximately 550bp was observed for all Fusarium strains, as expected regarding the sequence analyses. After RFLP of the PCR products, some species were definitely identified by the method and some strains had different patterns in same species. Our profile has potential not only for identification of species, but also for genotyping of strains. On the other hand, some Fusarium species were 100% identical in their ITS-5.8SrDNA-ITS2 sequences, therefore differentiation of these species is impossible regarding this target alone. ITS-PCR-RFLP method might be useful for preliminary differentiation and typing of most common Fusarium species.

Preparation of Meloidogyne javanica near-isogenic lines virulent and avirulent against the tomato resistance gene Mi and preliminary analyses of the genetic variation between the two lines.

PubMed

Xu, Jian-Hua; Narabu, Takashi; Li, Hong-Mei; Fu, Peng

2002-01-01

Meloidogyne javanica, reproducing by mitotic parthenogenesis, is an economically important pathogen of a wide range of crops. A pair of near-isogenic lines virulent and avirulent toward the tomato resistance gene Mi were prepared for M. javanica by continuously selecting an avirulent population on the resistant tomato cultivar Momotaro over 19 generations. Random amplified polymorphic DNA (RAPD) analysis with 102 primers revealed that RAPD patterns were highly conserved between the virulent and avirulent lines, confirming that the two lines were genomically very similar. Nevertheless, with one of the primers a distinct polymorphic fragment, specific for the avirulent lines, was amplified. Southern hybridization results indicated that the polymorphic fragment and its homologs were deleted from the genome of the virulent line during the process of virulence acquisition. Sequence analysis and homology searches of public data bases, however, revealed no published sequences significantly similar to the sequence of the fragment, precluding a prediction of the potential function of the sequence. The successful preparation of the near-isogenic Mi-virulent and avirulent lines laid a firm foundation for the further identification and isolation of virulence-related genes in M. javanica.

Mitochondrial DNA sequence data reveals association of haplogroup U with psychosis in bipolar disorder.

PubMed

Frye, Mark A; Ryu, Euijung; Nassan, Malik; Jenkins, Gregory D; Andreazza, Ana C; Evans, Jared M; McElroy, Susan L; Oglesbee, Devin; Highsmith, W Edward; Biernacka, Joanna M

2017-01-01

Converging genetic, postmortem gene-expression, cellular, and neuroimaging data implicate mitochondrial dysfunction in bipolar disorder. This study was conducted to investigate whether mitochondrial DNA (mtDNA) haplogroups and single nucleotide variants (SNVs) are associated with sub-phenotypes of bipolar disorder. MtDNA from 224 patients with Bipolar I disorder (BPI) was sequenced, and association of sequence variations with 3 sub-phenotypes (psychosis, rapid cycling, and adolescent illness onset) was evaluated. Gene-level tests were performed to evaluate overall burden of minor alleles for each phenotype. The haplogroup U was associated with a higher risk of psychosis. Secondary analyses of SNVs provided nominal evidence for association of psychosis with variants in the tRNA, ND4 and ND5 genes. The association of psychosis with ND4 (gene that encodes NADH dehydrogenase 4) was further supported by gene-level analysis. Preliminary analysis of mtDNA sequence data suggests a higher risk of psychosis with the U haplogroup and variation in the ND4 gene implicated in electron transport chain energy regulation. Further investigation of the functional consequences of this mtDNA variation is encouraged. Copyright © 2016. Published by Elsevier Ltd.

Initial sequence and comparative analysis of the cat genome

PubMed Central

Pontius, Joan U.; Mullikin, James C.; Smith, Douglas R.; Lindblad-Toh, Kerstin; Gnerre, Sante; Clamp, Michele; Chang, Jean; Stephens, Robert; Neelam, Beena; Volfovsky, Natalia; Schäffer, Alejandro A.; Agarwala, Richa; Narfström, Kristina; Murphy, William J.; Giger, Urs; Roca, Alfred L.; Antunes, Agostinho; Menotti-Raymond, Marilyn; Yuhki, Naoya; Pecon-Slattery, Jill; Johnson, Warren E.; Bourque, Guillaume; Tesler, Glenn; O’Brien, Stephen J.

2007-01-01

The genome sequence (1.9-fold coverage) of an inbred Abyssinian domestic cat was assembled, mapped, and annotated with a comparative approach that involved cross-reference to annotated genome assemblies of six mammals (human, chimpanzee, mouse, rat, dog, and cow). The results resolved chromosomal positions for 663,480 contigs, 20,285 putative feline gene orthologs, and 133,499 conserved sequence blocks (CSBs). Additional annotated features include repetitive elements, endogenous retroviral sequences, nuclear mitochondrial (numt) sequences, micro-RNAs, and evolutionary breakpoints that suggest historic balancing of translocation and inversion incidences in distinct mammalian lineages. Large numbers of single nucleotide polymorphisms (SNPs), deletion insertion polymorphisms (DIPs), and short tandem repeats (STRs), suitable for linkage or association studies were characterized in the context of long stretches of chromosome homozygosity. In spite of the light coverage capturing ∼65% of euchromatin sequence from the cat genome, these comparative insights shed new light on the tempo and mode of gene/genome evolution in mammals, promise several research applications for the cat, and also illustrate that a comparative approach using more deeply covered mammals provides an informative, preliminary annotation of a light (1.9-fold) coverage mammal genome sequence. PMID:17975172

Sirius PSB: a generic system for analysis of biological sequences.

PubMed

Koh, Chuan Hock; Lin, Sharene; Jedd, Gregory; Wong, Limsoon

2009-12-01

Computational tools are essential components of modern biological research. For example, BLAST searches can be used to identify related proteins based on sequence homology, or when a new genome is sequenced, prediction models can be used to annotate functional sites such as transcription start sites, translation initiation sites and polyadenylation sites and to predict protein localization. Here we present Sirius Prediction Systems Builder (PSB), a new computational tool for sequence analysis, classification and searching. Sirius PSB has four main operations: (1) Building a classifier, (2) Deploying a classifier, (3) Search for proteins similar to query proteins, (4) Preliminary and post-prediction analysis. Sirius PSB supports all these operations via a simple and interactive graphical user interface. Besides being a convenient tool, Sirius PSB has also introduced two novelties in sequence analysis. Firstly, genetic algorithm is used to identify interesting features in the feature space. Secondly, instead of the conventional method of searching for similar proteins via sequence similarity, we introduced searching via features' similarity. To demonstrate the capabilities of Sirius PSB, we have built two prediction models - one for the recognition of Arabidopsis polyadenylation sites and another for the subcellular localization of proteins. Both systems are competitive against current state-of-the-art models based on evaluation of public datasets. More notably, the time and effort required to build each model is greatly reduced with the assistance of Sirius PSB. Furthermore, we show that under certain conditions when BLAST is unable to find related proteins, Sirius PSB can identify functionally related proteins based on their biophysical similarities. Sirius PSB and its related supplements are available at: http://compbio.ddns.comp.nus.edu.sg/~sirius.

Cascade Optimization Strategy with Neural Network and Regression Approximations Demonstrated on a Preliminary Aircraft Engine Design

NASA Technical Reports Server (NTRS)

Hopkins, Dale A.; Patnaik, Surya N.

2000-01-01

A preliminary aircraft engine design methodology is being developed that utilizes a cascade optimization strategy together with neural network and regression approximation methods. The cascade strategy employs different optimization algorithms in a specified sequence. The neural network and regression methods are used to approximate solutions obtained from the NASA Engine Performance Program (NEPP), which implements engine thermodynamic cycle and performance analysis models. The new methodology is proving to be more robust and computationally efficient than the conventional optimization approach of using a single optimization algorithm with direct reanalysis. The methodology has been demonstrated on a preliminary design problem for a novel subsonic turbofan engine concept that incorporates a wave rotor as a cycle-topping device. Computations of maximum thrust were obtained for a specific design point in the engine mission profile. The results (depicted in the figure) show a significant improvement in the maximum thrust obtained using the new methodology in comparison to benchmark solutions obtained using NEPP in a manual design mode.

Sublaminate analysis of interlaminar fracture in composites

NASA Technical Reports Server (NTRS)

Armanios, E. A.; Rehfield, L. W.

1986-01-01

A simple analysis method based upon a transverse shear deformation theory and a sublaminate approach is utilized to analyze a mixed-mode edge delamination specimen. The analysis provides closed form expressions for the interlaminar shear stresses ahead of the crack, the total energy release rate, and the energy release rate components. The parameters controlling the behavior are identified. The effect of specimen stacking sequence and delamination interface on the strain energy release rate components is investigated. Results are compared with a finite element simulation for reference. The simple nature of the method makes it suitable for preliminary design analyses which require a large number of configurations to be evaluated quickly and economically.

Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments.

PubMed

Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

2017-01-01

In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis.

Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments

PubMed Central

Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

2017-01-01

In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249

Divergent Cryptosporidium parvum subtype and Enterocytozoon bieneusi genotypes in dromedary camels in Algeria.

PubMed

Baroudi, Djamel; Zhang, Hongwei; Amer, Said; Khelef, Djamel; Roellig, Dawn M; Wang, Yuanfei; Feng, Yaoyu; Xiao, Lihua

2018-03-01

Little information is available on the occurrence of the zoonotic protists Cryptosporidium spp. and none on Enterocytozoon bieneusi in camels. This preliminary study was conducted to examine the identity of Cryptosporidium subtypes and E. bieneusi genotypes in dromedary camels in Algeria. A total of 39 fecal specimens were collected from young camels. PCR-sequence analysis of the small subunit rRNA was used to detect and genotype Cryptosporidium spp. Cryptosporidium parvum present was further subtyped by sequence analysis of the 60 kDa glycoprotein gene. PCR-sequence analysis of the ribosomal internal transcribed spacer gene was used to detect and genotype E. bieneusi. Altogether, two and eight of the specimens analyzed were positive for C. parvum and E. bieneusi, respectively. The former was identified as a new subtype that is genetically related to the C. hominis If subtype family, whereas the latter was identified as two related genotypes (Macaque1 and a novel genotype) in the newly assigned E. bieneusi genotype group 8. Although they are not known hosts for C. parvum and E. bieneusi, camels are apparently infected with genetically distinct variants of these pathogens.

Analysis of mutational spectra by denaturant capillary electrophoresis

PubMed Central

Ekstrøm, Per O.; Khrapko, Konstantin; Li-Sucholeiki, Xiao-Cheng; Hunter, Ian W.; Thilly, William G.

2009-01-01

Numbers and kinds of point mutant within DNA from cells, tissues and human population may be discovered for nearly any 75–250bp DNA sequence. High fidelity DNA amplification incorporating a thermally stable DNA “clamp” is followed by separation by denaturing capillary electrophoresis (DCE). DCE allows for peak collection and verification sequencing. DCE in a mode of cycling temperature, e.g.+/− 5°C, CyDCE, permits high resolution of mutant sequences using computer defined analytes without preliminary optimization experiments. DNA sequencers have been modified to permit higher throughput CyDCE and a massively parallel,~25,000 capillary system, has been designed for pangenomic scans in large human populations. DCE has been used to define quantitative point mutational spectra for study a wide variety of genetic phenomena: errors of DNA polymerases, mutations induced in human cells by chemicals and irradiation, testing of human gene-common disease associations and the discovery of origins of point mutations in human development and carcinogenesis. PMID:18600220

Differential expression analysis of Paralichthys olivaceus microRNAs in adult ovary and testis by deep sequencing.

PubMed

Gu, Yifeng; Zhang, Lei; Chen, Xiaowu

2014-08-01

MicroRNAs (miRNAs) play an important role in gonadal development and differentiation in fish. However, understanding of the mechanism of this process is hindered by our poor knowledge of miRNA expression patterns in fish gonads. In this study, miRNA libraries derived from adult gonads of Paralichthys olivaceus were generated by using next-generation sequencing (NGS) technology. Bioinformatics analysis was performed to distinguish mature miRNA sequences from two classes of small RNAs represented in the sequencing data. A total of 141 mature miRNAs were identified, in which 21 miRNAs were found in P. olivaceus for the first time. Variance and preference of miRNAs expression were concluded from the deep sequencing reads. Some miRNAs, such as pol-miR-143, pol-miR-26a and pol-let-7a were found with quite high expression levels in both gonads, while some exhibited a clear sex-biased expression in different gonad. Approximate 20.0% and 13.1% of the isolated miRNAs were preferentially expressed in the testis (FC<0.5) or ovary (FC>2), respectively. The identification and the preliminary analysis of the sex-biased expression of miRNAs in P. olivaceus gonads in our work by using NGS will provide us a basic catalog of miRNAs to facilitate future improvement and exploitation of sexual regulatory mechanisms in P. olivaceus. Copyright © 2014. Published by Elsevier Inc.

The Nerium oleander aphid Aphis nerii is tolerant to a local isolate of Aphid lethal paralysis virus (ALPV).

PubMed

Dombrovsky, Aviv; Luria, Neta

2013-04-01

In a survey that was conducted during the year 2011, a local strain of Aphid lethal paralysis virus (ALPV) was identified and isolated from a wild population of Aphis nerii aphids living on Nerium oleander plants located in northern Israel. The new strain was tentatively named (ALPV-An). RNA extracted from the viral particles allowed the amplification and determination of the complete genome sequence. The virus genome is comprised of 9835 nucleotides. In a BLAST search analysis, the ALPV-An sequence showed 89 % nucleotide sequence identity with the whole genome of a South African ALPV and 96 and 94 % amino acid sequence identity with the ORF1 and ORF2 of that strain, respectively. In preliminary experiments, spray-applied, purified ALPV virions were highly pathogenic to the green peach aphid Myzus persicae; 95 % mortality was recorded 4 days post-infection. These preliminary results demonstrate the potential of ALPV for use as a biologic agent for some aphid control. Surprisingly, no visible ALPV pathogenic effects, such as morphological changes or paralysis, were observed in the A. nerii aphids infected with ALPV-An. The absence of clear ALPV symptoms in A. nerii led to the formulation of two hypotheses, which were partially examined in this study. The first hypothesis suggest that A. nerii is resistant or tolerant of ALPV, while the second hypothesis propose that ALPV-An may be a mild strain of ALPV. Currently, our results is in favor with the first hypothesis since ALPV-An is cryptic in A. nerii aphids and can be lethal for M. persicae aphids.

Isolation of mini- and microsatellite loci from chromosome 19 library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prosnyak, M.I.; Belajeva, O.V.; Polukarova, L.G.

Mini- and microsatellite sequences are abundant in the human genome and are very useful as genetic markers. We report the isolation of a panel of clones containing marker sequences from chromosome 19. We screened 10,000 clones from the chromosome 19 cosmid library for the presence of di-(CA)n, tri-(TCC)n, (CAC)n microsatellites and M13-like minisatellite sequences. For this we have used synthetic oligonucleotides and polynucleotides, including micro- (CA, TCC, CAC) and minisatellite (M13 core) sequences. Preliminary results indicated that the chromosome 19 cosmid library contained both human and hamster clones. In order to identify human sequences from this library we have developedmore » the technique of colony and blot hybridization with Alu-PCR, L1-PCR and B1-PCR probes. Dozens of clones have been selected, some of which were analyzed by conventional Southern blot analysis and non-radioactive in situ hybridization of chromosomes. Highly informative markers derived from these clones will be used for physical and genetic mapping of chromosome 19.« less

Dynamics of distribution and density of phreatophytes and other arid land plant communities

NASA Technical Reports Server (NTRS)

Turner, R. M. (Principal Investigator)

1973-01-01

The author has identified the following significant results. Ground truth measurements of plant coverage on six satellite overflight dates reveal unique trends in coverage for the five desert or semi-desert communities selected. Densitometry and multispectral additive color viewing were used in a preliminary analysis of imagery using the electronic satellite image analyzer console at Stanford Research Institute. The densitometric analysis shows promise for mapping boundaries between plant communities. Color additive viewing of a chronologic sequence of the same scene shown in rapid order will provide a method for mapping phreatophyte communities.

Spectral Analysis of the O(He)-Type Central Stars of the Planetary Nebulae K 1-27 and LoTr 4

NASA Technical Reports Server (NTRS)

Reindl, N.; Ringat, E.; Rauch, T.; Werner, K.; Kruk, J. W.

2011-01-01

The four known O(He) stars are the only amongst the hottest post-AGB stars whose atmospheres are composed of almost pure helium. Thus, their evolution deviates from the hydrogen-defiCient post-AGB evolutionary sequence of carbon-dominated stars like e.g. PG 1159 stars. The origin of the O(He) stars is still not explained. They might be either post-early AGB stars or the progeny of R Coronae Borealis stars. We present preliminary results of a non-LTE spectral analysis based on FUSE and HST/COS observations.

Low-coverage, whole-genome sequencing of Artocarpus camansi (Moraceae) for phylogenetic marker development and gene discovery1

PubMed Central

Gardner, Elliot M.; Johnson, Matthew G.; Ragone, Diane; Wickett, Norman J.; Zerega, Nyree J. C.

2016-01-01

Premise of the study: We used moderately low-coverage (17×) whole-genome sequencing of Artocarpus camansi (Moraceae) to develop genomic resources for Artocarpus and Moraceae. Methods and Results: A de novo assembly of Illumina short reads (251,378,536 pairs, 2 × 100 bp) accounted for 93% of the predicted genome size. Predicted coding regions were used in a three-way orthology search with published genomes of Morus notabilis and Cannabis sativa. Phylogenetic markers for Moraceae were developed from 333 inferred single-copy exons. Ninety-eight putative MADS-box genes were identified. Analysis of all predicted coding regions resulted in preliminary annotation of 49,089 genes. An analysis of synonymous substitutions for pairs of orthologs (Ks analysis) in M. notabilis and A. camansi strongly suggested a lineage-specific whole-genome duplication in Artocarpus. Conclusions: This study substantially increases the genomic resources available for Artocarpus and Moraceae and demonstrates the value of low-coverage de novo assemblies for nonmodel organisms with moderately large genomes. PMID:27437173

Expressed MHC class II genes in sea otters (Enhydra lutris) from geographically disparate populations

USGS Publications Warehouse

Bowen, Lizabeth; Aldridge, B.M.; Miles, A. Keith; Stott, J.L.

2006-01-01

The major histocompatibility complex (MHC) is central to maintaining the immunologic vigor of individuals and populations. Classical MHC class II genes were targeted for partial sequencing in sea otters (Enhydra lutris) from populations in California, Washington, and Alaska. Sequences derived from sea otter peripheral blood leukocyte mRNAs were similar to those classified as DQA, DQB, DRA, and DRB in other species. Comparisons of the derived amino acid compositions supported the classification of these as functional molecules from at least one DQA, DQB, and DRA locus and at least two DRB loci. While limited in scope, phylogenetic analysis of the DRB peptide‐binding region suggested the possible existence of distinct clades demarcated by geographic region. These preliminary findings support the need for additional MHC gene sequencing and expansion to a comprehensive study targeting additional otters.

A Module Experimental Process System Development Unit (MEPSDU)

NASA Technical Reports Server (NTRS)

1981-01-01

The purpose of this program is to demonstrate the technical readiness of a cost effective process sequence that has the potential for the production of flat plate photovoltaic modules which met the price goal in 1986 of $.70 or less per watt peak. Program efforts included: preliminary design review, preliminary cell fabrication using the proposed process sequence, verification of sandblasting back cleanup, study of resist parameters, evaluation of pull strength of the proposed metallization, measurement of contact resistance of Electroless Ni contacts, optimization of process parameter, design of the MEPSDU module, identification and testing of insulator tapes, development of a lamination process sequence, identification, discussions, demonstrations and visits with candidate equipment vendors, evaluation of proposals for tabbing and stringing machine.

Teaching Inquiry with Linked Classes and Learning Communities

ERIC Educational Resources Information Center

Piercey, Victor; Cullen, Roxanne

2017-01-01

In order to improve problem-solving dispositions, a section of an inquiry-based math sequence for first-year business students was linked with a section of our general education English sequence. We describe how the linked classes worked and compare some preliminary results from linked and unlinked sections of the math sequence.

Genome Sequences for Five Strains of the Emerging Pathogen Haemophilus haemolyticus

PubMed Central

Jordan, I. King; Conley, Andrew B.; Antonov, Ivan V.; Arthur, Robert A.; Cook, Erin D.; Cooper, Guy P.; Jones, Bernard L.; Knipe, Kristen M.; Lee, Kevin J.; Liu, Xing; Mitchell, Gabriel J.; Pande, Pushkar R.; Petit, Robert A.; Qin, Shaopu; Rajan, Vani N.; Sarda, Shruti; Sebastian, Aswathy; Tang, Shiyuyun; Thapliyal, Racchit; Varghese, Neha J.; Ye, Tianjun; Katz, Lee S.; Wang, Xin; Rowe, Lori; Frace, Michael; Mayer, Leonard W.

2011-01-01

We report the first whole-genome sequences for five strains, two carried and three pathogenic, of the emerging pathogen Haemophilus haemolyticus. Preliminary analyses indicate that these genome sequences encode markers that distinguish H. haemolyticus from its closest Haemophilus relatives and provide clues to the identity of its virulence factors. PMID:21952546

Theoretical study of refraction effects on noise produced by turbulent jets

NASA Technical Reports Server (NTRS)

Graham, E. W.; Graham, B. B.

1975-01-01

The transmission of acoustic disturbances from the interior of a jet into the ambient air is studied. The jet is assumed infinitely long with mean velocity profile independent of streamwise location. The noise generator is a sequence of transient sources drifting with the local fluid and confined to a short length of the jet. In Part 1, supersonic jets are considered. Numerical results for mean-square pressure versus angle in the far-field show unexpected peaks which are very sharp. Analysis of simplified models indicates that these are complex quasi-resonant effects which appear to the stationary observer in a high frequency range. The peaks are real for the idealized model, but would be smoothed by mathematical integration over source position, velocity, and frequency. Subsonic jets were considered in part 2, and a preliminary study of the near-field was attempted. Mean-square radial displacements (or mean radial energy flow or space-time correlations of radial pressure gradient) are first found for very simple cases. The most difficult case studied is a sequence of transient sources at the center of a uniform-velocity circular cylindrical jet. Here a numerical triple integration is required and seems feasible although only preliminary results for mean square radial displacement are now available. These preliminary results show disturbances decreasing with increasing radial distance, and with increasing distance upstream and downstream from the source. A trend towards greater downstream disturbances appears even in the near field.

PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

PubMed

Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

2016-09-01

The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

The ASTRAL Compendium in 2004

DOE R&D Accomplishments Database

Chandonia, John-Marc; Hon, Gary; Walker, Nigel S.; Lo Conte, Loredana; Koehl, Patrice; Levitt, Michael; Brenner, Steven E.

2003-09-15

The ASTRAL compendium provides several databases and tools to aid in the analysis of protein structures, particularly through the use of their sequences. Partially derived from the SCOP database of protein structure domains, it includes sequences for each domain and other resources useful for studying these sequences and domain structures. The current release of ASTRAL contains 54,745 domains, more than three times as many as the initial release four years ago. ASTRAL has undergone major transformations in the past two years. In addition to several complete updates each year, ASTRAL is now updated on a weekly basis with preliminary classifications of domains from newly released PDB structures. These classifications are available as a stand-alone database, as well as available integrated into other ASTRAL databases such as representative subsets. To enhance the utility of ASTRAL to structural biologists, all SCOP domains are now made available as PDB-style coordinate files as well as sequences. In addition to sequences and representative subsets based on SCOP domains, sequences and subsets based on PDB chains are newly included in ASTRAL. Several search tools have been added to ASTRAL to facilitate retrieval of data by individual users and automated methods.

Draft genome sequence of Streptomyces sp. strain F1, a potential source for glycoside hydrolases isolated from Brazilian soil.

PubMed

Melo, Ricardo Rodrigues de; Persinoti, Gabriela Felix; Paixão, Douglas Antonio Alvaredo; Squina, Fábio Márcio; Ruller, Roberto; Sato, Helia Harumi

Here, we show the draft genome sequence of Streptomyces sp. F1, a strain isolated from soil with great potential for secretion of hydrolytic enzymes used to deconstruct cellulosic biomass. The draft genome assembly of Streptomyces sp. strain F1 has 69 contigs with a total genome size of 8,142,296bp and G+C 72.65%. Preliminary genome analysis identified 175 proteins as Carbohydrate-Active Enzymes, being 85 glycoside hydrolases organized in 33 distinct families. This draft genome information provides new insights on the key genes encoding hydrolytic enzymes involved in biomass deconstruction employed by soil bacteria. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Genomes of microsporidia in mosquitoes: status and preliminary findings

USDA-ARS?s Scientific Manuscript database

The status and preliminary findings for full genome sequencing of three species of microsporidia with mosquitoes as type hosts will be presented. Vavraia culicis, the type species of the genus Vavraia, was originally described from Culex pipiens. Type material was not available and therefore Vavra...

RTJ-303: Variable geometry, oblique wing supersonic aircraft

NASA Technical Reports Server (NTRS)

Antaran, Albert; Belete, Hailu; Dryzmkowski, Mark; Higgins, James; Klenk, Alan; Rienecker, Lisa

1992-01-01

This document is a preliminary design of a High Speed Civil Transport (HSCT) named the RTJ-303. It is a 300 passenger, Mach 1.6 transport with a range of 5000 nautical miles. It features four mixed-flow turbofan engines, variable geometry oblique wing, with conventional tail-aft control surfaces. The preliminary cost analysis for a production of 300 aircraft shows that flyaway cost would be 183 million dollars (1992) per aircraft. The aircraft uses standard jet fuel and requires no special materials to handle aerodynamic heating in flight because the stagnation temperatures are approximately 130 degrees Fahrenheit in the supersonic cruise condition. It should be stressed that this aircraft could be built with today's technology and does not rely on vague and uncertain assumptions of technology advances. Included in this report are sections discussing the details of the preliminary design sequence including the mission to be performed, operational and performance constraints, the aircraft configuration and the tradeoffs of the final choice, wing design, a detailed fuselage design, empennage design, sizing of tail geometry, and selection of control surfaces, a discussion on propulsion system/inlet choice and their position on the aircraft, landing gear design including a look at tire selection, tip-over criterion, pavement loading, and retraction kinematics, structures design including load determination, and materials selection, aircraft performance, a look at stability and handling qualities, systems layout including location of key components, operations requirements maintenance characteristics, a preliminary cost analysis, and conclusions made regarding the design, and recommendations for further study.

Development of a DNA-Based Method for Distinguishing the Malaria Vectors, Anopheles Gambiae from Anopheles Arabiensis.

DTIC Science & Technology

1987-11-15

analysis. However, in our preliminary studies, hybridization with the DPro.5ohil actin probe required such low stringency conditions that the signal to...rDNA genes and could therefore contain seOuencec tjhich, under normal DNA hybridization conditions , behave in a species-specific mrnner. We theref’-e...pAGr23B) behave as species-specific probes under the conditions normally used for DNA hybridization. These sequences could be used to design specific

P53 Mutation Analysis to Predict Tumor Response in Patients Undergoing Neoadjuvant Treatment for Locally Advanced Breast Cancer

DTIC Science & Technology

2006-10-01

then sequenced (for GeneChip- positiv SSCP (for GeneChip-negative). We have received a total of 43 core breast biopsy DNA samples from the UNC... quantitative luciferase reporter. Both reporters exploit a “rheostatable” promoter for p53 expression and utilize the “delitto perfetto” in vivo... quantitative luciferase-based assay is also being used to characterize the altered function sistent an tion T mutants in greater detail. Preliminary

A one-page summary report of genome sequencing for the healthy adult.

PubMed

Vassy, Jason L; McLaughlin, Heather M; McLaughlin, Heather L; MacRae, Calum A; Seidman, Christine E; Lautenbach, Denise; Krier, Joel B; Lane, William J; Kohane, Isaac S; Murray, Michael F; McGuire, Amy L; Rehm, Heidi L; Green, Robert C

2015-01-01

As genome sequencing technologies increasingly enter medical practice, genetics laboratories must communicate sequencing results effectively to nongeneticist physicians. We describe the design and delivery of a clinical genome sequencing report, including a one-page summary suitable for interpretation by primary care physicians. To illustrate our preliminary experience with this report, we summarize the genomic findings from 10 healthy participants in a study of genome sequencing in primary care. © 2015 S. Karger AG, Basel.

A One-Page Summary Report of Genome Sequencing for the Healthy Adult

PubMed Central

Vassy, Jason L.; McLaughlin, Heather M.; MacRae, Calum A.; Seidman, Christine E.; Lautenbach, Denise; Krier, Joel B.; Lane, William J.; Kohane, Isaac S.; Murray, Michael F.; McGuire, Amy L.; Rehm, Heidi L.; Green, Robert C.

2015-01-01

As genome sequencing technologies increasingly enter medical practice, genetics laboratories must communicate sequencing results effectively to non-geneticist physicians. We describe the design and delivery of a clinical genome sequencing report, including a one-page summary suitable for interpretation by primary care physicians. To illustrate our preliminary experience with this report, we summarize the genomic findings from ten healthy patient participants in a study of genome sequencing in primary care. PMID:25612602

DraGnET: Software for storing, managing and analyzing annotated draft genome sequence data

PubMed Central

2010-01-01

Background New "next generation" DNA sequencing technologies offer individual researchers the ability to rapidly generate large amounts of genome sequence data at dramatically reduced costs. As a result, a need has arisen for new software tools for storage, management and analysis of genome sequence data. Although bioinformatic tools are available for the analysis and management of genome sequences, limitations still remain. For example, restrictions on the submission of data and use of these tools may be imposed, thereby making them unsuitable for sequencing projects that need to remain in-house or proprietary during their initial stages. Furthermore, the availability and use of next generation sequencing in industrial, governmental and academic environments requires biologist to have access to computational support for the curation and analysis of the data generated; however, this type of support is not always immediately available. Results To address these limitations, we have developed DraGnET (Draft Genome Evaluation Tool). DraGnET is an open source web application which allows researchers, with no experience in programming and database management, to setup their own in-house projects for storing, retrieving, organizing and managing annotated draft and complete genome sequence data. The software provides a web interface for the use of BLAST, allowing users to perform preliminary comparative analysis among multiple genomes. We demonstrate the utility of DraGnET for performing comparative genomics on closely related bacterial strains. Furthermore, DraGnET can be further developed to incorporate additional tools for more sophisticated analyses. Conclusions DraGnET is designed for use either by individual researchers or as a collaborative tool available through Internet (or Intranet) deployment. For genome projects that require genome sequencing data to initially remain proprietary, DraGnET provides the means for researchers to keep their data in-house for analysis using local programs or until it is made publicly available, at which point it may be uploaded to additional analysis software applications. The DraGnET home page is available at http://www.dragnet.cvm.iastate.edu and includes example files for examining the functionalities, a link for downloading the DraGnET setup package and a link to the DraGnET source code hosted with full documentation on SourceForge. PMID:20175920

Mechanical System Analysis/Design Tool (MSAT) Quick Guide

NASA Technical Reports Server (NTRS)

Lee, HauHua; Kolb, Mark; Madelone, Jack

1998-01-01

MSAT is a unique multi-component multi-disciplinary tool that organizes design analysis tasks around object-oriented representations of configuration components, analysis programs and modules, and data transfer links between them. This creative modular architecture enables rapid generation of input stream for trade-off studies of various engine configurations. The data transfer links automatically transport output from one application as relevant input to the next application once the sequence is set up by the user. The computations are managed via constraint propagation - the constraints supplied by the user as part of any optimization module. The software can be used in the preliminary design stage as well as during the detail design of product development process.

Features of the genomes of microsporidia in mosquitoes:status and preliminary findings

USDA-ARS?s Scientific Manuscript database

The status and preliminary findings for full genome sequencing of two distantly related species of microsporidia with mosquitoes as type hosts will be presented. Vavraia culicis, the type species of the genus Vavraia, was originally described from Culex pipiens. Type material was not available and...

Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle.

PubMed

El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl

2017-03-01

Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.

Genome sequencing of adzuki bean (Vigna angularis) provides insight into high starch and low fat accumulation and domestication.

PubMed

Yang, Kai; Tian, Zhixi; Chen, Chunhai; Luo, Longhai; Zhao, Bo; Wang, Zhuo; Yu, Lili; Li, Yisong; Sun, Yudong; Li, Weiyu; Chen, Yan; Li, Yongqiang; Zhang, Yueyang; Ai, Danjiao; Zhao, Jinyang; Shang, Cheng; Ma, Yong; Wu, Bin; Wang, Mingli; Gao, Li; Sun, Dongjing; Zhang, Peng; Guo, Fangfang; Wang, Weiwei; Li, Yuan; Wang, Jinlong; Varshney, Rajeev K; Wang, Jun; Ling, Hong-Qing; Wan, Ping

2015-10-27

Adzuki bean (Vigna angularis), an important legume crop, is grown in more than 30 countries of the world. The seed of adzuki bean, as an important source of starch, digestible protein, mineral elements, and vitamins, is widely used foods for at least a billion people. Here, we generated a high-quality draft genome sequence of adzuki bean by whole-genome shotgun sequencing. The assembled contig sequences reached to 450 Mb (83% of the genome) with an N50 of 38 kb, and the total scaffold sequences were 466.7 Mb with an N50 of 1.29 Mb. Of them, 372.9 Mb of scaffold sequences were assigned to the 11 chromosomes of adzuki bean by using a single nucleotide polymorphism genetic map. A total of 34,183 protein-coding genes were predicted. Functional analysis revealed that significant differences in starch and fat content between adzuki bean and soybean were likely due to transcriptional abundance, rather than copy number variations, of the genes related to starch and oil synthesis. We detected strong selection signals in domestication by the population analysis of 50 accessions including 11 wild, 11 semiwild, 17 landraces, and 11 improved varieties. In addition, the semiwild accessions were illuminated to have a closer relationship to the cultigen accessions than the wild type, suggesting that the semiwild adzuki bean might be a preliminary landrace and play some roles in the adzuki bean domestication. The genome sequence of adzuki bean will facilitate the identification of agronomically important genes and accelerate the improvement of adzuki bean.

Genome sequencing of adzuki bean (Vigna angularis) provides insight into high starch and low fat accumulation and domestication

PubMed Central

Yang, Kai; Tian, Zhixi; Chen, Chunhai; Luo, Longhai; Zhao, Bo; Wang, Zhuo; Yu, Lili; Li, Yisong; Sun, Yudong; Li, Weiyu; Chen, Yan; Li, Yongqiang; Zhang, Yueyang; Ai, Danjiao; Zhao, Jinyang; Shang, Cheng; Ma, Yong; Wu, Bin; Wang, Mingli; Gao, Li; Sun, Dongjing; Zhang, Peng; Guo, Fangfang; Wang, Weiwei; Li, Yuan; Wang, Jinlong; Varshney, Rajeev K.; Wang, Jun; Ling, Hong-Qing; Wan, Ping

2015-01-01

Adzuki bean (Vigna angularis), an important legume crop, is grown in more than 30 countries of the world. The seed of adzuki bean, as an important source of starch, digestible protein, mineral elements, and vitamins, is widely used foods for at least a billion people. Here, we generated a high-quality draft genome sequence of adzuki bean by whole-genome shotgun sequencing. The assembled contig sequences reached to 450 Mb (83% of the genome) with an N50 of 38 kb, and the total scaffold sequences were 466.7 Mb with an N50 of 1.29 Mb. Of them, 372.9 Mb of scaffold sequences were assigned to the 11 chromosomes of adzuki bean by using a single nucleotide polymorphism genetic map. A total of 34,183 protein-coding genes were predicted. Functional analysis revealed that significant differences in starch and fat content between adzuki bean and soybean were likely due to transcriptional abundance, rather than copy number variations, of the genes related to starch and oil synthesis. We detected strong selection signals in domestication by the population analysis of 50 accessions including 11 wild, 11 semiwild, 17 landraces, and 11 improved varieties. In addition, the semiwild accessions were illuminated to have a closer relationship to the cultigen accessions than the wild type, suggesting that the semiwild adzuki bean might be a preliminary landrace and play some roles in the adzuki bean domestication. The genome sequence of adzuki bean will facilitate the identification of agronomically important genes and accelerate the improvement of adzuki bean. PMID:26460024

On the purification and preliminary crystallographic analysis of isoquinoline 1-oxidoreductase from Brevundimonas diminuta 7

PubMed Central

Boer, D. Roeland; Müller, Axel; Fetzner, Susanne; Lowe, David J.; Romão, Maria João

2005-01-01

Isoquinoline 1-oxidoreductase (IOR) from Brevundimonas diminuta is a mononuclear molybdoenzyme of the xanthine-dehydrogenase family of proteins and catalyzes the conversion of isoquinoline to isoquinoline-1-one. Its primary sequence and behaviour, specifically in its substrate specificity and lipophilicity, differ from other members of the family. A crystal structure of the enzyme is expected to provide an explanation for these differences. This paper describes the crystallization and preliminary X-ray diffraction experiments as well as an optimized purification protocol for IOR. Crystallization of IOR was achieved using two different crystallization buffers. Streak-seeding and cross-linking were essential to obtain well diffracting crystals. Suitable cryo-conditions were found and a structure solution was obtained by molecular replacement. However, phases need to be improved in order to obtain a more interpretable electron-density map. PMID:16508115

Preliminary investigation of flow dynamics during the start-up of a bulb turbine model

NASA Astrophysics Data System (ADS)

Coulaud, M.; Fraser, R.; Lemay, J.; Duquesne, P.; Aeschlimann, V.; Deschênes, C.

2016-11-01

Nowadays, the electricity network undergoes more perturbations due to the market demand. Additionally, an increase of the production from alternative resources such as wind or solar also induces important variations on the grid. Hydraulic power plants are used to respond quickly to these variations to stabilize the network. Hydraulic turbines have to face more frequent start-up and stop sequences that might shorten significantly their life time. In this context, an experimental analysis of start-up sequences has been conducted on the bulb turbine model of the BulbT project at the Hydraulic Machines Laboratory (LAMH) of Laval University. Maintaining a constant head, guide vanes are opened from 0 ° to 30 °. Three guide vanes opening speed have been chosen from 5 °/s to 20 °/s. Several repetitions were done for each guide vanes opening speed. During these sequences, synchronous time resolved measurements have been performed. Pressure signals were recorded at the runner inlet and outlet and along the draft tube. Also, 25 pressure measurements and strain measurements were obtained on the runner blades. Time resolved particle image velocimetry were used to evaluate flowrate during start-up for some repetitions. Torque fluctuations at shaft were also monitored. This paper presents the experimental set-up and start-up conditions chosen to simulate a prototype start-up. Transient flowrate methodology is explained and validation measurements are detailed. The preliminary results of global performances and runner pressure measurements are presented.

Whole-genome sequencing reveals novel insights into sulfur oxidation in the extremophile Acidithiobacillus thiooxidans.

PubMed

Yin, Huaqun; Zhang, Xian; Li, Xiaoqi; He, Zhili; Liang, Yili; Guo, Xue; Hu, Qi; Xiao, Yunhua; Cong, Jing; Ma, Liyuan; Niu, Jiaojiao; Liu, Xueduan

2014-07-04

Acidithiobacillus thiooxidans (A. thiooxidans), a chemolithoautotrophic extremophile, is widely used in the industrial recovery of copper (bioleaching or biomining). The organism grows and survives by autotrophically utilizing energy derived from the oxidation of elemental sulfur and reduced inorganic sulfur compounds (RISCs). However, the lack of genetic manipulation systems has restricted our exploration of its physiology. With the development of high-throughput sequencing technology, the whole genome sequence analysis of A. thiooxidans has allowed preliminary models to be built for genes/enzymes involved in key energy pathways like sulfur oxidation. The genome of A. thiooxidans A01 was sequenced and annotated. It contains key sulfur oxidation enzymes involved in the oxidation of elemental sulfur and RISCs, such as sulfur dioxygenase (SDO), sulfide quinone reductase (SQR), thiosulfate:quinone oxidoreductase (TQO), tetrathionate hydrolase (TetH), sulfur oxidizing protein (Sox) system and their associated electron transport components. Also, the sulfur oxygenase reductase (SOR) gene was detected in the draft genome sequence of A. thiooxidans A01, and multiple sequence alignment was performed to explore the function of groups of related protein sequences. In addition, another putative pathway was found in the cytoplasm of A. thiooxidans, which catalyzes sulfite to sulfate as the final product by phosphoadenosine phosphosulfate (PAPS) reductase and adenylylsulfate (APS) kinase. This differs from its closest relative Acidithiobacillus caldus, which is performed by sulfate adenylyltransferase (SAT). Furthermore, real-time quantitative PCR analysis showed that most of sulfur oxidation genes were more strongly expressed in the S0 medium than that in the Na2S2O3 medium at the mid-log phase. Sulfur oxidation model of A. thiooxidans A01 has been constructed based on previous studies from other sulfur oxidizing strains and its genome sequence analyses, providing insights into our understanding of its physiology and further analysis of potential functions of key sulfur oxidation genes.

Whole-genome sequencing reveals novel insights into sulfur oxidation in the extremophile Acidithiobacillus thiooxidans

PubMed Central

2014-01-01

Background Acidithiobacillus thiooxidans (A. thiooxidans), a chemolithoautotrophic extremophile, is widely used in the industrial recovery of copper (bioleaching or biomining). The organism grows and survives by autotrophically utilizing energy derived from the oxidation of elemental sulfur and reduced inorganic sulfur compounds (RISCs). However, the lack of genetic manipulation systems has restricted our exploration of its physiology. With the development of high-throughput sequencing technology, the whole genome sequence analysis of A. thiooxidans has allowed preliminary models to be built for genes/enzymes involved in key energy pathways like sulfur oxidation. Results The genome of A. thiooxidans A01 was sequenced and annotated. It contains key sulfur oxidation enzymes involved in the oxidation of elemental sulfur and RISCs, such as sulfur dioxygenase (SDO), sulfide quinone reductase (SQR), thiosulfate:quinone oxidoreductase (TQO), tetrathionate hydrolase (TetH), sulfur oxidizing protein (Sox) system and their associated electron transport components. Also, the sulfur oxygenase reductase (SOR) gene was detected in the draft genome sequence of A. thiooxidans A01, and multiple sequence alignment was performed to explore the function of groups of related protein sequences. In addition, another putative pathway was found in the cytoplasm of A. thiooxidans, which catalyzes sulfite to sulfate as the final product by phosphoadenosine phosphosulfate (PAPS) reductase and adenylylsulfate (APS) kinase. This differs from its closest relative Acidithiobacillus caldus, which is performed by sulfate adenylyltransferase (SAT). Furthermore, real-time quantitative PCR analysis showed that most of sulfur oxidation genes were more strongly expressed in the S0 medium than that in the Na2S2O3 medium at the mid-log phase. Conclusion Sulfur oxidation model of A. thiooxidans A01 has been constructed based on previous studies from other sulfur oxidizing strains and its genome sequence analyses, providing insights into our understanding of its physiology and further analysis of potential functions of key sulfur oxidation genes. PMID:24993543

Phylogeonomics and Ecogenomics of the Mycorrhizal Symbiosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuo, Alan; Grigoriev, Igor V.; Kohler, Annegret

Mycorrhizal fungi play critical roles in host plant health, soil community structure and chemistry, and carbon and nutrient cycling, all areas of intense interest to the US Dept. of Energy (DOE) Joint Genome Institute (JGI). To this end we are building on our earlier sequencing of the Laccaria bicolor genome by partnering with INRA-Nancy and the mycorrhizal research community in the MGI to sequence and analyze 2 dozen mycorrhizal genomes of numerous known mycorrhizal orders and several ecological types (ectomycorrhizal [ECM], ericoid, orchid, and arbuscular). JGI has developed and deployed high-throughput pipelines for genomic, transcriptomic, and re-sequencing, and platforms formore » assembly, annotation, and analysis. In the last 2 years we have sequenced 21 genomes of mycorrhizal fungi, and resequenced 6 additional strains of L. bicolor. Most of this data is publicly available on JGI MycoCosm?s Mycorrhizal Fungi Portal (http://jgi.doe.gov/Mycorrhizal_fungi/), which provides access to both the genome data and tools with which to analyze the data. These data allow us to address long-standing issues in mycorrhizal evolution and ecology. For example, a major observation of mycorrhizal evolution is that each of the major ecological types appears to have evolved independently in multiple fungal clades. Using an ecogenomic approach we provide preliminary evidence that 2 clades (Cantharellales and Sebacinales) of a single symbiotic ecotype (orchid) utilize some common regulatory (protein tyrosine kinase) and metabolic (lipase) paths, the latter of which may be the product of HGT. Using a phylogenomic approach we provide preliminary evidence that a particular ecotype (ericoid) may have evolved more than once within a major clade (Leotiomycetes).« less

The Cosmic Skidmark: witnessing galaxy transformation at z = 0.19

NASA Astrophysics Data System (ADS)

Murphy, David N. A.

2015-02-01

We present an early-look analysis of the ``Cosmic Skidmark''. Discovered following visual inspection of the Geach, Murphy & Bower (2011) SDSS Stripe 82 cluster catalogue generated by ORCA (an automated cluster algorithm searching for red-sequences; Murphy, Geach & Bower 2012), this z = 0.19 1.4L* galaxy appears to have been caught in the rare act of transformation while accreting onto an estimated 1013-1014 h -1 M⊙-mass galaxy group. SDSS spectroscopy reveals clear signatures of star formation whilst deep optical imaging reveals a pronounced 50 kpc cometary tail. Pending completion of our ALMA Cycle 2 and IFU observations, we show here preliminary analysis of this target.

Shuttle cryogenics supply system. Optimization study. Volume 5 B-4: Programmers manual for space shuttle orbit injection analysis (SOPSA)

NASA Technical Reports Server (NTRS)

1973-01-01

A computer program for space shuttle orbit injection propulsion system analysis (SOPSA) is described to show the operational characteristics and the computer system requirements. The program was developed as an analytical tool to aid in the preliminary design of propellant feed systems for the space shuttle orbiter main engines. The primary purpose of the program is to evaluate the propellant tank ullage pressure requirements imposed by the need to accelerate propellants rapidly during the engine start sequence. The SOPSA program will generate parametric feed system pressure histories and weight data for a range of nominal feedline sizes.

Whole genome sequencing and phylogenetic analysis of Bluetongue virus serotype 2 strains isolated in the Americas including a novel strain from the western United States.

PubMed

Gaudreault, Natasha N; Mayo, Christie E; Jasperson, Dane C; Crossley, Beate M; Breitmeyer, Richard E; Johnson, Donna J; Ostlund, Eileen N; MacLachlan, N James; Wilson, William C

2014-07-01

Bluetongue is a potentially fatal arboviral disease of domestic and wild ruminants that is characterized by widespread edema and tissue necrosis. Bluetongue virus (BTV) serotypes 10, 11, 13, and 17 occur throughout much of the United States, whereas serotype 2 (BTV-2) was previously only detected in the southeastern United States. Since 1998, 10 other BTV serotypes have also been isolated from ruminants in the southeastern United States. In 2010, BTV-2 was identified in California for the first time, and preliminary sequence analysis indicated that the virus isolate was closely related to BTV strains circulating in the southeastern United States. In the current study, the whole genome sequence of the California strain of BTV-2 was compared with those of other BTV-2 strains in the Americas. The results of the analysis suggest co-circulation of genetically distinct viruses in the southeastern United States, and further suggest that the 2010 western isolate is closely related to southeastern strains of BTV. Although it remains uncertain as to how this novel virus was translocated to California, the findings of the current study underscore the need for ongoing surveillance of this economically important livestock disease.

A preliminary assessment of the true morels (Morchella) in Newfoundland and Labrador

USDA-ARS?s Scientific Manuscript database

A preliminary assessment of true morels (Morchella) from Newfoundland and Labrador (NL) was obtained by using DNA sequence data from portions of three genes to identify 20 collections from Newfoundland and one from a remote location in Labrador. To place this work in a broader context, data on 25 co...

MHC class II B diversity in blue tits: a preliminary study.

PubMed

Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

2013-07-01

In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4-7 fragments, indicating a minimum number of 2-4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date.

MHC class II B diversity in blue tits: a preliminary study

PubMed Central

Aguilar, Juan Rivero-de; Schut, Elske; Merino, Santiago; Martínez, Javier; Komdeur, Jan; Westerdahl, Helena

2013-01-01

In this study, we partly characterize major histocompatibility complex (MHC) class II B in the blue tit (Cyanistes caeruleus). A total of 22 individuals from three different European locations: Spain, The Netherlands, and Sweden were screened for MHC allelic diversity. The MHC genes were investigated using both PCR-based methods and unamplified genomic DNA with restriction fragment length polymorphism (RFLP) and southern blots. A total of 13 different exon 2 sequences were obtained independently from DNA and/or RNA, thus confirming gene transcription and likely functionality of the genes. Nine out of 13 alleles were found in more than one country, and two alleles appeared in all countries. Positive selection was detected in the region coding for the peptide binding region (PBR). A maximum of three alleles per individual was detected by sequencing and the RFLP pattern consisted of 4–7 fragments, indicating a minimum number of 2–4 loci per individual. A phylogenetic analysis, demonstrated that the blue tit sequences are divergent compared to sequences from other passerines resembling a different MHC lineage than those possessed by most passerines studied to date. PMID:23919136

Laughter and the Management of Divergent Positions in Peer Review Interactions

PubMed Central

Raclaw, Joshua; Ford, Cecilia E.

2017-01-01

In this paper we focus on how participants in peer review interactions use laughter as a resource as they publicly report divergence of evaluative positions, divergence that is typical in the give and take of joint grant evaluation. Using the framework of conversation analysis, we examine the infusion of laughter and multimodal laugh-relevant practices into sequences of talk in meetings of grant reviewers deliberating on the evaluation and scoring of high-level scientific grant applications. We focus on a recurrent sequence in these meetings, what we call the score-reporting sequence, in which the assigned reviewers first announce the preliminary scores they have assigned to the grant. We demonstrate that such sequences are routine sites for the use of laugh practices to navigate the initial moments in which divergence of opinion is made explicit. In the context of meetings convened for the purposes of peer review, laughter thus serves as a valuable resource for managing the socially delicate but institutionally required reporting of divergence and disagreement that is endemic to meetings where these types of evaluative tasks are a focal activity. PMID:29170594

Genomic sequence of the xylose fermenting, insect-inhabitingyeast, Pichia stipitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeffries, Thomas W.; Grigoriev, Igor; Grimwood, Jane

2007-06-25

Xylose is a major constituent of angiosperm lignocellulose,so its fermentation is important for bioconversion to fuels andchemicals. Pichia stipitis is the best-studied native xylose fermentingyeast. Genes from P. stipitis have been used to engineer xylosemetabolism in Saccharomycescerevisiae, and the regulation of the P.stipitis genome offers insights into the mechanisms of xylose metabolismin yeasts. We have sequenced, assembled and finished the genome ofP.stipitis. As such, it is one of only a handful of completely finishedeukaryotic organisms undergoing analysis and manual curation. Thesequence has revealed aspects of genome organization, numerous genes forbiocoversion, preliminary insights into regulation of central metabolicpathways, numerous examples ofmore » co-localized genes with related functions,and evidence of how P. stipitis manages to achieve redox balance whilegrowing on xylose under microaerobic conditions.« less

Pantoea sp. Isolated from Tropical Fresh Water Exhibiting N-Acyl Homoserine Lactone Production

PubMed Central

Tan, Wen-Si; Tan, Pui-Wan; Adrian, Tan-Guan-Sheng; Yin, Wai-Fong; Chan, Kok-Gan

2014-01-01

N-Acyl homoserine lactone (AHL) serves as signaling molecule for quorum sensing (QS) in Gram-negative bacteria to regulate various physiological activities including pathogenicity. With the aim of isolating freshwater-borne bacteria that can cause outbreak of disease in plants and portrayed QS properties, environmental water sampling was conducted. Here we report the preliminary screening of AHL production using Chromobacterium violaceum CV026 and Escherichia coli [pSB401] as AHL biosensors. The 16S rDNA gene sequence of isolate M009 showed the highest sequence similarity to Pantoea stewartii S9-116, which is a plant pathogen. The isolated Pantoea sp. was confirmed to produce N-3-oxohexanoyl-L-HSL (3-oxo-C6-HSL) through analysis of high resolution mass tandem mass spectrometry. PMID:25197715

Differences in community composition of bacteria in four glaciers in western China

NASA Astrophysics Data System (ADS)

An, L. Z.; Chen, Y.; Xiang, S.-R.; Shang, T.-C.; Tian, L.-D.

2010-06-01

Microbial community patterns vary in glaciers worldwide, presenting unique responses to global climatic and environmental changes. Four bacterial clone libraries were established by 16S rRNA gene amplification from four ice layers along the 42-m-long ice core MuztB drilled from the Muztag Ata Glacier. A total of 151 bacterial sequences obtained from the ice core MuztB were phylogenetically compared with the 71 previously reported sequences from three ice cores extracted from ice caps Malan, Dunde, and Puruogangri. Six phylogenetic clusters Flavisolibacter, Flexibacter (Bacteroidetes), Acinetobacter, Enterobacter (Gammaproteobacteria), Planococcus/Anoxybacillus (Firmicutes), and Propionibacter/Luteococcus (Actinobacteria) frequently occurred along the Muztag Ata Glacier profile, and their proportion varied by seasons. Sequence analysis showed that most of the sequences from the ice core clustered with those from cold environments, and the sequence clusters from the same glacier more closely grouped together than those from the geographically isolated glaciers. Moreover, bacterial communities from the same location or similarly aged ice formed a cluster, and were clearly separate from those from other geographically isolated glaciers. In summary, the findings provide preliminary evidence of zonal distribution of microbial community, and suggest biogeography of microorganisms in glacier ice.

Differences in community composition of bacteria in four deep ice sheets in western China

NASA Astrophysics Data System (ADS)

An, L.; Chen, Y.; Xiang, S.-R.; Shang, T.-C.; Tian, L.-De

2010-02-01

Microbial community patterns vary in glaciers world wide, presenting unique responses to global climatic and environmental changes. Four bacterial clone libraries were established by 16S rRNA gene amplification from four ice layers along the 42-m-long ice core MuztB drilled from the Muztag Ata Glacier. A total of 152 bacterial sequences obtained from the ice core MuztB were phylogenetically compared with the 71 previously reported sequences from three ice cores extracted from ice caps Malan, Dunde, and Puruoganri. The six functional clusters Flavisolibacter, Flexibacter (Bacteroidetes), Acinetobacter, Enterobacter (Gammaproteobacteria), Planococcus/Anoxybacillus (Firmicutes), and Propionibacter/Luteococcus (Actinobacteria) frequently occurred along the Muztag Ata Glacier profile. Sequence analysis showed that most of the sequences from the ice core clustered with those from cold environments, and the sequences from the same glacier formed a distinct cluster. Moreover, bacterial communities from the same location or similarly aged ice formed a cluster, and were clearly separate from those from other geographically isolated glaciers. In a summary, the findings provide preliminary evidence of zone distribution of microbial community, support our hypothesis of the spatial and temporal biogeography of microorganisms in glacial ice.

Microbial forensics: fiber optic microarray subtyping of Bacillus anthracis

NASA Astrophysics Data System (ADS)

Shepard, Jason R. E.

2009-05-01

The past decade has seen increased development and subsequent adoption of rapid molecular techniques involving DNA analysis for detection of pathogenic microorganisms, also termed microbial forensics. The continued accumulation of microbial sequence information in genomic databases now better positions the field of high-throughput DNA analysis to proceed in a more manageable fashion. The potential to build off of these databases exists as technology continues to develop, which will enable more rapid, cost effective analyses. This wealth of genetic information, along with new technologies, has the potential to better address some of the current problems and solve the key issues involved in DNA analysis of pathogenic microorganisms. To this end, a high density fiber optic microarray has been employed, housing numerous DNA sequences simultaneously for detection of various pathogenic microorganisms, including Bacillus anthracis, among others. Each organism is analyzed with multiple sequences and can be sub-typed against other closely related organisms. For public health labs, real-time PCR methods have been developed as an initial preliminary screen, but culture and growth are still considered the gold standard. Technologies employing higher throughput than these standard methods are better suited to capitalize on the limitless potential garnered from the sequence information. Microarray analyses are one such format positioned to exploit this potential, and our array platform is reusable, allowing repetitive tests on a single array, providing an increase in throughput and decrease in cost, along with a certainty of detection, down to the individual strain level.

Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

PubMed Central

2011-01-01

Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

The 2008 Wells, Nevada earthquake sequence: Source constraints using calibrated multiple event relocation and InSAR

USGS Publications Warehouse

Nealy, Jennifer; Benz, Harley M.; Hayes, Gavin; Berman, Eric; Barnhart, William

2017-01-01

The 2008 Wells, NV earthquake represents the largest domestic event in the conterminous U.S. outside of California since the October 1983 Borah Peak earthquake in southern Idaho. We present an improved catalog, magnitude complete to 1.6, of the foreshock-aftershock sequence, supplementing the current U.S. Geological Survey (USGS) Preliminary Determination of Epicenters (PDE) catalog with 1,928 well-located events. In order to create this catalog, both subspace and kurtosis detectors are used to obtain an initial set of earthquakes and associated locations. The latter are then calibrated through the implementation of the hypocentroidal decomposition method and relocated using the BayesLoc relocation technique. We additionally perform a finite fault slip analysis of the mainshock using InSAR observations. By combining the relocated sequence with the finite fault analysis, we show that the aftershocks occur primarily updip and along the southwestern edge of the zone of maximum slip. The aftershock locations illuminate areas of post-mainshock strain increase; aftershock depths, ranging from 5 to 16 km, are consistent with InSAR imaging, which shows that the Wells earthquake was a buried source with no observable near-surface offset.

Biosynthetic multitasking facilitates thalassospiramide structural diversity in marine bacteria.

PubMed

Ross, Avena C; Xu, Ying; Lu, Liang; Kersten, Roland D; Shao, Zongze; Al-Suwailem, Abdulaziz M; Dorrestein, Pieter C; Qian, Pei-Yuan; Moore, Bradley S

2013-01-23

Thalassospiramides A and B are immunosuppressant cyclic lipopeptides first reported from the marine α-proteobacterium Thalassospira sp. CNJ-328. We describe here the discovery and characterization of an extended family of 14 new analogues from four Tistrella and Thalassospira isolates. These potent calpain 1 protease inhibitors belong to six structure classes in which the length and composition of the acylpeptide side chain varies extensively. Genomic sequence analysis of the thalassospiramide-producing microbes revealed related, genus-specific biosynthetic loci encoding hybrid nonribosomal peptide synthetase/polyketide synthases consistent with thalassospiramide assembly. The bioinformatics analysis of the gene clusters suggests that structural diversity, which ranges from the 803.4 Da thalassospiramide C to the 1291.7 Da thalassospiramide F, results from a complex sequence of reactions involving amino acid substrate channeling and enzymatic multimodule skipping and iteration. Preliminary biochemical analysis of the N-terminal nonribosomal peptide synthetase module from the Thalassospira TtcA megasynthase supports a biosynthetic model in which in cis amino acid activation competes with in trans activation to increase the range of amino acid substrates incorporated at the N terminus.

Biosynthetic Multitasking Facilitates Thalassospiramide Structural Diversity in Marine Bacteria

PubMed Central

Ross, Avena C.; Xu, Ying; Lu, Liang; Kersten, Roland D.; Shao, Zongze; Al-Suwailem, Abdulaziz M.; Dorrestein, Pieter C.; Qian, Pei-Yuan; Moore, Bradley S.

2013-01-01

Thalassospiramides A and B are immunosuppressant cyclic lipopeptides first reported from the marine α-proteobacterium Thalassospira sp. CNJ-328. We describe here the discovery and characterization of an extended family of 14 new analogues from four Tistrella and Thalassospira isolates. These potent calpain 1 protease inhibitors belong to six structure classes in which the length and composition of the acylpeptide side chain varies extensively. Genomic sequence analysis of the thalassospiramide-producing microbes revealed related, genus-specific biosynthetic loci encoding hybrid nonribosomal peptide synthetase/polyketide synthases consistent with thalassospiramide assembly. The bioinformatics analysis of the gene clusters suggests that structural diversity, which ranges from the 803.4 Da thalassospiramide C to the 1291.7 Da thalassospiramide F, results from a complex sequence of reactions involving amino acid substrate channeling and enzymatic multi-module skipping and iteration. Preliminary biochemical analysis of the N-terminal NRPS module from the Thalassospira TtcA megasynthase supports a biosynthetic model in which in cis amino acid activation competes with in trans activation to increase the range of amino acid substrates incorporated at the N-terminus. PMID:23270364

Draft genome sequence of Therminicola potens strain JR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Byrne-Bailey, K.G.; Wrighton, K.C.; Melnyk, R.A.

'Thermincola potens' strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR.

Isolation and preliminary characterization of a Cd-binding protein from Tenebrio molitor (Coleoptera).

PubMed

Pedersen, S A; Kristiansen, E; Andersen, R A; Zachariassen, K E

2007-04-01

The effect of cadmium (Cd) exposure on Cd-binding ligands was investigated for the first time in a beetle (Coleoptera), using the mealworm Tenebrio molitor (L) as a model species. Exposure to Cd resulted in an approximate doubling of the Cd-binding capacity of the protein extracts from whole animals. Analysis showed that the increase was mainly explained by the induction of a Cd-binding protein of 7134.5 Da, with non-metallothionein characteristics. Amino acid analysis and de novo sequencing revealed that the protein has an unusually high content of the acidic amino acids aspartic and glutamic acid that may explain how this protein can bind Cd even without cysteine residues. Similarities in the amino acid composition suggest it to belong to a group of little studied proteins often referred to as "Cd-binding proteins without high cysteine content". This is the first report on isolation and peptide sequence determination of such a protein from a coleopteran.

Molecular Diet Analysis of Two African Free-Tailed Bats (Molossidae) Using High Throughput Sequencing

PubMed Central

Bohmann, Kristine; Monadjem, Ara; Lehmkuhl Noer, Christina; Rasmussen, Morten; Zeale, Matt R. K.; Clare, Elizabeth; Jones, Gareth; Willerslev, Eske; Gilbert, M. Thomas P.

2011-01-01

Given the diversity of prey consumed by insectivorous bats, it is difficult to discern the composition of their diet using morphological or conventional PCR-based analyses of their faeces. We demonstrate the use of a powerful alternate tool, the use of the Roche FLX sequencing platform to deep-sequence uniquely 5′ tagged insect-generic barcode cytochrome c oxidase I (COI) fragments, that were PCR amplified from faecal pellets of two free-tailed bat species Chaerephon pumilus and Mops condylurus (family: Molossidae). Although the analyses were challenged by the paucity of southern African insect COI sequences in the GenBank and BOLD databases, similarity to existing collections allowed the preliminary identification of 25 prey families from six orders of insects within the diet of C. pumilus, and 24 families from seven orders within the diet of M. condylurus. Insects identified to families within the orders Lepidoptera and Diptera were widely present among the faecal samples analysed. The two families that were observed most frequently were Noctuidae and Nymphalidae (Lepidoptera). Species-level analysis of the data was accomplished using novel bioinformatics techniques for the identification of molecular operational taxonomic units (MOTU). Based on these analyses, our data provide little evidence of resource partitioning between sympatric M. condylurus and C. pumilus in the Simunye region of Swaziland at the time of year when the samples were collected, although as more complete databases against which to compare the sequences are generated this may have to be re-evaluated. PMID:21731749

OSIRIS-REx Touch-And-Go (TAG) Mission Design and Analysis

NASA Technical Reports Server (NTRS)

Berry, Kevin; Sutter, Brian; May, Alex; Williams, Ken; Barbee, Brent W.; Beckman, Mark; Williams, Bobby

2013-01-01

The Origins Spectral Interpretation Resource Identification Security Regolith Explorer (OSIRIS-REx) mission is a NASA New Frontiers mission launching in 2016 to rendezvous with the near-Earth asteroid (101955) 1999 RQ36 in late 2018. After several months in formation with and orbit about the asteroid, OSIRIS-REx will fly a Touch-And-Go (TAG) trajectory to the asteroid s surface to obtain a regolith sample. This paper describes the mission design of the TAG sequence and the propulsive maneuvers required to achieve the trajectory. This paper also shows preliminary results of orbit covariance analysis and Monte-Carlo analysis that demonstrate the ability to arrive at a targeted location on the surface of RQ36 within a 25 meter radius with 98.3% confidence.

Draft genome sequence of marine alphaproteobacterial strain HIMB11, the first cultivated representative of a unique lineage within the Roseobacter clade possessing an unusually small genome

PubMed Central

Durham, Bryndan P.; Grote, Jana; Whittaker, Kerry A.; Bender, Sara J.; Luo, Haiwei; Grim, Sharon L.; Brown, Julia M.; Casey, John R.; Dron, Antony; Florez-Leiva, Lennin; Krupke, Andreas; Luria, Catherine M.; Mine, Aric H.; Nigro, Olivia D.; Pather, Santhiska; Talarmin, Agathe; Wear, Emma K.; Weber, Thomas S.; Wilson, Jesse M.; Church, Matthew J.; DeLong, Edward F.; Karl, David M.; Steward, Grieg F.; Eppley, John M.; Kyrpides, Nikos C.; Schuster, Stephan; Rappé, Michael S.

2014-01-01

Strain HIMB11 is a planktonic marine bacterium isolated from coastal seawater in Kaneohe Bay, Oahu, Hawaii belonging to the ubiquitous and versatile Roseobacter clade of the alphaproteobacterial family Rhodobacteraceae. Here we describe the preliminary characteristics of strain HIMB11, including annotation of the draft genome sequence and comparative genomic analysis with other members of the Roseobacter lineage. The 3,098,747 bp draft genome is arranged in 34 contigs and contains 3,183 protein-coding genes and 54 RNA genes. Phylogenomic and 16S rRNA gene analyses indicate that HIMB11 represents a unique sublineage within the Roseobacter clade. Comparison with other publicly available genome sequences from members of the Roseobacter lineage reveals that strain HIMB11 has the genomic potential to utilize a wide variety of energy sources (e.g. organic matter, reduced inorganic sulfur, light, carbon monoxide), while possessing a reduced number of substrate transporters. PMID:25197450

Draft genome sequence of marine alphaproteobacterial strain HIMB11, the first cultivated representative of a unique lineage within the Roseobacter clade possessing an unusually small genome.

PubMed

Durham, Bryndan P; Grote, Jana; Whittaker, Kerry A; Bender, Sara J; Luo, Haiwei; Grim, Sharon L; Brown, Julia M; Casey, John R; Dron, Antony; Florez-Leiva, Lennin; Krupke, Andreas; Luria, Catherine M; Mine, Aric H; Nigro, Olivia D; Pather, Santhiska; Talarmin, Agathe; Wear, Emma K; Weber, Thomas S; Wilson, Jesse M; Church, Matthew J; DeLong, Edward F; Karl, David M; Steward, Grieg F; Eppley, John M; Kyrpides, Nikos C; Schuster, Stephan; Rappé, Michael S

2014-06-15

Strain HIMB11 is a planktonic marine bacterium isolated from coastal seawater in Kaneohe Bay, Oahu, Hawaii belonging to the ubiquitous and versatile Roseobacter clade of the alphaproteobacterial family Rhodobacteraceae. Here we describe the preliminary characteristics of strain HIMB11, including annotation of the draft genome sequence and comparative genomic analysis with other members of the Roseobacter lineage. The 3,098,747 bp draft genome is arranged in 34 contigs and contains 3,183 protein-coding genes and 54 RNA genes. Phylogenomic and 16S rRNA gene analyses indicate that HIMB11 represents a unique sublineage within the Roseobacter clade. Comparison with other publicly available genome sequences from members of the Roseobacter lineage reveals that strain HIMB11 has the genomic potential to utilize a wide variety of energy sources (e.g. organic matter, reduced inorganic sulfur, light, carbon monoxide), while possessing a reduced number of substrate transporters.

A Tentative Application Of Morphological Filters To Time-Varying Images

NASA Astrophysics Data System (ADS)

Billard, D.; Poquillon, B.

1989-03-01

In this paper, morphological filters, which are commonly used to process either 2D or multidimensional static images, are generalized to the analysis of time-varying image sequence. The introduction of the time dimension induces then interesting prop-erties when designing such spatio-temporal morphological filters. In particular, the specification of spatio-temporal structuring ele-ments (equivalent to time-varying spatial structuring elements) can be adjusted according to the temporal variations of the image sequences to be processed : this allows to derive specific morphological transforms to perform noise filtering or moving objects discrimination on dynamic images viewed by a non-stationary sensor. First, a brief introduction to the basic principles underlying morphological filters will be given. Then, a straightforward gener-alization of these principles to time-varying images will be pro-posed. This will lead us to define spatio-temporal opening and closing and to introduce some of their possible applications to process dynamic images. At last, preliminary results obtained us-ing a natural forward looking infrared (FUR) image sequence are presented.

The membrane skeleton in Paramecium: Molecular characterization of a novel epiplasmin family and preliminary GFP expression results.

PubMed

Pomel, Sébastien; Diogon, Marie; Bouchard, Philippe; Pradel, Lydie; Ravet, Viviane; Coffe, Gérard; Viguès, Bernard

2006-02-01

Previous attempts to identify the membrane skeleton of Paramecium cells have revealed a protein pattern that is both complex and specific. The most prominent structural elements, epiplasmic scales, are centered around ciliary units and are closely apposed to the cytoplasmic side of the inner alveolar membrane. We sought to characterize epiplasmic scale proteins (epiplasmins) at the molecular level. PCR approaches enabled the cloning and sequencing of two closely related genes by amplifications of sequences from a macronuclear genomic library. Using these two genes (EPI-1 and EPI-2), we have contributed to the annotation of the Paramecium tetraurelia macronuclear genome and identified 39 additional (paralogous) sequences. Two orthologous sequences were found in the Tetrahymena thermophila genome. Structural analysis of the 43 sequences indicates that the hallmark of this new multigenic family is a 79 aa domain flanked by two Q-, P- and V-rich stretches of sequence that are much more variable in amino-acid composition. Such features clearly distinguish members of the multigenic family from epiplasmic proteins previously sequenced in other ciliates. The expression of Green Fluorescent Protein (GFP)-tagged epiplasmin showed significant labeling of epiplasmic scales as well as oral structures. We expect that the GFP construct described herein will prove to be a useful tool for comparative subcellular localization of different putative epiplasmins in Paramecium.

Lactobacillus wasatchensis sp. nov., a non-starter lactic acid bacteria isolated from aged Cheddar cheese.

PubMed

Oberg, Craig J; Oberg, Taylor S; Culumber, Michele D; Ortakci, Fatih; Broadbent, Jeffery R; McMahon, Donald J

2016-01-01

A Gram-stain positive, rod-shaped, non-spore-forming strain (WDC04T), which may be associated with late gas production in cheese, was isolated from aged Cheddar cheese following incubation on MRS agar (pH 5.2) at 6 °C for 35 days. Strain WDC04T had 97 % 16S rRNA gene sequence similarity with Lactobacillus hokkaidonensis DSM 26202T, Lactobacillus oligofermentans 533, 'Lactobacillus danicus' 9M3, Lactobacillus suebicus CCUG 32233T and Lactobacillus vaccinostercus DSM 20634T. API 50 CH carbohydrate fermentation panels indicated strain WDC04T could only utilize one of the 50 substrates tested, ribose, although it does slowly utilize galactose. In the API ZYM system, strain WDC04T was positive for leucine arylamidase, valine arylamidase, cysteine arylamidase (weakly), naphthol-AS-BI-phosphohydrolase and β-galactosidase activities. Total genomic DNA was sequenced from strain WDC04T using a whole-genome shotgun strategy on a 454 GS Titanium pyrosequencer. The sequence was assembled into a 1.90 Mbp draft genome consisting of 105 contigs with preliminary genome annotation performed using the RAST algorithm (rast.nmpdr.org). Genome analysis confirmed the pentose phosphate pathway for ribose metabolism as well as galactose, N-acetylglucosamine, and glycerol fermentation pathways. Genomic analysis places strain WDC04T in the obligately heterofermentative group of lactobacilli and metabolic results confirm this conclusion. The result of genome sequencing, along with 16S rRNA gene sequence analysis, indicates WDC04T represents a novel species of the genus Lactobacillus, for which the name Lactobacillus wasatchensis sp. nov. is proposed. The type strain is WDC04T ( = DSM 29958T = LMG 28678T).

Preliminary analysis of length and GC content variation in the ribosomal first internal transcribed spacer (ITS1) of marine animals.

PubMed

Chow, S; Ueno, Y; Toyokawa, M; Oohara, I; Takeyama, H

2009-01-01

Length and guanine-cytosine (GC) content of the ribosomal first internal transcribed spacer (ITS1) were compared across a wide variety of marine animal species, and its phylogenetic utility was investigated. From a total of 773 individuals representing 599 species, we only failed to amplify the ITS1 sequence from 87 individuals by polymerase chain reaction with universal ITS1 primers. No species was found to have an ITS1 region shorter than 100 bp. In general, the ITS1 sequences of vertebrates were longer (318 to 2,318 bp) and richer in GC content (56.8% to 78%) than those of invertebrates (117 to 1,613 bp and 35.8% to 71.3%, respectively). Specifically, gelatinous animals (Cnidaria and Ctenophora) were observed to have short ITS1 sequences (118 to 422 bp) with lower GC content (35.8% to 61.7%) than the other animal taxa. Mollusca and Crustacea were diverse groups with respect to ITS1 length, ranging from 108 to 1,118 and 182 to 1,613 bp, respectively. No universal relationship between length and GC content was observed. Our data indicated that ITS1 has a limited utility for phylogenetic analysis as obtaining confident sequence alignment was often impossible between different genera of the same family and even between congeneric species.

A novel ENU-induced mutation, peewee, causes dwarfism in the mouse

PubMed Central

Bon-Ryon, Lee; Kano, Kiyoshi; Young, Jay; John, Simon; Nishina, Patsy M; Naggert, Jurgen K; Naito, Kunihiko

2010-01-01

We identified a novel fertile, autosomal recessive mutation, called peewee and that results in dwarfing, in a region-specific ENU-induced mutagenesis. These mice at litter size were smaller those of other strains. Histological analysis revealed that the major organs appear normal, but abnormalities in cellular proliferation were observed in bone, liver and testis. Haplotype analysis localized the peewee gene to a 3.3-Mb region between D5Mit83 and D5Mit356.3. There are 18 genes in this linkage area, and we also performed in silico mapping using the PosMed℠ program, which searches for connections among keywords and genes in an interval, but no similar phenotype descriptions were found for these genes. In the peewee mutant compared to the normal, C57BL/6J mouse, only Slc10a4 expression was lower. Our preliminary mutation analysis examining the nucleotide sequence of three exons, two introns and an untranslated region of Slc10a4 did not find any sequence difference between the peewee mouse and the C57BL/6J mouse. Detailed analysis of peewee mice might provide novel molecular insights into the complex mechanisms regulating body growth. PMID:19513787

Search for Anisotropy Changes Associated with Two Large Earthquakes in Japan and New Zealand

NASA Astrophysics Data System (ADS)

Savage, M. K.; Graham, K.; Aoki, Y.; Arnold, R.

2017-12-01

Seismic anisotropy is often considered to be an indicator of stress in the crust, because the closure of cracks due to differential stress leads to waves polarized parallel to the cracks travelling faster than the orthogonal direction. Changes in shear wave splitting have been suggested to result from stress changes at volcanoes and earthquakes. However, the effects of mineral or structural alignment, and the difficulty of distinguishing between changes in anisotropy along an earthquake-station path from distinguishing changes in the path itself, have made such findings controversial. Two large earthquakes in 2016 provide unique datasets to test the use of shear wave splitting for measuring variations in stress because clusters of closely-spaced earthquakes occurred both before and after a mainshock. We use the automatic, objective splitting analysis code MFAST to speed process and minimize unwitting observer bias when determining time variations. The sequence of earthquakes related to the M=7.2 Japanese Kumamoto earthquake of 14 April 2016 includes both foreshocks, mainshocks and aftershocks. The sequence was recorded by the NIED permanent network, which already contributed background seismic anisotropy measurements in a previous study of anisotropy and stress in Kyushu. Preliminary measurements of shear wave splitting from earthquakes that occurred in 2016 show results at some stations that clearly differ from those of the earlier study. They also change between earthquakes recorded before and after the mainshock. Further work is under way to determine whether the changes are more likely due to changes in stress during the observation time, or due to spatial changes in anisotropy combined with changes in earthquake locations. Likewise, background seismicity and also foreshocks and aftershocks in the 2013 Cook Strait earthquake sequence including two M=6.5 earthquakes in 2013 in New Zealand were in the same general region as aftershocks of the M=7.8 Kaikoura earthquake that occurred on 14 November 2016. Here again, preliminary analysis suggests the possibility that we are observing changes in stress, but detailed analysis is needed to confirm that.

Discovering Prerequisite Structure of Skills through Probabilistic Association Rules Mining

ERIC Educational Resources Information Center

Chen, Yang; Wuillemin, Pierre-Henr; Labat, Jean-Marc

2015-01-01

Estimating the prerequisite structure of skills is a crucial issue in domain modeling. Students usually learn skills in sequence since the preliminary skills need to be learned prior to the complex skills. The prerequisite relations between skills underlie the design of learning sequence and adaptation strategies for tutoring systems. The…

Complete Genome Sequence of the Electricity-Producing “Thermincola potens” Strain JR▿

PubMed Central

Byrne-Bailey, Kathryne G.; Wrighton, Kelly C.; Melnyk, Ryan A.; Agbo, Peter; Hazen, Terry C.; Coates, John D.

2010-01-01

“Thermincola potens” strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR. PMID:20525829

Bi-exponential T2 analysis of healthy and diseased Achilles tendons: an in vivo preliminary magnetic resonance study and correlation with clinical score.

PubMed

Juras, Vladimir; Apprich, Sebastian; Szomolanyi, Pavol; Bieri, Oliver; Deligianni, Xeni; Trattnig, Siegfried

2013-10-01

To compare mono- and bi-exponential T2 analysis in healthy and degenerated Achilles tendons using a recently introduced magnetic resonance variable-echo-time sequence (vTE) for T2 mapping. Ten volunteers and ten patients were included in the study. A variable-echo-time sequence was used with 20 echo times. Images were post-processed with both techniques, mono- and bi-exponential [T2 m, short T2 component (T2 s) and long T2 component (T2 l)]. The number of mono- and bi-exponentially decaying pixels in each region of interest was expressed as a ratio (B/M). Patients were clinically assessed with the Achilles Tendon Rupture Score (ATRS), and these values were correlated with the T2 values. The means for both T2 m and T2 s were statistically significantly different between patients and volunteers; however, for T2 s, the P value was lower. In patients, the Pearson correlation coefficient between ATRS and T2 s was -0.816 (P = 0.007). The proposed variable-echo-time sequence can be successfully used as an alternative method to UTE sequences with some added benefits, such as a short imaging time along with relatively high resolution and minimised blurring artefacts, and minimised susceptibility artefacts and chemical shift artefacts. Bi-exponential T2 calculation is superior to mono-exponential in terms of statistical significance for the diagnosis of Achilles tendinopathy. • Magnetic resonance imaging offers new insight into healthy and diseased Achilles tendons • Bi-exponential T2 calculation in Achilles tendons is more beneficial than mono-exponential • A short T2 component correlates strongly with clinical score • Variable echo time sequences successfully used instead of ultrashort echo time sequences.

Computational prediction of CRISPR cassettes in gut metagenome samples from Chinese type-2 diabetic patients and healthy controls.

PubMed

Mangericao, Tatiana C; Peng, Zhanhao; Zhang, Xuegong

2016-01-11

CRISPR has been becoming a hot topic as a powerful technique for genome editing for human and other higher organisms. The original CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats coupled with CRISPR-associated proteins) is an important adaptive defence system for prokaryotes that provides resistance against invading elements such as viruses and plasmids. A CRISPR cassette contains short nucleotide sequences called spacers. These unique regions retain a history of the interactions between prokaryotes and their invaders in individual strains and ecosystems. One important ecosystem in the human body is the human gut, a rich habitat populated by a great diversity of microorganisms. Gut microbiomes are important for human physiology and health. Metagenome sequencing has been widely applied for studying the gut microbiomes. Most efforts in metagenome study has been focused on profiling taxa compositions and gene catalogues and identifying their associations with human health. Less attention has been paid to the analysis of the ecosystems of microbiomes themselves especially their CRISPR composition. We conducted a preliminary analysis of CRISPR sequences in a human gut metagenomic data set of Chinese individuals of type-2 diabetes patients and healthy controls. Applying an available CRISPR-identification algorithm, PILER-CR, we identified 3169 CRISPR cassettes in the data, from which we constructed a set of 1302 unique repeat sequences and 36,709 spacers. A more extensive analysis was made for the CRISPR repeats: these repeats were submitted to a more comprehensive clustering and classification using the web server tool CRISPRmap. All repeats were compared with known CRISPRs in the database CRISPRdb. A total of 784 repeats had matches in the database, and the remaining 518 repeats from our set are potentially novel ones. The computational analysis of CRISPR composition based contigs of metagenome sequencing data is feasible. It provides an efficient approach for finding potential novel CRISPR arrays and for analysing the ecosystem and history of human microbiomes.

G-CNV: A GPU-Based Tool for Preparing Data to Detect CNVs with Read-Depth Methods.

PubMed

Manconi, Andrea; Manca, Emanuele; Moscatelli, Marco; Gnocchi, Matteo; Orro, Alessandro; Armano, Giuliano; Milanesi, Luciano

2015-01-01

Copy number variations (CNVs) are the most prevalent types of structural variations (SVs) in the human genome and are involved in a wide range of common human diseases. Different computational methods have been devised to detect this type of SVs and to study how they are implicated in human diseases. Recently, computational methods based on high-throughput sequencing (HTS) are increasingly used. The majority of these methods focus on mapping short-read sequences generated from a donor against a reference genome to detect signatures distinctive of CNVs. In particular, read-depth based methods detect CNVs by analyzing genomic regions with significantly different read-depth from the other ones. The pipeline analysis of these methods consists of four main stages: (i) data preparation, (ii) data normalization, (iii) CNV regions identification, and (iv) copy number estimation. However, available tools do not support most of the operations required at the first two stages of this pipeline. Typically, they start the analysis by building the read-depth signal from pre-processed alignments. Therefore, third-party tools must be used to perform most of the preliminary operations required to build the read-depth signal. These data-intensive operations can be efficiently parallelized on graphics processing units (GPUs). In this article, we present G-CNV, a GPU-based tool devised to perform the common operations required at the first two stages of the analysis pipeline. G-CNV is able to filter low-quality read sequences, to mask low-quality nucleotides, to remove adapter sequences, to remove duplicated read sequences, to map the short-reads, to resolve multiple mapping ambiguities, to build the read-depth signal, and to normalize it. G-CNV can be efficiently used as a third-party tool able to prepare data for the subsequent read-depth signal generation and analysis. Moreover, it can also be integrated in CNV detection tools to generate read-depth signals.

Probabilistic Motor Sequence Yields Greater Offline and Less Online Learning than Fixed Sequence

PubMed Central

Du, Yue; Prashad, Shikha; Schoenbrun, Ilana; Clark, Jane E.

2016-01-01

It is well acknowledged that motor sequences can be learned quickly through online learning. Subsequently, the initial acquisition of a motor sequence is boosted or consolidated by offline learning. However, little is known whether offline learning can drive the fast learning of motor sequences (i.e., initial sequence learning in the first training session). To examine offline learning in the fast learning stage, we asked four groups of young adults to perform the serial reaction time (SRT) task with either a fixed or probabilistic sequence and with or without preliminary knowledge (PK) of the presence of a sequence. The sequence and PK were manipulated to emphasize either procedural (probabilistic sequence; no preliminary knowledge (NPK)) or declarative (fixed sequence; with PK) memory that were found to either facilitate or inhibit offline learning. In the SRT task, there were six learning blocks with a 2 min break between each consecutive block. Throughout the session, stimuli followed the same fixed or probabilistic pattern except in Block 5, in which stimuli appeared in a random order. We found that PK facilitated the learning of a fixed sequence, but not a probabilistic sequence. In addition to overall learning measured by the mean reaction time (RT), we examined the progressive changes in RT within and between blocks (i.e., online and offline learning, respectively). It was found that the two groups who performed the fixed sequence, regardless of PK, showed greater online learning than the other two groups who performed the probabilistic sequence. The groups who performed the probabilistic sequence, regardless of PK, did not display online learning, as indicated by a decline in performance within the learning blocks. However, they did demonstrate remarkably greater offline improvement in RT, which suggests that they are learning the probabilistic sequence offline. These results suggest that in the SRT task, the fast acquisition of a motor sequence is driven by concurrent online and offline learning. In addition, as the acquisition of a probabilistic sequence requires greater procedural memory compared to the acquisition of a fixed sequence, our results suggest that offline learning is more likely to take place in a procedural sequence learning task. PMID:26973502

Probabilistic Motor Sequence Yields Greater Offline and Less Online Learning than Fixed Sequence.

PubMed

Du, Yue; Prashad, Shikha; Schoenbrun, Ilana; Clark, Jane E

2016-01-01

It is well acknowledged that motor sequences can be learned quickly through online learning. Subsequently, the initial acquisition of a motor sequence is boosted or consolidated by offline learning. However, little is known whether offline learning can drive the fast learning of motor sequences (i.e., initial sequence learning in the first training session). To examine offline learning in the fast learning stage, we asked four groups of young adults to perform the serial reaction time (SRT) task with either a fixed or probabilistic sequence and with or without preliminary knowledge (PK) of the presence of a sequence. The sequence and PK were manipulated to emphasize either procedural (probabilistic sequence; no preliminary knowledge (NPK)) or declarative (fixed sequence; with PK) memory that were found to either facilitate or inhibit offline learning. In the SRT task, there were six learning blocks with a 2 min break between each consecutive block. Throughout the session, stimuli followed the same fixed or probabilistic pattern except in Block 5, in which stimuli appeared in a random order. We found that PK facilitated the learning of a fixed sequence, but not a probabilistic sequence. In addition to overall learning measured by the mean reaction time (RT), we examined the progressive changes in RT within and between blocks (i.e., online and offline learning, respectively). It was found that the two groups who performed the fixed sequence, regardless of PK, showed greater online learning than the other two groups who performed the probabilistic sequence. The groups who performed the probabilistic sequence, regardless of PK, did not display online learning, as indicated by a decline in performance within the learning blocks. However, they did demonstrate remarkably greater offline improvement in RT, which suggests that they are learning the probabilistic sequence offline. These results suggest that in the SRT task, the fast acquisition of a motor sequence is driven by concurrent online and offline learning. In addition, as the acquisition of a probabilistic sequence requires greater procedural memory compared to the acquisition of a fixed sequence, our results suggest that offline learning is more likely to take place in a procedural sequence learning task.

Pathway analysis with next-generation sequencing data.

PubMed

Zhao, Jinying; Zhu, Yun; Boerwinkle, Eric; Xiong, Momiao

2015-04-01

Although pathway analysis methods have been developed and successfully applied to association studies of common variants, the statistical methods for pathway-based association analysis of rare variants have not been well developed. Many investigators observed highly inflated false-positive rates and low power in pathway-based tests of association of rare variants. The inflated false-positive rates and low true-positive rates of the current methods are mainly due to their lack of ability to account for gametic phase disequilibrium. To overcome these serious limitations, we develop a novel statistic that is based on the smoothed functional principal component analysis (SFPCA) for pathway association tests with next-generation sequencing data. The developed statistic has the ability to capture position-level variant information and account for gametic phase disequilibrium. By intensive simulations, we demonstrate that the SFPCA-based statistic for testing pathway association with either rare or common or both rare and common variants has the correct type 1 error rates. Also the power of the SFPCA-based statistic and 22 additional existing statistics are evaluated. We found that the SFPCA-based statistic has a much higher power than other existing statistics in all the scenarios considered. To further evaluate its performance, the SFPCA-based statistic is applied to pathway analysis of exome sequencing data in the early-onset myocardial infarction (EOMI) project. We identify three pathways significantly associated with EOMI after the Bonferroni correction. In addition, our preliminary results show that the SFPCA-based statistic has much smaller P-values to identify pathway association than other existing methods.

A Three-Dimensional Approach and Open Source Structure for the Design and Experimentation of Teaching-Learning Sequences: The case of friction

NASA Astrophysics Data System (ADS)

Besson, Ugo; Borghi, Lidia; De Ambrosis, Anna; Mascheretti, Paolo

2010-07-01

We have developed a teaching-learning sequence (TLS) on friction based on a preliminary study involving three dimensions: an analysis of didactic research on the topic, an overview of usual approaches, and a critical analysis of the subject, considered also in its historical development. We found that mostly the usual presentations do not take into account the complexity of friction as it emerges from scientific research, may reinforce some inaccurate students' conceptions, and favour a limited vision of friction phenomena. The TLS we propose begins by considering a wide range of friction phenomena to favour an initial motivation and a broader view of the topic and then develops a path of interrelated observations, experiments, and theoretical aspects. It proposes the use of structural models, involving visual representations and stimulating intuition, aimed at helping students build mental models of friction mechanisms. To facilitate the reproducibility in school contexts, the sequence is designed as an open source structure, with a core of contents, conceptual correlations and methodological choices, and a cloud of elements that can be re-designed by teachers. The sequence has been tested in teacher education and in upper secondary school, and has shown positive results in overcoming student difficulties and stimulating richer reasoning based on the structural models we suggested. The proposed path has modified the teachers' view of the topic, producing a motivation to change their traditional presentations. The open structure of the sequence has facilitated its implementation by teachers in school in coherence with the rationale of the proposal.

Distance education through the Internet: the GNA-VSNS biocomputing course.

PubMed

de la Vega, F M; Giegerich, R; Fuellen, G

1996-01-01

A prototype course on biocomputing was delivered via international computer networks in early summer 1995. The course lasted 11 weeks, and was offered free of charge. It was organized by the BioComputing Division of the Virtual School of Natural Sciences, which is a member school of the Globewide Network Academy. It brought together 34 students and 7 instructors from all over the world, and covered the basics of sequence analysis. Five authors from Germany and USA prepared a hypertext book which was discussed in weekly study sessions that took place in a virtual classroom at the BioMOO electronic conferencing system. The course aimed at students with backgrounds in molecular biology, biomedicine or computer science, complementing and extending their skills with an interdisciplinary curriculum. Special emphasis was placed on the use of Internet resources, and the development of new teaching tools. The hypertext book includes direct links to sequence analysis and databank search services on the Internet. A tool for the interactive visualization of unit-cost pairwise sequence alignment was developed for the course. All course material will stay accessible at the World Wide Web address (Uniform Resource Locator) http://+www.techfak.uni-bielefeld.de/bcd/welcome .html. This paper describes the aims and organization of the course, and gives a preliminary account of this novel experience in distance education.

Optimization and quality control of genome-wide Hi-C library preparation.

PubMed

Zhang, Xiang-Yuan; He, Chao; Ye, Bing-Yu; Xie, De-Jian; Shi, Ming-Lei; Zhang, Yan; Shen, Wen-Long; Li, Ping; Zhao, Zhi-Hu

2017-09-20

Highest-throughput chromosome conformation capture (Hi-C) is one of the key assays for genome- wide chromatin interaction studies. It is a time-consuming process that involves many steps and many different kinds of reagents, consumables, and equipments. At present, the reproducibility is unsatisfactory. By optimizing the key steps of the Hi-C experiment, such as crosslinking, pretreatment of digestion, inactivation of restriction enzyme, and in situ ligation etc., we established a robust Hi-C procedure and prepared two biological replicates of Hi-C libraries from the GM12878 cells. After preliminary quality control by Sanger sequencing, the two replicates were high-throughput sequenced. The bioinformatics analysis of the raw sequencing data revealed the mapping-ability and pair-mate rate of the raw data were around 90% and 72%, respectively. Additionally, after removal of self-circular ligations and dangling-end products, more than 96% of the valid pairs were reached. Genome-wide interactome profiling shows clear topological associated domains (TADs), which is consistent with previous reports. Further correlation analysis showed that the two biological replicates strongly correlate with each other in terms of both bin coverage and all bin pairs. All these results indicated that the optimized Hi-C procedure is robust and stable, which will be very helpful for the wide applications of the Hi-C assay.

Study of the Paleogene carbonate sequence in Campeche and Yucatan, southern Mexico

NASA Astrophysics Data System (ADS)

García Avendaño, A.; Fucugauchi, J. U.

2013-05-01

The relief in the northeastern sector of Yucatan Peninsula is marked in several features, like the Campeche-Hecelchakan fault that indicates a scarp where the carbonate factory was produced from the different processes of eustatic variation throughout all extensions of the shelf. The Campeche scarp is one of the major structures of the peninsula. In this work we present preliminary results of the study on the Paleogene carbonate sequence (stratigraphic age derived from previous works) along a regional transect from the town of Champoton Campeche till Maxcanu town and into nearby Sierra of Ticul in Yucatan state, Mexico. Along this route we carried field work to measure geologic columns and sampled outcrops for petrographic analysis, selected based in litofacies settings in two units Champoton-Maxcanu (CH-CM) and Ticul Sierra (TS), CH-CM unit is formed by interbedded clay, shale, limestone and marl of different thickness, in addition to the content of various bioclasts. ST unit is comprised mostly of collapse breccias. This paper presents the microfacies analysis, directed to highlight changes in lithological horizons within the sequence. The study of carbonates in this study area contributes to the interpretation of the Yucatan geomorphology and development of the carbonate platform, for which the karst topography indicates a gradual subaerial exposure environment. .

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase.

PubMed

Bamford, Vicki A; Armour, Maria; Mitchell, Sue A; Cartron, Michaël; Andrews, Simon C; Watson, Kimberly A

2008-09-01

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Extraterrestrial consumables production and utilization

NASA Technical Reports Server (NTRS)

Sanders, A. P.

1972-01-01

Potential oxygen requirements for lunar-surface, lunar-orbit, and planetary missions are presented with emphasis on: (1) emergency survival of the crew, (2) provision of energy consumables for vehicles, and (3) nondependency on an earth supply of oxygen. Although many extraterrestrial resource processes are analytically feasible, this study has considered hydrogen and fluorine processing concepts to obtain oxygen or water (or both). The results are quite encouraging and are extrapolatable to other processes. Preliminary mission planning and sequencing analysis has enabled the programmatic evaluation of using lunar-derived oxygen relative to transportation cost as a function of vehicle delivery and operational capability.

Automatic detection of pelvic lymph nodes using multiple MR sequences

NASA Astrophysics Data System (ADS)

Yan, Michelle; Lu, Yue; Lu, Renzhi; Requardt, Martin; Moeller, Thomas; Takahashi, Satoru; Barentsz, Jelle

2007-03-01

A system for automatic detection of pelvic lymph nodes is developed by incorporating complementary information extracted from multiple MR sequences. A single MR sequence lacks sufficient diagnostic information for lymph node localization and staging. Correct diagnosis often requires input from multiple complementary sequences which makes manual detection of lymph nodes very labor intensive. Small lymph nodes are often missed even by highly-trained radiologists. The proposed system is aimed at assisting radiologists in finding lymph nodes faster and more accurately. To the best of our knowledge, this is the first such system reported in the literature. A 3-dimensional (3D) MR angiography (MRA) image is employed for extracting blood vessels that serve as a guide in searching for pelvic lymph nodes. Segmentation, shape and location analysis of potential lymph nodes are then performed using a high resolution 3D T1-weighted VIBE (T1-vibe) MR sequence acquired by Siemens 3T scanner. An optional contrast-agent enhanced MR image, such as post ferumoxtran-10 T2*-weighted MEDIC sequence, can also be incorporated to further improve detection accuracy of malignant nodes. The system outputs a list of potential lymph node locations that are overlaid onto the corresponding MR sequences and presents them to users with associated confidence levels as well as their sizes and lengths in each axis. Preliminary studies demonstrates the feasibility of automatic lymph node detection and scenarios in which this system may be used to assist radiologists in diagnosis and reporting.

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.

The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less

40 CFR 161.170 - Preliminary analysis.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Preliminary analysis. (a) If the product is produced by an integrated system, the applicant must provide a preliminary analysis of each technical grade of active ingredient contained in the product to identify all... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Preliminary analysis. 161.170 Section...

Authentication of meat from game and domestic species by SNaPshot minisequencing analysis.

PubMed

La Neve, Fabio; Civera, Tiziana; Mucci, Nadia; Bottero, Maria Teresa

2008-10-01

The aim of the present study is to develop an assay for the specific identification of meat from Capreolus capreolus, Cervus elaphus, Capra ibex, Rupicapra rupicapra, targeting sequences of the cytochrome b (cyt b) gene of mitochondrial DNA. The assay is also intended to enable differentiation between meat from these wild species as well as Ovis aries, Capra hircus, Bubalus bubalis, Bos taurus and Sus scrofa domestic species. The primers used in the preliminary PCR were designed in well conserved regions upstream and downstream of the diagnosis sites. They successfully amplified a conserved 232bp region from the cyt b gene of all the species taken into consideration. The sites of diagnosis have been interrogated using a minisequencing reaction and capillary electrophoresis. All the results of the multiplex PER (primer extension reaction) test were confirmed by fragment sequencing. The assay offers the possibility of discriminating nine species at the same time.

Corrective emotional experience in an integrative affect-focused therapy: Building a preliminary model using task analysis.

PubMed

Nakamura, Kaori; Iwakabe, Shigeru

2018-03-01

The present study constructed a preliminary process model of corrective emotional experience (CEE) in an integrative affect-focused therapy. Task analysis was used to analyse 6 in-session events taken from 6 Japanese clients who worked with an integrative affect-focused therapist. The 6 events included 3 successful CEEs and 3 partially successful CEEs for comparison. A rational-empirical model of CEE was generated, which consisted of two parallel client change processes, intrapersonal change and interpersonal change, and the therapist interventions corresponding to each process. Therapist experiential interventions and therapist affirmation facilitated both intrapersonal and interpersonal change processes, whereas his relational interventions were associated with the interpersonal change process. The partially successful CEEs were differentiated by the absence of the component of core painful emotions or negative beliefs in intrapersonal change process, which seemed crucial for the interpersonal change process to develop. CEE is best represented by a preliminary model that depicts two parallel yet interacting change processes. Intrapersonal change process is similar to the sequence of change described by the emotional processing model (Pascual-Leone & Greenberg, ), whereas interpersonal change process is a unique contribution of this study. Interpersonal change process was facilitated when the therapist's active stance and use of immediacy responses to make their relational process explicit allowed a shared exploration. Therapist affirmation bridged intrapersonal change to interpersonal change by promoting an adaptive sense of self in clients and forging a deeper emotional connection between the two. Copyright © 2017 John Wiley & Sons, Ltd.

Optimization of whole-transcriptome amplification from low cell density deep-sea microbial samples for metatranscriptomic analysis.

PubMed

Wu, Jieying; Gao, Weimin; Zhang, Weiwen; Meldrum, Deirdre R

2011-01-01

Limitation in sample quality and quantity is one of the big obstacles for applying metatranscriptomic technologies to explore gene expression and functionality of microbial communities in natural environments. In this study, several amplification methods were evaluated for whole-transcriptome amplification of deep-sea microbial samples, which are of low cell density and high impurity. The best amplification method was identified and incorporated into a complete protocol to isolate and amplify deep-sea microbial samples. In the protocol, total RNA was first isolated by a modified method combining Trizol (Invitrogen, CA) and RNeasy (QIAGEN, CA) method, amplified with a WT-Ovation™ Pico RNA Amplification System (NuGEN, CA), and then converted to double-strand DNA from single-strand cDNA with a WT-Ovation™ Exon Module (NuGEN, CA). The products from the whole-transcriptome amplification of deep-sea microbial samples were assessed first through random clone library sequencing. The BLAST search results showed that marine-based sequences are dominant in the libraries, consistent with the ecological source of the samples. The products were then used for next-generation Roche GS FLX Titanium sequencing to obtain metatranscriptome data. Preliminary analysis of the metatranscriptomic data showed good sequencing quality. Although the protocol was designed and demonstrated to be effective for deep-sea microbial samples, it should be applicable to similar samples from other extreme environments in exploring community structure and functionality of microbial communities. Copyright © 2010 Elsevier B.V. All rights reserved.

Comparison of the canine and human acid {beta}-galactosidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less

A new enigmatic Late Miocene mylodontoid sloth from northern South America

PubMed Central

Rincón, Ascanio D.; McDonald, H. Gregory; Solórzano, Andrés; Flores, Mónica Núñez; Ruiz-Ramoni, Damián

2015-01-01

A new genus and species of sloth (Eionaletherium tanycnemius gen. et sp. nov.) recently collected from the Late Miocene Urumaco Formation, Venezuela (northern South America) is herein described based on a partial skeleton including associated femora and tibiae. In order to make a preliminary analysis of the phylogenetic affinities of this new sloth we performed a discriminate analysis based on several characters of the femur and tibia of selected Mylodontoidea and Megatherioidea sloths. The consensus tree produced indicates that the new sloth, E. tanycnemius, is a member of the Mylodontoidea. Surprisingly, the new taxon shows some enigmatic features among Neogene mylodontoid sloths, e.g. femur with a robust lesser trochanter that projects medially and the straight distinctly elongated tibia. The discovery of E. tanycnemius increases the diversity of sloths present in the Urumaco sequence to ten taxa. This taxon supports previous studies of the sloth assemblage from the Urumaco sequence as it further indicates that there are several sloth lineages present that are unknown from the better sampled areas of southern South America. PMID:26064594

Lower extremity kinetics in tap dance.

PubMed

Mayers, Lester; Bronner, Shaw; Agraharasamakulam, Sujani; Ojofeitimi, Sheyi

2010-01-01

Tap dance is a unique performing art utilizing the lower extremities as percussion instruments. In a previous study these authors reported decreased injury prevalence among tap dancers compared to other dance and sports participants. No biomechanical analyses of tap dance exist to explain this finding. The purpose of the current pilot study was to provide a preliminary overview of normative peak kinetic and kinematic data, based on the hypothesis that tap dance generates relatively low ground reaction forces and joint forces and moments. Six professional tap dancers performed four common tap dance sequences that produced data captured by the use of a force platform and a five-camera motion analysis system. The mean vertical ground reaction force for all sequences was found to be 2.06+/-0.55 BW. Mean peak sagittal, frontal, and transverse plane joint moments (hip, knee, and ankle) ranged from 0.07 to 2.62 N.m/kg. These small ground reaction forces and joint forces and moments support our hypothesis, and may explain the relatively low injury incidence in tap dancers. Nevertheless, the analysis is highly complex, and other factors remain to be studied and clarified.

Compilation of Reprints Number 63.

DTIC Science & Technology

1986-03-01

Michel Be6, Stephen H1. Johnson, and E.F. Chiburis PRELIMINARY SEISMIC REFRACTION RESULTS USING A BOREHOLE SEISMOMETER IN DEEP SEA DRILLING PROJECT HOLE...refraction data with wells drilled on land and offshore reflection profiles permits tentative identification of geologic sequences on the basis of...PERIOD CO’VEAEO PRELIMINARY SEISMIC REFRACTION RESULTS USING A Rern BOREHOLE SEISMOMETER IN DEEP SEA DRILLING ~ rn PROJECT HOLE 395A 6.PERFORMING ORG

Multiscale Analysis of Solar Image Data

NASA Astrophysics Data System (ADS)

Young, C. A.; Myers, D. C.

2001-12-01

It is often said that the blessing and curse of solar physics is that there is too much data. Solar missions such as Yohkoh, SOHO and TRACE have shown us the Sun with amazing clarity but have also cursed us with an increased amount of higher complexity data than previous missions. We have improved our view of the Sun yet we have not improved our analysis techniques. The standard techniques used for analysis of solar images generally consist of observing the evolution of features in a sequence of byte scaled images or a sequence of byte scaled difference images. The determination of features and structures in the images are done qualitatively by the observer. There is little quantitative and objective analysis done with these images. Many advances in image processing techniques have occured in the past decade. Many of these methods are possibly suited for solar image analysis. Multiscale/Multiresolution methods are perhaps the most promising. These methods have been used to formulate the human ability to view and comprehend phenomena on different scales. So these techniques could be used to quantitify the imaging processing done by the observers eyes and brains. In this work we present a preliminary analysis of multiscale techniques applied to solar image data. Specifically, we explore the use of the 2-d wavelet transform and related transforms with EIT, LASCO and TRACE images. This work was supported by NASA contract NAS5-00220.

77 FR 17410 - Bottom Mount Combination Refrigerator-Freezers From the Republic of Korea: Final Affirmative...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-26

..., 2011, the Department issued its Post-Preliminary Analysis of Cross-ownership and its Post- Preliminary Analysis of New Subsidy Allegations. On that date, the Department also issued its Post-Preliminary Analysis... Post-Preliminary Analysis: GOK Preferential Lending Under the Daewoo Workout, and the GOK, LGE, SEC...

Transcriptome analysis of Spodoptera frugiperda Sf9 cells reveals putative apoptosis-related genes and a preliminary apoptosis mechanism induced by azadirachtin.

PubMed

Shu, Benshui; Zhang, Jingjing; Sethuraman, Veeran; Cui, Gaofeng; Yi, Xin; Zhong, Guohua

2017-10-16

As an important botanical pesticide, azadirachtin demonstrates broad insecticidal activity against many agricultural pests. The results of a previous study indicated the toxicity and apoptosis induction of azadirachtin in Spodoptera frugiperda Sf9 cells. However, the lack of genomic data has hindered a deeper investigation of apoptosis in Sf9 cells at a molecular level. In the present study, the complete transcriptome data for Sf9 cell line was accomplished using Illumina sequencing technology, and 97 putative apoptosis-related genes were identified through BLAST and KEGG orthologue annotations. Fragments of potential candidate apoptosis-related genes were cloned, and the mRNA expression patterns of ten identified genes regulated by azadirachtin were examined using qRT-PCR. Furthermore, Western blot analysis showed that six putative apoptosis-related proteins were upregulated after being treated with azadirachtin while the protein Bcl-2 were downregulated. These data suggested that both intrinsic and extrinsic apoptotic signal pathways comprising the identified potential apoptosis-related genes were potentially active in S. frugiperda. In addition, the preliminary results revealed that caspase-dependent or caspase-independent apoptotic pathways could function in azadirachtin-induced apoptosis in Sf9 cells.

Noninvasive Localization of Prostate Cancer via Diffusion Sensitive MRI

DTIC Science & Technology

2008-03-01

sequence, Haker et al and Roebuck et al using a line-scan diffusion sequence, and Vigneron et al using a fast spin-echo diffusion sequence (33,35-37...Mulkern RV, Haker S, Zhang J, Zou KH, Maier SE, Tempany CM. Detection of prostate cancer by integration of line-scan diffusion, T2-mapping and T2-weighted...36. Haker SJ, Szot Barnes A, Maier SE, Tempany CM, Mulkern RV. Diffusion Tensor Imaging for Prostate Cancer Detection: Preliminary Results from a

Molecular diversity of methanogens in fecal samples from Bactrian camels (Camelus bactrianus) at two zoos.

PubMed

Turnbull, Kathryn L; Smith, Rachel P; St-Pierre, Benoit; Wright, André-Denis G

2012-08-01

Animals are dependent on mutualistic microbial communities that reside in their gastrointestinal track for essential physiological functions such as nutrition and pathogen resistance. The composition of microbial communities in an animal is influenced by various factors, including species, diet and geographical location. In this preliminary study, the population structure of fecal methanogens in Bactrian camels (Camelus bactrianus) from two zoos was studied using separate 16S rRNA gene libraries for each zoo. While methanogen sequences belonging to the genus Methanobrevibacter were dominant in both libraries, they showed significant differences in diversity (p=0.05) and structure (p<0.0001). Population structure analysis revealed that only two operational taxonomic units (OTUs) were shared between libraries, while two OTUs were unique to the Southwick Zoo library and seven OTUs were unique to the Potter Park Zoo library. These preliminary results highlight how methanogen population structures can vary greatly between animals of the same species maintained in captivity at different locations. Copyright © 2011 Elsevier Ltd. All rights reserved.

First ancient DNA sequences from the Late Pleistocene red deer (Cervus elaphus) in the Crimea, Ukraine

NASA Astrophysics Data System (ADS)

Stanković, Ana; Nadachowski, Adam; Doan, Karolina; Stefaniak, Krzysztof; Baca, Mateusz; Socha, Paweł; Wegleński, Piotr; Ridush, Bogdan

2010-05-01

The Late Pleistocene has been a period of significant population and species turnover and extinctions among the large mammal fauna. Massive climatic and environmental changes during Pleistocene significantly influenced the distribution and also genetic diversity of plants and animals. The model of glacial refugia and habitat contraction to southern peninsulas in Europe as areas for the survival of temperate animal species during unfavourable Pleistocene glaciations is at present widely accepted. However, both molecular data and the fossil record indicate the presence of northern and perhaps north-eastern refugia in Europe. In recent years, much new palaeontological data have been obtained in the Crimean Peninsula, Ukraine, following extensive investigations. The red deer (Cervus elaphus) samples for aDNA studies were collected in Emine-Bair-Khosar Cave, situated on the north edge of Lower Plateau of the Chatyrdag Massif (Crimean Mountains). The cave is a vertical shaft, which functioned as a huge mega-trap over a long period of time (probably most of the Pleistocene). The bone assemblages provided about 5000 bones belonging to more than 40 species. The C. elaphus bones were collected from three different stratigraphical levels, radiocarbon dated by accelerator mass spectrometry (AMS) method. The bone fragments of four specimens of red deer were used for the DNA isolation and analysis. The mtDNA (Cytochome b) was successfully isolated from three bone fragments and the cytochrome b sequences were amplified by multiplex PCR. The sequences obtained so far allowed for the reconstruction of only preliminary phylogenetic trees. A fragment of metatarsus from level dated to ca. 48,500±2,000 years BP, yielded a sequence of 513 bp, allowing to locate the specimen on the phylogenetic tree within modern C. elaphus specimens from southern and middle Europe. The second bone fragment, a fragment of mandible, collected from level dated approximately to ca. 33,500±400 years BP, yielded a sequence (696 bp) locating this specimen much closer to the modern C. elaphus specimens from China and Far East. From the third bone fragment (metatarsus), dated between ca. 12,000 years BP and 30,000 years BP, the sequence of only 346 bp has been obtained. It locates this specimen between European and Asiatic haplogroups. The preliminary results of analysis of the DNA from Crimean C. elaphus fossils reveal the great genetic heterogeneity and a complex phylogeographical pattern of the material studied. The obtained results support the opinion that Crimean Peninsula was the most north-eastern refugium in Europe during Late Pleistocene playing a major role in recolonization and dispersal processes of temperate species during and after the Late Pleistocene in this part of the Euro-Asian continent.

[Blue-light induced expression of S-adenosy-L-homocysteine hydrolase-like gene in Mucor amphibiorum RCS1].

PubMed

Gao, Ya; Wang, Shu; Fu, Mingjia; Zhong, Guolin

2013-09-04

To determine blue-light induced expression of S-adenosyl-L-homocysteine hydrolase-like (sahhl) gene in fungus Mucor amphibiorum RCS1. In the random process of PCR, a sequence of 555 bp was obtained from M. amphibiorum RCS1. The 555 bp sequence was labeled with digoxin to prepare the probe for northern hybridization. By northern hybridization, the transcription of sahhl gene was analyzed in M. amphibiorum RCS1 mycelia culture process from darkness to blue light to darkness. Simultaneously real-time PCR method was used to the sahhl gene expression analysis. Compared with the sequence of sahh gene from Homo sapiens, Mus musculus and some fungi species, a high homology of the 555 bp sequence was confirmed. Therefore, the preliminary confirmation has supported that the 555 bp sequence should be sahhl gene from M. amphibiorum RCS1. Under the dark pre-culture in 24 h, a large amounts of transcript of sahhl gene in the mycelia can be detected by northern hybridization and real-time PCR in the condition of 24 h blue light. But a large amounts of transcript of sahhl gene were not found in other detection for the dark pre-culture of 48 h, even though M. amphibiorum RCS1 mycelia were induced by blue light. Blue light can induce the expression of sahhl gene in the vigorous growth of M. amphibiorum RCS1 mycelia.

Identification and Characterization of Multiple Spidroin 1 Genes Encoding Major Ampullate Silk Proteins in Nephila clavipes

PubMed Central

Gaines, William A.; Marcotte, William R.

2010-01-01

Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSp) that consist of a large repeat array flanked by non-repetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We have experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species. PMID:18828837

First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)

PubMed Central

Bockwoldt, Mathias; Hagen, Live H.; Pope, Phillip B.; Sundset, Monica A.

2016-01-01

The faecal microbiota of muskoxen (n=3) pasturing on Ryøya (69° 33′ N 18° 43′ E), Norway, in late September was characterized using high-throughput sequencing of partial 16S rRNA gene regions. A total of 16 209 high-quality sequence reads from bacterial domains and 19 462 from archaea were generated. Preliminary taxonomic classifications of 806 bacterial operational taxonomic units (OTUs) resulted in 53.7–59.3 % of the total sequences being without designations beyond the family level. Firmicutes (70.7–81.1 % of the total sequences) and Bacteroidetes (16.8–25.3 %) constituted the two major bacterial phyla, with uncharacterized members within the family Ruminococcaceae (28.9–40.9 %) as the major phylotype. Multiple-library comparisons between muskoxen and other ruminants indicated a higher similarity for muskoxen faeces and reindeer caecum (P>0.05) and some samples from cattle faeces. The archaeal sequences clustered into 37 OTUs, with dominating phylotypes affiliated to the methane-producing genus Methanobrevibacter (80–92 % of the total sequences). UniFrac analysis demonstrated heterogeneity between muskoxen archaeal libraries and those from reindeer and roe deer (P=1.0e-02, Bonferroni corrected), but not with foregut fermenters. The high proportion of cellulose-degrading Ruminococcus-affiliated bacteria agrees with the ingestion of a highly fibrous diet. Further experiments are required to elucidate the role played by these novel bacteria in the digestion of this fibrous Artic diet eaten by muskoxen. PMID:28348861

Genomic Analysis of Vaccine-Derived Poliovirus Strains in Stool Specimens by Combination of Full-Length PCR and Oligonucleotide Microarray Hybridization

PubMed Central

Laassri, Majid; Dragunsky, Eugenia; Enterline, Joan; Eremeeva, Tatiana; Ivanova, Olga; Lottenbach, Kathleen; Belshe, Robert; Chumakov, Konstantin

2005-01-01

Sabin strains of poliovirus used in the manufacture of oral poliovirus vaccine (OPV) are prone to genetic variations that occur during growth in cell cultures and the organisms of vaccine recipients. Such derivative viruses often have increased neurovirulence and transmissibility, and in some cases they can reestablish chains of transmission in human populations. Monitoring for vaccine-derived polioviruses is an important part of the worldwide campaign to eradicate poliomyelitis. Analysis of vaccine-derived polioviruses requires, as a first step, their isolation in cell cultures, which takes significant time and may yield viral stocks that are not fully representative of the strains present in the original sample. Here we demonstrate that full-length viral cDNA can be PCR amplified directly from stool samples and immediately subjected to genomic analysis by oligonucleotide microarray hybridization and nucleotide sequencing. Most fecal samples from healthy children who received OPV were found to contain variants of Sabin vaccine viruses. Sequence changes in the 5′ untranslated region were common, as were changes in the VP1-coding region, including changes in a major antigenic site. Analysis of stool samples taken from cases of acute flaccid paralysis revealed the presence of mixtures of recombinant polioviruses, in addition to the emergence of new sequence variants. Avoiding the need for cell culture isolation dramatically shortened the time needed for identification and analysis of vaccine-derived polioviruses and could be useful for preliminary screening of clinical samples. The amplified full-length viral cDNA can be archived and used to recover live virus for further virological studies. PMID:15956413

Method of interplanetary trajectory optimization for the spacecraft with low thrust and swing-bys

NASA Astrophysics Data System (ADS)

Konstantinov, M. S.; Thein, M.

2017-07-01

The method developed to avoid the complexity of solving the multipoint boundary value problem while optimizing interplanetary trajectories of the spacecraft with electric propulsion and a sequence of swing-bys is presented in the paper. This method is based on the use of the preliminary problem solutions for the impulsive trajectories. The preliminary problem analyzed at the first stage of the study is formulated so that the analysis and optimization of a particular flight path is considered as the unconstrained minimum in the space of the selectable parameters. The existing methods can effectively solve this problem and make it possible to identify rational flight paths (the sequence of swing-bys) to receive the initial approximation for the main characteristics of the flight path (dates, values of the hyperbolic excess velocity, etc.). These characteristics can be used to optimize the trajectory of the spacecraft with electric propulsion. The special feature of the work is the introduction of the second (intermediate) stage of the research. At this stage some characteristics of the analyzed flight path (e.g. dates of swing-bys) are fixed and the problem is formulated so that the trajectory of the spacecraft with electric propulsion is optimized on selected sites of the flight path. The end-to-end optimization is carried out at the third (final) stage of the research. The distinctive feature of this stage is the analysis of the full set of optimal conditions for the considered flight path. The analysis of the characteristics of the optimal flight trajectories to Jupiter with Earth, Venus and Mars swing-bys for the spacecraft with electric propulsion are presented. The paper shows that the spacecraft weighing more than 7150 kg can be delivered into the vicinity of Jupiter along the trajectory with two Earth swing-bys by use of the space transportation system based on the "Angara A5" rocket launcher, the chemical upper stage "KVTK" and the electric propulsion system with input electrical power of 100 kW.

Worldwide genetic variability of the Duffy binding protein: insights into Plasmodium vivax vaccine development.

PubMed

Nóbrega de Sousa, Taís; Carvalho, Luzia Helena; Alves de Brito, Cristiana Ferreira

2011-01-01

The dependence of Plasmodium vivax on invasion mediated by Duffy binding protein (DBP) makes this protein a prime candidate for development of a vaccine. However, the development of a DBP-based vaccine might be hampered by the high variability of the protein ligand (DBP(II)), known to bias the immune response toward a specific DBP variant. Here, the hypothesis being investigated is that the analysis of the worldwide DBP(II) sequences will allow us to determine the minimum number of haplotypes (MNH) to be included in a DBP-based vaccine of broad coverage. For that, all DBP(II) sequences available were compiled and MNH was based on the most frequent nonsynonymous single nucleotide polymorphisms, the majority mapped on B and T cell epitopes. A preliminary analysis of DBP(II) genetic diversity from eight malaria-endemic countries estimated that a number between two to six DBP haplotypes (17 in total) would target at least 50% of parasite population circulating in each endemic region. Aiming to avoid region-specific haplotypes, we next analyzed the MNH that broadly cover worldwide parasite population. The results demonstrated that seven haplotypes would be required to cover around 60% of DBP(II) sequences available. Trying to validate these selected haplotypes per country, we found that five out of the eight countries will be covered by the MNH (67% of parasite populations, range 48-84%). In addition, to identify related subgroups of DBP(II) sequences we used a Bayesian clustering algorithm. The algorithm grouped all DBP(II) sequences in six populations that were independent of geographic origin, with ancestral populations present in different proportions in each country. In conclusion, in this first attempt to undertake a global analysis about DBP(II) variability, the results suggest that the development of DBP-based vaccine should consider multi-haplotype strategies; otherwise a putative P. vivax vaccine may not target some parasite populations.

DNA barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera).

PubMed

Foottit, Robert G; Maw, Eric; Hebert, P D N

2014-01-01

Many studies have shown the suitability of sequence variation in the 5' region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage.

DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)

PubMed Central

Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

2014-01-01

Background Many studies have shown the suitability of sequence variation in the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

Polarisation Measurement with a Dual Beam Interferometer (CATSI). Exploratory Results and Preliminary Phenomenological Analysis

DTIC Science & Technology

2006-06-01

Polarisation measurement with a dual beam interferometer (CATSI) Exploratory results and preliminary phenomenological analysis H. Lavoie J.-M... Polarisation measurement with a dual beam interferometer (CATSI) Exploratory results and preliminary phenomenological analysis H. Lavoie J.-M. Thériault... Polarisation measurement with a dual beam interferometer (CATSI) - Exploratory results and preliminary phenomenological analysis. ECR 2004-372. DRDC Valcartier

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

PubMed Central

Bamford, Vicki A.; Armour, Maria; Mitchell, Sue A.; Cartron, Michaël; Andrews, Simon C.; Watson, Kimberly A.

2008-01-01

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 Å resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily. PMID:18765906

AVID - A design system for technology studies of advanced transportation concepts. [Aerospace Vehicle Interactive Design

NASA Technical Reports Server (NTRS)

Wilhite, A. W.; Rehder, J. J.

1979-01-01

The basic AVID (Aerospace Vehicle Interactive Design) is a general system for conceptual and preliminary design currently being applied to a broad range of future space transportation and spacecraft vehicle concepts. AVID hardware includes a minicomputer allowing rapid designer interaction. AVID software includes (1) an executive program and communication data base which provide the automated capability to couple individual programs, either individually in an interactive mode or chained together in an automatic sequence mode; and (2) the individual technology and utility programs which provide analysis capability in areas such as graphics, aerodynamics, propulsion, flight performance, weights, sizing, and costs.

Scaling of theory-of-mind tasks.

PubMed

Wellman, Henry M; Liu, David

2004-01-01

Two studies address the sequence of understandings evident in preschoolers' developing theory of mind. The first, preliminary study provides a meta-analysis of research comparing different types of mental state understandings (e.g., desires vs. beliefs, ignorance vs. false belief). The second, primary study tests a theory-of-mind scale for preschoolers. In this study 75 children (aged 2 years, 11 months to 6 years, 6 months) were tested on 7 tasks tapping different aspects of understanding persons' mental states. Responses formed a consistent developmental progression, where for most children if they passed a later item they passed all earlier items as well, as confirmed by Guttman and Rasch measurement model analyses.

Multiband Lightcurve of Tabby’s Star: Observations and Modeling

NASA Astrophysics Data System (ADS)

Yin, Yao; Wilcox, Alejandro; Boyajian, Tabetha S.

2018-06-01

Since March 2017, The Thacher Observatory in California has been monitoring changes in brightness of KIC 8462852 (Tabby's Star), an F-type main sequence star whose irregular dimming behavior was first discovered by Tabetha Boyajian by examining Kepler data. We obtained over 20k observations over 135 nights in 2017 in 4 photometric bands, and detected 4 dip events greater than 1%. The relative magnitude of each dip compared across our 4 different photometric bands provides critical information regarding the nature of the obscuring material, and we present a preliminary analysis of these events. The Thacher Observatory is continuing its monitoring of Tabby’s Star in 2018.

[Multiplexing mapping of human cDNAs]. Final report, September 1, 1991--February 28, 1994

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

Using PCR with automated product analysis, 329 human brain cDNA sequences have been assigned to individual human chromosomes. Primers were designed from single-pass cDNA sequences expressed sequence tags (ESTs). Primers were used in PCR reactions with DNA from somatic cell hybrid mapping panels as templates, often with multiplexing. Many ESTs mapped match sequence database records. To evaluate of these matches, the position of the primers relative to the matching region (In), the BLAST scores and the Poisson probability values of the EST/sequence record match were determined. In cases where the gene product was stringently identified by the sequence match hadmore » already been mapped, the gene locus determined by EST was consistent with the previous position which strongly supports the validity of assigning unknown genes to human chromosomes based on the EST sequence matches. In the present cases mapping the ESTs to a chromosome can also be considered to have mapped the known gene product: rolipram-sensitive cAMP phosphodiesterase, chromosome 1; protein phosphatase 2A{beta}, chromosome 4; alpha-catenin, chromosome 5; the ELE1 oncogene, chromosome 10q11.2 or q2.1-q23; MXII protein, chromosome l0q24-qter; ribosomal protein L18a homologue, chromosome 14; ribosomal protein L3, chromosome 17; and moesin, Xp11-cen. There were also ESTs mapped that were closely related to non-human sequence records. These matches therefore can be considered to identify human counterparts of known gene products, or members of known gene families. Examples of these include membrane proteins, translation-associated proteins, structural proteins, and enzymes. These data then demonstrate that single pass sequence information is sufficient to design PCR primers useful for assigning cDNA sequences to human chromosomes. When the EST sequence matches previous sequence database records, the chromosome assignments of the EST can be used to make preliminary assignments of the human gene to a chromosome.« less

Studies in astronomical time series analysis: Modeling random processes in the time domain

NASA Technical Reports Server (NTRS)

Scargle, J. D.

1979-01-01

Random process models phased in the time domain are used to analyze astrophysical time series data produced by random processes. A moving average (MA) model represents the data as a sequence of pulses occurring randomly in time, with random amplitudes. An autoregressive (AR) model represents the correlations in the process in terms of a linear function of past values. The best AR model is determined from sampled data and transformed to an MA for interpretation. The randomness of the pulse amplitudes is maximized by a FORTRAN algorithm which is relatively stable numerically. Results of test cases are given to study the effects of adding noise and of different distributions for the pulse amplitudes. A preliminary analysis of the optical light curve of the quasar 3C 273 is given.

75 FR 54117 - Building Energy Standards Program: Preliminary Determination Regarding Energy Efficiency...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-03

... Response to Comments on Previous Analysis C. Summary of the Comparative Analysis 1. Quantitative Analysis 2... preliminary quantitative analysis are specific building designs, in most cases with specific spaces defined... preliminary determination. C. Summary of the Comparative Analysis DOE carried out both a broad quantitative...

Gemi: PCR Primers Prediction from Multiple Alignments

PubMed Central

Sobhy, Haitham; Colson, Philippe

2012-01-01

Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

Sequencing and characterizing the genome of Estrella lausannensis as an undergraduate project: training students and biological insights.

PubMed

Bertelli, Claire; Aeby, Sébastien; Chassot, Bérénice; Clulow, James; Hilfiker, Olivier; Rappo, Samuel; Ritzmann, Sébastien; Schumacher, Paolo; Terrettaz, Céline; Benaglio, Paola; Falquet, Laurent; Farinelli, Laurent; Gharib, Walid H; Goesmann, Alexander; Harshman, Keith; Linke, Burkhard; Miyazaki, Ryo; Rivolta, Carlo; Robinson-Rechavi, Marc; van der Meer, Jan Roelof; Greub, Gilbert

2015-01-01

With the widespread availability of high-throughput sequencing technologies, sequencing projects have become pervasive in the molecular life sciences. The huge bulk of data generated daily must be analyzed further by biologists with skills in bioinformatics and by "embedded bioinformaticians," i.e., bioinformaticians integrated in wet lab research groups. Thus, students interested in molecular life sciences must be trained in the main steps of genomics: sequencing, assembly, annotation and analysis. To reach that goal, a practical course has been set up for master students at the University of Lausanne: the "Sequence a genome" class. At the beginning of the academic year, a few bacterial species whose genome is unknown are provided to the students, who sequence and assemble the genome(s) and perform manual annotation. Here, we report the progress of the first class from September 2010 to June 2011 and the results obtained by seven master students who specifically assembled and annotated the genome of Estrella lausannensis, an obligate intracellular bacterium related to Chlamydia. The draft genome of Estrella is composed of 29 scaffolds encompassing 2,819,825 bp that encode for 2233 putative proteins. Estrella also possesses a 9136 bp plasmid that encodes for 14 genes, among which we found an integrase and a toxin/antitoxin module. Like all other members of the Chlamydiales order, Estrella possesses a highly conserved type III secretion system, considered as a key virulence factor. The annotation of the Estrella genome also allowed the characterization of the metabolic abilities of this strictly intracellular bacterium. Altogether, the students provided the scientific community with the Estrella genome sequence and a preliminary understanding of the biology of this recently-discovered bacterial genus, while learning to use cutting-edge technologies for sequencing and to perform bioinformatics analyses.

Mediators of exposure therapy for youth obsessive-compulsive disorder: specificity and temporal sequence of client and treatment factors.

PubMed

Chu, Brian C; Colognori, Daniela B; Yang, Guang; Xie, Min-ge; Lindsey Bergman, R; Piacentini, John

2015-05-01

Behavioral engagement and cognitive coping have been hypothesized to mediate effectiveness of exposure-based therapies. Identifying which specific child factors mediate successful therapy and which therapist factors facilitate change can help make our evidence-based treatments more efficient and robust. The current study examines the specificity and temporal sequence of relations among hypothesized client and therapist mediators in exposure therapy for pediatric Obsessive Compulsive Disorder (OCD). Youth coping (cognitive, behavioral), youth safety behaviors (avoidance, escape, compulsive behaviors), therapist interventions (cognitive, exposure extensiveness), and youth anxiety were rated via observational ratings of therapy sessions of OCD youth (N=43; ages=8 - 17; 62.8% male) who had received Exposure and Response Prevention (ERP). Regression analysis using Generalized Estimation Equations and cross-lagged panel analysis (CLPA) were conducted to model anxiety change within and across sessions, to determine formal mediators of anxiety change, and to establish sequence of effects. Anxiety ratings decreased linearly across exposures within sessions. Youth coping and therapist interventions significantly mediated anxiety change across exposures, and youth-interfering behavior mediated anxiety change at the trend level. In CLPA, youth-interfering behaviors predicted, and were predicted by, changes in anxiety. Youth coping was predicted by prior anxiety change. The study provides a preliminary examination of specificity and temporal sequence among child and therapist behaviors in predicting youth anxiety. Results suggest that therapists should educate clients in the natural rebound effects of anxiety between sessions and should be aware of the negatively reinforcing properties of avoidance during exposure. Copyright © 2015. Published by Elsevier Ltd.

A knowledge engineering approach to recognizing and extracting sequences of nucleic acids from scientific literature.

PubMed

García-Remesal, Miguel; Maojo, Victor; Crespo, José

2010-01-01

In this paper we present a knowledge engineering approach to automatically recognize and extract genetic sequences from scientific articles. To carry out this task, we use a preliminary recognizer based on a finite state machine to extract all candidate DNA/RNA sequences. The latter are then fed into a knowledge-based system that automatically discards false positives and refines noisy and incorrectly merged sequences. We created the knowledge base by manually analyzing different manuscripts containing genetic sequences. Our approach was evaluated using a test set of 211 full-text articles in PDF format containing 3134 genetic sequences. For such set, we achieved 87.76% precision and 97.70% recall respectively. This method can facilitate different research tasks. These include text mining, information extraction, and information retrieval research dealing with large collections of documents containing genetic sequences.

Genomic resources and draft assemblies of the human and porcine varieties of scabies mites, Sarcoptes scabiei var. hominis and var. suis.

PubMed

Mofiz, Ehtesham; Holt, Deborah C; Seemann, Torsten; Currie, Bart J; Fischer, Katja; Papenfuss, Anthony T

2016-06-02

The scabies mite, Sarcoptes scabiei, is a parasitic arachnid and cause of the infectious skin disease scabies in humans and mange in other animal species. Scabies infections are a major health problem, particularly in remote Indigenous communities in Australia, where secondary group A streptococcal and Staphylococcus aureus infections of scabies sores are thought to drive the high rate of rheumatic heart disease and chronic kidney disease. We sequenced the genome of two samples of Sarcoptes scabiei var. hominis obtained from unrelated patients with crusted scabies located in different parts of northern Australia using the Illumina HiSeq. We also sequenced samples of Sarcoptes scabiei var. suis from a pig model. Because of the small size of the scabies mite, these data are derived from pools of thousands of mites and are metagenomic, including host and microbiome DNA. We performed cleaning and de novo assembly and present Sarcoptes scabiei var. hominis and var. suis draft reference genomes. We have constructed a preliminary annotation of this reference comprising 13,226 putative coding sequences based on sequence similarity to known proteins. We have developed extensive genomic resources for the scabies mite, including reference genomes and a preliminary annotation.

Seismic stratigraphy and tomography in the outer shelf and slope of the Central Basin, Ross Sea, Antarctica

NASA Astrophysics Data System (ADS)

Kim, Sookwan; De Santis, Laura; Böhm, Gualtiero; Kuk Hong, Jong; Jin, Young Keun; Geletti, Riccardo; Wardell, Nigel; Petronio, Lorenzo; Colizza, Ester

2014-05-01

The Ross Sea, located between Victoria Land and Marie Byrd Land in Antarctica, is one of the main drainage of the Antarctic Ice Sheet (AIS). Reflection seismic data acquired by many countries during several decades have provided insights into the history of the Ross Sea and the AIS evolution. However the majority of the existing seismic data are concentrated in the shelf area, where hiatus formed by grounding ice sheet erosion multiple events prevent to reconstruct the entire sedimentary sequences depositional evolution. On the outer shelf and upper slope, the sedimentary sequences are relatively well preserved. The main purpose of this study is the investigation of the Cenozoic Antarctic Ice Sheet evolution through the seismic sequence analysis of the outer shelf and slope of the Central Basin, in the Ross Sea. The data used are the new multi-channel seismic data, KSL12, were acquired on the outer shelf and upper slope of the Central Bain in February 2013 by Korea Polar Research Institute. The reflection seismic data, previously collected by the Italian Antarctic Program (PNRA) and other data available from the Seismic Data Library System (SDLS) are also used for velocity tomography and seismic sequence mapping. The seismic data were processed by a conventional processing flow to produce the seismic profiles. Preliminary results show well-developed prograding wedges at the mouth of glacial troughs, eroded by a major glacial unconformity, the Ross Sea Unconformity 4 (RSU-4), correlated to a main event between early- and mid-Miocene. The velocity anomalies shown along KSL12-1 can be interpreted as showing the occurrence of gas and fluids, diagenetic horizons and sediment compactions. The isopach maps of each sequence show the variation of thickness of the sediments depocenter shift. The seismic sequence stratigraphy and acoustic facies analysis provide information about different phases of ice sheet's advance and retreat related to the AIS Cenozoic dynamics.

Multiple autoimmune diseases syndrome in Italian Greyhounds: preliminary studies of genome-wide diversity and possible associations within the dog leukocyte antigen (DLA) complex.

PubMed

Pedersen, Niels C; Liu, Hongwei; Greenfield, Daniel L; Echols, Layle Griffioen

2012-01-15

A disorder manifested by multiple autoimmune disorders, and resembling autoimmune polyendocrine syndrome type 2 (APS-2) in humans, may exist in Italian Greyhounds. The incidence of this disorder is increasing and its potential impact on the health of the breed is becoming of great concern. The aims of the present study were to document the existence of this syndrome, conduct a preliminary assessment of genetic diversity across the breed and within affected and unaffected dogs, determine whether the disorder associates with the dog leukocyte antigen (DLA) complex, and demonstrate similarities to APS-2 of humans. To these ends, information on disease, pedigrees, and blood or buccal swab samples were collected from affected and healthy Italian Greyhounds and extracted DNA analyzed. Analysis of Y chromosome markers and mitochondrial DNA sequences showed that Italian Greyhounds evolved from a single patriline and two major and four minor matrilines. A panel of 24 highly polymorphic simple tandem repeat (STR) markers across 20 autosomes demonstrated that affected and unaffected dogs were not distinguishable from the population as a whole by heterozygosity, F-statistics, and principal component analysis (PCA). However, analysis of allele frequencies at each STR loci identified regions of increased or decreased disease risk on four chromosomes. A similar genetic analysis using 109 single nucleotide polymorphisms (SNPs) across the DLA region showed differences between affected and unaffected dogs. PCA and zygosity mapping of DLA SNPs from unrelated dogs demonstrated two distinct subpopulations among the affected individuals. One population was very homozygous and the other closely resembled unaffected dogs in its heterozygosity, suggesting the evolution of a disease prone bloodline as a result of non-random selection. Exon 2 sequencing of the DLA class II genes demonstrated 5-8 alleles at each locus and 14 three loci haplotypes. Two specific haplotypes containing DRB1*00203 or DRB1*02901 were associated with increased disease risk in about one-third of affected dogs. However, high density SNP association mapping across the DLA region and CFA12 did not corroborate the association. Copyright © 2011 Elsevier B.V. All rights reserved.

Geographically widespread swordfish barcode stock identification: a case study of its application.

PubMed

Pappalardo, Anna Maria; Guarino, Francesca; Reina, Simona; Messina, Angela; De Pinto, Vito

2011-01-01

The swordfish (Xiphias gladius) is a cosmopolitan large pelagic fish inhabiting tempered and tropical waters and it is a target species for fisheries all around the world. The present study investigated the ability of COI barcoding to reliably identify swordfish and particularly specific stocks of this commercially important species. We applied the classical DNA barcoding technology, upon a 682 bp segment of COI, and compared swordfish sequences from different geographical sources (Atlantic, Indian Oceans and Mediterranean Sea). The sequences of the 5' hyper-variable fragment of the control region (5'dloop), were also used to validate the efficacy of COI as a stock-specific marker. This information was successfully applied to the discrimination of unknown samples from the market, detecting in some cases mislabeled seafood products. The NJ distance-based phenogram (K2P model) obtained with COI sequences allowed us to correlate the swordfish haplotypes to the different geographical stocks. Similar results were obtained with 5'dloop. Our preliminary data in swordfish Xiphias gladius confirm that Cytochrome Oxidase I can be proposed as an efficient species-specific marker that has also the potential to assign geographical provenance. This information might speed the samples analysis in commercial application of barcoding.

BeerDeCoded: the open beer metagenome project.

PubMed

Sobel, Jonathan; Henry, Luc; Rotman, Nicolas; Rando, Gianpaolo

2017-01-01

Next generation sequencing has radically changed research in the life sciences, in both academic and corporate laboratories. The potential impact is tremendous, yet a majority of citizens have little or no understanding of the technological and ethical aspects of this widespread adoption. We designed BeerDeCoded as a pretext to discuss the societal issues related to genomic and metagenomic data with fellow citizens, while advancing scientific knowledge of the most popular beverage of all. In the spirit of citizen science, sample collection and DNA extraction were carried out with the participation of non-scientists in the community laboratory of Hackuarium, a not-for-profit organisation that supports unconventional research and promotes the public understanding of science. The dataset presented herein contains the targeted metagenomic profile of 39 bottled beers from 5 countries, based on internal transcribed spacer (ITS) sequencing of fungal species. A preliminary analysis reveals the presence of a large diversity of wild yeast species in commercial brews. With this project, we demonstrate that coupling simple laboratory procedures that can be carried out in a non-professional environment with state-of-the-art sequencing technologies and targeted metagenomic analyses, can lead to the detection and identification of the microbial content in bottled beer.

Do pattern recognition skills transfer across sports? A preliminary analysis.

PubMed

Smeeton, Nicholas J; Ward, Paul; Williams, A Mark

2004-02-01

The ability to recognize patterns of play is fundamental to performance in team sports. While typically assumed to be domain-specific, pattern recognition skills may transfer from one sport to another if similarities exist in the perceptual features and their relations and/or the strategies used to encode and retrieve relevant information. A transfer paradigm was employed to compare skilled and less skilled soccer, field hockey and volleyball players' pattern recognition skills. Participants viewed structured and unstructured action sequences from each sport, half of which were randomly represented with clips not previously seen. The task was to identify previously viewed action sequences quickly and accurately. Transfer of pattern recognition skill was dependent on the participant's skill, sport practised, nature of the task and degree of structure. The skilled soccer and hockey players were quicker than the skilled volleyball players at recognizing structured soccer and hockey action sequences. Performance differences were not observed on the structured volleyball trials between the skilled soccer, field hockey and volleyball players. The skilled field hockey and soccer players were able to transfer perceptual information or strategies between their respective sports. The less skilled participants' results were less clear. Implications for domain-specific expertise, transfer and diversity across domains are discussed.

Classification of Pelteobagrus fish in Poyang Lake based on mitochondrial COI gene sequence.

PubMed

Zhong, Bin; Chen, Ting-Ting; Gong, Rui-Yue; Zhao, Zhe-Xia; Wang, Binhua; Fang, Chunlin; Mao, Hui-Ling

2016-11-01

We use DNA molecular marker technology to correct the deficiency of traditional morphological taxonomy. Totality 770 Pelteobagrus fish from Poyang Lake were collected. After preliminary morphological classification, random selected eight samples in each species for DNA extraction. Mitochondrial COI gene sequence was cloned with universal primers and sequenced. The results showed that there are four species of Pelteobagrus living in Poyang Lake. The average of intraspecific genetic distance value was 0.003, while the average interspecific genetic distance was 0.128. The interspecific genetic distance is far more than intraspecific genetic distance. Besides, phylogenetic tree analysis revealed that molecular systematics was in accord with morphological classification. It indicated that COI gene is an effective DNA molecular marker in Pelteobagrus classification. Surprisingly, the intraspecific difference of some individuals (P. e6, P. n6, P. e5, and P. v4) from their original named exceeded species threshold (2%), which should be renewedly classified into Pelteobagrus fulvidraco. However, another individual P. v3 was very different, because its genetic distance was over 8.4% difference from original named Pelteobagrus vachelli. Its taxonomic status remained to be further studied.

BeerDeCoded: the open beer metagenome project

PubMed Central

Sobel, Jonathan; Henry, Luc; Rotman, Nicolas; Rando, Gianpaolo

2017-01-01

Next generation sequencing has radically changed research in the life sciences, in both academic and corporate laboratories. The potential impact is tremendous, yet a majority of citizens have little or no understanding of the technological and ethical aspects of this widespread adoption. We designed BeerDeCoded as a pretext to discuss the societal issues related to genomic and metagenomic data with fellow citizens, while advancing scientific knowledge of the most popular beverage of all. In the spirit of citizen science, sample collection and DNA extraction were carried out with the participation of non-scientists in the community laboratory of Hackuarium, a not-for-profit organisation that supports unconventional research and promotes the public understanding of science. The dataset presented herein contains the targeted metagenomic profile of 39 bottled beers from 5 countries, based on internal transcribed spacer (ITS) sequencing of fungal species. A preliminary analysis reveals the presence of a large diversity of wild yeast species in commercial brews. With this project, we demonstrate that coupling simple laboratory procedures that can be carried out in a non-professional environment with state-of-the-art sequencing technologies and targeted metagenomic analyses, can lead to the detection and identification of the microbial content in bottled beer. PMID:29123645

Space shuttle on-orbit flight control software requirements, preliminary version

NASA Technical Reports Server (NTRS)

1975-01-01

Software modules associated with various flight control functions for the space shuttle orbiter are described. Data flow, interface requirements, initialization requirements and module sequencing requirements are considered. Block diagrams and tables are included.

Internal Dynamics and Crustal Evolution of Mars

NASA Technical Reports Server (NTRS)

Zuber, Maria

2005-01-01

The objective of this work is to improve understanding of the internal structure, crustal evolution, and thermal history of Mars by combining geophysical data analysis of topography, gravity and magnetics with results from analytical and computational modeling. Accomplishments thus far in this investigation include: (1) development of a new crustal thickness model that incorporates constraints from Mars meteorites, corrections for polar cap masses and other surface loads, Pratt isostasy, and core flattening; (2) determination of a refined estimate of crustal thickness of Mars from geoid/topography ratios (GTRs); (3) derivation of a preliminary estimate of the k(sub 2) gravitational Love number and a preliminary estimate of possible dissipation within Mars consistent with this value; and (4) an integrative analysis of the sequence of evolution of early Mars. During the remainder of this investigation we will: (1) extend models of degree-1 mantle convection from 2-D to 3-D; (2) investigate potential causal relationships and effects of major impacts on mantle plume formation, with primary application to Mars; (3) develop exploratory models to assess the convective stability of various Martian core states as relevant to the history of dynamo action; and (4) develop models of long-wavelength relaxation of crustal thickness anomalies to potentially explain the degree-1 structure of the Martian crust.

Sequence-defined oligo(ortho-arylene) foldamers derived from the benzannulation of ortho(arylene ethynylene)s† †Electronic supplementary information (ESI) available. CCDC 1483959–1483967. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c6sc02520j Click here for additional data file. Click here for additional data file.

PubMed Central

Lehnherr, Dan; Chen, Chen; Pedramrazi, Zahra; DeBlase, Catherine R.; Alzola, Joaquin M.; Keresztes, Ivan; Lobkovsky, Emil B.

2016-01-01

A Cu-catalyzed benzannulation reaction transforms ortho(arylene ethynylene) oligomers into ortho-arylenes. This approach circumvents iterative Suzuki cross-coupling reactions previously used to assemble hindered ortho-arylene backbones. These derivatives form helical folded structures in the solid-state and in solution, as demonstrated by X-ray crystallography and solution-state NMR analysis. DFT calculations of misfolded conformations are correlated with variable-temperature 1H and EXSY NMR to reveal that folding is cooperative and more favorable in halide-substituted naphthalenes. Helical ortho-arylene foldamers with specific aromatic sequences organize functional π-electron systems into arrangements ideal for ambipolar charge transport and show preliminary promise for the surface-mediated synthesis of structurally defined graphene nanoribbons. PMID:28567248

Six components observations of local earthquakes during the 2016 Central Italy seismic sequence

NASA Astrophysics Data System (ADS)

Simonelli, A.; Bernauer, F.; Chow, B.; Braun, T.; Wassermann, J. M.; Igel, H.

2017-12-01

For many years the seismological community has looked for a reliable, sensitive, broadband three-component portable rotational sensor. In this preliminary study, we show the possibility of measuring and extracting relevant seismological information from local earthquakes. We employ portable three-component rotational sensors, insensitive to translations, which operate on optical interferometry principles (Sagnac effect). Multiple sensors recording redundantly add significance to the measurements.During the Central Italy seismic sequence in November 2016, we deployed two portable fiber-optic gyroscopes (BlueSeis3A from iXBlue and LCG demonstrator from LITEF) and a broadband seismometer in Colfiorito, Italy. We present here the six-component observations, with analysis of rotational (three redundant components) and translational (three components) ground motions, generated by earthquakes at local distances. For each seismic event, we compare coherence between rotational sensors and estimate a back azimuth consistent with theoretical values. We also estimate Love and Rayleigh wave phase velocities in the 5 to 10 Hz frequency range.

Effects of imatinib and nilotinib on the whole transcriptome of cultured murine osteoblasts.

PubMed

Kirschner, Gyöngyi; Balla, Bernadett; Horváth, Péter; Kövesdi, Andrea; Lakatos, Gergely; Takács, István; Nagy, Zsolt; Tóbiás, Bálint; Árvai, Kristóf; Kósa, János Pál; Lakatos, Péter

2016-09-01

Numerous clinical observations have confirmed that breakpoint cluster region-abelson fusion oncoprotein tyrosine kinase inhibitors used in leukemia treatment alter bone physiology in a complex manner. The aim of the present study was to analyze the whole transcriptome of cultured murine osteoblasts and determine the changes following treatment with imatinib and nilotinib using Sequencing by Oligonucleotide Ligation and Detection next generation RNA sequencing. This study also aimed to identify candidate signaling pathways and network regulators by multivariate Ingenuity Pathway Analysis. Based on the right-tailed Fisher's exact test, significantly altered pathways including upstream regulators were defined for each drug. The correlation between these pathways and bone metabolism was also examined. The preliminary results suggest the two drugs have different mechanisms of action on osteoblasts, and imatinib was shown to have a greater effect on gene expression. Data also indicated the potential role of a number of genes and signaling cascades that may contribute to identifying novel targets for the treatment of metabolic bone diseases.

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less

Functional analysis of Drosophila HSP70 promoter with different HSE numbers in human cells.

PubMed

Kust, Nadezda; Rybalkina, Ekaterina; Mertsalov, Ilya; Savchenko, Ekaterina; Revishchin, Alexander; Pavlova, Gali

2014-01-01

The activation of genetic constructs including the Drosophila hsp70 promoter with four and eight HSE sequences in the regulatory region has been described in human cells. The promoter was shown to be induced at lower temperatures compared to the human hsp70 promoter. The promoter activity increased after a 60-min heat shock already at 38 °C in human cells. The promoter activation was observed 24 h after heat shock for the constructs with eight HSEs, while those with four HSEs required 48 h. After transplantation of in vitro heat-shocked transfected cells, the promoter activity could be maintained for 3 days with a gradual decline. The promoter activation was confirmed in vivo without preliminary heat shock in mouse ischemic brain foci. Controlled expression of the Gdnf gene under a Drosophila hsp70 promoter was demonstrated. This promoter with four and eight HSE sequences in the regulatory region can be proposed as a regulated promoter in genetic therapeutic systems.

Electrospray-assisted laser desorption/ionization and tandem mass spectrometry of peptides and proteins.

PubMed

Peng, Ivory X; Shiea, Jentaie; Ogorzalek Loo, Rachel R; Loo, Joseph A

2007-01-01

We have constructed an electrospray-assisted laser desorption/ionization (ELDI) source which utilizes a nitrogen laser pulse to desorb intact molecules from matrix-containing sample solution droplets, followed by electrospray ionization (ESI) post-ionization. The ELDI source is coupled to a quadrupole ion trap mass spectrometer and allows sampling under ambient conditions. Preliminary data showed that ELDI produces ESI-like multiply charged peptides and proteins up to 29 kDa carbonic anhydrase and 66 kDa bovine albumin from single-protein solutions, as well as from complex digest mixtures. The generated multiply charged polypeptides enable efficient tandem mass spectrometric (MS/MS)-based peptide sequencing. ELDI-MS/MS of protein digests and small intact proteins was performed both by collisionally activated dissociation (CAD) and by nozzle-skimmer dissociation (NSD). ELDI-MS/MS may be a useful tool for protein sequencing analysis and top-down proteomics study, and may complement matrix-assisted laser desorption/ionization (MALDI)-based measurements. Copyright (c) 2007 John Wiley & Sons, Ltd.

A Preliminary Analysis of the Costs and Benefits of Older Age Accessions.

DTIC Science & Technology

1984-03-01

8217AD-A143 160 A PRELIMINARY ANALYSIS OF THE COSTS AND BENEFITS OF I/ OLDER AGE ACCESSIONS(U) NAVAL POSTGRADUATE SCHOOL N A MONTEREY CA S D BARCLAY MAR...ELECTE JUL 1884d THESIS A PRELIMINARY ANALYSIS CF THE COSTS AND BENEFITS OF OLDER AGE ACCESSIONS CL by Susan D. Barclay March 1984 Thesis Advisor...for public release; distribution unlimited. A Preliminary Analysis of the Costs and Benefits of Older Age Accessions by Susan D. Barclay Lieutenant

A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle

NASA Astrophysics Data System (ADS)

Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo

2003-04-01

From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.

A search for pre-main sequence stars in the high-latitude molecular clouds. II - A survey of the Einstein database

NASA Technical Reports Server (NTRS)

Caillault, Jean-Pierre; Magnani, Loris

1990-01-01

The preliminary results are reported of a survey of every EINSTEIN image which overlaps any high-latitude molecular cloud in a search for X-ray emitting pre-main sequence stars. This survey, together with complementary KPNO and IRAS data, will allow the determination of how prevalent low mass star formation is in these clouds in general and, particularly, in the translucent molecular clouds.

40 CFR 158.345 - Preliminary analysis.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...

40 CFR 158.345 - Preliminary analysis.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...

40 CFR 158.345 - Preliminary analysis.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...

40 CFR 158.345 - Preliminary analysis.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...

40 CFR 158.345 - Preliminary analysis.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Preliminary analysis. 158.345 Section 158.345 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR PESTICIDES Product Chemistry § 158.345 Preliminary analysis. (a) If the product is produced by...

10 CFR 830.206 - Preliminary documented safety analysis.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Preliminary documented safety analysis. 830.206 Section 830.206 Energy DEPARTMENT OF ENERGY NUCLEAR SAFETY MANAGEMENT Safety Basis Requirements § 830.206 Preliminary documented safety analysis. If construction begins after December 11, 2000, the contractor...

Molecular-based estimate of species number, phylogenetic relationships and divergence times for the genus Stenotaenia (Chilopoda, Geophilomorpha) in the Italian region

PubMed Central

Del Latte, Laura; Bortolin, Francesca; Rota-Stabelli, Omar; Fusco, Giuseppe; Bonato, Lucio

2015-01-01

Abstract Stenotaenia is one of the largest and most widespread genera of geophilid centipedes in the Western Palearctic, with a very uniform morphology and about fifteen species provisionally recognized. For a better understanding of Stenotaenia species-level taxonomy, we have explored the possibility of using molecular data. As a preliminary assay, we sampled twelve populations, mainly from the Italian region, and analyzed partial sequences of the two genes COI and 28S. We employed a DNA-barcoding approach, complemented by a phylogenetic analysis coupled with divergence time estimation. Assuming a barcoding gap of 10–16% K2P pairwise distances, we found evidence for the presence of at least six Stenotaenia species in the Italian region, which started diverging about 50 million years ago, only partially matching with previously recognized species. We found that small-sized oligopodous species belong to a single clade that originated about 33 million years ago, and obtained some preliminary evidence of the related genus Tuoba being nested within Stenotaenia. PMID:26257533

Preliminary report on the Late Pleistocene and Holocene diatoms of Swamp Lake, Yosemite National Park, California, USA

USGS Publications Warehouse

Starratt, Scott W.; Anderson, R. Scott

2013-01-01

Swamp Lake, Yosemite National Park, is the only known lake in California containing long sequences of varved sediments and thus has the potential to provide a high-resolution record of climate variability. This preliminary analysis of the diatom assemblages from a 947-cm-long composite sediment core (freeze core FZ02–05; 0–67 cm, Livingstone core 02–05; 53–947 cm) shows that the lake has been freshwater, oligotrophic, and circumneutral to alkaline throughout its ~16,000-year-long history. The first sediments deposited in the lake show that the vegetation in the watershed was sparse, allowing organic matter-poor silt and clay to be deposited in the basin. The basin filled quickly to a depth of at least 5 m and remained at least that deep for most of the sediment record. Several short intervals provided evidence of large fluctuations in lake level during the Holocene. The upper 50 cm of the core contains evidence of the Medieval Climate Anomaly and Little Ice Age.

A preliminary 'test case' manufacturing sequence for 50 cents/watt solar photovoltaic modules in 1986

NASA Technical Reports Server (NTRS)

Bickler, D. B.

1979-01-01

The paper describes a 'test case' manufacturing process sequence for solar photovoltaic modules which will cost 50 cents/watt in 1986. The process, which starts with the purification of silicon grown into 75-mm-wide thin ribbons, is discussed, and the plant layout is depicted; each department is sized to produce 250 MW of modules/per year. The cost of this process sequence is compared to present technology at various companies showing considerable spread for each process; data are tabulated in a composite state-of-the-art cell processing cost summary for these processes.

Interactive Block Games for Assessing Children's Cognitive Skills: Design and Preliminary Evaluation.

PubMed

Lee, Kiju; Jeong, Donghwa; Schindler, Rachael C; Hlavaty, Laura E; Gross, Susan I; Short, Elizabeth J

2018-01-01

Background: This paper presents design and results from preliminary evaluation of Tangible Geometric Games (TAG-Games) for cognitive assessment in young children. The TAG-Games technology employs a set of sensor-integrated cube blocks, called SIG-Blocks, and graphical user interfaces for test administration and real-time performance monitoring. TAG-Games were administered to children from 4 to 8 years of age for evaluating preliminary efficacy of this new technology-based approach. Methods: Five different sets of SIG-Blocks comprised of geometric shapes, segmented human faces, segmented animal faces, emoticons, and colors, were used for three types of TAG-Games, including Assembly, Shape Matching, and Sequence Memory. Computational task difficulty measures were defined for each game and used to generate items with varying difficulty. For preliminary evaluation, TAG-Games were tested on 40 children. To explore the clinical utility of the information assessed by TAG-Games, three subtests of the age-appropriate Wechsler tests (i.e., Block Design, Matrix Reasoning, and Picture Concept) were also administered. Results: Internal consistency of TAG-Games was evaluated by the split-half reliability test. Weak to moderate correlations between Assembly and Block Design, Shape Matching and Matrix Reasoning, and Sequence Memory and Picture Concept were found. The computational measure of task complexity for each TAG-Game showed a significant correlation with participants' performance. In addition, age-correlations on TAG-Game scores were found, implying its potential use for assessing children's cognitive skills autonomously.

Interactive Block Games for Assessing Children's Cognitive Skills: Design and Preliminary Evaluation

PubMed Central

Lee, Kiju; Jeong, Donghwa; Schindler, Rachael C.; Hlavaty, Laura E.; Gross, Susan I.; Short, Elizabeth J.

2018-01-01

Background: This paper presents design and results from preliminary evaluation of Tangible Geometric Games (TAG-Games) for cognitive assessment in young children. The TAG-Games technology employs a set of sensor-integrated cube blocks, called SIG-Blocks, and graphical user interfaces for test administration and real-time performance monitoring. TAG-Games were administered to children from 4 to 8 years of age for evaluating preliminary efficacy of this new technology-based approach. Methods: Five different sets of SIG-Blocks comprised of geometric shapes, segmented human faces, segmented animal faces, emoticons, and colors, were used for three types of TAG-Games, including Assembly, Shape Matching, and Sequence Memory. Computational task difficulty measures were defined for each game and used to generate items with varying difficulty. For preliminary evaluation, TAG-Games were tested on 40 children. To explore the clinical utility of the information assessed by TAG-Games, three subtests of the age-appropriate Wechsler tests (i.e., Block Design, Matrix Reasoning, and Picture Concept) were also administered. Results: Internal consistency of TAG-Games was evaluated by the split-half reliability test. Weak to moderate correlations between Assembly and Block Design, Shape Matching and Matrix Reasoning, and Sequence Memory and Picture Concept were found. The computational measure of task complexity for each TAG-Game showed a significant correlation with participants' performance. In addition, age-correlations on TAG-Game scores were found, implying its potential use for assessing children's cognitive skills autonomously. PMID:29868520

75 FR 54090 - Stainless Steel Bar From India: Final Results of Antidumping Duty Administrative Review

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-03

...-preliminary analysis and released the results of the analysis on May 19, 2010. We gave the interested parties an opportunity to comment on the Preliminary Results and the post-preliminary analysis. Based on our analysis of the comments received, we have made changes to the margin calculation. The final weighted...

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Purification, crystallization and preliminary crystallographic analysis of the adhesion domain of Epf from Streptococcus pyogenes

PubMed Central

Linke, Christian; Siemens, Nikolai; Middleditch, Martin J.; Kreikemeyer, Bernd; Baker, Edward N.

2012-01-01

The extracellular protein Epf from Streptococcus pyogenes is important for streptococcal adhesion to human epithelial cells. However, Epf has no sequence identity to any protein of known structure or function. Thus, several predicted domains of the 205 kDa protein Epf were cloned separately and expressed in Escherichia coli. The N-terminal domain of Epf was crystallized in space groups P21 and P212121 in the presence of the protease chymotrypsin. Mass spectrometry showed that the species crystallized corresponded to a fragment comprising residues 52–357 of Epf. Complete data sets were collected to 2.0 and 1.6 Å resolution, respectively, at the Australian Synchrotron. PMID:22750867

A Module Experimental Process System Development Unit (MEPSDU). [flat plate solar arrays

NASA Technical Reports Server (NTRS)

1981-01-01

The development of a cost effective process sequence that has the potential for the production of flat plate photovoltaic modules which meet the price goal in 1986 of 70 cents or less per Watt peak is described. The major accomplishments include (1) an improved AR coating technique; (2) the use of sand blast back clean-up to reduce clean up costs and to allow much of the Al paste to serve as a back conductor; and (3) the development of wave soldering for use with solar cells. Cells were processed to evaluate different process steps, a cell and minimodule test plan was prepared and data were collected for preliminary Samics cost analysis.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Crystallisation and preliminary X-ray diffraction analysis of the protease from Southampton norovirus complexed with a Michael-acceptor inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coates, Leighton; Cooper, Jon; Hussey, Robert

2008-01-01

Noroviruses are the predominant cause of human epidemic nonbacterial gastroenteritis. Viral replication requires a cysteine protease that cleaves a 200 kDa viral polyprotein into its constituent functional parts. Here, the crystallization of the recombinant protease from the Southampton norovirus is described. While the native crystals were found to diffract only to medium resolution (2.9 {angstrom}), cocrystals of an inhibitor complex diffracted X-rays to 1.7 {angstrom} resolution. The polypeptide inhibitor (Ac-EFQLQ-propenyl ethyl ester) possesses an amino-acid sequence designed to match the substrate specificity of the enzyme, but was synthesized with a reactive Michael acceptor group at the C-terminal end.

Between disorder and order: A case study of power law

NASA Astrophysics Data System (ADS)

Cao, Yong; Zhao, Youjie; Yue, Xiaoguang; Xiong, Fei; Sun, Yongke; He, Xin; Wang, Lichao

2016-08-01

Power law is an important feature of phenomena in long memory behaviors. Zipf ever found power law in the distribution of the word frequencies. In physics, the terms order and disorder are Thermodynamic or statistical physics concepts originally and a lot of research work has focused on self-organization of the disorder ingredients of simple physical systems. It is interesting what make disorder-order transition. We devise an experiment-based method about random symbolic sequences to research regular pattern between disorder and order. The experiment results reveal power law is indeed an important regularity in transition from disorder to order. About these results the preliminary study and analysis has been done to explain the reasons.

A tapping device for recording and quantitative characterization of rhythmic/auditory sequences.

PubMed

Piazza, Caterina; Cesareo, Ambra; Caccia, Martina; Reni, Gianluigi; Lorusso, Maria L

2017-07-01

The processing of auditory stimuli is essential for the correct perception of language and deficits in this ability are often related to the presence or development of language disorders. The motor imitation (e.g. tapping or beating) of rhythmic sequences can be a very sensitive correlate of deficits in auditory processing. Thus, the study of the tapping performance, with the investigation of both temporal and intensity information, might be very useful. The present work is aimed at the development and preliminary testing of a tapping device to be used for the imitation and/or the production of rhythmic sequences, allowing the recording of both tapping duration and intensity. The device is essentially made up of a Force Sensing Resistor and an Arduino UNO board. It was validated using different sampling frequencies (f s ) in a group of 10 young healthy adults investigating its efficacy in terms of touch and intensity detection by means of two testing procedures. Results demonstrated a good performance of the device when programmed with fs equal to 50 and 100Hz. Moreover, both temporal and intensity parameters were extracted, thus supporting the potential use of the device for the analysis of the imitation or production of rhythmic sequences. This work represents a first step for the development of a useful, low cost tool to support the diagnosis, training and rehabilitation of language disorders.

Assembly, Annotation, and Analysis of Multiple Mycorrhizal Fungal Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Initiative Consortium, Mycorrhizal Genomics; Kuo, Alan; Grigoriev, Igor

Mycorrhizal fungi play critical roles in host plant health, soil community structure and chemistry, and carbon and nutrient cycling, all areas of intense interest to the US Dept. of Energy (DOE) Joint Genome Institute (JGI). To this end we are building on our earlier sequencing of the Laccaria bicolor genome by partnering with INRA-Nancy and the mycorrhizal research community in the MGI to sequence and analyze dozens of mycorrhizal genomes of all Basidiomycota and Ascomycota orders and multiple ecological types (ericoid, orchid, and ectomycorrhizal). JGI has developed and deployed high-throughput sequencing techniques, and Assembly, RNASeq, and Annotation Pipelines. In 2012more » alone we sequenced, assembled, and annotated 12 draft or improved genomes of mycorrhizae, and predicted ~;;232831 genes and ~;;15011 multigene families, All of this data is publicly available on JGI MycoCosm (http://jgi.doe.gov/fungi/), which provides access to both the genome data and tools with which to analyze the data. Preliminary comparisons of the current total of 14 public mycorrhizal genomes suggest that 1) short secreted proteins potentially involved in symbiosis are more enriched in some orders than in others amongst the mycorrhizal Agaricomycetes, 2) there are wide ranges of numbers of genes involved in certain functional categories, such as signal transduction and post-translational modification, and 3) novel gene families are specific to some ecological types.« less

The Alveolate Perkinsus marinus: Biological Insights from EST Gene Discovery

PubMed Central

2010-01-01

Background Perkinsus marinus, a protozoan parasite of the eastern oyster Crassostrea virginica, has devastated natural and farmed oyster populations along the Atlantic and Gulf coasts of the United States. It is classified as a member of the Perkinsozoa, a recently established phylum considered close to the ancestor of ciliates, dinoflagellates, and apicomplexans, and a key taxon for understanding unique adaptations (e.g. parasitism) within the Alveolata. Despite intense parasite pressure, no disease-resistant oysters have been identified and no effective therapies have been developed to date. Results To gain insight into the biological basis of the parasite's virulence and pathogenesis mechanisms, and to identify genes encoding potential targets for intervention, we generated >31,000 5' expressed sequence tags (ESTs) derived from four trophozoite libraries generated from two P. marinus strains. Trimming and clustering of the sequence tags yielded 7,863 unique sequences, some of which carry a spliced leader. Similarity searches revealed that 55% of these had hits in protein sequence databases, of which 1,729 had their best hit with proteins from the chromalveolates (E-value ≤ 1e-5). Some sequences are similar to those proven to be targets for effective intervention in other protozoan parasites, and include not only proteases, antioxidant enzymes, and heat shock proteins, but also those associated with relict plastids, such as acetyl-CoA carboxylase and methyl erythrithol phosphate pathway components, and those involved in glycan assembly, protein folding/secretion, and parasite-host interactions. Conclusions Our transcriptome analysis of P. marinus, the first for any member of the Perkinsozoa, contributes new insight into its biology and taxonomic position. It provides a very informative, albeit preliminary, glimpse into the expression of genes encoding functionally relevant proteins as potential targets for chemotherapy, and evidence for the presence of a relict plastid. Further, although P. marinus sequences display significant similarity to those from both apicomplexans and dinoflagellates, the presence of trans-spliced transcripts confirms the previously established affinities with the latter. The EST analysis reported herein, together with the recently completed sequence of the P. marinus genome and the development of transfection methodology, should result in improved intervention strategies against dermo disease. PMID:20374649

Scalable Parallel Methods for Analyzing Metagenomics Data at Extreme Scale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daily, Jeffrey A.

2015-05-01

The field of bioinformatics and computational biology is currently experiencing a data revolution. The exciting prospect of making fundamental biological discoveries is fueling the rapid development and deployment of numerous cost-effective, high-throughput next-generation sequencing technologies. The result is that the DNA and protein sequence repositories are being bombarded with new sequence information. Databases are continuing to report a Moore’s law-like growth trajectory in their database sizes, roughly doubling every 18 months. In what seems to be a paradigm-shift, individual projects are now capable of generating billions of raw sequence data that need to be analyzed in the presence of alreadymore » annotated sequence information. While it is clear that data-driven methods, such as sequencing homology detection, are becoming the mainstay in the field of computational life sciences, the algorithmic advancements essential for implementing complex data analytics at scale have mostly lagged behind. Sequence homology detection is central to a number of bioinformatics applications including genome sequencing and protein family characterization. Given millions of sequences, the goal is to identify all pairs of sequences that are highly similar (or “homologous”) on the basis of alignment criteria. While there are optimal alignment algorithms to compute pairwise homology, their deployment for large-scale is currently not feasible; instead, heuristic methods are used at the expense of quality. In this dissertation, we present the design and evaluation of a parallel implementation for conducting optimal homology detection on distributed memory supercomputers. Our approach uses a combination of techniques from asynchronous load balancing (viz. work stealing, dynamic task counters), data replication, and exact-matching filters to achieve homology detection at scale. Results for a collection of 2.56M sequences show parallel efficiencies of ~75-100% on up to 8K cores, representing a time-to-solution of 33 seconds. We extend this work with a detailed analysis of single-node sequence alignment performance using the latest CPU vector instruction set extensions. Preliminary results reveal that current sequence alignment algorithms are unable to fully utilize widening vector registers.« less

Mesoarchean black shale -iron sedimentary sequences in Cleaverville Formation, Pilbara Australia: drilling preliminary result of DXCL2

NASA Astrophysics Data System (ADS)

Kiyokawa, S.; Ito, T.; Ikehara, M.; Yamaguchi, K. E.; Onoue, T.; Horie, K.; Sakamoto, R.; Teraji, S.; Aihara, Y.

2012-12-01

The 3.2-3.1 Ga Dixon island-Cleaverville formations are well-preserved hydrothermal oceanic sequence at oceanic island arc setting (Kiyokawa et al., 2002, 2006, 2012). The Dixon Island (3195+15 Ma) - Cleaverville (3108+13 Ma) formations formed volcano-sedimentary sequences with hydrothermal chert, black shale and banded iron formation to the top. Based on the scientific drilling as DXCL1 at 2007 and DXCL2 at 2011, lithology was clearly understood. Four drilling holes had been done at coastal sites; the Dixon Island Formation is DX site (100m) and the Cleaverville Formation is CL2 (40m), CL1 (60m) and CL3 (200m) sites and from stratigraphic bottom to top. These sequences formed coarsening and thickening upward black shale-BIF sequences. The Dixon Island Formation consists komatiite-rhyolite sequences with many hydrothermal veins and very fine laminated cherty rocks above them. The Cleaverville Formation contains black shale, fragments-bearing pyroclastic beds, white chert, greenish shale and BIF. Especially, CL3 core, which drilled through the Iron formation, shows siderite-chert beds above black shale identified before magnetite lamination bed. The magnetite bed formed very thin laminated bed with siderite lamination. This magnetite bed was covered by black shale beds again. New U-Pb SHRIMP data of the pyroclastic in black shale is 3109Ma. Estimated 2-8 cm/1000year sedimentation rate are identified in these sequences. Our preliminary result show that siderite and chert layers formed before magnetite iron sedimentation. The lower-upper sequence of organic carbon rich black shales are similar amount of organic content and 13C isotope (around -30per mill). So we investigate that the Archean iron formation, especially Cleaverville iron formation, was highly related by hydrothermal input and started pre-syn iron sedimentation at anoxic oceanic condition.

Infrared fluorescent automated detection of thirteen short tandem repeat polymorphisms and one gender-determining system of the CODIS core system.

PubMed

Ricci, U; Sani, I; Guarducci, S; Biondi, C; Pelagatti, S; Lazzerini, V; Brusaferri, A; Lapini, M; Andreucci, E; Giunti, L; Giovannucci Uzielli, M L

2000-11-01

We used an infrared (IR) automated fluorescence monolaser sequencer for the analysis of 13 autosomal short tandem repeat (STR) systems (TPOX, D3S1358, FGA, CSF1PO, D5S818, D7S820, D8S1179, TH01, vWA, D13S317, D16S359, D18S51, D21S11) and the X-Y homologous gene amelogenin system. These two systems represent the core of the combined DNA index systems (CODIS). Four independent multiplex reactions, based on the polymerase chain reaction (PCR) technique and on the direct labeling of the forward primer of every primer pair, with a new molecule (IRDye800), were set up, permitting the exact characterization of the alleles by comparison with ladders of specific sequenced alleles. This is the first report of the whole analysis of the STRs of the CODIS core using an IR automated DNA sequencer. The protocol was used to solve paternity/maternity tests and for population studies. The electrophoretic system also proved useful for the correct typing of those loci differing in size by only 2 bp. A sensibility study demonstrated that the test can detect an average of 10 pg of undegraded human DNA. We also performed a preliminary study analyzing some forensic samples and mixed stains, which suggested the usefulness of using this analytical system for human identification as well as for forensic purposes.

Next generation sequencing of SNPs for non-invasive prenatal diagnosis: challenges and feasibility as illustrated by an application to β-thalassaemia

PubMed Central

Papasavva, Thessalia; van IJcken, Wilfred F J; Kockx, Christel E M; van den Hout, Mirjam C G N; Kountouris, Petros; Kythreotis, Loukas; Kalogirou, Eleni; Grosveld, Frank G; Kleanthous, Marina

2013-01-01

β-Thalassaemia is one of the most common autosomal recessive single-gene disorder worldwide, with a carrier frequency of 12% in Cyprus. Prenatal tests for at risk pregnancies use invasive methods and development of a non-invasive prenatal diagnostic (NIPD) method is of paramount importance to prevent unnecessary risks inherent to invasive methods. Here, we describe such a method by assessing a modified version of next generation sequencing (NGS) using the Illumina platform, called ‘targeted sequencing', based on the detection of paternally inherited fetal alleles in maternal plasma. We selected four single-nucleotide polymorphisms (SNPs) located in the β-globin locus with a high degree of heterozygosity in the Cypriot population. Spiked genomic samples were used to determine the specificity of the platform. We could detect the minor alleles in the expected ratio, showing the specificity of the platform. We then developed a multiplexed format for the selected SNPs and analysed ten maternal plasma samples from pregnancies at risk. The presence or absence of the paternal mutant allele was correctly determined in 27 out of 34 samples analysed. With haplotype analysis, NIPD was possible on eight out of ten families. This is the first study carried out for the NIPD of β-thalassaemia using targeted NGS and haplotype analysis. Preliminary results show that NGS is effective in detecting paternally inherited alleles in the maternal plasma. PMID:23572027

Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1

PubMed Central

Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves

2003-01-01

The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be developed for the successful detection of “putative” CpG and CpNpG islands in plants. PMID:12857799

TRTH-30. PRELIMINARY EXPERIENCE WITH SERIAL WHOLE EXOME SEQUENCING OF PEDIATRIC CNS TUMORS AT DIAGNOSIS AND RECURRENCE.

PubMed Central

Szalontay, Luca; Pendrick, Danielle; Feldstein, Neil; Anderson, Richard; Stark, Eileen; Bender, Julia Glade; Oberg, Jennifer; Hsiao, Susan; Turk, Andrew; Sireci, Anthony; Mansukhani, Mahesh; Garvin, James

2017-01-01

Abstract INTRODUCTION: Whole exome sequencing (WES) of newly diagnosed pediatric central nervous system (CNS) tumors is quickly becoming part of routine care. Through the Precision in Pediatric Sequencing (PiPseq) program at Columbia University, we have found potentially actionable mutations in more than 40% of evaluable CNS cases at diagnosis. More recently, we have integrated this approach into the management of patients undergoing surgery for CNS tumor recurrence. METHOD: After obtaining informed consent, tumor-normal WES with transcriptome analysis was performed in a CLIA-certified laboratory on fresh frozen or paraffin embedded CNS tumor samples and peripheral blood. RESULTS: 7 cases (5 male, 2 female; median age 5 years) with adequate diagnostic and recurrent tumor tissue were tested. No case had a somatic mutation of established clinical utility (tier 1). Among 3 embryonal tumors, a splice site variant in TSC1 (tier 2 mutation of potential utility) was detected in a medulloblastoma, but only at recurrence and not at initial diagnosis. FOXR2 overexpression was detected at diagnosis and confirmed at early progression of a temporal lobe tumor, prompting revision of the initial diagnosis of high grade glioma to CNS neuroblastoma subtype of PNET, and treated accordingly. In a third patient initially diagnosed with medulloblastoma, overexpression of PDGFRA, MDM4, CDKN2A, EGFR, OLIG2, and GFAP supported a change in diagnosis to glioblastoma. Two gliomas had tier 2 mutations detected at initial diagnosis and progression: SETD2 p.R2040* (optic nerve lesion, called pseudotumor initially but glioma at progression), and H3F3A p.K28M (thalamic low grade glioma). In one patient with ependymoma, copy number gain of 1q25 (associated with poor prognosis) was seen only in the recurrence specimen. CONCLUSION: Our preliminary experience suggests that in pediatric CNS tumor patients referred for reoperation at recurrence, repeat WES may reveal a previously unrecognized treatment option, at least in embryonal tumors.

YersiniaBase: a genomic resource and analysis platform for comparative analysis of Yersinia.

PubMed

Tan, Shi Yang; Dutta, Avirup; Jakubovics, Nicholas S; Ang, Mia Yang; Siow, Cheuk Chuen; Mutha, Naresh Vr; Heydari, Hamed; Wee, Wei Yee; Wong, Guat Jah; Choo, Siew Woh

2015-01-16

Yersinia is a Gram-negative bacteria that includes serious pathogens such as the Yersinia pestis, which causes plague, Yersinia pseudotuberculosis, Yersinia enterocolitica. The remaining species are generally considered non-pathogenic to humans, although there is evidence that at least some of these species can cause occasional infections using distinct mechanisms from the more pathogenic species. With the advances in sequencing technologies, many genomes of Yersinia have been sequenced. However, there is currently no specialized platform to hold the rapidly-growing Yersinia genomic data and to provide analysis tools particularly for comparative analyses, which are required to provide improved insights into their biology, evolution and pathogenicity. To facilitate the ongoing and future research of Yersinia, especially those generally considered non-pathogenic species, a well-defined repository and analysis platform is needed to hold the Yersinia genomic data and analysis tools for the Yersinia research community. Hence, we have developed the YersiniaBase, a robust and user-friendly Yersinia resource and analysis platform for the analysis of Yersinia genomic data. YersiniaBase has a total of twelve species and 232 genome sequences, of which the majority are Yersinia pestis. In order to smooth the process of searching genomic data in a large database, we implemented an Asynchronous JavaScript and XML (AJAX)-based real-time searching system in YersiniaBase. Besides incorporating existing tools, which include JavaScript-based genome browser (JBrowse) and Basic Local Alignment Search Tool (BLAST), YersiniaBase also has in-house developed tools: (1) Pairwise Genome Comparison tool (PGC) for comparing two user-selected genomes; (2) Pathogenomics Profiling Tool (PathoProT) for comparative pathogenomics analysis of Yersinia genomes; (3) YersiniaTree for constructing phylogenetic tree of Yersinia. We ran analyses based on the tools and genomic data in YersiniaBase and the preliminary results showed differences in virulence genes found in Yersinia pestis and Yersinia pseudotuberculosis compared to other Yersinia species, and differences between Yersinia enterocolitica subsp. enterocolitica and Yersinia enterocolitica subsp. palearctica. YersiniaBase offers free access to wide range of genomic data and analysis tools for the analysis of Yersinia. YersiniaBase can be accessed at http://yersinia.um.edu.my .

Genetic characterization of poxviruses in Camelus dromedarius in Ethiopia, 2011-2014.

PubMed

Gelaye, Esayas; Achenbach, Jenna Elizabeth; Ayelet, Gelagay; Jenberie, Shiferaw; Yami, Martha; Grabherr, Reingard; Loitsch, Angelika; Diallo, Adama; Lamien, Charles Euloge

2016-10-01

Camelpox and camel contagious ecthyma are infectious viral diseases of camelids caused by camelpox virus (CMLV) and camel contagious ecthyma virus (CCEV), respectively. Even though, in Ethiopia, pox disease has been creating significant economic losses in camel production, little is known on the responsible pathogens and their genetic diversity. Thus, the present study aimed at isolation, identification and genetic characterization of the causative viruses. Accordingly, clinical case observations, infectious virus isolation, and molecular and phylogenetic analysis of poxviruses infecting camels in three regions and six districts in the country, Afar (Chifra), Oromia (Arero, Miyu and Yabello) and Somali (Gursum and Jijiga) between 2011 and 2014 were undertaken. The full hemagglutinin (HA) and partial A-type inclusion protein (ATIP) genes of CMLV and full major envelope protein (B2L) gene of CCEV of Ethiopian isolates were sequenced, analyzed and compared among each other and to foreign isolates. The viral isolation confirmed the presence of infectious poxviruses. The preliminary screening by PCR showed 27 CMLVs and 20 CCEVs. The sequence analyses showed that the HA and ATIP gene sequences are highly conserved within the local isolates of CMLVs, and formed a single cluster together with isolates from Somalia and Syria. Unlike CMLVs, the B2L gene analysis of Ethiopian CCEV showed few genetic variations. The phylogenetic analysis revealed three clusters of CCEV in Ethiopia with the isolates clustering according to their geographical origins. To our knowledge, this is the first report indicating the existence of CCEV in Ethiopia where camel contagious ecthyma was misdiagnosed as camelpox. Additionally, this study has also disclosed the existence of co-infections with CMLV and CCEV. A comprehensive characterization of poxviruses affecting camels in Ethiopia and the full genome sequencing of representative isolates are recommended to better understand the dynamics of pox diseases of camels and to assist in the implementation of more efficient control measures. Copyright © 2016 Elsevier B.V. All rights reserved.

Whole-exome sequencing in obsessive-compulsive disorder identifies rare mutations in immunological and neurodevelopmental pathways

PubMed Central

Cappi, C; Brentani, H; Lima, L; Sanders, S J; Zai, G; Diniz, B J; Reis, V N S; Hounie, A G; Conceição do Rosário, M; Mariani, D; Requena, G L; Puga, R; Souza-Duran, F L; Shavitt, R G; Pauls, D L; Miguel, E C; Fernandez, T V

2016-01-01

Studies of rare genetic variation have identified molecular pathways conferring risk for developmental neuropsychiatric disorders. To date, no published whole-exome sequencing studies have been reported in obsessive-compulsive disorder (OCD). We sequenced all the genome coding regions in 20 sporadic OCD cases and their unaffected parents to identify rare de novo (DN) single-nucleotide variants (SNVs). The primary aim of this pilot study was to determine whether DN variation contributes to OCD risk. To this aim, we evaluated whether there is an elevated rate of DN mutations in OCD, which would justify this approach toward gene discovery in larger studies of the disorder. Furthermore, to explore functional molecular correlations among genes with nonsynonymous DN SNVs in OCD probands, a protein–protein interaction (PPI) network was generated based on databases of direct molecular interactions. We applied Degree-Aware Disease Gene Prioritization (DADA) to rank the PPI network genes based on their relatedness to a set of OCD candidate genes from two OCD genome-wide association studies (Stewart et al., 2013; Mattheisen et al., 2014). In addition, we performed a pathway analysis with genes from the PPI network. The rate of DN SNVs in OCD was 2.51 × 10−8 per base per generation, significantly higher than a previous estimated rate in unaffected subjects using the same sequencing platform and analytic pipeline. Several genes harboring DN SNVs in OCD were highly interconnected in the PPI network and ranked high in the DADA analysis. Nearly all the DN SNVs in this study are in genes expressed in the human brain, and a pathway analysis revealed enrichment in immunological and central nervous system functioning and development. The results of this pilot study indicate that further investigation of DN variation in larger OCD cohorts is warranted to identify specific risk genes and to confirm our preliminary finding with regard to PPI network enrichment for particular biological pathways and functions. PMID:27023170

Mitochondrial Genome Sequences of Nematocera (Lower Diptera): Evidence of Rearrangement following a Complete Genome Duplication in a Winter Crane Fly

PubMed Central

Beckenbach, Andrew T.

2012-01-01

The complete mitochondrial DNA sequences of eight representatives of lower Diptera, suborder Nematocera, along with nearly complete sequences from two other species, are presented. These taxa represent eight families not previously represented by complete mitochondrial DNA sequences. Most of the sequences retain the ancestral dipteran mitochondrial gene arrangement, while one sequence, that of the midge Arachnocampa flava (family Keroplatidae), has an inversion of the trnE gene. The most unusual result is the extensive rearrangement of the mitochondrial genome of a winter crane fly, Paracladura trichoptera (family Trichocera). The pattern of rearrangement indicates that the mechanism of rearrangement involved a tandem duplication of the entire mitochondrial genome, followed by random and nonrandom loss of one copy of each gene. Another winter crane fly retains the ancestral diperan gene arrangement. A preliminary mitochondrial phylogeny of the Diptera is also presented. PMID:22155689

Preliminary Design Program: Vapor Compression Distillation Flight Experiment Program

NASA Technical Reports Server (NTRS)

Schubert, F. H.; Boyda, R. B.

1995-01-01

This document provides a description of the results of a program to prepare a preliminary design of a flight experiment to demonstrate the function of a Vapor Compression Distillation (VCD) Wastewater Processor (WWP) in microgravity. This report describes the test sequence to be performed and the hardware, control/monitor instrumentation and software designs prepared to perform the defined tests. the purpose of the flight experiment is to significantly reduce the technical and programmatic risks associated with implementing a VCD-based WWP on board the International Space Station Alpha.

PASS2: an automated database of protein alignments organised as structural superfamilies.

PubMed

Bhaduri, Anirban; Pugalenthi, Ganesan; Sowdhamini, Ramanathan

2004-04-02

The functional selection and three-dimensional structural constraints of proteins in nature often relates to the retention of significant sequence similarity between proteins of similar fold and function despite poor sequence identity. Organization of structure-based sequence alignments for distantly related proteins, provides a map of the conserved and critical regions of the protein universe that is useful for the analysis of folding principles, for the evolutionary unification of protein families and for maximizing the information return from experimental structure determination. The Protein Alignment organised as Structural Superfamily (PASS2) database represents continuously updated, structural alignments for evolutionary related, sequentially distant proteins. An automated and updated version of PASS2 is, in direct correspondence with SCOP 1.63, consisting of sequences having identity below 40% among themselves. Protein domains have been grouped into 628 multi-member superfamilies and 566 single member superfamilies. Structure-based sequence alignments for the superfamilies have been obtained using COMPARER, while initial equivalencies have been derived from a preliminary superposition using LSQMAN or STAMP 4.0. The final sequence alignments have been annotated for structural features using JOY4.0. The database is supplemented with sequence relatives belonging to different genomes, conserved spatially interacting and structural motifs, probabilistic hidden markov models of superfamilies based on the alignments and useful links to other databases. Probabilistic models and sensitive position specific profiles obtained from reliable superfamily alignments aid annotation of remote homologues and are useful tools in structural and functional genomics. PASS2 presents the phylogeny of its members both based on sequence and structural dissimilarities. Clustering of members allows us to understand diversification of the family members. The search engine has been improved for simpler browsing of the database. The database resolves alignments among the structural domains consisting of evolutionarily diverged set of sequences. Availability of reliable sequence alignments of distantly related proteins despite poor sequence identity and single-member superfamilies permit better sampling of structures in libraries for fold recognition of new sequences and for the understanding of protein structure-function relationships of individual superfamilies. PASS2 is accessible at http://www.ncbs.res.in/~faculty/mini/campass/pass2.html

Knowledge-based decision support for Space Station assembly sequence planning

NASA Astrophysics Data System (ADS)

1991-04-01

A complete Personal Analysis Assistant (PAA) for Space Station Freedom (SSF) assembly sequence planning consists of three software components: the system infrastructure, intra-flight value added, and inter-flight value added. The system infrastructure is the substrate on which software elements providing inter-flight and intra-flight value-added functionality are built. It provides the capability for building representations of assembly sequence plans and specification of constraints and analysis options. Intra-flight value-added provides functionality that will, given the manifest for each flight, define cargo elements, place them in the National Space Transportation System (NSTS) cargo bay, compute performance measure values, and identify violated constraints. Inter-flight value-added provides functionality that will, given major milestone dates and capability requirements, determine the number and dates of required flights and develop a manifest for each flight. The current project is Phase 1 of a projected two phase program and delivers the system infrastructure. Intra- and inter-flight value-added were to be developed in Phase 2, which has not been funded. Based on experience derived from hundreds of projects conducted over the past seven years, ISX developed an Intelligent Systems Engineering (ISE) methodology that combines the methods of systems engineering and knowledge engineering to meet the special systems development requirements posed by intelligent systems, systems that blend artificial intelligence and other advanced technologies with more conventional computing technologies. The ISE methodology defines a phased program process that begins with an application assessment designed to provide a preliminary determination of the relative technical risks and payoffs associated with a potential application, and then moves through requirements analysis, system design, and development.

Erwinia teleogrylli sp. nov., a Bacterial Isolate Associated with a Chinese Cricket

PubMed Central

Liu, Bo; Luo, Jin; Li, Wei; Long, Xiu-Feng; Zhang, Yu-Qin; Zeng, Zhi-Gang; Tian, Yong-Qiang

2016-01-01

A bacterial isolate (SCU-B244T) was obtained in China from crickets (Teleogryllus occipitalis) living in cropland deserted for approximately 10 years. The isolated bacteria were Gram-negative, facultatively anaerobic, oxidase-negative rods. A preliminary analysis of the 16S rRNA gene sequence indicated that the strain belongs to either the genus Erwinia or Pantoea. Analysis of multilocus sequence typing based on concatenated partial atpD, gyrB and infB gene sequences and physiological and biochemical characteristics indicated that the strain belonged to the genus Erwinia, as member of a new species as it was distinct from other known Erwinia species. Further analysis of the 16S rRNA gene showed SCU-B244T to have 94.71% identity to the closest species of that genus, Erwinia oleae (DSM 23398T), which is below the threshold of 97% used to discriminate bacterial species. DNA-DNA hybridization results (5.78±2.52%) between SCU-B244T and Erwinia oleae (DSM 23398T) confirmed that SCU-B244T and Erwinia oleae (DSM 23398T) represent different species combined with average nucleotide identity values which range from 72.42% to 74.41. The DNA G+C content of SCU-B244T was 55.32 mol%, which also differs from that of Erwinia oleae (54.7 to 54.9 mol%). The polyphasic taxonomic approach used here confirmed that the strain belongs to the Erwinia group and represents a novel species. The name Erwinia teleogrylli sp. nov. is proposed for this novel taxon, for which the type strain is SCU-B244T (= CGMCC 1.12772T = DSM 28222T = KCTC 42022T). PMID:26800121

Knowledge-based decision support for Space Station assembly sequence planning

NASA Technical Reports Server (NTRS)

1991-01-01

A complete Personal Analysis Assistant (PAA) for Space Station Freedom (SSF) assembly sequence planning consists of three software components: the system infrastructure, intra-flight value added, and inter-flight value added. The system infrastructure is the substrate on which software elements providing inter-flight and intra-flight value-added functionality are built. It provides the capability for building representations of assembly sequence plans and specification of constraints and analysis options. Intra-flight value-added provides functionality that will, given the manifest for each flight, define cargo elements, place them in the National Space Transportation System (NSTS) cargo bay, compute performance measure values, and identify violated constraints. Inter-flight value-added provides functionality that will, given major milestone dates and capability requirements, determine the number and dates of required flights and develop a manifest for each flight. The current project is Phase 1 of a projected two phase program and delivers the system infrastructure. Intra- and inter-flight value-added were to be developed in Phase 2, which has not been funded. Based on experience derived from hundreds of projects conducted over the past seven years, ISX developed an Intelligent Systems Engineering (ISE) methodology that combines the methods of systems engineering and knowledge engineering to meet the special systems development requirements posed by intelligent systems, systems that blend artificial intelligence and other advanced technologies with more conventional computing technologies. The ISE methodology defines a phased program process that begins with an application assessment designed to provide a preliminary determination of the relative technical risks and payoffs associated with a potential application, and then moves through requirements analysis, system design, and development.

Genetic Relatedness of Clostridium difficile Isolates from Various Origins Determined by Triple-Locus Sequence Analysis Based on Toxin Regulatory Genes tcdC, tcdR, and cdtR▿

PubMed Central

Bouvet, Philippe J. M.; Popoff, Michel R.

2008-01-01

A triple-locus nucleotide sequence analysis based on toxin regulatory genes tcdC, tcdR and cdtR was initiated to assess the sequence variability of these genes among Clostridium difficile isolates and to study the genetic relatedness between isolates. A preliminary investigation of the variability of the tcdC gene was done with 57 clinical and veterinary isolates. Twenty-three isolates representing nine main clusters were selected for tcdC, tcdR, and cdtR analysis. The numbers of alleles found for tcdC, tcdR and cdtR were nine, six, and five, respectively. All strains possessed the cdtR gene except toxin A-negative toxin B-positive variants. All but one binary toxin CDT-positive isolate harbored a deletion (>1 bp) in the tcdC gene. The combined analyses of the three genes allowed us to distinguish five lineages correlated with the different types of deletion in tcdC, i.e., 18 bp (associated or not with a deletion at position 117), 36 bp, 39 bp, and 54 bp, and with the wild-type tcdC (no deletion). The tcdR and tcdC genes, though located within the same pathogenicity locus, were found to have evolved separately. Coevolution of the three genes was noted only with strains harboring a 39-bp or a 54-bp deletion in tcdC that formed two homogeneous, separate divergent clusters. Our study supported the existence of the known clones (PCR ribotype 027 isolates and toxin A-negative toxin B-positive C. difficile variants) and evidence for clonality of isolates with a 39-bp deletion (toxinotype V, PCR ribotype 078) that are frequently isolated worldwide from human infections and from food animals. PMID:18832125

The amino acid sequence of Staphylococcus aureus penicillinase.

PubMed Central

Ambler, R P

1975-01-01

The amino acid sequence of the penicillinase (penicillin amido-beta-lactamhydrolase, EC 3.5.2.6) from Staphylococcus aureus strain PC1 was determined. The protein consists of a single polypeptide chain of 257 residues, and the sequence was determined by characterization of tryptic, chymotryptic, peptic and CNBr peptides, with some additional evidence from thermolysin and S. aureus proteinase peptides. A mistake in the preliminary report of the sequence is corrected; residues 113-116 are now thought to be -Lys-Lys-Val-Lys- rather than -Lys-Val-Lys-Lys-. Detailed evidence for the amino acid sequence has been deposited as Supplementary Publication SUP 50056 (91 pages) at the British Library (Lending Division), Boston Spa, Wetherby, West Yorkshire LS23 7BQ, U.K., from whom copies may be obtained on the terms given in Biochem. J. (1975) 145, 5. PMID:1218078

Transcriptomic Analysis of Metabolic Pathways in Milkfish That Respond to Salinity and Temperature Changes.

PubMed

Hu, Yau-Chung; Kang, Chao-Kai; Tang, Cheng-Hao; Lee, Tsung-Han

2015-01-01

Milkfish (Chanos chanos), an important marine aquaculture species in southern Taiwan, show considerable euryhalinity but have low tolerance to sudden drops in water temperatures in winter. Here, we used high throughput next-generation sequencing (NGS) to identify molecular and biological processes involved in the responses to environmental changes. Preliminary tests revealed that seawater (SW)-acclimated milkfish tolerated lower temperatures than the fresh water (FW)-acclimated group. Although FW- and SW-acclimated milkfish have different levels of tolerance for hypothermal stress, to date, the molecular physiological basis of this difference has not been elucidated. Here, we performed a next-generation sequence analysis of mRNAs from four groups of milkfish. We obtained 29669 unigenes with an average length of approximately 1936 base pairs. Gene ontology (GO) analysis was performed after gene annotation. A large number of genes for molecular regulation were identified through a transcriptomic comparison in a KEGG analysis. Basal metabolic pathways involved in hypothermal tolerance, such as glycolysis, fatty acid metabolism, amino acid catabolism and oxidative phosphorylation, were analyzed using PathVisio and Cytoscape software. Our results indicate that in response to hypothermal stress, genes for oxidative phosphorylation, e.g., succinate dehydrogenase, were more highly up-regulated in SW than FW fish. Moreover, SW and FW milkfish used different strategies when exposed to hypothermal stress: SW milkfish up-regulated oxidative phosphorylation and catabolism genes to produce more energy budget, whereas FW milkfish down-regulated genes related to basal metabolism to reduce energy loss.

Transcriptomic Analysis of Metabolic Pathways in Milkfish That Respond to Salinity and Temperature Changes

PubMed Central

Hu, Yau-Chung; Kang, Chao-Kai; Tang, Cheng-Hao; Lee, Tsung-Han

2015-01-01

Milkfish (Chanos chanos), an important marine aquaculture species in southern Taiwan, show considerable euryhalinity but have low tolerance to sudden drops in water temperatures in winter. Here, we used high throughput next-generation sequencing (NGS) to identify molecular and biological processes involved in the responses to environmental changes. Preliminary tests revealed that seawater (SW)-acclimated milkfish tolerated lower temperatures than the fresh water (FW)-acclimated group. Although FW- and SW-acclimated milkfish have different levels of tolerance for hypothermal stress, to date, the molecular physiological basis of this difference has not been elucidated. Here, we performed a next-generation sequence analysis of mRNAs from four groups of milkfish. We obtained 29669 unigenes with an average length of approximately 1936 base pairs. Gene ontology (GO) analysis was performed after gene annotation. A large number of genes for molecular regulation were identified through a transcriptomic comparison in a KEGG analysis. Basal metabolic pathways involved in hypothermal tolerance, such as glycolysis, fatty acid metabolism, amino acid catabolism and oxidative phosphorylation, were analyzed using PathVisio and Cytoscape software. Our results indicate that in response to hypothermal stress, genes for oxidative phosphorylation, e.g., succinate dehydrogenase, were more highly up-regulated in SW than FW fish. Moreover, SW and FW milkfish used different strategies when exposed to hypothermal stress: SW milkfish up-regulated oxidative phosphorylation and catabolism genes to produce more energy budget, whereas FW milkfish down-regulated genes related to basal metabolism to reduce energy loss. PMID:26263550

Sequence Optimized Real-Time RT-PCR Assay for Detection of Crimean-Congo Hemorrhagic Fever Virus

DTIC Science & Technology

2017-03-21

19-23]. Real-56 time reverse-transcription PCR remains the gold standard for quantitative , sensitive, and specific 57 detection of CCHFV; however...five-fold in two different series , and samples were run by real- time RT-PCR 116 in triplicate. The preliminary LOD was the lowest RNA dilution where...1 Sequence optimized real- time RT-PCR assay for detection of Crimean-Congo hemorrhagic fever 1 virus 2 3 JW Koehler1, KL Delp1, AT Hall1, SP

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

PubMed Central

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin

2016-01-01

Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855

Yeast species diversity in apple juice for cider production evidenced by culture-based method.

PubMed

Lorenzini, Marilinda; Simonato, Barbara; Zapparoli, Giacomo

2018-05-07

Identification of yeasts isolated from apple juices of two cider houses (one located in a plain area and one in an alpine area) was carried out by culture-based method. Wallerstein Laboratory Nutrient Agar was used as medium for isolation and preliminary yeasts identification. A total of 20 species of yeasts belonging to ten different genera were identified using both BLAST algorithm for pairwise sequence comparison and phylogenetic approaches. A wide variety of non-Saccharomyces species was found. Interestingly, Candida railenensis, Candida cylindracea, Hanseniaspora meyeri, Hanseniaspora pseudoguilliermondii, and Metschnikowia sinensis were recovered for the first time in the yeast community of an apple environment. Phylogenetic analysis revealed a better resolution in identifying Metschnikowia and Moesziomyces isolates than comparative analysis using the GenBank or YeastIP gene databases. This study provides important data on yeast microbiota of apple juice and evidenced differences between two geographical cider production areas in terms of species composition.

Refining and end use study of coal liquids II - linear programming analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowe, C.; Tam, S.

1995-12-31

A DOE-funded study is underway to determine the optimum refinery processing schemes for producing transportation fuels that will meet CAAA regulations from direct and indirect coal liquids. The study consists of three major parts: pilot plant testing of critical upgrading processes, linear programming analysis of different processing schemes, and engine emission testing of final products. Currently, fractions of a direct coal liquid produced form bituminous coal are being tested in sequence of pilot plant upgrading processes. This work is discussed in a separate paper. The linear programming model, which is the subject of this paper, has been completed for themore » petroleum refinery and is being modified to handle coal liquids based on the pilot plant test results. Preliminary coal liquid evaluation studies indicate that, if a refinery expansion scenario is adopted, then the marginal value of the coal liquid (over the base petroleum crude) is $3-4/bbl.« less

New insights into old methods for identifying causal rare variants.

PubMed

Wang, Haitian; Huang, Chien-Hsun; Lo, Shaw-Hwa; Zheng, Tian; Hu, Inchi

2011-11-29

The advance of high-throughput next-generation sequencing technology makes possible the analysis of rare variants. However, the investigation of rare variants in unrelated-individuals data sets faces the challenge of low power, and most methods circumvent the difficulty by using various collapsing procedures based on genes, pathways, or gene clusters. We suggest a new way to identify causal rare variants using the F-statistic and sliced inverse regression. The procedure is tested on the data set provided by the Genetic Analysis Workshop 17 (GAW17). After preliminary data reduction, we ranked markers according to their F-statistic values. Top-ranked markers were then subjected to sliced inverse regression, and those with higher absolute coefficients in the most significant sliced inverse regression direction were selected. The procedure yields good false discovery rates for the GAW17 data and thus is a promising method for future study on rare variants.

Expressed sequence tags (ESTs) from immune tissues of turbot (Scophthalmus maximus) challenged with pathogens

PubMed Central

Pardo, Belén G; Fernández, Carlos; Millán, Adrián; Bouza, Carmen; Vázquez-López, Araceli; Vera, Manuel; Alvarez-Dios, José A; Calaza, Manuel; Gómez-Tato, Antonio; Vázquez, María; Cabaleiro, Santiago; Magariños, Beatriz; Lemos, Manuel L; Leiro, José M; Martínez, Paulino

2008-01-01

Background The turbot (Scophthalmus maximus; Scophthalmidae; Pleuronectiformes) is a flatfish species of great relevance for marine aquaculture in Europe. In contrast to other cultured flatfish, very few genomic resources are available in this species. Aeromonas salmonicida and Philasterides dicentrarchi are two pathogens that affect turbot culture causing serious economic losses to the turbot industry. Little is known about the molecular mechanisms for disease resistance and host-pathogen interactions in this species. In this work, thousands of ESTs for functional genomic studies and potential markers linked to ESTs for mapping (microsatellites and single nucleotide polymorphisms (SNPs)) are provided. This information enabled us to obtain a preliminary view of regulated genes in response to these pathogens and it constitutes the basis for subsequent and more accurate microarray analysis. Results A total of 12584 cDNAs partially sequenced from three different cDNA libraries of turbot (Scophthalmus maximus) infected with Aeromonas salmonicida, Philasterides dicentrarchi and from healthy fish were analyzed. Three immune-relevant tissues (liver, spleen and head kidney) were sampled at several time points in the infection process for library construction. The sequences were processed into 9256 high-quality sequences, which constituted the source for the turbot EST database. Clustering and assembly of these sequences, revealed 3482 different putative transcripts, 1073 contigs and 2409 singletons. BLAST searches with public databases detected significant similarity (e-value ≤ 1e-5) in 1766 (50.7%) sequences and 816 of them (23.4%) could be functionally annotated. Two hundred three of these genes (24.9%), encoding for defence/immune-related proteins, were mostly identified for the first time in turbot. Some ESTs showed significant differences in the number of transcripts when comparing the three libraries, suggesting regulation in response to these pathogens. A total of 191 microsatellites, with 104 having sufficient flanking sequences for primer design, and 1158 putative SNPs were identified from these EST resources in turbot. Conclusion A collection of 9256 high-quality ESTs was generated representing 3482 unique turbot sequences. A large proportion of defence/immune-related genes were identified, many of them regulated in response to specific pathogens. Putative microsatellites and SNPs were identified. These genome resources constitute the basis to develop a microarray for functional genomics studies and marker validation for genetic linkage and QTL analysis in turbot. PMID:18817567

Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vivian, J. P.; Porter, C.; Wilce, J. A.

2006-11-01

A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

Gear Shifting of Quadriceps during Isometric Knee Extension Disclosed Using Ultrasonography.

PubMed

Zhang, Shu; Huang, Weijian; Zeng, Yu; Shi, Wenxiu; Diao, Xianfen; Wei, Xiguang; Ling, Shan

2018-01-01

Ultrasonography has been widely employed to estimate the morphological changes of muscle during contraction. To further investigate the motion pattern of quadriceps during isometric knee extensions, we studied the relative motion pattern between femur and quadriceps under ultrasonography. An interesting observation is that although the force of isometric knee extension can be controlled to change almost linearly, femur in the simultaneously captured ultrasound video sequences has several different piecewise moving patterns. This phenomenon is like quadriceps having several forward gear ratios like a car starting from rest towards maximal voluntary contraction (MVC) and then returning to rest. Therefore, to verify this assumption, we captured several ultrasound video sequences of isometric knee extension and collected the torque/force signal simultaneously. Then we extract the shapes of femur from these ultrasound video sequences using video processing techniques and study the motion pattern both qualitatively and quantitatively. The phenomenon can be seen easier via a comparison between the torque signal and relative spatial distance between femur and quadriceps. Furthermore, we use cluster analysis techniques to study the process and the clustering results also provided preliminary support to the conclusion that, during both ramp increasing and decreasing phases, quadriceps contraction may have several forward gear ratios relative to femur.

Characterization of Viral Communities of Biting Midges and Identification of Novel Thogotovirus Species and Rhabdovirus Genus

PubMed Central

Temmam, Sarah; Monteil-Bouchard, Sonia; Robert, Catherine; Baudoin, Jean-Pierre; Sambou, Masse; Aubadie-Ladrix, Maxence; Labas, Noémie; Raoult, Didier; Mediannikov, Oleg; Desnues, Christelle

2016-01-01

More than two thirds of emerging viruses are of zoonotic origin, and among them RNA viruses represent the majority. Ceratopogonidae (genus Culicoides) are well-known vectors of several viruses responsible for epizooties (bluetongue, epizootic haemorrhagic disease, etc.). They are also vectors of the only known virus infecting humans: the Oropouche virus. Female midges usually feed on a variety of hosts, leading to possible transmission of emerging viruses from animals to humans. In this context, we report here the analysis of RNA viral communities of Senegalese biting midges using next-generation sequencing techniques as a preliminary step toward the identification of potential viral biohazards. Sequencing of the RNA virome of three pools of Culicoides revealed the presence of a significant diversity of viruses infecting plants, insects and mammals. Several novel viruses were detected, including a novel Thogotovirus species, related but genetically distant from previously described tick-borne thogotoviruses. Novel rhabdoviruses were also detected, possibly constituting a novel Rhabdoviridae genus, and putatively restricted to insects. Sequences related to the major viruses transmitted by Culicoides, i.e., African horse sickness, bluetongue and epizootic haemorrhagic disease viruses were also detected. This study highlights the interest in monitoring the emergence and circulation of zoonoses and epizooties using their arthropod vectors. PMID:26978389

Characterization of Viral Communities of Biting Midges and Identification of Novel Thogotovirus Species and Rhabdovirus Genus.

PubMed

Temmam, Sarah; Monteil-Bouchard, Sonia; Robert, Catherine; Baudoin, Jean-Pierre; Sambou, Masse; Aubadie-Ladrix, Maxence; Labas, Noémie; Raoult, Didier; Mediannikov, Oleg; Desnues, Christelle

2016-03-11

More than two thirds of emerging viruses are of zoonotic origin, and among them RNA viruses represent the majority. Ceratopogonidae (genus Culicoides) are well-known vectors of several viruses responsible for epizooties (bluetongue, epizootic haemorrhagic disease, etc.). They are also vectors of the only known virus infecting humans: the Oropouche virus. Female midges usually feed on a variety of hosts, leading to possible transmission of emerging viruses from animals to humans. In this context, we report here the analysis of RNA viral communities of Senegalese biting midges using next-generation sequencing techniques as a preliminary step toward the identification of potential viral biohazards. Sequencing of the RNA virome of three pools of Culicoides revealed the presence of a significant diversity of viruses infecting plants, insects and mammals. Several novel viruses were detected, including a novel Thogotovirus species, related but genetically distant from previously described tick-borne thogotoviruses. Novel rhabdoviruses were also detected, possibly constituting a novel Rhabdoviridae genus, and putatively restricted to insects. Sequences related to the major viruses transmitted by Culicoides, i.e., African horse sickness, bluetongue and epizootic haemorrhagic disease viruses were also detected. This study highlights the interest in monitoring the emergence and circulation of zoonoses and epizooties using their arthropod vectors.

Spatial distribution of aquatic marine fungi across the western Arctic and sub-arctic.

PubMed

Hassett, Brandon T; Ducluzeau, Anne-Lise L; Collins, Roy E; Gradinger, Rolf

2017-02-01

Fungi are important parasites of primary producers and nutrient cyclers in aquatic ecosystems. In the Pacific-Arctic domain, fungal parasitism is linked to light intensities and algal stress that can elevate disease incidence on algae and reduce diatom concentrations. Fungi are vastly understudied in the marine realm and knowledge of their function is constrained by the current understanding of fungal distribution and drivers on global scales. To investigate the spatial distribution of fungi in the western Arctic and sub-Arctic, we used high throughput methods to sequence 18S rRNA, cloned and sequenced 28S rRNA and microscopically counted chytrid-infected diatoms. We identified a broad distribution of fungal taxa predominated by Chytridiomycota and Dikarya. Phylogenetic analysis of our Chytridiomycota clones placed Arctic marine fungi sister to the order Lobulomycetales. This clade of fungi predominated in fungal communities under ice with low snowpack. Microscopic examination of fixed seawater and sea ice samples revealed chytrids parasitizing diatoms collected across the Arctic that notably infected 25% of a single diatom species in the Bering Sea. The Pezizomycotina comprised > 95% of eukaryotic sequence reads in Greenland, providing preliminary evidence for osmotrophs being a substitute for algae as the base of food webs. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Characterisation of lab in typical Salento Pecorino cheese.

PubMed

Cappello, M S; Laddomada, B; Poltronieri, P; Zacheo, G

2001-01-01

Twenty-nine strains of Lactic Acid Bacteria isolated from the typical Pecorino cheese of the Salento area of Italy, were identified and grouped according to their genetic similarity. A preliminary characterisation of the strains was conducted by means of morphological and biochemical analysis, but molecular approaches were necessary for the clear identification of the species. For the species detection, the amplification and sequencing of the 16S rDNA gene was employed In addition, restriction analysis of amplified rDNA (ARDRA) and PCR and AFLP fingerprinting enabled inter- and intra-specific variation to be estimated UPGMA cluster analysis was used to divide the strains into distinct clusters which corresponded with the species delineation obtained by molecular identification. The data obtained show that the community of lactobacilli responsible for the fermentation and aging of Pecorino cheese is composed of a limited number of species. The main identified strains were Lactobacillus brevis, L. plantarum, L. casei, L. sakei, L. pentosus, L. farciminis and Leuconostoc mesenteroides.

The base number of ‘loxoscaphoid’ Asplenium species and its implication for cytoevolution in Aspleniaceae

PubMed Central

Bellefroid, Elke; Rambe, S. Khadijah; Leroux, Olivier; Viane, Ronald L. L.

2010-01-01

Background and Aims ‘Loxoscaphoid’ Asplenium species are morphologically a remarkably distinct group of Aspleniaceae. Except for two preliminary chromosome counts of Asplenium theciferum, the cytology of this group of species has, however, been largely unstudied. Methods Chromosome counts were obtained by acetocarmine squash preparations of one mitotic cell and several meiotic cells. Relative DNA content of gametophytic and sporophytic cells was determined by flow cytometry. The phylogenetic placement of A. loxoscaphoides, A. rutifolium s.l. and A. theciferum s.l. was investigated through an analysis of rbcL sequences. Key Results The dysploid base number is reported to be x = 35 in Asplenium centrafricanum, A. loxoscaphoides, A. sertularioides and A. theciferum. Analysis of rbcL sequences confirms that ‘loxoscaphoids’ nest robustly within Asplenium. Several high ploidy levels exceeding the tetraploid level were found in A. theciferum s.l. and A. rutifolium s.l. All taxa proved to be sexual. Conclusions Four base numbers are known at present for Aspleniaceae: x = 39, 38, 36 and 35. The dysploid base number x = 35 found in the ‘loxoscaphoid’ Asplenium spp. sheds a novel light on the cytoevolution of the whole family. We postulate a recurrent descending dysploid evolution within Aspleniaceae, leading to speciation at the (sub)generic and species/group level. PMID:20498038

Antimicrobial Resistance and Molecular Characteristics of Methicillin-Resistant Staphylococcus aureus Isolates from Child Patients of High-Risk Wards in Shenzhen, China.

PubMed

Qin, Yang; Wen, Feiqiu; Zheng, Yuejie; Zhao, Ruizhen; Hu, Qinghua; Zhang, Renli

2017-09-25

Methicillin-resistant Staphylococcus aureus (MRSA) strains are responsible for high rates of mortality and thus pose a substantial burden to public health worldwide. Here, we investigated the antimicrobial susceptibility and molecular characteristics of MRSA isolated from child patients at Shenzhen Children's Hospital. We characterized 140 MRSA strains through antimicrobial susceptibility testing. We further performed spa typing, multilocus sequence typing (MLST), staphylococcal cassette chromosome mec (SCCmec) analysis, pvl gene analysis, and pulsed-field gel electrophoresis (PFGE). The analyzed MRSA strains were found to be sensitive to most non-β-lactam antimicrobial agents. Sequence type (ST) 59 was found to be the most common MLST lineage (54.3%). Most MRSA isolates belonged to the SCCmec IV (64.3%) and V (22.8%) types. The MRSA-ST59-SCCmec IV-t437 clone was the most predominant strain that infected 28.6% of all patients studied. Moreover, 50.7% of MRSA isolates were found to be pvl-positive. We report preliminary data on the prevalence and distribution of MRSA genotypes in Shenzhen Children's Hospital. We characterized MRSA colonization dynamics in child patients in China, and our findings can serve as the basis for the development of strategies to prevent MRSA infection and transmission.

Cloning and expression of a conjugated bile acid hydrolase gene from Lactobacillus plantarum by using a direct plate assay.

PubMed

Christiaens, H; Leer, R J; Pouwels, P H; Verstraete, W

1992-12-01

The conjugated bile acid hydrolase gene from the silage isolate Lactobacillus plantarum 80 was cloned and expressed in Escherichia coli MC1061. For the screening of this hydrolase gene within the gene bank, a direct plate assay developed by Dashkevicz and Feighner (M. P. Dashkevicz and S. D. Feighner, Appl. Environ. Microbiol. 53:331-336, 1989) was adapted to the growth requirements of E. coli. Because of hydrolysis and medium acidification, hydrolase-active colonies were surrounded with big halos of precipitated, free bile acids. This phenomenon was also obtained when the gene was cloned into a multicopy shuttle vector and subsequently reintroduced into the parental Lactobacillus strain. The cbh gene and surrounding regions were characterized by nucleotide sequence analysis. The deduced amino acid sequence was shown to have 52% similarity with a penicillin V amidase from Bacillus sphaericus. Preliminary characterization of the gene product showed that it is a cholylglycine hydrolase (EC 3.5.1.24) with only slight activity against taurine conjugates. The optimum pH was between 4.7 and 5.5. Optimum temperature ranged from 30 to 45 degrees C. Southern blot analysis indicated that the cloned gene has similarity with genomic DNA of bile acid hydrolase-active Lactobacillus spp. of intestinal origin.

Comparative sequence analysis of acid sensitive/resistance proteins in Escherichia coli and Shigella flexneri

PubMed Central

Manikandan, Selvaraj; Balaji, Seetharaaman; Kumar, Anil; Kumar, Rita

2007-01-01

The molecular basis for the survival of bacteria under extreme conditions in which growth is inhibited is a question of great current interest. A preliminary study was carried out to determine residue pattern conservation among the antiporters of enteric bacteria, responsible for extreme acid sensitivity especially in Escherichia coli and Shigella flexneri. Here we found the molecular evidence that proved the relationship between E. coli and S. flexneri. Multiple sequence alignment of the gadC coded acid sensitive antiporter showed many conserved residue patterns at regular intervals at the N-terminal region. It was observed that as the alignment approaches towards the C-terminal, the number of conserved residues decreases, indicating that the N-terminal region of this protein has much active role when compared to the carboxyl terminal. The motif, FHLVFFLLLGG, is well conserved within the entire gadC coded protein at the amino terminal. The motif is also partially conserved among other antiporters (which are not coded by gadC) but involved in acid sensitive/resistance mechanism. Phylogenetic cluster analysis proves the relationship of Escherichia coli and Shigella flexneri. The gadC coded proteins are converged as a clade and diverged from other antiporters belongs to the amino acid-polyamine-organocation (APC) superfamily. PMID:21670792

Preparation, crystallization and preliminary X-ray diffraction analysis of two intestinal fatty-acid binding proteins in the presence of 11-(dansylamino)undecanoic acid

PubMed Central

Laguerre, Aisha; Wielens, Jerome; Parker, Michael W.; Porter, Christopher J. H.; Scanlon, Martin J.

2011-01-01

Fatty-acid binding proteins (FABPs) are abundantly expressed proteins that bind a range of lipophilic molecules. They have been implicated in the import and intracellular distribution of their ligands and have been linked with metabolic and inflammatory responses in the cells in which they are expressed. Despite their high sequence identity, human intestinal FABP (hIFABP) and rat intestinal FABP (rIFABP) bind some ligands with different affinities. In order to address the structural basis of this differential binding, diffraction-quality crystals have been obtained of hIFABP and rIFABP in complex with the fluorescent fatty-acid analogue 11-(dansylamino)undecanoic acid. PMID:21301109

Crystallization and preliminary X-ray analysis of native and selenomethionyl vinorine synthase from Rauvolfia serpentina.

PubMed

Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim

2005-06-01

Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.

Purification, crystallization and preliminary crystallographic analysis of the adhesion domain of Epf from Streptococcus pyogenes.

PubMed

Linke, Christian; Siemens, Nikolai; Middleditch, Martin J; Kreikemeyer, Bernd; Baker, Edward N

2012-07-01

The extracellular protein Epf from Streptococcus pyogenes is important for streptococcal adhesion to human epithelial cells. However, Epf has no sequence identity to any protein of known structure or function. Thus, several predicted domains of the 205 kDa protein Epf were cloned separately and expressed in Escherichia coli. The N-terminal domain of Epf was crystallized in space groups P2(1) and P2(1)2(1)2(1) in the presence of the protease chymotrypsin. Mass spectrometry showed that the species crystallized corresponded to a fragment comprising residues 52-357 of Epf. Complete data sets were collected to 2.0 and 1.6 Å resolution, respectively, at the Australian Synchrotron.

Impact of geostationary satellite water vapor channel data on weather analysis and forecasting

NASA Technical Reports Server (NTRS)

Velden, Christopher S.

1995-01-01

Preliminary results from NWP impact studies are indicating that upper-tropospheric wind information provided by tracking motions in sequences of geostationary satellite water vapor imagery can positively influence forecasts on regional scales, and possibly on global scales as well. The data are complimentary to cloud-tracked winds by providing data in cloud-free regions, as well as comparable in quality. First results from GOES-8 winds are encouraging, and further efforts and model impacts will be directed towards optimizing these data in numerical weather prediction (NWP). Assuming successful launches of GOES-J and GMS-5 satellites in 1995, high quality and resolution water vapor imagers will be available to provide nearly complete global upper-tropospheric wind coverage.

Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

PubMed

Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

2015-04-02

Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

Noninvasive Prenatal Testing and Incidental Detection of Occult Maternal Malignancies.

PubMed

Bianchi, Diana W; Chudova, Darya; Sehnert, Amy J; Bhatt, Sucheta; Murray, Kathryn; Prosen, Tracy L; Garber, Judy E; Wilkins-Haug, Louise; Vora, Neeta L; Warsof, Stephen; Goldberg, James; Ziainia, Tina; Halks-Miller, Meredith

2015-07-14

Understanding the relationship between aneuploidy detection on noninvasive prenatal testing (NIPT) and occult maternal malignancies may explain results that are discordant with the fetal karyotype and improve maternal clinical care. To evaluate massively parallel sequencing data for patterns of copy-number variations that might prospectively identify occult maternal malignancies. Case series identified from 125,426 samples submitted between February 15, 2012, and September 30, 2014, from asymptomatic pregnant women who underwent plasma cell-free DNA sequencing for clinical prenatal aneuploidy screening. Analyses were conducted in a clinical laboratory that performs DNA sequencing. Among the clinical samples, abnormal results were detected in 3757 (3%); these were reported to the ordering physician with recommendations for further evaluation. NIPT for fetal aneuploidy screening (chromosomes 13, 18, 21, X, and Y). Detailed genome-wide bioinformatics analysis was performed on available sequencing data from 8 of 10 women with known cancers. Genome-wide copy-number changes in the original NIPT samples and in subsequent serial samples from individual patients when available are reported. Copy-number changes detected in NIPT sequencing data in the known cancer cases were compared with the types of aneuploidies detected in the overall cohort. From a cohort of 125,426 NIPT results, 3757 (3%) were positive for 1 or more aneuploidies involving chromosomes 13, 18, 21, X, or Y. From this set of 3757 samples, 10 cases of maternal cancer were identified. Detailed clinical and sequencing data were obtained in 8. Maternal cancers most frequently occurred with the rare NIPT finding of more than 1 aneuploidy detected (7 known cancers among 39 cases of multiple aneuploidies by NIPT, 18% [95% CI, 7.5%-33.5%]). All 8 cases that underwent further bioinformatics analysis showed unique patterns of nonspecific copy-number gains and losses across multiple chromosomes. In 1 case, blood was sampled after completion of treatment for colorectal cancer and the abnormal pattern was no longer evident. In this preliminary study, a small number of cases of occult malignancy were subsequently diagnosed among pregnant women whose noninvasive prenatal testing results showed discordance with the fetal karyotype. The clinical importance of these findings will require further research.

40 CFR 1065.650 - Emission calculations.

Code of Federal Regulations, 2011 CFR

2011-07-01

... following sequence of preliminary calculations on recorded concentrations: (i) Correct all THC and CH4.... (iii) Calculate all THC and NMHC concentrations, including dilution air background concentrations, as... NMHC to background corrected mass of THC. If the background corrected mass of NMHC is greater than 0.98...

Better chocolate through genomics

USDA-ARS?s Scientific Manuscript database

Theobroma cacao, the cacao or chocolate tree, is a tropical understory tree whose seeds are used to make chocolate. And like any important crop, cacao is the subject of much research. On September 15, 2010, scientists publicly released a preliminary sequence of the cacao genome--which contains all o...

Purification, identification and preliminary crystallographic studies of a 2S albumin seed protein from Lens culinaris

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Pankaj; Gaur, Vineet; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

2008-08-01

A 2S albumin from L. culinaris was purified and crystallized and preliminary crystallographic studies were carried out. Lens culinaris (lentil) is a widely consumed high-protein-content leguminous crop. A 2S albumin protein (26.5 kDa) has been identified using NH{sub 2}-terminal sequencing from a 90% ammonium sulfate saturation fraction of total L. culinaris seed protein extract. The NH{sub 2}-terminal sequence shows very high homology to PA2, an allergy-related protein from Pisum sativum. The 2S albumin protein was purified using a combination of size-exclusion and ion-exchange chromatography. Crystals of the 2S seed albumin obtained using the hanging-drop vapour-diffusion method diffracted to 2.5 Åmore » resolution and were indexed in space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 78.6, c = 135.2 Å.« less

Molecular cloning and characterization of rat sperm surface antigen 2B1, a glycoprotein implicated in sperm-zona binding.

PubMed

Hou, S T; Ma, A; Jones, R; Hall, L

1996-10-01

The rat sperm surface antigen, 2B1, that has been proposed to play a key role in sperm adhesion to the zona pellucida, has been cloned and its entire cDNA sequenced. Northern blot analysis indicates that 2B1 is encoded by a 2.2-kb RNA transcript that is abundantly expressed in the testis. The deduced protein sequence contains 512 amino-acid residues with a strong candidate signal sequence and C-terminal transmembrane domain. Data base searches reveal a high degree of sequence similarity to guinea pig, rabbit, monkey, and human PH20 sperm surface antigens, and a lower degree of similarity to honey bee and whiteface hornet venom hyaluronidases. Rat 2B1 antigen also possesses hyaluronidase activity, suggesting that it is a bifunctional protein with putative roles in the dispersion of cumulus oophorus cells as well as zona adhesion. However, while it would appear that 2B1 is the rat homologue of the guinea pig PH20 antigen, they differ in a number of important biochemical respects (including their mode of attachment to the sperm membrane and distribution between soluble and membrane-bound fractions), as well as in their localization on the sperm membrane. Expression of regions of the 2B1 protein in recombinant bacterial cells has allowed a preliminary mapping of the 2B1 epitope, and has provided more definitive information on the endoproteolytic processing of 2B1 during epididymal transit.

De Novo Assembly of the Donkey White Blood Cell Transcriptome and a Comparative Analysis of Phenotype-Associated Genes between Donkeys and Horses

PubMed Central

Xie, Feng-Yun; Feng, Yu-Long; Wang, Hong-Hui; Ma, Yun-Feng; Yang, Yang; Wang, Yin-Chao; Shen, Wei; Pan, Qing-Jie; Yin, Shen; Sun, Yu-Jiang; Ma, Jun-Yu

2015-01-01

Prior to the mechanization of agriculture and labor-intensive tasks, humans used donkeys (Equus africanus asinus) for farm work and packing. However, as mechanization increased, donkeys have been increasingly raised for meat, milk, and fur in China. To maintain the development of the donkey industry, breeding programs should focus on traits related to these new uses. Compared to conventional marker-assisted breeding plans, genome- and transcriptome-based selection methods are more efficient and effective. To analyze the coding genes of the donkey genome, we assembled the transcriptome of donkey white blood cells de novo. Using transcriptomic deep-sequencing data, we identified 264,714 distinct donkey unigenes and predicted 38,949 protein fragments. We annotated the donkey unigenes by BLAST searches against the non-redundant (NR) protein database. We also compared the donkey protein sequences with those of the horse (E. caballus) and wild horse (E. przewalskii), and linked the donkey protein fragments with mammalian phenotypes. As the outer ear size of donkeys and horses are obviously different, we compared the outer ear size-associated proteins in donkeys and horses. We identified three ear size-associated proteins, HIC1, PRKRA, and KMT2A, with sequence differences among the donkey, horse, and wild horse loci. Since the donkey genome sequence has not been released, the de novo assembled donkey transcriptome is helpful for preliminary investigations of donkey cultivars and for genetic improvement. PMID:26208029

De Novo Assembly of the Donkey White Blood Cell Transcriptome and a Comparative Analysis of Phenotype-Associated Genes between Donkeys and Horses.

PubMed

Xie, Feng-Yun; Feng, Yu-Long; Wang, Hong-Hui; Ma, Yun-Feng; Yang, Yang; Wang, Yin-Chao; Shen, Wei; Pan, Qing-Jie; Yin, Shen; Sun, Yu-Jiang; Ma, Jun-Yu

2015-01-01

Prior to the mechanization of agriculture and labor-intensive tasks, humans used donkeys (Equus africanus asinus) for farm work and packing. However, as mechanization increased, donkeys have been increasingly raised for meat, milk, and fur in China. To maintain the development of the donkey industry, breeding programs should focus on traits related to these new uses. Compared to conventional marker-assisted breeding plans, genome- and transcriptome-based selection methods are more efficient and effective. To analyze the coding genes of the donkey genome, we assembled the transcriptome of donkey white blood cells de novo. Using transcriptomic deep-sequencing data, we identified 264,714 distinct donkey unigenes and predicted 38,949 protein fragments. We annotated the donkey unigenes by BLAST searches against the non-redundant (NR) protein database. We also compared the donkey protein sequences with those of the horse (E. caballus) and wild horse (E. przewalskii), and linked the donkey protein fragments with mammalian phenotypes. As the outer ear size of donkeys and horses are obviously different, we compared the outer ear size-associated proteins in donkeys and horses. We identified three ear size-associated proteins, HIC1, PRKRA, and KMT2A, with sequence differences among the donkey, horse, and wild horse loci. Since the donkey genome sequence has not been released, the de novo assembled donkey transcriptome is helpful for preliminary investigations of donkey cultivars and for genetic improvement.

The canine sarcoglycan delta gene: BAC clone contig assembly, chromosome assignment and interrogation as a candidate gene for dilated cardiomyopathy in Dobermann dogs.

PubMed

Stabej, P; Leegwater, P A J; Imholz, S; Versteeg, S A; Zijlstra, C; Stokhof, A A; Domanjko-Petriè, A; van Oost, B A

2005-01-01

Dilated cardiomyopathy (DCM) is a common disease of the myocardium recognized in human, dog and experimental animals. Genetic factors are responsible for a large proportion of cases in humans, and 17 genes with DCM causing mutations have been identified. The genetic origin of DCM in the Dobermann dogs has been suggested, but no disease genes have been identified to date. In this paper, we describe the characterization and evaluation of the canine sarcoglycan delta (SGCD), a gene implicated in DCM in human and hamster. Bacterial artificial chromosomes (BACs) containing the canine SGCD gene were isolated with probes for exon 3 and exons 4-8 and were characterized by Southern blot analysis. BAC end sequences were obtained for four BACs. Three of the BACs overlapped and could be ordered relative to each other and the end sequences of all four BACs could be anchored on the preliminary assembly of the dog genome sequence (www. ensembl.org). One of the BACs of the partial contig was localized by fluorescent in situ hybridization to canine chromosome 4q22, in agreement with the dog genome sequence. Two highly informative polymorphic microsatellite markers in intron 7 of the SGCD gene were identified. In 25 DCM-affected and 13 non DCM-affected dogs seven different haplotypes could be distinguished. However, no association between any of the SGCD variants and the disease locus was apparent.

Predicting discovery rates of genomic features.

PubMed

Gravel, Simon

2014-06-01

Successful sequencing experiments require judicious sample selection. However, this selection must often be performed on the basis of limited preliminary data. Predicting the statistical properties of the final sample based on preliminary data can be challenging, because numerous uncertain model assumptions may be involved. Here, we ask whether we can predict "omics" variation across many samples by sequencing only a fraction of them. In the infinite-genome limit, we find that a pilot study sequencing 5% of a population is sufficient to predict the number of genetic variants in the entire population within 6% of the correct value, using an estimator agnostic to demography, selection, or population structure. To reach similar accuracy in a finite genome with millions of polymorphisms, the pilot study would require ∼15% of the population. We present computationally efficient jackknife and linear programming methods that exhibit substantially less bias than the state of the art when applied to simulated data and subsampled 1000 Genomes Project data. Extrapolating based on the National Heart, Lung, and Blood Institute Exome Sequencing Project data, we predict that 7.2% of sites in the capture region would be variable in a sample of 50,000 African Americans and 8.8% in a European sample of equal size. Finally, we show how the linear programming method can also predict discovery rates of various genomic features, such as the number of transcription factor binding sites across different cell types. Copyright © 2014 by the Genetics Society of America.

Co1 DNA supports conspecificity of Geomyphilus pierai and G. barrerai (Coleoptera, Scarabaeidae, Aphodiinae) and is a good marker for their phylogeographic investigation in Mexican mountains

PubMed Central

Arriaga-Jiménez, Alfonsina; Roy, Lise

2015-01-01

Abstract Members of Geomyphilus are associated with rodent burrows, such as pocket gophers and prairie dogs. In Mexico, they are found in the mountains of the Mexican Volcanic Belt and in Sierra Madre Oriental. Our study aims to initiate the exploration of the dispersal modes of Geomyphilus pierai and Geomyphilus barrerai from burrows of pocket gophers. In order to estimate the dispersal scale of the beetles, the utility of mitochondrial and nuclear molecular markers for studying the phylogeographic structure of this complex of species (Geomyphilus pierai and Geomyphilus barrerai) was tested from 49 beetle individuals. High intraspecific and intra-mountain nucleotidic diversity was captured from this sample using Co1 mitochondrial sequences, whilst the ITS2 nuclear ribosomal sequence did not allow observing informative variation. Mitochondrial phylogenetic analysis revealed that the specific delineation between the two species under study was doubtful. In this preliminary study, Co1 was shown to be a good marker for elucidating dispersal routes of the burrowing rodent-associated beetles. PMID:26257561

A novel approach on accelerated ageing towards reliability optimization of high concentration photovoltaic cells

NASA Astrophysics Data System (ADS)

Tsanakas, John A.; Jaffre, Damien; Sicre, Mathieu; Elouamari, Rachid; Vossier, Alexis; de Salins, Jean-Edouard; Bechou, Laurent; Levrier, Bruno; Perona, Arnaud; Dollet, Alain

2014-09-01

This paper presents a preliminary study upon a novel approach proposed for highly accelerated ageing and reliability optimization of high concentrating photovoltaic (HCPV) cells and assemblies. The intended approach aims to overcome several limitations of some current accelerated ageing tests (AAT) adopted up today, proposing the use of an alternative experimental set-up for performing faster and more realistic thermal cycles, under real sun, without the involvement of environmental chamber. The study also includes specific characterization techniques, before and after each AAT sequence, which respectively provide the initial and final diagnosis on the condition of the tested sample. The acquired data from these diagnostic/characterization methods are then used as indices to determine both quantitatively and qualitatively the severity of degradation and, thus, the ageing level for each tested HCPV assembly or cell sample. Ultimate goal of such "initial diagnosis - AAT - final diagnosis" sequences is to provide the basis for a future work on the reliability analysis of the main degradation mechanisms and confident prediction of failure propagation in HCPV cells, by means of acceleration factor (AF) and mean-time-to-failure (MTTF) estimations.

Climate Change Effects on Stream and River Biological Indicators: A Preliminary Analysis (Final Report)

EPA Science Inventory

EPA announced the availability of the final report,Climate Change Effects on Stream and River Biological Indicators: A Preliminary Analysis. This report is a preliminary assessment that describes how biological indicators are likely to respond to climate change, how wel...

Feasibility and systems definition study for microwave multi-application payload (MMAP)

NASA Technical Reports Server (NTRS)

Horton, J. B.; Allen, C. C.; Massaro, M. J.; Zemany, J. L.; Murrell, J. W.; Stanhouse, R. W.; Condon, G. P.; Stone, R. F.

1977-01-01

There were three Shuttle/Spacelab experiments: adaptive multibeam phased array antenna (AMPA) experiment, electromagnetic environment experiment (EEE), and millimeter wave communications experiment (MWCE). Work on the AMPA experiment was completed. Results included are definition of operating modes, sequence of operation, radii of operation about several ground stations, signal format, foot prints of typical orbits and preliminary definition of ground and user terminals. Definition of the MOD I EEE included conceptual hardware designs, spacelab interfaces, preliminary data handling methods, experiment tests and verification, and EMC studies. The MWCE was defined conceptually for a steerable high gain antenna.

Empirical transfer functions for stations in the Central California seismological network

USGS Publications Warehouse

Bakun, W.H.; Dratler, Jay

1976-01-01

A sequence of calibration signals composed of a station identification code, a transient from the release of the seismometer mass at rest from a known displacement from the equilibrium position, and a transient from a known step in voltage to the amplifier input are generated by the automatic daily calibration system (ADCS) now operational in the U.S. Geological Survey central California seismographic network. Documentation of a sequence of interactive programs to compute, from the calibration data, the complex transfer functions for the seismographic system (ground motion through digitizer) the electronics (amplifier through digitizer), and the seismometer alone are presented. The analysis utilizes the Fourier transform technique originally suggested by Espinosa et al (1962). Section I is a general description of seismographic calibration. Section II contrasts the 'Fourier transform' and the 'least-squares' techniques for analyzing transient calibration signals. Theoretical consideration for the Fourier transform technique used here are described in Section III. Section IV is a detailed description of the sequence of calibration signals generated by the ADCS. Section V is a brief 'cookbook description' of the calibration programs; Section VI contains a detailed sample program execution. Section VII suggests the uses of the resultant empirical transfer functions. Supplemental interactive programs by which smooth response functions, suitable for reducing seismic data to ground motion, are also documented in Section VII. Appendices A and B contain complete listings of the Fortran source Codes while Appendix C is an update containing preliminary results obtained from an analysis of some of the calibration signals from stations in the seismographic network near Oroville, California.

Integration of Lupinus angustifolius L. (narrow-leafed lupin) genome maps and comparative mapping within legumes.

PubMed

Wyrwa, Katarzyna; Książkiewicz, Michał; Szczepaniak, Anna; Susek, Karolina; Podkowiński, Jan; Naganowska, Barbara

2016-09-01

Narrow-leafed lupin (Lupinus angustifolius L.) has recently been considered a reference genome for the Lupinus genus. In the present work, genetic and cytogenetic maps of L. angustifolius were supplemented with 30 new molecular markers representing lupin genome regions, harboring genes involved in nitrogen fixation during the symbiotic interaction of legumes and soil bacteria (Rhizobiaceae). Our studies resulted in the precise localization of bacterial artificial chromosomes (BACs) carrying sequence variants for early nodulin 40, nodulin 26, nodulin 45, aspartate aminotransferase P2, asparagine synthetase, cytosolic glutamine synthetase, and phosphoenolpyruvate carboxylase. Together with previously mapped chromosomes, the integrated L. angustifolius map encompasses 73 chromosome markers, including 5S ribosomal DNA (rDNA) and 45S rDNA, and anchors 20 L. angustifolius linkage groups to corresponding chromosomes. Chromosomal identification using BAC fluorescence in situ hybridization identified two BAC clones as narrow-leafed lupin centromere-specific markers, which served as templates for preliminary studies of centromere composition within the genus. Bioinformatic analysis of these two BACs revealed that centromeric/pericentromeric regions of narrow-leafed lupin chromosomes consisted of simple sequence repeats ordered into tandem repeats containing the trinucleotide and pentanucleotide simple sequence repeats AGG and GATAC, structured into long arrays. Moreover, cross-genus microsynteny analysis revealed syntenic patterns of 31 single-locus BAC clones among several legume species. The gene and chromosome level findings provide evidence of ancient duplication events that must have occurred very early in the divergence of papilionoid lineages. This work provides a strong foundation for future comparative mapping among legumes and may facilitate understanding of mechanisms involved in shaping legume chromosomes.

[Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

PubMed

Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

2007-07-01

To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

Next-generation Sequencing (NGS) Analysis on Single Circulating Tumor Cells (CTCs) with No Need of Whole-genome Amplification (WGA).

PubMed

Palmirotta, Raffaele; Lovero, Domenica; Silvestris, Erica; Felici, Claudia; Quaresmini, Davide; Cafforio, Paola; Silvestris, Franco

2017-01-01

Isolation and genotyping of circulating tumor cells (CTCs) is gaining an increasing interest by clinical researchers in oncology not only for investigative purposes, but also for concrete application in clinical practice in terms of diagnosis, prognosis and decision treatment with targeted therapies. For the mutational analysis of single CTCs, the most advanced biotechnology methodology currently available includes the combination of whole genome amplification (WGA) followed by next-generation sequencing (NGS). However, the sequence of these molecular techniques is time-consuming and may also favor operator-dependent errors, related to the procedures themselves that, as in the case of the WGA technique, might affect downstream molecular analyses. A preliminary approach of molecular analysis by NGS on a model of CTCs without previous WGA procedural step was performed. We set-up an artificial sample obtained by spiking the SK-MEL-28 melanoma cell line in normal donor peripheral whole blood. Melanoma cells were first enriched using an AutoMACS® (Miltenyi) cell separator and then isolated as single and pooled CTCs by DEPArray™ System (Silicon Biosystems). NGS analysis, using the Ion AmpliSeq™ Cancer Hotspot Panel v2 (Life Technologies) with the Ion Torrent PGM™ system (Life Technologies), was performed on the SK-MEL-28 cell pellet, a single CTC previously processed with WGA and on 1, 2, 4 and 8 recovered CTCs without WGA pre-amplification. NGS directly carried out on CTCs without WGA showed the same mutations identified in SK-MEL-28 cell line pellet, with a considerable efficiency and avoiding the errors induced by the WGA procedure. We identified a cost-effective, time-saving and reliable methodological approach that could improve the analytical accuracy of the liquid biopsy and appears promising in studying CTCs from cancer patients for both research and clinical purposes. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Mel-36 – preliminary description of a new morel species

USDA-ARS?s Scientific Manuscript database

A pilot survey of true morels (Morchella) of Newfoundland and Labrador (NL), employing phylogenetic analyses of multilocus DNA sequence data, resulted in the discovery of a novel species that is currently only known from NL and New Brunswick. This unnamed species was informally designated Morchella ...

NUCLEAR SCIENCE, AN INTRODUCTORY COURSE.

ERIC Educational Resources Information Center

SULCOSKI, JOHN W.

THIS CURRICULUM GUIDE DESCRIBES A TWELFTH-GRADE INTERDISCIPLINARY, INTRODUCTORY NUCLEAR SCIENCE COURSE. IT IS BELIEVED TO FILL THE NEED FOR AN ADVANCED COURSE THAT IS TIMELY, CHALLENGING, AND APPROPRIATE AS A SEQUENTIAL ADDITION TO THE BIOLOGY-CHEMISTRY-PHYSICS SEQUENCE. PRELIMINARY INFORMATION COVERS SUCH MATTERS AS (1) RADIOISOTOPE WORK AREAS,…

Mesozoic clay diagenesis in the Appalachian Plateau

NASA Astrophysics Data System (ADS)

Boles, A.; Mulch, A.; van der Pluijm, B.

2017-12-01

Integrated investigation of authigenic clays in the Appalachian Plateau of the northeastern US Midcontinent using X-ray goniometry, Rietveld-method based illite polytype analysis, and 40Ar/39Ar geochronology yields novel insights about the structural diagenetic history of the North American sedimentary cover sequence. Texture analysis by High Resolution X-ray Texture Goniometry records the presence of a bedding-parallel diagenetic fabric, corresponding to a burial depth of 2-5 km. New development of polytype modeling using BGMN®, a quantitative X-ray powder diffraction forward modeling and whole-pattern matching program matches mineralic characteristic of illite at those depths and reduces uncertainty estimates in age analysis. Based on dating size fractions, the diagenetic age is constrained to 225-250 Ma (Triassic) by four authigenic illite samples, reflecting protracted, regional diagenesis in the area. Preliminary H isotopic analysis points to a surface-derived diagenetic fluid with δD values ranging from -48 to -72‰ (in the range of predicted Pangea meteoric fluid), with a dependence on proximity to the Appalachian Mountains that may reflect a rain shadow effect.

2b-RAD genotyping for population genomic studies of Chagas disease vectors: Rhodnius ecuadoriensis in Ecuador.

PubMed

Hernandez-Castro, Luis E; Paterno, Marta; Villacís, Anita G; Andersson, Björn; Costales, Jaime A; De Noia, Michele; Ocaña-Mayorga, Sofía; Yumiseva, Cesar A; Grijalva, Mario J; Llewellyn, Martin S

2017-07-01

Rhodnius ecuadoriensis is the main triatomine vector of Chagas disease, American trypanosomiasis, in Southern Ecuador and Northern Peru. Genomic approaches and next generation sequencing technologies have become powerful tools for investigating population diversity and structure which is a key consideration for vector control. Here we assess the effectiveness of three different 2b restriction site-associated DNA (2b-RAD) genotyping strategies in R. ecuadoriensis to provide sufficient genomic resolution to tease apart microevolutionary processes and undertake some pilot population genomic analyses. The 2b-RAD protocol was carried out in-house at a non-specialized laboratory using 20 R. ecuadoriensis adults collected from the central coast and southern Andean region of Ecuador, from June 2006 to July 2013. 2b-RAD sequencing data was performed on an Illumina MiSeq instrument and analyzed with the STACKS de novo pipeline for loci assembly and Single Nucleotide Polymorphism (SNP) discovery. Preliminary population genomic analyses (global AMOVA and Bayesian clustering) were implemented. Our results showed that the 2b-RAD genotyping protocol is effective for R. ecuadoriensis and likely for other triatomine species. However, only BcgI and CspCI restriction enzymes provided a number of markers suitable for population genomic analysis at the read depth we generated. Our preliminary genomic analyses detected a signal of genetic structuring across the study area. Our findings suggest that 2b-RAD genotyping is both a cost effective and methodologically simple approach for generating high resolution genomic data for Chagas disease vectors with the power to distinguish between different vector populations at epidemiologically relevant scales. As such, 2b-RAD represents a powerful tool in the hands of medical entomologists with limited access to specialized molecular biological equipment.

2b-RAD genotyping for population genomic studies of Chagas disease vectors: Rhodnius ecuadoriensis in Ecuador

PubMed Central

Villacís, Anita G.; Andersson, Björn; Costales, Jaime A.; De Noia, Michele; Ocaña-Mayorga, Sofía; Yumiseva, Cesar A.; Grijalva, Mario J.; Llewellyn, Martin S.

2017-01-01

Background Rhodnius ecuadoriensis is the main triatomine vector of Chagas disease, American trypanosomiasis, in Southern Ecuador and Northern Peru. Genomic approaches and next generation sequencing technologies have become powerful tools for investigating population diversity and structure which is a key consideration for vector control. Here we assess the effectiveness of three different 2b restriction site-associated DNA (2b-RAD) genotyping strategies in R. ecuadoriensis to provide sufficient genomic resolution to tease apart microevolutionary processes and undertake some pilot population genomic analyses. Methodology/Principal findings The 2b-RAD protocol was carried out in-house at a non-specialized laboratory using 20 R. ecuadoriensis adults collected from the central coast and southern Andean region of Ecuador, from June 2006 to July 2013. 2b-RAD sequencing data was performed on an Illumina MiSeq instrument and analyzed with the STACKS de novo pipeline for loci assembly and Single Nucleotide Polymorphism (SNP) discovery. Preliminary population genomic analyses (global AMOVA and Bayesian clustering) were implemented. Our results showed that the 2b-RAD genotyping protocol is effective for R. ecuadoriensis and likely for other triatomine species. However, only BcgI and CspCI restriction enzymes provided a number of markers suitable for population genomic analysis at the read depth we generated. Our preliminary genomic analyses detected a signal of genetic structuring across the study area. Conclusions/Significance Our findings suggest that 2b-RAD genotyping is both a cost effective and methodologically simple approach for generating high resolution genomic data for Chagas disease vectors with the power to distinguish between different vector populations at epidemiologically relevant scales. As such, 2b-RAD represents a powerful tool in the hands of medical entomologists with limited access to specialized molecular biological equipment. PMID:28723901

Preliminary body-wave analysis of the St. Elias, Alaska, earthquake of February 28, 1979

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boatwright, J.

1980-04-01

Employing a new technique for the body-wave analysis of shallow-focus earthquakes, we have made a preliminary analysis of the St. Elias, Alaska, earthquake of February 28, 1979, using five long-period P and S waves recorded at three WWSSN stations and at Palisades, New York. Using a well determined focal mechanism and an average source depth of approx. = 11 km, the interference of the depth phases (i.e., pP and sP, or sS) has been deconvolved from the recorded pulse shapes to obtain velocity and displacement pulse shapes as they would appear if the earthquake had occurred within an infinite medium.more » These approximate whole space pulse shapes indicate that the rupture contained three distinct subevents as well as a small initial event which preceded this subevent sequence by about 7 sec. From the pulse rise times of the subevents, their rupture lengths are estimated as 12, 27, and 17 km, assuming that the subevent rupture velocity was 3 km/sec. Overall, the earthquake ruptured approx. = 60 km to the southeast with an average rupture velocity of 2.2 km/sec. The cumulative body-wave moment for the whole event, 1.2 x 10/sup 27/ dyne-cm, is substantially smaller than the surface-wave moments reported by Lahr et al. (1979) of 5 x 10/sup 27/ dyne-cm. The moments of the subevents are estimated to be 0.6, 3.2, and 7.5 x 10/sup 26/ dyne-cm, respectively.« less

Molecular Signatures of Microbial Metabolism in an Actively Growing, Silicified, Microbial Structure from Yellowstone National Park

NASA Astrophysics Data System (ADS)

Ferreira, M.; Creveling, J.; Hilburn, I.; Karlsson, E.; Pepe-Ranney, C.; Spear, J.; Dawson, S.; Geobio2008, I.

2008-12-01

Silicified structures that exhibit a putative biologic component in their formation permeate the rock record as stromatolites. We have studied a silicified microbial structure from a hot spring in Yellowstone National Park using phenotypic, phylogenetic, and metagenomic analyses to determine microbial carbon metabolic pathways and the phylogenetic affiliations of microbes present in this unique structure. In this multi-faceted approach, dominant physiologies, specifically with regards to anaerobic and aerobic metabolisms, were inferred from 16S rRNA gene sequences and 454 sequencing data from bulk DNA samples of the structure. Carbon utilization as indicated by ECO Biolog plates showed abundant heterotrophy and heterotrophic diversity throughout the microbial structure. Microbes within the structure are able to utilize all tested sources of carbohydrates, lipids/fatty acids, and protein/amino acids as carbon sources. ECO plate testing of the hot spring water yielded considerable less carbohydrate consumption (only 4 out of 13 tested carbohydrates) and similar lipids/fatty acids and protein/amino acids consumption (2 out of 3 and 5 out of 5 tested sources respectively). Full length 16S rRNA gene sequences and metagenomic 454 pyrosequencing of community DNA showed limited diversity among primary producers. From the 16S data, the majority of the autotrophs are inferred to utilize the Calvin cycle for CO2 fixation, followed by 3-hydroxypropionate/4- hydroxybutyrate CO2 fixation. However, an analysis of the metagenomic data compared to the KEGG database does not show genes directly involved with Calvin cycle carbon fixation. Further BLAST searches of our data failed to find significant matches within our 6514 metagenomic sequences to known RuBisCo sequences taken from the NCBI database. This is likely due to a far under-sampled dataset of metagenomic sequences, and the low number (958) that had matches to the KEGG pathways database. Anaerobic versus aerobic physiology also can be estimated from the 16S clone libraries. Phylogenetic analysis of recovered 16S sequences suggests that 15% of the 16S sequences can be attributed to anaerobic microbes while 42% likely come from aerobes. The remaining 43% of 16S rRNA gene sequences belong to metabolically unassigned phyla both known and novel. This preliminary study demonstrates that the small spatially stratified silicified microbial structure present on the margins of a hot spring contains a rich and complex microbial community with different trophic levels and enzymatic pathways.

76 FR 43298 - Building Energy Standards Program: Preliminary Determination Regarding Energy Efficiency...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-20

... Methodology II. Summary of the Comparative Analysis A. Qualitative Analysis 1. Discussion of Detailed Textual... used for this preliminary determination. II. Summary of the Comparative Analysis DOE carried out both a...

The surface glycoprotein of a natural feline leukemia virus subgroup A variant, FeLV-945, as a determinant of disease outcome.

PubMed

Bolin, Lisa L; Ahmad, Shamim; Levy, Laura S

2011-10-15

Feline leukemia virus (FeLV) is a natural retrovirus of domestic cats associated with degenerative, proliferative and malignant diseases. Studies of FeLV infection in a cohort of naturally infected cats were undertaken to examine FeLV variation, the selective pressures operative in FeLV infection that lead to predominance of natural variants, and the consequences for infection and disease progression. A unique variant, designated FeLV-945, was identified as the predominant isolate in the cohort and was associated with non-T-cell diseases including multicentric lymphoma. FeLV-945 was assigned to the FeLV-A subgroup based on sequence analysis and receptor utilization, but was shown to differ in sequence from a prototype member of FeLV-A, designated FeLV-A/61E, in the long terminal repeat (LTR) and the surface glycoprotein gene (SU). A unique sequence motif in the FeLV-945 LTR was shown to function as a transcriptional enhancer and to confer a replicative advantage. The FeLV-945 SU protein was observed to differ in sequence as compared to FeLV-A/61E within functional domains known to determine receptor selection and binding. Experimental infection of newborn cats was performed using wild type FeLV-A/61E or recombinant FeLV-A/61E in which the LTR (61E/945L) or LTR and SU (61E/945SL) were exchanged for that of FeLV-945. Infection with either FeLV-A/61E or 61E/945L resulted in T-cell lymphoma of the thymus, although 61E/945L caused disease significantly more rapidly. In contrast, infection with 61E/945SL resulted in the rapid induction of a multicentric lymphoma of B-cell origin, thus recapitulating the outcome of natural infection and implicating FeLV-945 SU as a determinant of disease outcome. Recombinant FeLV-B was detected infrequently and at low levels in multicentric lymphomas, and was thereby not implicated in disease induction. Preliminary studies of receptor interaction indicated that virus particles bearing FeLV-945 SU bind to the FeLV-A receptor more efficiently than do particles bearing FeLV-A/61E SU, and that soluble SU proteins expressed from the viruses demonstrate the same differential binding phenotype. Preliminary mutational analysis of FeLV-945 was performed by exchanging regions containing either the primary receptor binding determinant, VRA, the secondary determinant, VRB, or a proline-rich region, PRR, with that of FeLV-A/61E. Results implicated a region containing VRA as a minor contributor, while a region containing VRB largely conferred increased binding efficiency. Copyright © 2011 Elsevier B.V. All rights reserved.

Purification, characterization and preliminary crystallographic studies of a PR-10 protein from Pachyrrhizus erosus seeds.

PubMed

Wu, Fang; Li, Yikun; Chang, Shaojie; Zhou, Zhaocai; Wang, Fang; Song, Xiaomin; Lin, Yujuan; Gong, Weimin

2002-12-01

A 16 kDa protein SPE16 was purified from the seeds of Pachyrrhizus erosus. Its N-terminal amino-acid sequence showed significant sequence homology to pathogenesis-related proteins from the PR-10 family. An activity assay indicated that SPE16 possesses ribonuclease activity as do some other PR-10 proteins. SPE16 crystals were obtained by the hanging-drop vapour-diffusion method. The space group is P2(1)2(1)2(1), with unit-cell parameters a = 53.36, b = 63.70, c = 72.96 A.

Pediatric Neurosurgery Patients Need More than a Pediatric Neurosurgeon. Part II. A Clinical Report: In the USA Lack of Parent/Caregiver Compliance Interferes with the Patient Care Sequence.

PubMed

MacGregor, Teresa L; James, Hector E; Everett, Laurel; Childers, David O

2016-01-01

We have previously reported on the initiation, development, and preliminary results of a comprehensive multidisciplinary team for the long-term management of children with neurosurgical conditions other than spina bifida. This report addresses the follow-up of the care of these patients and identifies limitations in the care sequence including, but not limited to, lack of parental/caregiver compliance, unmet educational needs, and medical insurance issues. © 2016 S. Karger AG, Basel.

Comparison of corrosion scales in full and partially replaced lead service lines after changes in water quality

EPA Science Inventory

Preliminary results from scales formed 38 weeks following the LSL replacement simulations revealed differences in scale formations amongst varying water qualities and pipe sequence. Rigs fed with dechlorinated tap water show distinct pH gradients between the galvanic and the back...

Preliminary geologic map of the Wadi As Sirhan Quadrangle, sheet 30C, Kingdom of Saudi Arabia

USGS Publications Warehouse

Meissner, C.R.; Griffin, M.B.; Riddler, G.P.; Van Eck, Marcel; Aspinall, N.C.; Farasani, A.M.; Dini, S.M.

1990-01-01

Several deep drill holes in the Wadi as Sirhan depression have penetrated thick sequences of marine rocks that are potential sources of oil and gas. Geological and geophysical conditions are favorable for the accumulation of hydrocarbons, and additional exploration is recommended.

High density bit transition requirements versus the effects on BCH error correcting code. [bit synchronization

NASA Technical Reports Server (NTRS)

Ingels, F. M.; Schoggen, W. O.

1982-01-01

The design to achieve the required bit transition density for the Space Shuttle high rate multiplexes (HRM) data stream of the Space Laboratory Vehicle is reviewed. It contained a recommended circuit approach, specified the pseudo random (PN) sequence to be used and detailed the properties of the sequence. Calculations showing the probability of failing to meet the required transition density were included. A computer simulation of the data stream and PN cover sequence was provided. All worst case situations were simulated and the bit transition density exceeded that required. The Preliminary Design Review and the critical Design Review are documented. The Cover Sequence Generator (CSG) Encoder/Decoder design was constructed and demonstrated. The demonstrations were successful. All HRM and HRDM units incorporate the CSG encoder or CSG decoder as appropriate.

Hydrothermal Liquefaction Treatment Preliminary Hazard Analysis Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowry, Peter P.; Wagner, Katie A.

A preliminary hazard assessment was completed during February 2015 to evaluate the conceptual design of the modular hydrothermal liquefaction treatment system. The hazard assessment was performed in 2 stages. An initial assessment utilizing Hazard Identification and Preliminary Hazards Analysis (PHA) techniques identified areas with significant or unique hazards (process safety-related hazards) that fall outside of the normal operating envelope of PNNL and warranted additional analysis. The subsequent assessment was based on a qualitative What-If analysis. This analysis was augmented, as necessary, by additional quantitative analysis for scenarios involving a release of hazardous material or energy with the potential for affectingmore » the public.« less

Preliminary design package for prototype solar heating system

NASA Technical Reports Server (NTRS)

1978-01-01

A summary is given of the preliminary analysis and design activity on solar heating systems. The analysis was made without site specific data other than weather; therefore, the results indicate performance expected under these special conditions. Major items include system candidates, design approaches, trade studies and other special data required to evaluate the preliminary analysis and design. The program calls for the development and delivery of eight prototype solar heating and cooling systems for installation and operational test.

Two approaches to biological decontamination of groundwater and soil polluted by aromatics-characterization of microbial populations.

PubMed

Demnerová, Katerina; Mackova, Martina; Spevákova, Veronika; Beranova, Katarina; Kochánková, Lucie; Lovecká, Petra; Ryslavá, Edita; Macek, Tomas

2005-09-01

As part of the EU project MULTIBARRIERS, six new endogenous aerobic bacterial isolates able to grow in the presence of BTmX (benzene, toluene, m-xylene) were characterized with respect to their growth specificities. Preliminary analysis included restriction fragment length polymorphism profiles and 16S rDNA sequencing. The diversity of these strains was confirmed by denaturing gradient gel electrophoresis. Additional aerobic bacterial strains were isolated from the rhizospheres of plants grown in polychlorinated biphenyl (PCB)-contaminated soils. Pot experiments were designed to show the beneficial effect of plants on the bacterial degradation of PCBs. The effect of PCB removal from soil was evaluated and bacteria isolated from three different plant species were examined for the presence of the bph operon.

Preliminary crystallographic analysis of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-[beta] receptor promoter DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agarkar, Vinod B.; Babayeva, Nigar D.; Rizzino, Angie

2010-10-08

Ets proteins are transcription factors that activate or repress the expression of genes that are involved in various biological processes, including cellular proliferation, differentiation, development, transformation and apoptosis. Like other Ets-family members, Elf3 functions as a sequence-specific DNA-binding transcriptional factor. A mouse Elf3 C-terminal fragment (amino-acid residues 269-371) containing the DNA-binding domain has been crystallized in complex with mouse type II TGF-{beta} receptor promoter (TR-II) DNA. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 42.66, b = 52, c = 99.78 {angstrom}, and diffracted to a resolution of 2.2 {angstrom}.

Application of optimal control principles to describe the supervisory control behavior of AAA crew members

NASA Technical Reports Server (NTRS)

Hale, C.; Valentino, G. J.

1982-01-01

Supervisory decision making and control behavior within a C(3) oriented, ground based weapon system is being studied. The program involves empirical investigation of the sequence of control strategies used during engagement of aircraft targets. An engagement is conceptually divided into several stages which include initial information processing activity, tracking, and ongoing adaptive control decisions. Following a brief description of model parameters, two experiments which served as initial investigation into the accuracy of assumptions regarding the importance of situation assessment in procedure selection are outlined. Preliminary analysis of the results upheld the validity of the assumptions regarding strategic information processing and cue-criterion relationship learning. These results indicate that this model structure should be useful in studies of supervisory decision behavior.

Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection.

PubMed

Fadda, M E; Pisano, M B; Scaccabarozzi, L; Mossa, V; Deplano, M; Moroni, P; Liciardi, M; Cosentino, S

2013-01-01

This study reports a rapid PCR-based technique using a one-enzyme RFLP for discrimination of yeasts isolated from bovine clinical and subclinical mastitis milk samples. We analyzed a total of 1,486 milk samples collected over 1 yr in south Sardinia and northern Italy, and 142 yeast strains were preliminarily grouped based on their cultural morphology and physiological characteristics. Assimilation tests were conducted using the identification kit API ID 32C and APILAB Plus software (bioMérieux, Marcy l'Etoile, France). For PCR-RFLP analysis, the 18S-ITS1-5.8S ribosomal(r)DNA region was amplified and then digested with HaeIII, and dendrogram analysis of RFLP fragments was carried out. Furthermore, within each of the groups identified by the API or PCR-RFLP methods, the identification of isolates was confirmed by sequencing of the D1/D2 region using an ABI Prism 310 automatic sequencer (Applied Biosystems, Foster City, CA). The combined phenotypic and molecular approach enabled the identification of 17 yeast species belonging to the genera Candida (47.9%), Cryptococcus (21.1%), Trichosporon (19.7%), Geotrichum (7.1%), and Rhodotorula (4.2%). All Candida species were correctly identified by the API test and their identification confirmed by sequencing. All strains identified with the API system as Geotrichum candidum, Cryptococcus uniguttulatus, and Rhodotorula glutinis also produced characteristic restriction patterns and were confirmed as Galactomyces geotrichum (a teleomorph of G. candidum), Filobasidium uniguttulatum (teleomorph of Crypt. uniguttulatus), and R. glutinis, respectively, by D1/D2 rDNA sequencing. With regard to the genus Trichosporon, preliminary identification by API was problematic, whereas the RFLP technique used in this study gave characteristic restriction profiles for each species. Moreover, sequencing of the D1/D2 region allowed not only successful identification of Trichosporon gracile where API could not, but also correct identification of misidentified isolates. In conclusion, the 18S-ITS1-5.8S region appears to be useful in detecting genetic variability among yeast species, which is valuable for taxonomic purposes and for species identification. We have established an RFLP database for yeast species identified in milk samples using the software GelCompar II and the RFLP database constitutes an initial method for veterinary yeast identification. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Uncertainties in Eddy Covariance fluxes due to post-field data processing: a multi-site, full factorial analysis

NASA Astrophysics Data System (ADS)

Sabbatini, S.; Fratini, G.; Arriga, N.; Papale, D.

2012-04-01

Eddy Covariance (EC) is the only technologically available direct method to measure carbon and energy fluxes between ecosystems and atmosphere. However, uncertainties related to this method have not been exhaustively assessed yet, including those deriving from post-field data processing. The latter arise because there is no exact processing sequence established for any given situation, and the sequence itself is long and complex, with many processing steps and options available. However, the consistency and inter-comparability of flux estimates may be largely affected by the adoption of different processing sequences. The goal of our work is to quantify the uncertainty introduced in each processing step by the fact that different options are available, and to study how the overall uncertainty propagates throughout the processing sequence. We propose an easy-to-use methodology to assign a confidence level to the calculated fluxes of energy and mass, based on the adopted processing sequence, and on available information such as the EC system type (e.g. open vs. closed path), the climate and the ecosystem type. The proposed methodology synthesizes the results of a massive full-factorial experiment. We use one year of raw data from 15 European flux stations and process them so as to cover all possible combinations of the available options across a selection of the most relevant processing steps. The 15 sites have been selected to be representative of different ecosystems (forests, croplands and grasslands), climates (mediterranean, nordic, arid and humid) and instrumental setup (e.g. open vs. closed path). The software used for this analysis is EddyPro™ 3.0 (www.licor.com/eddypro). The critical processing steps, selected on the basis of the different options commonly used in the FLUXNET community, are: angle of attack correction; coordinate rotation; trend removal; time lag compensation; low- and high- frequency spectral correction; correction for air density fluctuations; and length of the flux averaging interval. We illustrate the results of the full-factorial combination relative to a subset of the selected sites with particular emphasis on the total uncertainty at different time scales and aggregations, as well as a preliminary analysis of the most critical steps for their contribution to the total uncertainties and their potential relation with site set-up characteristics and ecosystem type.

Use of transcriptome sequencing to understand the pistillate flowering in hickory (Carya cathayensis Sarg.).

PubMed

Huang, You-Jun; Liu, Li-Li; Huang, Jian-Qin; Wang, Zheng-Jia; Chen, Fang-Fang; Zhang, Qi-Xiang; Zheng, Bing-Song; Chen, Ming

2013-10-10

Different from herbaceous plants, the woody plants undergo a long-period vegetative stage to achieve floral transition. They then turn into seasonal plants, flowering annually. In this study, a preliminary model of gene regulations for seasonal pistillate flowering in hickory (Carya cathayensis) was proposed. The genome-wide dynamic transcriptome was characterized via the joint-approach of RNA sequencing and microarray analysis. Differential transcript abundance analysis uncovered the dynamic transcript abundance patterns of flowering correlated genes and their major functions based on Gene Ontology (GO) analysis. To explore pistillate flowering mechanism in hickory, a comprehensive flowering gene regulatory network based on Arabidopsis thaliana was constructed by additional literature mining. A total of 114 putative flowering or floral genes including 31 with differential transcript abundance were identified in hickory. The locations, functions and dynamic transcript abundances were analyzed in the gene regulatory networks. A genome-wide co-expression network for the putative flowering or floral genes shows three flowering regulatory modules corresponding to response to light abiotic stimulus, cold stress, and reproductive development process, respectively. Totally 27 potential flowering or floral genes were recruited which are meaningful to understand the hickory specific seasonal flowering mechanism better. Flowering event of pistillate flower bud in hickory is triggered by several pathways synchronously including the photoperiod, autonomous, vernalization, gibberellin, and sucrose pathway. Totally 27 potential flowering or floral genes were recruited from the genome-wide co-expression network function module analysis. Moreover, the analysis provides a potential FLC-like gene based vernalization pathway and an 'AC' model for pistillate flower development in hickory. This work provides an available framework for pistillate flower development in hickory, which is significant for insight into regulation of flowering and floral development of woody plants.

Use of transcriptome sequencing to understand the pistillate flowering in hickory (Carya cathayensis Sarg.)

PubMed Central

2013-01-01

Background Different from herbaceous plants, the woody plants undergo a long-period vegetative stage to achieve floral transition. They then turn into seasonal plants, flowering annually. In this study, a preliminary model of gene regulations for seasonal pistillate flowering in hickory (Carya cathayensis) was proposed. The genome-wide dynamic transcriptome was characterized via the joint-approach of RNA sequencing and microarray analysis. Results Differential transcript abundance analysis uncovered the dynamic transcript abundance patterns of flowering correlated genes and their major functions based on Gene Ontology (GO) analysis. To explore pistillate flowering mechanism in hickory, a comprehensive flowering gene regulatory network based on Arabidopsis thaliana was constructed by additional literature mining. A total of 114 putative flowering or floral genes including 31 with differential transcript abundance were identified in hickory. The locations, functions and dynamic transcript abundances were analyzed in the gene regulatory networks. A genome-wide co-expression network for the putative flowering or floral genes shows three flowering regulatory modules corresponding to response to light abiotic stimulus, cold stress, and reproductive development process, respectively. Totally 27 potential flowering or floral genes were recruited which are meaningful to understand the hickory specific seasonal flowering mechanism better. Conclusions Flowering event of pistillate flower bud in hickory is triggered by several pathways synchronously including the photoperiod, autonomous, vernalization, gibberellin, and sucrose pathway. Totally 27 potential flowering or floral genes were recruited from the genome-wide co-expression network function module analysis. Moreover, the analysis provides a potential FLC-like gene based vernalization pathway and an 'AC’ model for pistillate flower development in hickory. This work provides an available framework for pistillate flower development in hickory, which is significant for insight into regulation of flowering and floral development of woody plants. PMID:24106755

Identification of members of the genera Panaeolus and Psilocybe by a DNA test. A preliminary test for hallucinogenic fungi.

PubMed

Lee, J C; Cole, M; Linacre, A

2000-08-14

Abuse of hallucinogens produced by the fungal genera Psilocybe and Panaeolus are a growing problem. Five species from each of the two genera were examined in this preliminary research and a method that will unambiguously identify fungal samples as being of one of these two genera has been developed. The method uses genus specific DNA sequences within the Internal Transcribed Spacer of the ribosomal gene complex. Amplification of a common DNA product and a genus specific product results in two identifiable products, which facilitates the unambiguous identification of material from these two fungi to generic level.

Brief communication: Co-seismic displacement on 26 and 30 October 2016 (Mw = 5.9 and 6.5) - earthquakes in central Italy from the analysis of a local GNSS network

NASA Astrophysics Data System (ADS)

De Guidi, Giorgio; Vecchio, Alessia; Brighenti, Fabio; Caputo, Riccardo; Carnemolla, Francesco; Di Pietro, Adriano; Lupo, Marco; Maggini, Massimiliano; Marchese, Salvatore; Messina, Danilo; Monaco, Carmelo; Naso, Salvatore

2017-11-01

On 24 August 2016 a strong earthquake (Mw = 6.0) affected central Italy and an intense seismic sequence started. Field observations, DInSAR (Differential INterferometry Synthetic-Aperture Radar) analyses and preliminary focal mechanisms, as well as the distribution of aftershocks, suggested the reactivation of the northern sector of the Laga fault, the southern part of which was already rebooted during the 2009 L'Aquila sequence, and of the southern segment of the Mt Vettore fault system (MVFS). Based on this preliminary information and following the stress-triggering concept (Stein, 1999; Steacy et al., 2005), we tentatively identified a potential fault zone that is very vulnerable to future seismic events just north of the earlier epicentral area. Accordingly, we planned a local geodetic network consisting of five new GNSS (Global Navigation Satellite System) stations located a few kilometres away from both sides of the MVFS. This network was devoted to working out, at least partially but in some detail, the possible northward propagation of the crustal network ruptures. The building of the stations and a first set of measurements were carried out during a first campaign (30 September and 2 October 2016). On 26 October 2016, immediately north of the epicentral area of the 24 August event, another earthquake (Mw = 5.9) occurred, followed 4 days later (30 October) by the main shock (Mw = 6.5) of the whole 2016 summer-autumn seismic sequence. Our local geodetic network was fully affected by the new events and therefore we performed a second campaign soon after (11-13 November 2016). In this brief note, we provide the results of our geodetic measurements that registered the co-seismic and immediately post-seismic deformation of the two major October shocks, documenting in some detail the surface deformation close to the fault trace. We also compare our results with the available surface deformation field of the broader area, obtained on the basis of the DInSAR technique, and show an overall good fit.

Characterization of microflora in Latin-style cheeses by next-generation sequencing technology.

PubMed

Lusk, Tina S; Ottesen, Andrea R; White, James R; Allard, Marc W; Brown, Eric W; Kase, Julie A

2012-11-07

Cheese contamination can occur at numerous stages in the manufacturing process including the use of improperly pasteurized or raw milk. Of concern is the potential contamination by Listeria monocytogenes and other pathogenic bacteria that find the high moisture levels and moderate pH of popular Latin-style cheeses like queso fresco a hospitable environment. In the investigation of a foodborne outbreak, samples typically undergo enrichment in broth for 24 hours followed by selective agar plating to isolate bacterial colonies for confirmatory testing. The broth enrichment step may also enable background microflora to proliferate, which can confound subsequent analysis if not inhibited by effective broth or agar additives. We used 16S rRNA gene sequencing to provide a preliminary survey of bacterial species associated with three brands of Latin-style cheeses after 24-hour broth enrichment. Brand A showed a greater diversity than the other two cheese brands (Brands B and C) at nearly every taxonomic level except phylum. Brand B showed the least diversity and was dominated by a single bacterial taxon, Exiguobacterium, not previously reported in cheese. This genus was also found in Brand C, although Lactococcus was prominent, an expected finding since this bacteria belongs to the group of lactic acid bacteria (LAB) commonly found in fermented foods. The contrasting diversity observed in Latin-style cheese was surprising, demonstrating that despite similarity of cheese type, raw materials and cheese making conditions appear to play a critical role in the microflora composition of the final product. The high bacterial diversity associated with Brand A suggests it may have been prepared with raw materials of high bacterial diversity or influenced by the ecology of the processing environment. Additionally, the presence of Exiguobacterium in high proportions (96%) in Brand B and, to a lesser extent, Brand C (46%), may have been influenced by the enrichment process. This study is the first to define Latin-style cheese microflora using Next-Generation Sequencing. These valuable preliminary data will direct selective tailoring of agar formulations to improve culture-based detection of pathogens in Latin-style cheese.

Characterization of microflora in Latin-style cheeses by next-generation sequencing technology

PubMed Central

2012-01-01

Background Cheese contamination can occur at numerous stages in the manufacturing process including the use of improperly pasteurized or raw milk. Of concern is the potential contamination by Listeria monocytogenes and other pathogenic bacteria that find the high moisture levels and moderate pH of popular Latin-style cheeses like queso fresco a hospitable environment. In the investigation of a foodborne outbreak, samples typically undergo enrichment in broth for 24 hours followed by selective agar plating to isolate bacterial colonies for confirmatory testing. The broth enrichment step may also enable background microflora to proliferate, which can confound subsequent analysis if not inhibited by effective broth or agar additives. We used 16S rRNA gene sequencing to provide a preliminary survey of bacterial species associated with three brands of Latin-style cheeses after 24-hour broth enrichment. Results Brand A showed a greater diversity than the other two cheese brands (Brands B and C) at nearly every taxonomic level except phylum. Brand B showed the least diversity and was dominated by a single bacterial taxon, Exiguobacterium, not previously reported in cheese. This genus was also found in Brand C, although Lactococcus was prominent, an expected finding since this bacteria belongs to the group of lactic acid bacteria (LAB) commonly found in fermented foods. Conclusions The contrasting diversity observed in Latin-style cheese was surprising, demonstrating that despite similarity of cheese type, raw materials and cheese making conditions appear to play a critical role in the microflora composition of the final product. The high bacterial diversity associated with Brand A suggests it may have been prepared with raw materials of high bacterial diversity or influenced by the ecology of the processing environment. Additionally, the presence of Exiguobacterium in high proportions (96%) in Brand B and, to a lesser extent, Brand C (46%), may have been influenced by the enrichment process. This study is the first to define Latin-style cheese microflora using Next-Generation Sequencing. These valuable preliminary data will direct selective tailoring of agar formulations to improve culture-based detection of pathogens in Latin-style cheese. PMID:23134566

Substitute CT generation from a single ultra short time echo MRI sequence: preliminary study

NASA Astrophysics Data System (ADS)

Ghose, Soumya; Dowling, Jason A.; Rai, Robba; Liney, Gary P.

2017-04-01

In MR guided radiation therapy planning both MR and CT images for a patient are acquired and co-registered to obtain a tissue specific HU map. Generation of the HU map directly from the MRI would eliminate the CT acquisition and may improve radiation therapy planning. In this preliminary study of substitute CT (sCT) generation, two porcine leg phantoms were scanned using a 3D ultrashort echo time (PETRA) sequence and co-registered to corresponding CT images to build tissue specific regression models. The model was created from one co-registered CT-PETRA pair to generate the sCT for the other PETRA image. An expectation maximization based clustering was performed on the co-registered PETRA image to identify the soft tissues, dense bone and air class membership probabilities. A tissue specific non linear regression model was built from one registered CT-PETRA pair dataset to predict the sCT of the second PETRA image in a two-fold cross validation schema. A complete substitute CT is generated in 3 min. The mean absolute HU error for air was 0.3 HU, bone was 95 HU, fat was 30 HU and for muscle it was 10 HU. The mean surface reconstruction error for the bone was 1.3 mm. The PETRA sequence enabled a low mean absolute surface distance for the bone and a low HU error for other classes. The sCT generated from a single PETRA sequence shows promise for the generation of fast sCT for MRI based radiation therapy planning.

Identification and characterization of earthquake clusters: a comparative analysis for selected sequences in Italy

NASA Astrophysics Data System (ADS)

Peresan, Antonella; Gentili, Stefania

2017-04-01

Identification and statistical characterization of seismic clusters may provide useful insights about the features of seismic energy release and their relation to physical properties of the crust within a given region. Moreover, a number of studies based on spatio-temporal analysis of main-shocks occurrence require preliminary declustering of the earthquake catalogs. Since various methods, relying on different physical/statistical assumptions, may lead to diverse classifications of earthquakes into main events and related events, we aim to investigate the classification differences among different declustering techniques. Accordingly, a formal selection and comparative analysis of earthquake clusters is carried out for the most relevant earthquakes in North-Eastern Italy, as reported in the local OGS-CRS bulletins, compiled at the National Institute of Oceanography and Experimental Geophysics since 1977. The comparison is then extended to selected earthquake sequences associated with a different seismotectonic setting, namely to events that occurred in the region struck by the recent Central Italy destructive earthquakes, making use of INGV data. Various techniques, ranging from classical space-time windows methods to ad hoc manual identification of aftershocks, are applied for detection of earthquake clusters. In particular, a statistical method based on nearest-neighbor distances of events in space-time-energy domain, is considered. Results from clusters identification by the nearest-neighbor method turn out quite robust with respect to the time span of the input catalogue, as well as to minimum magnitude cutoff. The identified clusters for the largest events reported in North-Eastern Italy since 1977 are well consistent with those reported in earlier studies, which were aimed at detailed manual aftershocks identification. The study shows that the data-driven approach, based on the nearest-neighbor distances, can be satisfactorily applied to decompose the seismic catalog into background seismicity and individual sequences of earthquake clusters, also in areas characterized by moderate seismic activity, where the standard declustering techniques may turn out rather gross approximations. With these results acquired, the main statistical features of seismic clusters are explored, including complex interdependence of related events, with the aim to characterize the space-time patterns of earthquakes occurrence in North-Eastern Italy and capture their basic differences with Central Italy sequences.

Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno

2008-08-01

The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6{sub 5}22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to bemore » involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6{sub 5}22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative.« less

Molecular screening of blue mussels indicated high mid-summer prevalence of human genogroup II Noroviruses, including the pandemic "GII.4 2012" variants in UK coastal waters during 2013.

PubMed

Biswas, Subhajit; Jackson, Philippa; Shannon, Rebecca; Dulwich, Katherine; Sukla, Soumi; Dixon, Ronald A

This molecular study is the first report, to the best of our knowledge, on identification of norovirus, NoV GII.4 Sydney 2012 variants, from blue mussels collected from UK coastal waters. Blue mussels (three pooled samples from twelve mussels) collected during the 2013 summer months from UK coastal sites were screened by RT-PCR assays. PCR products of RdRP gene for noroviruses were purified, sequenced and subjected to phylogenetic analysis. All the samples tested positive for NoVs. Sequencing revealed that the NoV partial RdRP gene sequences from two pooled samples clustered with the pandemic "GII.4 Sydney variants" whilst the other pooled sample clustered with the NoV GII.2 variants. This molecular study indicated mussel contamination with pathogenic NoVs even during mid-summer in UK coastal waters which posed potential risk of NoV outbreaks irrespective of season. As the detection of Sydney 2012 NoV from our preliminary study of natural coastal mussels interestingly corroborated with NoV outbreaks in nearby areas during the same period, it emphasizes the importance of environmental surveillance work for forecast of high risk zones of NoV outbreaks. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

New data on Neodiplostomum americanum Chandler and Rausch, 1947 (Digenea: Diplostomidae), in the Great Horned Owl Bubo virginianus Gmelin, 1788 and the Eastern Screech Owl Megascops asio Linnaeus, 1758 in Mississippi, USA.

PubMed

Woodyard, Ethan T; Rosser, Thomas G; Griffin, Matt J

2017-08-01

Neodiplostomum americanum Chandler and Rausch, 1947 has been reported from six species of owls in North America. At present, there are no molecular data for this species and gene sequence data from Neodiplostomum Railliet, 1919 are limited. A freshly deceased specimen of the Great Horned Owl Bubo virginianus Gmelin, 1788 and a freshly deceased specimen of the Eastern Screech Owl Megascops asio Linnaeus, 1758 were collected in Oktibbeha County, Mississippi in 2014 and 2016, respectively. Neodiplostomum americanum were recovered from both hosts. Herein, updated morphological descriptions are supplemented with gene sequence data from conserved (18S, ITS1-5.8S, ITS2, and 28S rRNA) and fast-evolving (cytochrome c oxidase subunit 1 mtDNA) regions. Preliminary phylogenetic analysis of the genus based on cytochrome c oxidase subunit 1 gene sequence data supports the placement of N. americanum within a discrete phylogroup of the family Diplostomidae. The life history of N. americanum is unknown and currently limited to the description of the adult stage in avian hosts. The molecular data generated in this study offer insight into the phylogenetic placement of N. americanum within the Diplostomatidae and will aid in identifying different life stages in putative intermediate hosts.

Comparative sequence analysis of Mycobacterium leprae and the new leprosy-causing Mycobacterium lepromatosis.

PubMed

Han, Xiang Y; Sizer, Kurt C; Thompson, Erika J; Kabanja, Juma; Li, Jun; Hu, Peter; Gómez-Valero, Laura; Silva, Francisco J

2009-10-01

Mycobacterium lepromatosis is a newly discovered leprosy-causing organism. Preliminary phylogenetic analysis of its 16S rRNA gene and a few other gene segments revealed significant divergence from Mycobacterium leprae, a well-known cause of leprosy, that justifies the status of M. lepromatosis as a new species. In this study we analyzed the sequences of 20 genes and pseudogenes (22,814 nucleotides). Overall, the level of matching of these sequences with M. leprae sequences was 90.9%, which substantiated the species-level difference; the levels of matching for the 16S rRNA genes and 14 protein-encoding genes were 98.0% and 93.1%, respectively, but the level of matching for five pseudogenes was only 79.1%. Five conserved protein-encoding genes were selected to construct phylogenetic trees and to calculate the numbers of synonymous substitutions (dS values) and nonsynonymous substitutions (dN values) in the two species. Robust phylogenetic trees constructed using concatenated alignment of these genes placed M. lepromatosis and M. leprae in a tight cluster with long terminal branches, implying that the divergence occurred long ago. The dS and dN values were also much higher than those for other closest pairs of mycobacteria. The dS values were 14 to 28% of the dS values for M. leprae and Mycobacterium tuberculosis, a more divergent pair of species. These results thus indicate that M. lepromatosis and M. leprae diverged approximately 10 million years ago. The M. lepromatosis pseudogenes analyzed that were also pseudogenes in M. leprae showed nearly neutral evolution, and their relative ages were similar to those of M. leprae pseudogenes, suggesting that they were pseudogenes before divergence. Taken together, the results described above indicate that M. lepromatosis and M. leprae diverged from a common ancestor after the massive gene inactivation event described previously for M. leprae.

ISOL@: an Italian SOLAnaceae genomics resource.

PubMed

Chiusano, Maria Luisa; D'Agostino, Nunzio; Traini, Alessandra; Licciardello, Concetta; Raimondo, Enrico; Aversano, Mario; Frusciante, Luigi; Monti, Luigi

2008-03-26

Present-day '-omics' technologies produce overwhelming amounts of data which include genome sequences, information on gene expression (transcripts and proteins) and on cell metabolic status. These data represent multiple aspects of a biological system and need to be investigated as a whole to shed light on the mechanisms which underpin the system functionality. The gathering and convergence of data generated by high-throughput technologies, the effective integration of different data-sources and the analysis of the information content based on comparative approaches are key methods for meaningful biological interpretations. In the frame of the International Solanaceae Genome Project, we propose here ISOLA, an Italian SOLAnaceae genomics resource. ISOLA (available at http://biosrv.cab.unina.it/isola) represents a trial platform and it is conceived as a multi-level computational environment.ISOLA currently consists of two main levels: the genome and the expression level. The cornerstone of the genome level is represented by the Solanum lycopersicum genome draft sequences generated by the International Tomato Genome Sequencing Consortium. Instead, the basic element of the expression level is the transcriptome information from different Solanaceae species, mainly in the form of species-specific comprehensive collections of Expressed Sequence Tags (ESTs). The cross-talk between the genome and the expression levels is based on data source sharing and on tools that enhance data quality, that extract information content from the levels' under parts and produce value-added biological knowledge. ISOLA is the result of a bioinformatics effort that addresses the challenges of the post-genomics era. It is designed to exploit '-omics' data based on effective integration to acquire biological knowledge and to approach a systems biology view. Beyond providing experimental biologists with a preliminary annotation of the tomato genome, this effort aims to produce a trial computational environment where different aspects and details are maintained as they are relevant for the analysis of the organization, the functionality and the evolution of the Solanaceae family.

Preliminary characterisation of Pentlands paramyxovirus-1, -2 and -3, three new paramyxoviruses of rodents.

PubMed

Brooks, Fiona; Wood, Ann R; Thomson, Jackie; Deane, David; Everest, David J; McInnes, Colin J

2014-06-04

A paramyxovirus was discovered by chance during the primary culture of grey squirrel (Sciurus carolinensis) kidney cells from the UK. Amplification, sequencing and phylogenetic analysis of part of the genome encoding a region of the RNA polymerase (L gene) confirmed that the virus was a member of the Paramyxovirinae subfamily, but that it did not partition with any of the currently recognised paramyxovirus genera and instead segregated with the unclassified rodent viruses, J-virus, Beilong virus and Tailam virus as well as paramyxoviruses recently detected in rodents in Africa. A subsequent examination of kidney samples from red squirrels (Sciurus vulgaris) revealed that they too harboured a paramyxovirus, but sequence analysis of the corresponding region of the L gene revealed that it was approximately 67% identical to the grey squirrel virus, suggesting the presence of a second species of virus. In addition, one of the red squirrels examined harboured a second virus with approximately 69% identity to the grey squirrel virus, but only approximately 63% identity to the other red squirrel viruses, signifying the presence of a third species of paramyxovirus. In a sample of 22 red and grey squirrels 68% of those examined were found to harbour virus suggesting that paramyxovirus infection in squirrels may be common within the UK. Copyright © 2014 Elsevier B.V. All rights reserved.

Engine With Regression and Neural Network Approximators Designed

NASA Technical Reports Server (NTRS)

Patnaik, Surya N.; Hopkins, Dale A.

2001-01-01

At the NASA Glenn Research Center, the NASA engine performance program (NEPP, ref. 1) and the design optimization testbed COMETBOARDS (ref. 2) with regression and neural network analysis-approximators have been coupled to obtain a preliminary engine design methodology. The solution to a high-bypass-ratio subsonic waverotor-topped turbofan engine, which is shown in the preceding figure, was obtained by the simulation depicted in the following figure. This engine is made of 16 components mounted on two shafts with 21 flow stations. The engine is designed for a flight envelope with 47 operating points. The design optimization utilized both neural network and regression approximations, along with the cascade strategy (ref. 3). The cascade used three algorithms in sequence: the method of feasible directions, the sequence of unconstrained minimizations technique, and sequential quadratic programming. The normalized optimum thrusts obtained by the three methods are shown in the following figure: the cascade algorithm with regression approximation is represented by a triangle, a circle is shown for the neural network solution, and a solid line indicates original NEPP results. The solutions obtained from both approximate methods lie within one standard deviation of the benchmark solution for each operating point. The simulation improved the maximum thrust by 5 percent. The performance of the linear regression and neural network methods as alternate engine analyzers was found to be satisfactory for the analysis and operation optimization of air-breathing propulsion engines (ref. 4).

Pseudomonas aestusnigri sp. nov., isolated from crude oil-contaminated intertidal sand samples after the Prestige oil spill.

PubMed

Sánchez, David; Mulet, Magdalena; Rodríguez, Ana C; David, Zoyla; Lalucat, Jorge; García-Valdés, Elena

2014-03-01

Strains VGXO14(T) and Vi1 were isolated from the Atlantic intertidal shore from Galicia, Spain, after the Prestige oil spill. Both strains were Gram-negative rod-shaped bacteria with one polar inserted flagellum, strictly aerobic, and able to grow at 18-37°C, pH 6-10 and 2-10% NaCl. A preliminary analysis of the 16S rRNA and the partial rpoD gene sequences indicated that these strains belonged to the Pseudomonas genus but were distinct from any known Pseudomonas species. A polyphasic taxonomic approach including phylogenetic, chemotaxonomic, phenotypic and genotypic data confirmed that the strains belonged to the Pseudomonas pertucinogena group. In a multilocus sequence analysis, the similarity of VGXO14(T) and Vi1 to the closest type strain of the group, Pseudomonas pachastrellae, was 90.4%, which was lower than the threshold of 97% established to discriminate species in the Pseudomonas genus. The DNA-DNA hybridisation similarity between strains VGXO14(T) and Vi1 was 79.6%, but below 70% with the type strains in the P. pertucinogena group. Therefore, the strains should be classified within the genus Pseudomonas as a novel species, for which the name Pseudomonas aestusnigri is proposed. The type strain is VGXO14(T) (=CCUG 64165(T)=CECT 8317(T)). Copyright © 2013 Elsevier GmbH. All rights reserved.

Environmental Sequencing of Biotic Components of Dust in the Chihuahuan Desert

NASA Astrophysics Data System (ADS)

Walsh, E.; Gill, T. E.; Rivas, J. A., Jr.; Leung, M. Y.; Mohl, J.

2015-12-01

A growing number of studies mark the role of wind in dispersing biota. Most of these approaches have used traditional methods to assess taxonomic diversity. Here we used next generation sequencing to characterize microbiota in dust collected from the Chihuahuan Desert. Atmospheric dust was collected during events during 2011-2014 using dry deposition collectors placed at two sites in El Paso Co., TX. In parallel experiments, we rehydrated subsamples of dust and conducted PCR amplifications using conserved primers for 16S and 18S ribosomal genes. Sequenced reads were de-multiplexed, quality filtered, and processed using QIIME. Taxonomy was assigned based on pairwise identity using BLAST for microbial eukaryotes. All samples were rarefied to a set number of sequences per sample prior to downstream analyses. Bioinformatic analysis of four of the dust samples yielded a diversity of biota, including zooplankton, bacteria, fungi, algae, and protists, but fungi predominate (>90% of both 10K and 3K reads). In our rehydrations of dust samples from the U.S. southwest nematodes, gastrotrichs, tardigrades, monogonont and bdelloid rotifers, branchiopods and numerous ciliates have been recovered. Variability in genetic diversity among samples is based, in part, on the source and extent of the particular dust event. We anticipate the same patterns will be seen in the complete data set. These preliminary results indicate that wind is a major transporter of not only fungi, bacteria and other unicellular organisms but may also be important in shaping the distribution patterns of multi-cellular organisms such as those that inhabit aquatic environments in the arid southwestern US.

A Preliminary Study of Viral Metagenomics of French Bat Species in Contact with Humans: Identification of New Mammalian Viruses

PubMed Central

Dacheux, Laurent; Cervantes-Gonzalez, Minerva; Guigon, Ghislaine; Thiberge, Jean-Michel; Vandenbogaert, Mathias; Maufrais, Corinne

2014-01-01

The prediction of viral zoonosis epidemics has become a major public health issue. A profound understanding of the viral population in key animal species acting as reservoirs represents an important step towards this goal. Bats harbor diverse viruses, some of which are of particular interest because they cause severe human diseases. However, little is known about the diversity of the global population of viruses found in bats (virome). We determined the viral diversity of five different French insectivorous bat species (nine specimens in total) in close contact with humans. Sequence-independent amplification, high-throughput sequencing with Illumina technology and a dedicated bioinformatics analysis pipeline were used on pooled tissues (brain, liver and lungs). Comparisons of the sequences of contigs and unassembled reads provided a global taxonomic distribution of virus-related sequences for each sample, highlighting differences both within and between bat species. Many viral families were present in these viromes, including viruses known to infect bacteria, plants/fungi, insects or vertebrates, the most relevant being those infecting mammals (Retroviridae, Herpesviridae, Bunyaviridae, Poxviridae, Flaviviridae, Reoviridae, Bornaviridae, Picobirnaviridae). In particular, we detected several new mammalian viruses, including rotaviruses, gammaretroviruses, bornaviruses and bunyaviruses with the identification of the first bat nairovirus. These observations demonstrate that bats naturally harbor viruses from many different families, most of which infect mammals. They may therefore constitute a major reservoir of viral diversity that should be analyzed carefully, to determine the role played by bats in the spread of zoonotic viral infections. PMID:24489870

New Coffee Plant-Infecting Xylella fastidiosa Variants Derived via Homologous Recombination

PubMed Central

Denancé, Nicolas; Legendre, Bruno; Morel, Emmanuelle; Briand, Martial; Mississipi, Stelly; Durand, Karine; Olivier, Valérie; Portier, Perrine; Poliakoff, Françoise; Crouzillat, Dominique

2015-01-01

Xylella fastidiosa is a xylem-limited phytopathogenic bacterium endemic to the Americas that has recently emerged in Asia and Europe. Although this bacterium is classified as a quarantine organism in the European Union, importation of plant material from contaminated areas and latent infection in asymptomatic plants have engendered its inevitable introduction. In 2012, four coffee plants (Coffea arabica and Coffea canephora) with leaf scorch symptoms growing in a confined greenhouse were detected and intercepted in France. After identification of the causal agent, this outbreak was eradicated. Three X. fastidiosa strains were isolated from these plants, confirming a preliminary identification based on immunology. The strains were characterized by multiplex PCR and by multilocus sequence analysis/typing (MLSA-MLST) based on seven housekeeping genes. One strain, CFBP 8073, isolated from C. canephora imported from Mexico, was assigned to X. fastidiosa subsp. fastidiosa/X. fastidiosa subsp. sandyi. This strain harbors a novel sequence type (ST) with novel alleles at two loci. The two other strains, CFBP 8072 and CFBP 8074, isolated from Coffea arabica imported from Ecuador, were allocated to X. fastidiosa subsp. pauca. These two strains shared a novel ST with novel alleles at two loci. These MLST profiles showed evidence of recombination events. We provide genome sequences for CFBP 8072 and CFBP 8073 strains. Comparative genomic analyses of these two genome sequences with publicly available X. fastidiosa genomes, including the Italian strain CoDiRO, confirmed these phylogenetic positions and provided candidate alleles for coffee plant adaptation. This study demonstrates the global diversity of X. fastidiosa and highlights the diversity of strains isolated from coffee plants. PMID:26712553

Analyzing Students' Learning Progressions Throughout a Teaching Sequence on Acoustic Properties of Materials with a Model-Based Inquiry Approach

NASA Astrophysics Data System (ADS)

Hernández, María Isabel; Couso, Digna; Pintó, Roser

2015-04-01

The study we have carried out aims to characterize 15- to 16-year-old students' learning progressions throughout the implementation of a teaching-learning sequence on the acoustic properties of materials. Our purpose is to better understand students' modeling processes about this topic and to identify how the instructional design and actual enactment influences students' learning progressions. This article presents the design principles which elicit the structure and types of modeling and inquiry activities designed to promote students' development of three conceptual models. Some of these activities are enhanced by the use of ICT such as sound level meters connected to data capture systems, which facilitate the measurement of the intensity level of sound emitted by a sound source and transmitted through different materials. Framing this study within the design-based research paradigm, it consists of the experimentation of the designed teaching sequence with two groups of students ( n = 29) in their science classes. The analysis of students' written productions together with classroom observations of the implementation of the teaching sequence allowed characterizing students' development of the conceptual models. Moreover, we could evidence the influence of different modeling and inquiry activities on students' development of the conceptual models, identifying those that have a major impact on students' modeling processes. Having evidenced different levels of development of each conceptual model, our results have been interpreted in terms of the attributes of each conceptual model, the distance between students' preliminary mental models and the intended conceptual models, and the instructional design and enactment.

On the Detection and Characterization of Polluted White Dwarfs

NASA Astrophysics Data System (ADS)

Steele, Amy; Debes, John H.; Deming, Drake

2017-06-01

There is evidence of circumstellar material around main sequence, giant, and white dwarf stars. What happens to this material after the main sequence? With this work, we focus on the characterization of the material around WD 1145+017. The goals are to monitor the white dwarf—which has a transiting, disintegrating planetesimal and determine the composition of the evaporated material for that same white dwarf by looking at high-resolution spectra. We also present preliminary results of follow-up photometric observations of known polluted WDs. If rocky bodies survive red giant branch evolution, then the material raining down on a WD atmosphere is a direct probe of main sequence cosmochemistry. If rocky bodies do not survive the evolution, then this informs the degree of post-main-sequence processing. These case studies will provide the community with further insight about debris disk modeling, the degree of post-main-sequence processing of circumstellar material, and the composition of a disintegrating planetesimal.

Molecular Cloning, Sequencing and Characterization of Channel Catfish (Ictalurus punctatus, Rafinesque 1818) Cathepsin S Gene

USDA-ARS?s Scientific Manuscript database

Cathepsin S is a lysosomal cysteine endopeptidase of the papain family. Our preliminary results showed the up-regulation of cathepsin S (CTSS) transcript during the early stage of Edwardsiella ictaluri infection. This prompted us to speculate that the CTSS may play a role in infection. In this re...

Evaluation of Instructional Materials for Exceptional Children and Youth: A Preliminary Instrument.

ERIC Educational Resources Information Center

Eash, Maurice

An instrument for the evaluation of instructional materials is presented. Evaluative items are arranged under four constructs: objectives, organization of material (both scope and sequence), methodology, and evaluation. A section is also provided for summary quantitative judgment. A glossary of terms used in the instrument is included. A training…

Nanophytoplankton Diversity Across the Oligohaline Lake Pontchartrain Basin Estuary: A Preliminary Investigation Utlizing psbA Sequences

USDA-ARS?s Scientific Manuscript database

The Lake Pontchartrain basin estuary is shallow, wind-driven and comprised of two large embayments (1645 km2). Salinities range from freshwater in the west to 8 ppt in the east near the Gulf of Mexico. Phytoplankton investigations spanning this salinity gradient or examining small photoautotrophs ar...

The Technique of Documentary Film Production. Revised Edition.

ERIC Educational Resources Information Center

Baddeley, W. Hugh

The means and methods of producing factual films are dealt with step-by-step from the initial idea to making and distributing the final release prints. The author describes preparing a script; breaking the script down to shooting sequences; budgeting for everything from materials to insurance; preliminary planning for actors, commentators,…

A Preliminary Investigation of Racial Bias in Early Writing Curriculum-Based Measures

ERIC Educational Resources Information Center

Kondisko, Joseph E.

2017-01-01

Using de-identified data, this study investigated the relationship between racial categories with curriculum-based early writing measures (CBM-W), which included word dictation, picture word sentence writing, and story prompt tasks for over 300 participants in Grades 1, 2, and 3. Words written, words spelled correctly, correct letter sequences,…

A Mars orbiter mission design

NASA Astrophysics Data System (ADS)

Castronuovo, Marco M.

1992-08-01

A preliminary study of a new orbiter mission to Mars using an earth gravity assist is presented. The trajectory resulting from this study has been evaluated utilizing Everhart's (1985) integrator RADAU. The mission sequences are described and compared to other proposed mission designs and some mission opportunities for the years 1997 to 2014 are discussed.

Cognitive Task Analysis and Work-Centered Support System Recommendations for a Deployed Network Operations Support Center (NOSC-D)

DTIC Science & Technology

2001-08-01

This report presents the results of a preliminary Cognitive Task Analysis (CTA) of the deployed Network Operations Support Center (NOSC-D), and the...conducted Cognitive Task Analysis interviews with four (4) NOSC-D personnel. Because of the preliminary nature of the finding, the analysis is

Reconstruction of the Paleoproterozoic deeper ocean environment: Preliminary Report of the Ghana Birimian Greenstone Belt Drilling Project (GHB)

NASA Astrophysics Data System (ADS)

Kiyokawa, S.; Yoshimaru, S.; Miki, T.; Sakai, S.; Ikehara, M.; Yamaguchi, K. E.; Ito, T.; Onoue, T.; Takehara, M.; Tetteh, G. M.; Nyame, F. K.

2016-12-01

The Paleoproterozoic Era are one of the most rapid environmental change when the earth surface environment was affected by formation of continents and increasing atmospheric oxygen levels. Major oxidation of Great Oxidation Event (GOE) are reported this ages (eg. Holland, 2006; Condie, 2001; Lyons et al., 2014). The nature of deep sea environments at this time have not been clearly identified and oceanic sediments are mostly involved in subduction. The Paleoproterozoic Birimian Greenstone Belt is an ophiolitic volcaniclastic sequence in Ghana, with depositional age of over 2.3-2.2 Ga (Petersson et al., 2016). Detail research was conducted of the Ashanti (Axim-Konongo) Belt of the Birimian Greenstone Belt along the coast near Cape Three Points area. Very thick volcaniclastic and organic-rich sedimentary rocks, which we now refer to as the Cape Three Points Group, crop out in the lower part of the Birimian Greenstone Belt. Stratigraphically, three unit identified; the lower portion contains thick vesicular volcaniclastic rocks, the middle portion is made up of laminated volcaniclastics and black shale, and the upper portion dominated by fine laminated volcaniclastics with more black shale sequence. Continuous core drilling from Dec 3-12th 2015 of the upper part of the sequence intersected saprolite to a depth of 30m and fresh, well preserved stratigraphy with graded bedding and lamination to a depth of 195m. Half cut cores show well laminated organic rich black shale and relative carbonate rich layers with very fine pyrite grains. SHRIMP age data from a porphyry intrusion into this sequence indicate an age of 2250 Ma. Carbon isotope analysis shows δ13C = -43 to -37‰ for black shale with the very light isotope values for cyanobacterial signature.The fining-upward sequences, well laminated bed and black shales and REE data suggest this sequence situated partly silent stagnant with volcanic activity ocean floor environment around an oceanic island arc condition.

Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

PubMed

Riley, Matthew C; Wilkes, Rebecca P

2015-12-18

Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine escape.

Modelling the 2013 North Aegean (Greece) seismic sequence: geometrical and frictional constraints, and aftershock probabilities

NASA Astrophysics Data System (ADS)

Karakostas, Vassilis; Papadimitriou, Eleftheria; Gospodinov, Dragomir

2014-04-01

The 2013 January 8 Mw 5.8 North Aegean earthquake sequence took place on one of the ENE-WSW trending parallel dextral strike slip fault branches in this area, in the continuation of 1968 large (M = 7.5) rupture. The source mechanism of the main event indicates predominantly strike slip faulting in agreement with what is expected from regional seismotectonics. It was the largest event to have occurred in the area since the establishment of the Hellenic Unified Seismological Network (HUSN), with an adequate number of stations in close distances and full azimuthal coverage, thus providing the chance of an exhaustive analysis of its aftershock sequence. The main shock was followed by a handful of aftershocks with M ≥ 4.0 and tens with M ≥ 3.0. Relocation was performed by using the recordings from HUSN and a proper crustal model for the area, along with time corrections in each station relative to the model used. Investigation of the spatial and temporal behaviour of seismicity revealed possible triggering of adjacent fault segments. Theoretical static stress changes from the main shock give a preliminary explanation for the aftershock distribution aside from the main rupture. The off-fault seismicity is perfectly explained if μ > 0.5 and B = 0.0, evidencing high fault friction. In an attempt to forecast occurrence probabilities of the strong events (Mw ≥ 5.0), estimations were performed following the Restricted Epidemic Type Aftershock Sequence (RETAS) model. The identified best-fitting MOF model was used to execute 1-d forecasts for such aftershocks and follow the probability evolution in time during the sequence. Forecasting was also implemented on the base of a temporal model of aftershock occurrence, different from the modified Omori formula (the ETAS model), which resulted in probability gain (though small) in strong aftershock forecasting for the beginning of the sequence.

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

Whole-genome sequence of Erysipelothrix larvae LV19(T) (=KCTC 33523(T)), a useful strain for arsenic detoxification, from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus.

PubMed

Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan

2016-04-10

Erysipelothrix larvae LV19(T) was preliminary isolated from the larval gut of a rhinoceros beetle, Trypoxylus dichotomus in Korea. Here, we present the whole genome sequence of E. larvae LV19(T) strain, which consisted of 2,511,486 base pairs with a GC content of 37.4% and one plasmid. Unlike other Erysipelothrix strains (SY 1027, Fujisawa and ATCC 19414), the arsenic-resistance genes were identified in LV19(T) strain. Copyright © 2016 Elsevier B.V. All rights reserved.

Establishing use of crutches by a mentally retarded spina bifida child1

PubMed Central

Horner, R. Don

1971-01-01

A 5-yr-old mentally retarded spina bifida child was taught to walk with the aid of crutches. This behavior was developed through fading of physical prompting within a 10-step successive approximation sequence. Preliminary training to establish gait consisted of developing use of parallel bars through fading of physically modelled responses within a six-step successive approximation sequence. Use of parallel bars ceased during an extinction period and completely recovered upon being primed with one “free” reinforcement. Systematic use of natural reinforcers was employed as an aid in maintaining use of crutches. PMID:16795294

V380 Dra: New short-period totally eclipsing active binary

NASA Astrophysics Data System (ADS)

Özdarcan, O.

2014-02-01

In this study, first complete and standard BVR light curves and photometric analysis of the eclipsing binary system V380 Dra are presented. Photometric analysis result indicates that the system has components which are cool main sequence stars. In light and color curves, remarkable asymmetry is observed, especially after secondary minimum, which is believed to be a result of chromospheric activity in one or both components. O-C diagram of available small number of eclipse times, together with new eclipse timings in this work, exhibits no significant variation. Preliminary light curve solution shows that the secondary minimum is total eclipse. By using the advantage of total eclipse and mass-luminosity relation, it is found that the system has a possible mass ratio of q = 0.81. First estimation of masses and radii of primary and secondary components are M1 = 0.77 M⊙,M2 = 0.62 M⊙ and R1 = 0.93 R⊙,R2 = 0.77 R⊙, respectively.

Analysis of ISO Data

NASA Technical Reports Server (NTRS)

Lambert, David L.

2003-01-01

A block grant supported several astronomers who executed observing programs using the Infrared Space Observatory (ISO). The ISO project in which Harriet Dinerstein participated was a study of sulfur and neon abundances in extragalactic H II regions using the ISO Short Wavelength Spectrometer (SWS). Evans and Jaffe, along with collaborators Ewine van Dishoeck and Wing-Fai Thi, and then graduate student Wenbin Li, carried out an in-depth study of the peripheral region of the molecular cloud L1204/S140, where the far ultraviolet radiation and the density are relatively low. Their observations test theories of photon-dominated regions (PDRs) in a regime that has been little explored. One ISO program was involved with PHT-32 observations of about a dozen young stars to search for extended emission that could be modeled with our dust-modeling-code at UT. The document reports on preliminary analysis of PHT 32 scanning of 10 pre-main-sequence stars at 50 and 100 microns. A small sample of R Coronae Borealis stars was observed with the SWS.

A focus of attention mechanism for gaze control within a framework for intelligent image analysis tools

NASA Astrophysics Data System (ADS)

Rodrigo, Ranga P.; Ranaweera, Kamal; Samarabandu, Jagath K.

2004-05-01

Focus of attention is often attributed to biological vision system where the entire field of view is first monitored and then the attention is focused to the object of interest. We propose using a similar approach for object recognition in a color image sequence. The intention is to locate an object based on a prior motive, concentrate on the detected object so that the imaging device can be guided toward it. We use the abilities of the intelligent image analysis framework developed in our laboratory to generate an algorithm dynamically to detect the particular type of object based on the user's object description. The proposed method uses color clustering along with segmentation. The segmented image with labeled regions is used to calculate the shape descriptor parameters. These and the color information are matched with the input description. Gaze is then controlled by issuing camera movement commands as appropriate. We present some preliminary results that demonstrate the success of this approach.

Molecular evidence for the occurrence of tomato leaf curl New Delhi virus on chayote (Sechium edule) in southern India.

PubMed

Nagendran, K; Mohankumar, S; Mohammed Faisal, P; Bagewadi, B; Karthikeyan, G

2017-12-01

During 2012-2014, mosaic disease on chayote in the farmers field of Kodaikanal region (high altitude zone) of Tamil Nadu was observed. The disease was characterized with severe mosaic, cupping and enation on leaves with reduced fruit size. Disease was found to causes an yield loss of more than 60% with the maximum disease incidence of 100% for the past 5 years consecutively. Preliminary serological and molecular screening indicated the association of begomovirus with the disease. Complete nucleotide sequence and phylogenetic analysis of DNA A revealed the identity of the virus as tomato leaf curl New Delhi virus (ToLCNDV). In recombination analysis study, the major parent was identified as ToLCNDV from Pakistan infecting tomato. Thus the present finding confirms expansion of new geographical region and host for ToLCNDV causing mosaic disease on chayote from Tamil Nadu. To our knowledge this is the first confirmed report for the occurrence of ToLCNDV on chayote in southern India.

Photometric Calibrations of Gemini Images of NGC 6253

NASA Astrophysics Data System (ADS)

Pearce, Sean; Jeffery, Elizabeth

2017-01-01

We present preliminary results of our analysis of the metal-rich open cluster NGC 6253 using imaging data from GMOS on the Gemini-South Observatory. These data are part of a larger project to observe the effects of high metallicity on white dwarf cooling processes, especially the white dwarf cooling age, which have important implications on the processes of stellar evolution. To standardize the Gemini photometry, we have also secured imaging data of both the cluster and standard star fields using the 0.6-m SARA Observatory at CTIO. By analyzing and comparing the standard star fields of both the SARA data and the published Gemini zero-points of the standard star fields, we will calibrate the data obtained for the cluster. These calibrations are an important part of the project to obtain a standardized deep color-magnitude diagram to analyze the cluster. We present the process of verifying our standardization process. With a standardized CMD, we also present an analysis of the cluster's main sequence turn off age.

Genotypic and phenotypic characterization of aerosolized bacteria collected from African dust events

DOE PAGES

Wilson, Christina A.; Brigmon, Robin L.; Yeager, Chris; ...

2013-07-31

Twenty-one bacteria were isolated and characterized from air samples collected in Africa and the Caribbean by the United States Geological Survey (USGS). Isolates were selected based on preliminary characterization as possible pathogens. Identification of the bacterial isolates was 25 achieved using 16S rRNA gene sequence analysis, fatty acid methyl esters (FAMEs) profiling, the BIOLOG Microlog® System (carbon substrate assay), and repetitive extragenic palindromic (REP)-PCR analysis. The majority of isolates (18/21) were identified as species of the genus Bacillus. Three isolates were classified within the Bacillus cereus senso lato group, which includes Bacillus anthracis, Bacillus thuringiensis, and Bacillus cereus strains. Onemore » isolate was identified as a Staphylococcus sp., 30 most closely related to species (i.e Staphylococcus kloosii, Staphylococcus warneri) that are commonly associated with human or animal skin, but can also act as opportunistic pathogen. Another isolate was tentatively identified as Tsukamurella inchonensis, a known respiratory pathogen, and was resistant to the ten antibiotics tested including vancomycin.« less

Deep Borehole Emplacement Mode Hazard Analysis Revision 0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sevougian, S. David

This letter report outlines a methodology and provides resource information for the Deep Borehole Emplacement Mode Hazard Analysis (DBEMHA). The main purpose is identify the accident hazards and accident event sequences associated with the two emplacement mode options (wireline or drillstring), to outline a methodology for computing accident probabilities and frequencies, and to point to available databases on the nature and frequency of accidents typically associated with standard borehole drilling and nuclear handling operations. Risk mitigation and prevention measures, which have been incorporated into the two emplacement designs (see Cochran and Hardin 2015), are also discussed. A key intent ofmore » this report is to provide background information to brief subject matter experts involved in the Emplacement Mode Design Study. [Note: Revision 0 of this report is concentrated more on the wireline emplacement mode. It is expected that Revision 1 will contain further development of the preliminary fault and event trees for the drill string emplacement mode.]« less

The recA gene from the thermophile Thermus aquaticus YT-1: cloning, expression, and characterization.

PubMed Central

Angov, E; Camerini-Otero, R D

1994-01-01

We have cloned, expressed, and purified the RecA analog from the thermophilic eubacterium Thermus aquaticus YT-1. Analysis of the deduced amino acid sequence indicates that the T. aquaticus RecA is structurally similar to the Escherichia coli RecA and suggests that RecA-like function has been conserved in thermophilic organisms. Preliminary biochemical analysis indicates that the protein has an ATP-dependent single-stranded DNA binding activity and can pair and carry out strand exchange to form a heteroduplex DNA under reaction conditions previously described for E. coli RecA, but at 55 to 65 degrees C. Further characterization of a thermophilically derived RecA protein should yield important information concerning DNA-protein interactions at high temperatures. In addition, a thermostable RecA protein may have some general applicability in stabilizing DNA-protein interactions in reactions which occur at high temperatures by increasing the specificity (stringency) of annealing reactions. Images PMID:8113181

Strain improvement of chymosin-producing strains of Aspergillus niger var. awamori using parasexual recombination.

PubMed

Bodie, E A; Armstrong, G L; Dunn-Coleman, N S

1994-05-01

Parasexual recombination was used to obtain improved chymosin-producing strains and to perform genetic analysis on existing strains. Chlorate resistance was used to select for a variety of spontaneous nitrate assimilation pathway mutations in strains previously improved for chymosin production using classical strain improvement methods including mutation and screening, and selection for 2-deoxyglucose resistance (dgr). Diploids of these improved strains were generated via parasexual recombination and were isolated on selective media by complementation of nitrate assimilation mutations. A preliminary genetic analysis of diploid and haploid segregants indicated that the dgr trait, resulting in overexpression of chymosin, was recessive. Also, mutations in two different dgr genes resulted in an increased level of chymosin production. When these mutations were combined via parasexual recombination, the resulting haploid segregants produced about 15% more chymosin than either parental strain. CHEF gel electrophoresis was used to determine the chromosomal location of the integrated chymosin DNA sequences, and to verify diploidy in one case where the chromosome composition of two haploid parents differed.

Baseline studies to select the most sound and sensitive sites to install continuous monitoring per sismo-geochemical networks. The case history of the Norcia-Amatrice-Spoleto seismic sequences (2016-2017)

NASA Astrophysics Data System (ADS)

Quattrocchi, F.; Gallo, F.

2017-12-01

The paper review methodologically and historically - in the frame of seismo-geochemical studies in Italy and abroad to select the most "sensitive" sites along active faults, mostly where structural geology is not able to discover "blind" faults or complex fault crossing systems, with maximum fluids-faults interaction. The paper is highlighting the "site specific" case histories and processes helping in networks design, gathered in occasion of strong-moderate earthquakes, gas-burst or groundwater evolution in geothermal-hydrocarbons field during EU projects (i.e., Geochemical Seismic Zonation, 3F-Faults-Fractures-Fluids Corinth). Some concepts are highlighted based on gather experimental data in 25 years: - if the network is in soil gas is necessary a preliminary study on groundwater too, to understand the sectors of shallow aquifers, as "buffer" bodies, more prone to be oversaturated by geogas from depth; a preliminary grid should consider both the CO2-CH4-Rn fluxes, all gas concentrations and isotopes analyses (TDIC, CH4 CO2 , rare gas) case by case described here, mostly where the regional faults are crossing each other and where a carrier gas is acting i.e., CO2. It is very un-correct to install mono-parametric stations, i.e. only Radon to understand the real WRI processes. - if the network is in groundwater is very important a preliminary study before, during and after seismic sequences, to realize where the maximum anomalies (i.e., anomalous animal behavior, temperature increasing, geochemical anomalies, new gas relase) are and will be envisaged, as found for the Umbria-Marche border (the Colfiorito 1997-1998 and the 2016-2017 Norcia-Amatrice seismic sequences), where a deep pore-pressure dominated situation could be constrained by seismo-geochemistry, along "still silent" close fault segments too. if the network is in groundwater is very important a geochemical multidisciplinary approach to constrain the segment length and relative maximum magnitude.

Empowered genome community: leveraging a bioinformatics platform as a citizen-scientist collaboration tool.

PubMed

Wendelsdorf, Katherine; Shah, Sohela

2015-09-01

There is on-going effort in the biomedical research community to leverage Next Generation Sequencing (NGS) technology to identify genetic variants that affect our health. The main challenge facing researchers is getting enough samples from individuals either sick or healthy - to be able to reliably identify the few variants that are causal for a phenotype among all other variants typically seen among individuals. At the same time, more and more individuals are having their genome sequenced either out of curiosity or to identify the cause of an illness. These individuals may benefit from of a way to view and understand their data. QIAGEN's Ingenuity Variant Analysis is an online application that allows users with and without extensive bioinformatics training to incorporate information from published experiments, genetic databases, and a variety of statistical models to identify variants, from a long list of candidates, that are most likely causal for a phenotype as well as annotate variants with what is already known about them in the literature and databases. Ingenuity Variant Analysis is also an information sharing platform where users may exchange samples and analyses. The Empowered Genome Community (EGC) is a new program in which QIAGEN is making this on-line tool freely available to any individual who wishes to analyze their own genetic sequence. EGC members are then able to make their data available to other Ingenuity Variant Analysis users to be used in research. Here we present and describe the Empowered Genome Community in detail. We also present a preliminary, proof-of-concept study that utilizes the 200 genomes currently available through the EGC. The goal of this program is to allow individuals to access and understand their own data as well as facilitate citizen-scientist collaborations that can drive research forward and spur quality scientific dialogue in the general public.

Correlation of offshore seismic profiles with onshore New Jersey Miocene sediments

USGS Publications Warehouse

Monteverde, D.H.; Miller, K.G.; Mountain, Gregory S.

2000-01-01

The New Jersey passive continental margin records the interaction of sequences and sea-level, although previous studies linking seismically defined sequences, borehole control, and global ??18O records were hindered by a seismic data gap on the inner-shelf. We describe new seismic data from the innermost New Jersey shelf that tie offshore seismic stratigraphy directly to onshore boreholes. These data link the onshore boreholes to existing seismic grids across the outer margin and to boreholes on the continental slope. Surfaces defined by age; facies, and log signature in the onshore boreholes at the base of sequences Kw2b, Kw2a, Kw1c, and Kw0 are now tied to seismic sequence boundaries m5s, m5.2s, m5.4s, and m6s, respectively, defined beneath the inner shelf. Sequence boundaries recognized in onshore boreholes and inner shelf seismic profiles apparently correlate with reflections m5, m5.2, m5.4, and m6, respectively, that were dated at slope boreholes during ODP Leg 150. We now recognize an additional sequence boundary beneath the shelf that we name m5.5s and correlate to the base of the onshore sequence Kw1b. The new seismic data image prograding Oligocene clinoforms beneath the inner shelf, consistent with the results from onshore boreholes. A land-based seismic profile crossing the Island Beach borehole reveals reflector geometries that we tie to Lower Miocene litho- and bio-facies in this borehole. These land-based seismic profiles image well-defined sequence boundaries, onlap and downlap truncations that correlate to Transgressive Systems Tracts (TST) and Highstand Systems Tracts (HST) identified in boreholes. Preliminary analysis of CH0698 data continues these system tract delineations across the inner shelf The CH0698 seismic profiles tie seismically defined sequence boundaries with sequences identified by lithiologic and paleontologic criteria. Both can now be related to global ??18O increases and attendant glacioeustatic lowerings. This integration of core, log, and seismic character of mid-Tertiary sediments across the width of the New Jersey margin is a major step in the long-standing effort to evaluate the impact of glaciouestasy on siliciclastic sediments of a passive continental margin. (C) 2000 Elsevier Science B.V. All rights reserved.

New Results from the Flare Genesis Experiment

NASA Astrophysics Data System (ADS)

Rust, D. M.; Bernasconi, P. N.; Eaton, H. A.; Keller, C.; Murphy, G. A.; Schmieder, B.

2000-05-01

From January 10 to 27, 2000, the Flare Genesis solar telescope observed the Sun while suspended from a balloon in the stratosphere above Antarctica. The goal of the mission was to acquire long time series of high-resolution images and vector magnetograms of the solar photosphere and chromosphere. Images were obtained in the magnetically sensitive Ca I line at 6122 Angstroms and at H-alpha (6563 Angstroms). The FGE data were obtained in the context of Max Millennium Observing Campaign #004, the objective of which was to study the ``Genesis of Solar Flares and Active Filaments/Sigmoids." Flare Genesis obtained about 26,000 usable images on the 8 targeted active regions. A preliminary examination reveals a good sequence on an emerging flux region and data on the M1 flare on January 22, as well as a number of sequences on active filaments. We will present the results of our first analysis efforts. Flare Genesis was supported by NASA grants NAG5-4955, NAG5-5139, and NAG5-8331 and by NSF grant OPP-9615073. The Air Force Office of Scientific Research and the Ballistic Missile Defense Organization supported early development of the Flare Genesis Experiment.

Occurrence of Giardia in Swedish Red Foxes ( Vulpes vulpes ).

PubMed

Debenham, John J; Landuyt, Hanne; Troell, Karin; Tysnes, Kristoffer; Robertson, Lucy J

2017-07-01

Giardia duodenalis is an intestinal protozoan capable of causing gastrointestinal disease in a range of vertebrate hosts. It is transmitted via the fecal-oral route. Understanding the epidemiology of G. duodenalis in animals is important, both for public health and for the health of the animals it infects. We investigated the occurrence of G. duodenalis in wild Swedish red foxes ( Vulpes vulpes ), with the aim of providing preliminary information on how this abundant predator might be involved in the transmission and epidemiology of G. duodenalis . Fecal samples (n=104) were analysed for G. duodenalis using a commercially available direct immunofluorescent antibody test. Giardia duodenalis cysts were found in 44% (46/104) of samples, with foxes excreting 100 to 140,500 cysts per gram of feces (mean, 4,930; median, 600). Molecular analysis, using PCR with sequencing of PCR amplicons, was performed on 14 samples, all containing over 2,000 cysts per gram feces. Amplification only occurred in four samples at the tpi gene, sequencing of which revealed assemblage B in all four samples. This study provides baseline information on the role of red foxes in the transmission dynamics of G. duodenalis in Sweden.

Occurrence, hosts, morphology, and molecular characterisation of Pasteuria bacteria parasitic in nematodes of the family Plectidae.

PubMed

Sturhan, Dieter; Shutova, Tatyana S; Akimov, Vladimir N; Subbotin, Sergei A

2005-01-01

Parasitic bacteria of the genus Pasteuria are reported for three Anaplectus and four identified and several unidentified Plectus species found in eight countries in various habitats. The pasteurias from plectids agree in essential morphological characters of sporangia and endospores as well as in developmental cycle with those of the Pasteuria species and strains described from tylenchid nematodes, but appear to be mainly distinguished from these by absence of a distinct perisporium in the spores and the endospores obviously not being cup- or saucer-shaped. The wide range of measurements and morphological peculiarities of sporangia and endospores suggest that probably several Pasteuria species have to be distinguished as parasites in Plectidae. From an infected juvenile of an unidentified plectid species the 16S rRNA gene sequence of Pasteuria sp. was obtained. Substantial sequence divergence from described Pasteuria species and its phylogenetic position on molecular trees indicate that this Pasteuria sp. could be considered as a new species. Preliminary results of the analysis of DNA phylogeny of Pasteuria spp. and their nematode hosts provide evidence for incongruence of their phylogenetic history and of host switching events during evolution of the bacterial parasites.

Key metabolic pathways involved in xenobiotic biotransformation and stress responses revealed by transcriptomics of the mangrove oyster Crassostrea brasiliana.

PubMed

Lüchmann, Karim H; Clark, Melody S; Bainy, Afonso C D; Gilbert, Jack A; Craft, John A; Chipman, J Kevin; Thorne, Michael A S; Mattos, Jacó J; Siebert, Marília N; Schroeder, Declan C

2015-09-01

The Brazilian oyster Crassostrea brasiliana was challenged to three common environmental contaminants: phenanthrene, diesel fuel water-accommodated fraction (WAF) and domestic sewage. Total RNA was extracted from the gill and digestive gland, and cDNA libraries were sequenced using the 454 FLX platform. The assembled transcriptome resulted in ̃20,000 contigs, which were annotated to produce the first de novo transcriptome for C. brasiliana. Sequences were screened to identify genes potentially involved in the biotransformation of xenobiotics and associated antioxidant defence mechanisms. These gene families included those of the cytochrome P450 (CYP450), 70kDa heat shock, antioxidants, such as glutathione S-transferase, superoxide dismutase, catalase and also multi-drug resistance proteins. Analysis showed that the massive expansion of the CYP450 and HSP70 family due to gene duplication identified in the Crassostrea gigas genome also occurred in C. brasiliana, suggesting these processes form the base of the Crassostrea lineage. Preliminary expression analyses revealed several candidates biomarker genes that were up-regulated during each of the three treatments, suggesting the potential for environmental monitoring. Copyright © 2015 Elsevier B.V. All rights reserved.

Orbital transfer rocket engine technology 7.5K-LB thrust rocket engine preliminary design

NASA Technical Reports Server (NTRS)

Harmon, T. J.; Roschak, E.

1993-01-01

A preliminary design of an advanced LOX/LH2 expander cycle rocket engine producing 7,500 lbf thrust for Orbital Transfer vehicle missions was completed. Engine system, component and turbomachinery analysis at both on design and off design conditions were completed. The preliminary design analysis results showed engine requirements and performance goals were met. Computer models are described and model outputs are presented. Engine system assembly layouts, component layouts and valve and control system analysis are presented. Major design technologies were identified and remaining issues and concerns were listed.

Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.

PubMed

Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia

2017-07-24

Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.

The influence of phonological priming on variability in articulation

NASA Astrophysics Data System (ADS)

Babel, Molly E.; Munson, Benjamin

2004-05-01

Previous research [Sevald and Dell, Cognition 53, 91-127 (1994)] has found that reiterant sequences of CVC words are produced more quickly when the prime word and target word share VC sequences (i.e., sequences like sit sick) than when they are identical (sequences like sick sick). Even slower production rates are found when primes and targets share a CV sequence (sequences like kick sick). These data have been used to support a model of speech production in which lexical items and their constituent phonemes are activated sequentially. The current experiment investigated whether phonological priming also influences variability in the acoustic characteristics of words. Specifically, we examined whether greater variability in the acoustic characteristics of target words was noted in the CV-related prime context than in the identical-prime context, and whether less variability was noted in the VC-related context. Thirty adult subjects with typical speech, language, and hearing ability produced reiterant two-word sequences that varied in their phonological similarity. The duration, first, and second formant frequencies of the target-words' vowels were measured. Preliminary analyses indicate that phonological priming does not have a systematic effect on variability in these acoustic parameters.

SUMS preliminary design and data analysis development. [shuttle upper atmosphere mass spectrometer experiment

NASA Technical Reports Server (NTRS)

Hinson, E. W.

1981-01-01

The preliminary analysis and data analysis system development for the shuttle upper atmosphere mass spectrometer (SUMS) experiment are discussed. The SUMS experiment is designed to provide free stream atmospheric density, pressure, temperature, and mean molecular weight for the high altitude, high Mach number region.

Evaluation of Analysis Techniques for Fluted-Core Sandwich Cylinders

NASA Technical Reports Server (NTRS)

Lovejoy, Andrew E.; Schultz, Marc R.

2012-01-01

Buckling-critical launch-vehicle structures require structural concepts that have high bending stiffness and low mass. Fluted-core, also known as truss-core, sandwich construction is one such concept. In an effort to identify an analysis method appropriate for the preliminary design of fluted-core cylinders, the current paper presents and compares results from several analysis techniques applied to a specific composite fluted-core test article. The analysis techniques are evaluated in terms of their ease of use and for their appropriateness at certain stages throughout a design analysis cycle (DAC). Current analysis techniques that provide accurate determination of the global buckling load are not readily applicable early in the DAC, such as during preliminary design, because they are too costly to run. An analytical approach that neglects transverse-shear deformation is easily applied during preliminary design, but the lack of transverse-shear deformation results in global buckling load predictions that are significantly higher than those from more detailed analysis methods. The current state of the art is either too complex to be applied for preliminary design, or is incapable of the accuracy required to determine global buckling loads for fluted-core cylinders. Therefore, it is necessary to develop an analytical method for calculating global buckling loads of fluted-core cylinders that includes transverse-shear deformations, and that can be easily incorporated in preliminary design.

The Scrap Tire Problem: A Preliminary Economic Analysis (1985)

EPA Pesticide Factsheets

The purpose of the study was to conduct a preliminary economic analysis of the social benefits of EPA action to require more appropriate disposal of scrap tires versus the social costs of such an action.

Preliminary design package for prototype solar heating and cooling systems

NASA Technical Reports Server (NTRS)

1978-01-01

A summary is given of the preliminary analysis and design activity on solar heating and cooling systems. The analysis was made without site specific data other than weather; therefore, the results indicate performance expected under these special conditions. Major items include a market analysis, design approaches, trade studies and other special data required to evaluate the preliminary analysis and design. The program calls for the development and delivery of eight prototype solar heating and cooling systems for installation and operational test. Two heating and six heating and cooling units will be delivered for Single Family Residences, Multiple-family Residences and commercial applications.

Deep subsurface microbiology of 64-71 million year old inactive seamounts along the Louisville Seamount Chain

NASA Astrophysics Data System (ADS)

Sylvan, J. B.; Morono, Y.; Grim, S.; Inagaki, F.; Edwards, K. J.

2013-12-01

One of the objectives of IODP Expedition 330, Louisville Seamount Trail, was to sample and learn about the subsurface biosphere in the Louisville Seamount Chain (LSC). Seamounts are volcanic constructs that are ubiquitous along the seafloor - models suggest there are >100,000 seamounts of >1 km in height globally (Wessel et al., 2010). Therefore, knowledge about microbiology in the LSC subsurface can broadly be interpreted as representative of much the seafloor. In addition, despite the fact that the vast majority of the sea floor is comprised of crust >10 Ma, the majority of work to date has focused on young sites with active hydrology. Our presentation summarizes work focusing on subsurface microbiology from two different LSC seamounts: holes U1374A (65-71 Ma) and U1376A (64 Ma). We here present data for microbial biomass in the LSC subsurface using a method we developed to quantify microbial biomass in subseafloor ocean crust. We also present results from pyrotag analysis of 15 samples from holes U1374A and holes U1376A, representing several different lithologies from 40-491 meters below seafloor (mbsf) in hole U1374A and from 29-174 mbsf in hole U1376A. Finally, we present preliminary analysis of metagenomic sequencing from three of the samples from Hole U1376A. Biomass was low in the subsurface of both seamounts, ranging from below detection to ~104 cells cm-3. Bacteria comprised >99% of the prokaryotic community in LSC subsurface samples, therefore, bacterial diversity was assessed through 454 pyrosequencing of the V4V6 region of the 16S rRNA gene. Rarefaction analysis indicates that bacterial communities from the LSC subsurface are low diversity, on the order of a few hundred operational taxonomic units per sample. The phyla Actinobacteria, Bacteroidetes, Firmicutes and the classes α-, β- and γ-Proteobacteria are most abundant in the LSC subsurface. Within these, the orders Actinomycetales, Sphingobacteriales, Bacillales and Burkholderiales are the most common. Samples from different lithologies in hole U1374A grouped together, indicating more similarity to each other than to samples from hole U1376A. However, samples from different lithologies in hole U1376A were not similar to other samples from the same site, indicating some differences in the microbial communities between the two seamounts. Preliminary analysis of the metagenomic data will provide further assessment of community structure and reveal likely metabolisms present in the LSC subsurface. Altogether, the biomass data, pyrotag analysis and metagenomic sequencing provide a well-balanced analysis of subsurface microbiology in an old oceanic crustal environment. Wessel, P., Sandwell, D. T. & Kim, S. S. (2010). The Global Seamount Census. Oceanography 23, 24-33.

An in-depth comparison of the porcine, murine and human inflammasomes; lessons from the porcine genome and transcriptome.

PubMed

Dawson, Harry D; Smith, Allen D; Chen, Celine; Urban, Joseph F

2017-04-01

Emerging evidence suggests that swine are a scientifically acceptable intermediate species between rodents and humans to model immune function relevant to humans. The swine genome has recently been sequenced and several preliminary structural and functional analysis of the porcine immunome have been published. Herein we provide an expanded in silico analysis using an improved assembly of the porcine transcriptome that provides an in depth analysis of genes that are related to inflammasomes, responses to Toll-like receptor ligands, and M1 macrophage polarization and Escherichia coli as a model organism. Comparisons of the expansion or contraction of orthologous gene families indicated more similar rates and classes of genes in humans and pigs than in mice; however several novel porcine or artiodactyl-specific paralogs or pseudogenes were identified. Conservation of homology and structural motifs of orthologs revealed that the overall similarity to human proteins was significantly higher for pigs compared to mouse. Despite these similarities, two out of four canonical inflammasome pathways, Absent in melanoma 2 (AIM2) and NLR family and CARD domain containing 4 (NLRC4), were found to be missing in pigs. Pig M1 Mφ polarization in response to interferon-γ (IFN-γ) and lipopolysaccharide (LPS) was assessed, via the transcriptome, using next generation sequencing. Our analysis revealed predominantly human-like responses however some, mouse-like responses were observed, as well as induction of numerous pig or artiodactyl-specific genes. This work supports using swine to model both human immunological and inflammatory responses to infection. However, caution must be exercised as pigs differ from humans in several fundamental pathways. Published by Elsevier B.V.

Structural modeling and molecular simulation analysis of HvAP2/EREBP from barley.

PubMed

Pandey, Bharati; Sharma, Pradeep; Tyagi, Chetna; Goyal, Sukriti; Grover, Abhinav; Sharma, Indu

2016-06-01

AP2/ERF transcription factors play a critical role in plant development and stress adaptation. This study reports the three-dimensional ab initio-based model of AP2/EREBP protein of barley and its interaction with DNA. Full-length coding sequence of HvAP2/EREBP gene isolated from two Indian barley cultivars, RD 2503 and RD 31, was used to model the protein. Of five protein models obtained, the one with lowest C-score was chosen for further analysis. The N- and C-terminal regions of HvAP2 protein were found to be highly disordered. The dynamic properties of AP2/EREBP and its interaction with DNA were investigated by molecular dynamics simulation. Analysis of trajectories from simulation yielded the equilibrated conformation between 2-10ns for protein and 7-15ns for protein-DNA complex. We established relationship between DNA having GCC box and DNA-binding domain of HvAP2/EREBP was established by modeling 11-base-pair-long nucleotide sequence and HvAP2/EREBP protein using ab initio method. Analysis of protein-DNA interaction showed that a β-sheet motif constituting amino acid residues THR105, ARG100, ARG93, and ARG83 seems to play important role in stabilizing the complex as they form strong hydrogen bond interactions with the DNA motif. Taken together, this study provides first-hand comprehensive information detailing structural conformation and interactions of HvAP2/EREBP proteins in barley. The study intensifies the role of computational approaches for preliminary examination of unknown proteins in the absence of experimental information. It also provides molecular insight into protein-DNA binding for understanding and enhancing abiotic stress resistance for improving the water use efficiency in crop plants.

The phytochemical and genetic survey of common and dwarf juniper (Juniperus communis and Juniperus nana) identifies chemical races and close taxonomic identity of the species.

PubMed

Filipowicz, Natalia; Piotrowski, Arkadiusz; Ochocka, J Renata; Asztemborska, Monika

2006-07-01

Juniperus communis L. (= J. communis var. communis) and Juniperus nana Willd. (= J. communis var. SAXATILIS) are subspecies of juniper. J. communis grows widely in both hemispheres, primarily in lower elevations while J. nana is mainly observed in high mountains. Although they can be distinguished by morphological features, it is not known whether they are genetically and phytochemically distinct entities. We aimed to check whether it is possible to distinguish these two plants (i) by pharmaceutically important chemical traits and (ii) on the basis of intraspecifically highly polymorphic fragment of chloroplast DNA. We used GC with achiral as well as with enantioselective stationary phase columns to identify the main monoterpenes of the essential oil. Sequence analysis of the TRNL (UAA)- TRNF (GAA) intergenic spacer of the chloroplast genome was used as a genetic marker of taxonomic identity between these two subspecies. The chromatographic analysis showed the existence of three chemical races - the alpha-pinene type, the sabinene type and one with intermediate contents of these terpenes among both J. communis and J. nana. Surprisingly, sequence analysis of TRNL (UAA)- TRNF (GAA) revealed 100 % similarity between the common and the dwarf juniper. Thus, the monoterpene pattern is related to geographical origin, and not to the species identity. We suggest that the three chemical races identified in the present study should be considered as separate sources of pharmaceutical raw material. Our results demonstrate that the contents of alpha-pinene and sabinene may be applied as a quick diagnostic test for preliminary evaluation of plant material.

Preliminary Subsystem Designs for the Assured Crew Return Vehicle (ACRV), volumes 1-3

NASA Technical Reports Server (NTRS)

1990-01-01

A long term manned facility in space must include provisions for the safety of the crew. The resolution of this need was the design of an Assured Crew Return Vehicle (ACRV). The main focus is on the braking and landing system of the ACRV. This subsystem of the ACRV was divided into three phases. The Phase 1 analysis showed that the use of a tether to aid in the reentry of the ACRV was infeasible due to cost and efficiency. Therefore, a standard rocket would be used for reentry. It was also found that the continental United States was an achievable landing site for the ACRV. The Phase 2 analysis determined the L/D of the vehicle to be 1.8, thus requiring the use of a lifting body for reentry. It was also determined that shuttle tiles would be used for the thermal protection system. In addition, a parachute sequence for further deceleration was included, namely a ringslot drogue chute, a pilot chute, and finally a ringsail main parachute. This sequence was found to be capable of slowing the vehicle to a descent velocity of 9 to 10 m/s, which is the required velocity for aerial recovery. The Phase 3 analysis proved that a Sikorsky CH-53E helicopter is capable of retrieving the ACRV at 5.5 km altitude with minimal g-forces induced on the ACRV and minimal induced moments on the helicopter upon hookup. The helicopter would be modified such that it could stabilize the ACRV close to the bottom of helicopter and carry it to the nearest designated trauma center.

Proposed space shuttle cargo handling criteria at the operational site (preliminary)

NASA Technical Reports Server (NTRS)

Beck, P. E.

1972-01-01

The criteria for cargo handling at the operational site of space shuttles are presented, based on assumed program requirements. The concepts for the following functions are described: maintenance and checkout facility, transfer to launch pad, and launch pad. The requirements for the ground equipment are given along with the general sequences for cargo loading.

Contribution of Implicit Sequence Learning to Spoken Language Processing: Some Preliminary Findings with Hearing Adults

ERIC Educational Resources Information Center

Conway, Christopher M.; Karpicke, Jennifer; Pisoni, David B.

2007-01-01

Spoken language consists of a complex, sequentially arrayed signal that contains patterns that can be described in terms of statistical relations among language units. Previous research has suggested that a domain-general ability to learn structured sequential patterns may underlie language acquisition. To test this prediction, we examined the…

Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki

2007-09-01

Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less

Evaluation of magnetic resonance signal modification induced by hyaluronic acid therapy in chondromalacia patellae: a preliminary study.

PubMed

Magarelli, N; Palmieri, D; Ottaviano, L; Savastano, M; Barbato, M; Leone, A; Maggialetti, A; Ciampa, F P; Bonomo, L

2008-01-01

Hyaluronic Acid (HA) is an alternative method for the treatment of osteoarthritis (OA), which acts on pain through a double action: anti-inflammatory and synovial fluid (SF) visco-supplementation. Magnetic Resonance Imaging (MRI), utilizing specific sequences, is a valid method for studying the initial phase of chondral damage. The analysis of the data, obtained through the intensity of values taken by positioning Region of Interest (ROIs) within the lesion, determining the differences before and after treatment with HA injected into the knee. The results obtained after six months and one year from the injection were statistically different in respect to those taken before, immediately and after three months of treatment. MRI represents a valid tool to evaluate the grade of chondromalacia patellae and also to follow the cartilage modification induced by HA therapy.

Crystallization and preliminary X-ray analysis of a novel haemagglutinin component of the toxin complex of serotype C Clostridium botulinum.

PubMed

Hayashi, Shintaro; Akiyama, Tomonori; Sagane, Yoshimasa; Miyashita, Shin-Ichiro; Watanabe, Toshihiro; Yajima, Shunsuke; Niwa, Koichi

2014-03-01

The botulinum toxin complex, the causative agent of botulism, passes through the intestinal wall via sugar-chain-dependent cell binding of a haemagglutinin of 33 kDa molecular weight (HA-33). The amino-acid sequence of the C-terminal half of HA-33 of the serotype C strain Yoichi (C-Yoichi) shares only 46% identity with those of the major serotype C strains. Additionally, C-Yoichi HA-33 exhibits a unique sugar-binding specificity. In the present work, C-Yoichi HA-33 was expressed in Escherichia coli and crystallized. Diffraction data were collected at a resolution of 2.2 Å. The crystals belonged to space group R3. The complete detailed protein structure will yield insight into how the unique HA-33 protein recognizes sugar moieties.

Optimising magnetic resonance image quality of the ear in healthy dogs.

PubMed

Wolf, Davina; Lüpke, Matthias; Wefstaedt, Patrick; Klopmann, Thilo; Nolte, Ingo; Seifert, Hermann

2011-03-01

The aim of this study was to develop an examination protocol for magnetic resonance imaging, in order to display diagnostically important information of the canine middle and inner ear. To ensure that this protocol could also be used as a basis for determining pathological changes, the anatomical structures of the ear were presented in detail. To minimise stress through anaesthesia in live animals, preliminary examinations were carried out on four dog cadavers. During these initial examinations, three-dimensional (3D) sequences proved to be superior to two-dimensional ones. Therefore, only 3D sequences were applied for the main examinations performed on six clinically healthy Beagles. The anonymised MR images were rated by three experienced reviewers using a five-point scale. The most valuable sequence was a T2-weighted CISS sequence (TR = 16.7 ms, TE = 8.08 ms). This sequence proved to be most suitable for illustrating the inner ear structures and enabled good tissue contrasts. The sequence ranked second best was also a T2-weighted DESS sequence (TR = 19 ms, TE = 6 ms), allowing the imaging of the tympanic cavity and enabling 3D reconstruction due to its isotropic voxels. Due to low contrast and strong noise, the other sequences (TSE, FISP, MP RAGE) were not suitable for anatomical illustration of the middle and inner ear.

Dual-fuel, dual-throat engine preliminary analysis

NASA Technical Reports Server (NTRS)

Obrien, C. J.

1979-01-01

A propulsion system analysis of the dual fuel, dual throat engine for launch vehicle applications was conducted. Basic dual throat engine characterization data were obtained to allow vehicle optimization studies to be conducted. A preliminary baseline engine system was defined.

Prediction of cis/trans isomerization in proteins using PSI-BLAST profiles and secondary structure information.

PubMed

Song, Jiangning; Burrage, Kevin; Yuan, Zheng; Huber, Thomas

2006-03-09

The majority of peptide bonds in proteins are found to occur in the trans conformation. However, for proline residues, a considerable fraction of Prolyl peptide bonds adopt the cis form. Proline cis/trans isomerization is known to play a critical role in protein folding, splicing, cell signaling and transmembrane active transport. Accurate prediction of proline cis/trans isomerization in proteins would have many important applications towards the understanding of protein structure and function. In this paper, we propose a new approach to predict the proline cis/trans isomerization in proteins using support vector machine (SVM). The preliminary results indicated that using Radial Basis Function (RBF) kernels could lead to better prediction performance than that of polynomial and linear kernel functions. We used single sequence information of different local window sizes, amino acid compositions of different local sequences, multiple sequence alignment obtained from PSI-BLAST and the secondary structure information predicted by PSIPRED. We explored these different sequence encoding schemes in order to investigate their effects on the prediction performance. The training and testing of this approach was performed on a newly enlarged dataset of 2424 non-homologous proteins determined by X-Ray diffraction method using 5-fold cross-validation. Selecting the window size 11 provided the best performance for determining the proline cis/trans isomerization based on the single amino acid sequence. It was found that using multiple sequence alignments in the form of PSI-BLAST profiles could significantly improve the prediction performance, the prediction accuracy increased from 62.8% with single sequence to 69.8% and Matthews Correlation Coefficient (MCC) improved from 0.26 with single local sequence to 0.40. Furthermore, if coupled with the predicted secondary structure information by PSIPRED, our method yielded a prediction accuracy of 71.5% and MCC of 0.43, 9% and 0.17 higher than the accuracy achieved based on the singe sequence information, respectively. A new method has been developed to predict the proline cis/trans isomerization in proteins based on support vector machine, which used the single amino acid sequence with different local window sizes, the amino acid compositions of local sequence flanking centered proline residues, the position-specific scoring matrices (PSSMs) extracted by PSI-BLAST and the predicted secondary structures generated by PSIPRED. The successful application of SVM approach in this study reinforced that SVM is a powerful tool in predicting proline cis/trans isomerization in proteins and biological sequence analysis.

Preliminary design package for Sunair SEC-601 solar collector

NASA Technical Reports Server (NTRS)

1978-01-01

The preliminary design of the Owens-Illinois model Sunair SEC-601 tubular air solar collector is presented. Information in this package includes the subsystem design and development approaches, hazard analysis, and detailed drawings available as the preliminary design review.

Development of high repetition rate nitric oxide planar laser induced fluorescence imaging

NASA Astrophysics Data System (ADS)

Jiang, Naibo

This thesis has documented the development of a MHz repitition rate pulse burst laser system. Second harmonic and third harmonic efficiencies are improved by adding a Phase Conjugate Mirror to the system. Some high energy fundamental, second harmonic, and third harmonic burst sequences consisting of 1--12 pulses separated in time by between 4 and 12 microseconds are now routinely obtained. The reported burst envelopes are quite uniform. We have also demonstrated the ability to generate ultra-high frequency sequences of broadly wavelength tunable, high intensity laser pulses using a home built injection seeded Optical Parametric Oscillator (OPO), pumped by the second and third harmonic output of the pulse burst laser. Typical OPO output burst sequences consist of 6--10 pulses, separated in time by between 6 and 10 microseconds. With third harmonic pumping of the OPO system, we studied four conditions, two-crystal Singly Resonant OPO (SRO) cavity, three-crystal OPO cavity, single pass two-crystal Doubly Resonant OPO (DRO) cavity and double pass two-crystal OPO cavity. The double pass two-crystal OPO cavity gives the best operation in burst mode. For single pass OPO, the average total OPO conversion efficiency is approximately 25%. For double pass OPO, the average total OPO conversion efficiency is approximately 35%. As a preliminary work, we studied 532nm pumping of a single crystal OPO cavity. With single pulse pumping, the conversion efficiency can reach 30%. For both 355nm and 532nm pumping OPO, we have demonstrated injection seeding. The OPO output light linewidth is significantly narrowed. Some preliminary etalon traces are also reported. By mixing the OPO signal output at 622nm with residual third harmonic at 355nm, we obtained 226nm burst sequences with average pulse energy of ˜0.2 mJ. Injection seeding of the OPO increases the energy achieved by a factor of ˜2. 226nm burst sequences with reasonably uniform burst envelopes are reported. Using the system we have obtained, for the first time by any known optical method, Planar Laser Induced Fluorescence (PLIF) image sequences at ultrahigh (≥100kHz) frame rates, in particular NO PLIF image sequences, have been obtained in a Mach 2 jet. We also studied the possibility of utilizing a 250 kHz pulsed Nd:YVO 4 laser as the master oscillator. 10-pulse-10-mus spacing burst sequences with reasonably uniform burst envelope have been obtained. The total energy of the burst sequence is ˜2.5J.

Preliminary evaluation of diabatic heating distribution from FGGE level 3b analysis data

NASA Technical Reports Server (NTRS)

Kasahara, A.; Mizzi, A. P.

1985-01-01

A method is presented for calculating the global distribution of diabatic heating rate. Preliminary results of global heating rate evaluated from the European center for Medium Range Weather Forecasts Level IIIb analysis data is also presented.

40 CFR 161.170 - Preliminary analysis.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Preliminary analysis. 161.170 Section 161.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Product Chemistry Data Requirements § 161.170...

40 CFR 161.170 - Preliminary analysis.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Preliminary analysis. 161.170 Section 161.170 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Product Chemistry Data Requirements § 161.170...

NASA Hazard Analysis Process

NASA Technical Reports Server (NTRS)

Deckert, George

2010-01-01

This viewgraph presentation reviews The NASA Hazard Analysis process. The contents include: 1) Significant Incidents and Close Calls in Human Spaceflight; 2) Subsystem Safety Engineering Through the Project Life Cycle; 3) The Risk Informed Design Process; 4) Types of NASA Hazard Analysis; 5) Preliminary Hazard Analysis (PHA); 6) Hazard Analysis Process; 7) Identify Hazardous Conditions; 8) Consider All Interfaces; 9) Work a Preliminary Hazard List; 10) NASA Generic Hazards List; and 11) Final Thoughts

Characterization of Microbial Communities Associated With Deep-Sea Hydrothermal Vent Animals of the East Pacific Rise and the Galápagos Rift

NASA Astrophysics Data System (ADS)

Ward, N.; Page, S.; Heidelberg, J.; Eisen, J. A.; Fraser, C. M.

2002-12-01

The composition of microbial communities associated with deep-sea hydrothermal vent animals is of interest because of the key role of bacterial symbionts in driving the chemosynthetic food chain of the vent system, and also because bacterial biofilms attached to animal exterior surfaces may play a part in settlement of larval forms. Sequence analysis of 16S ribosomal RNA (rRNA) genes from such communities provides a snapshot of community structure, as this gene is present in all Bacteria and Archaea, and a useful phylogenetic marker for both cultivated microbial species, and uncultivated species such as many of those found in the deep-sea environment. Specimens of giant tube worms (Riftia pachyptila), mussels (Bathymodiolus thermophilus), and clams (Calyptogena magnifica) were collected during the 2002 R/V Atlantis research cruises to the East Pacific Rise (9N) and Galápagos Rift. Microbial biofilms attached to the exterior surfaces of individual animals were sampled, as were tissues known to harbor chemosynthetic bacterial endosymbionts. Genomic DNA was extracted from the samples using a commercially available kit, and 16S rRNA genes amplified from the mixed bacterial communities using the polymerase chain reaction (PCR) and oligonucleotide primers targeting conserved terminal regions of the 16S rRNA gene. The PCR products obtained were cloned into a plasmid vector and the recombinant plasmids transformed into cells of Escherichia coli. Individual cloned 16S rRNA genes were sequenced at the 5' end of the gene (the most phylogenetically informative region in most taxa) and the sequence data compared to publicly available gene sequence databases, to allow a preliminary assignment of clones to taxonomic groups within the Bacteria and Archaea, and to determine the overall composition and phylogenetic diversity of the animal-associated microbial communities. Analysis of Riftia pachyptila exterior biofilm samples revealed the presence of members of the delta and epsilon proteobacteria, low GC Gram positive bacteria (firmicutes), spirochetes, CFB (Cytophaga-Flavobacterium-Bacteroides) group, green nonsulfur bacteria, acidobacteria, verrucomicrobia, and planctomycetes. The presence of the latter three taxonomic groups is of special interest, as they represent phylogenetically distinct groups within the Bacteria for which specific ecological functions have not yet been identified, but which have been found to be widely distributed and often numerically significant in diverse terrestrial and aquatic habitats. Although further sequencing is required to demonstrate the presence of a Riftia-associated microbial population distinct from that of the surrounding seawater, results available from three Riftia individuals from the East Pacific Rise suggest this to be the case. Analysis of microbial communities associated with the gill tissue of the mussel Bathymodiolus thermophilus shows a population dominated by gamma-Proteobacterial chemoautotrophic symbionts, although lower frequency novel phylotypes have been detected. Representatives of specific taxonomic groups have been selected for sequencing of the complete 16S rRNA gene, and the sequences used to reconstruct phylogenetic trees to more accurately determine the evolutionary relationships between the novel sequences, and available sequences for both cultured and non-cultured bacteria.

Final definition and preliminary design study for the initial atmospheric cloud physics laboratory, a Spacelab mission payload

NASA Technical Reports Server (NTRS)

1976-01-01

The following areas related to the final definition and preliminary design study of the initial atmospheric cloud physics laboratory (ACPL) were covered: (1) proposal organization, personnel, schedule, and project management, (2) proposed configurations, (3) study objectives, (4) ACPL experiment program listing and description, (5) mission/flight flexibility and modularity/commonality, (6) study plan, and (7) description of following tasks: requirement analysis and definition task flow, systems analysis and trade studies, subsystem analysis and trade studies, specifications and interface control documents, preliminary design task flow, work breakdown structure, programmatic analysis and planning, and project costs. Finally, an overview of the scientific requirements was presented.

Microbial Community Responses to Glycine Addition in Kansas Prairie Soils

NASA Astrophysics Data System (ADS)

Bottos, E.; Roy Chowdhury, T.; White, R. A., III; Brislawn, C.; Fansler, S.; Kim, Y. M.; Metz, T. O.; McCue, L. A.; Jansson, J.

2015-12-01

Advances in sequencing technologies are rapidly expanding our abilities to unravel aspects of microbial community structure and function in complex systems like soil; however, characterizing the highly diverse communities is problematic, due primarily to challenges in data analysis. To tackle this problem, we aimed to constrain the microbial diversity in a soil by enriching for particular functional groups within a community through addition of "trigger substrates". Such trigger substrates, characterized by low molecular weight, readily soluble and diffusible in soil solution, representative of soil organic matter derivatives, would also be rapidly degradable. A relatively small energy investment to maintain the cell in a state of metabolic alertness for such substrates would be a better evolutionary strategy and presumably select for a cohort of microorganisms with the energetics and cellular machinery for utilization and growth. We chose glycine, a free amino acid (AA) known to have short turnover times (in the range of hours) in soil. As such, AAs are a good source of nitrogen and easily degradable, and can serve as building blocks for microbial proteins and other biomass components. We hypothesized that the addition of glycine as a trigger substrate will decrease microbial diversity and evenness, as taxa capable of metabolizing it are enriched in relation to those that are not. We tested this hypothesis by incubating three Kansas native prairie soils with glycine for 24 hours at 21 degree Celsius, and measured community level responses by 16S rRNA gene sequencing, metagenomics, and metatranscriptomics. Preliminary evaluation of 16S rRNA gene sequences revealed minor changes in bacterial community composition in response to glycine addition. We will also present data on functional gene abundance and expression. The results of these analyses will be useful in designing sequencing strategies aimed at dissecting and deciphering complex microbial communities.

New Coffee Plant-Infecting Xylella fastidiosa Variants Derived via Homologous Recombination.

PubMed

Jacques, Marie-Agnès; Denancé, Nicolas; Legendre, Bruno; Morel, Emmanuelle; Briand, Martial; Mississipi, Stelly; Durand, Karine; Olivier, Valérie; Portier, Perrine; Poliakoff, Françoise; Crouzillat, Dominique

2015-12-28

Xylella fastidiosa is a xylem-limited phytopathogenic bacterium endemic to the Americas that has recently emerged in Asia and Europe. Although this bacterium is classified as a quarantine organism in the European Union, importation of plant material from contaminated areas and latent infection in asymptomatic plants have engendered its inevitable introduction. In 2012, four coffee plants (Coffea arabica and Coffea canephora) with leaf scorch symptoms growing in a confined greenhouse were detected and intercepted in France. After identification of the causal agent, this outbreak was eradicated. Three X. fastidiosa strains were isolated from these plants, confirming a preliminary identification based on immunology. The strains were characterized by multiplex PCR and by multilocus sequence analysis/typing (MLSA-MLST) based on seven housekeeping genes. One strain, CFBP 8073, isolated from C. canephora imported from Mexico, was assigned to X. fastidiosa subsp. fastidiosa/X. fastidiosa subsp. sandyi. This strain harbors a novel sequence type (ST) with novel alleles at two loci. The two other strains, CFBP 8072 and CFBP 8074, isolated from Coffea arabica imported from Ecuador, were allocated to X. fastidiosa subsp. pauca. These two strains shared a novel ST with novel alleles at two loci. These MLST profiles showed evidence of recombination events. We provide genome sequences for CFBP 8072 and CFBP 8073 strains. Comparative genomic analyses of these two genome sequences with publicly available X. fastidiosa genomes, including the Italian strain CoDiRO, confirmed these phylogenetic positions and provided candidate alleles for coffee plant adaptation. This study demonstrates the global diversity of X. fastidiosa and highlights the diversity of strains isolated from coffee plants. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Short Communication: Lack of Support for Socially Connected HIV-1 Transmission Among Young Adult Black Men Who Have Sex with Men.

PubMed

Fujimoto, Kayo; Coghill, Lyndon M; Weier, Christopher A; Hwang, Lu-Yu; Kim, Ju Yeong; Schneider, John A; Metzker, Michael L; Brown, Jeremy M

2017-09-01

We explore the phylogenetic relationships among HIV sequences sampled from young adult black men who have sex with men (YAB-MSM), who are connected through peer referral/social ties and who attend common venues. Using 196 viral sequences sampled from the peripheral blood mononuclear cells of 10 individuals, our preliminary phylogenetic results indicate that these socially connected YAB-MSM are infected with distantly related viruses and provide no evidence for viral transmission between network members. Our results suggest that HIV-prevention strategies that target young adult MSM should extend beyond their network members and local community.

A Module Experimental Process System Development Unit (MEPSDU). [development of low cost solar arrays

NASA Technical Reports Server (NTRS)

1981-01-01

The technical readiness of a cost effective process sequence that has the potential for the production of flat plate photovoltaic modules which met the price goal in 1986 of $.70 or less per Watt peak was demonstrated. The proposed process sequence was reviewed and laboratory verification experiments were conducted. The preliminary process includes the following features: semicrystalline silicon (10 cm by 10 cm) as the silicon input material; spray on dopant diffusion source; Al paste BSF formation; spray on AR coating; electroless Ni plate solder dip metallization; laser scribe edges; K & S tabbing and stringing machine; and laminated EVA modules.

Cloning and Expression of a Ralstonia eutropha HF39 Gene Mediating Indigo Formation in Escherichia coli

PubMed Central

Drewlo, Sascha; Brämer, Christian O.; Madkour, Mohamed; Mayer, Frank; Steinbüchel, Alexander

2001-01-01

On complex medium Escherichia coli strains carrying hybrid plasmid pBEC/EE:11.0, pSKBEC/BE:9.0, pSKBEC/PP:3.3, or pSKBEC/PP:2.4 harboring genomic DNA of Ralstonia eutropha HF39 produced a blue pigment characterized as indigo by several chemical and spectroscopic methods. A 1,251-bp open reading frame (bec) was cloned and sequenced. The deduced amino acid sequence of bec showed only weak similarities to short-chain acyl-coenzyme A dehydrogenases, and the gene product catalyzed formation of indoxyl, a reactive preliminary stage for production of indigo. PMID:11282658

Crystallization and preliminary crystallographic analysis of calcium-binding protein-2 from Entamoeba histolytica and its complexes with strontium and the IQ1 motif of myosin V

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gourinath, S., E-mail: sgourinath@mail.jnu.ac.in; Padhan, Narendra; Alam, Neelima

2005-04-01

Calcium-binding protein-2 (EhCaBP2) crystals were grown using MPD as a precipitant. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. Calcium plays a pivotal role in the pathogenesis of amoebiasis, a major disease caused by Entamoeba histolytica. Two domains with four canonical EF-hand-containing calcium-binding proteins (CaBPs) have been identified from E. histolytica. Even though they have very high sequence similarity, these bind to different target proteins in a Ca{sup 2+}-dependent manner, leading to different functional pathways. Calcium-binding protein-2 (EhCaBP2) crystals were grown usingmore » MPD as a precipitant. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 111.74, b = 68.83, c = 113.25 Å, β = 116.7°. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 69.18, b = 112.03, c = 93.42 Å, β = 92.8°. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. This complex was crystallized with MPD and ethanol as precipitating agents. These crystals belong to space group P2{sub 1}, with unit-cell parameters a = 60.5, b = 69.86, c = 86.5 Å, β = 97.9°.« less

Vehicle Design Evaluation Program (VDEP). A computer program for weight sizing, economic, performance and mission analysis of fuel-conservative aircraft, multibodied aircraft and large cargo aircraft using both JP and alternative fuels

NASA Technical Reports Server (NTRS)

Oman, B. H.

1977-01-01

The NASA Langley Research Center vehicle design evaluation program (VDEP-2) was expanded by (1) incorporating into the program a capability to conduct preliminary design studies on subsonic commercial transport type aircraft using both JP and such alternate fuels as hydrogen and methane;(2) incorporating an aircraft detailed mission and performance analysis capability; and (3) developing and incorporating an external loads analysis capability. The resulting computer program (VDEP-3) provides a preliminary design tool that enables the user to perform integrated sizing, structural analysis, and cost studies on subsonic commercial transport aircraft. Both versions of the VDEP-3 Program which are designated preliminary Analysis VDEP-3 and detailed Analysis VDEP utilize the same vehicle sizing subprogram which includes a detailed mission analysis capability, as well as a geometry and weight analysis for multibodied configurations.

Development of Phased-Array Ultrasonic Testing Acceptability Criteria : (Phase II)

DOT National Transportation Integrated Search

2014-10-01

The preliminary technical approach and scan plans developed during phase I of this research was implemented on testing four butt-weld specimens. The ray path analysis carried out to develop the scan plans and the preliminary data analysis indicated t...

Facile Recovery of Individual High-Molecular-Weight, Low-Copy-Number Natural Plasmids for Genomic Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, L.E.; Detter, C,; Barrie, K.

2006-06-01

Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less

76 FR 36086 - Certain Circular Welded Non-Alloy Steel Pipe From Mexico: Final Results of Antidumping Duty...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-21

... ``TUNA's No-Shipment Claim'' section of this notice for further explanation). As a result of our analysis... Results Analysis Memorandum for Mueller Comercial, S. de R.L. de C.V.,'' dated February 10, 2011 (Post-Preliminary Results Analysis Memorandum). As part of that post-preliminary calculation, three memoranda from...

Advanced Field Artillery System (AFAS) Future Armored Resupply Vehicle (FARV) Simulation Feasibility Analysis Study (FAS). Appendix C-F. Revision 1.0

DTIC Science & Technology

1994-07-18

09 Software Product Training 3 .4 .11 Physical Cues Segment Development3 .01 Technical Management .02 SW Requirements Analysis .03 Preliminary Design...Mission Planning Subsystem Development3 .01 Technical Management .02 SW Requirements Analysis .03 Preliminary Design - .04 Detailed Design .05 Code & CSU

Dimensions of Human-Work Domain Interaction: A Preliminary Analysis for the Design of a Corporate Digital Library.

ERIC Educational Resources Information Center

Xie, Hong

2003-01-01

Applies the cognitive system engineering approach to investigate human-work interaction at a corporate setting. Reports preliminary analysis of data collected from diary analysis and interview of 20 subjects. Results identify three dimensions for each of four interactive activities involved in human-work interaction and their relationships.…

A Preliminary Study on Gender Differences in Studying Systems Analysis and Design

ERIC Educational Resources Information Center

Lee, Fion S. L.; Wong, Kelvin C. K.

2017-01-01

Systems analysis and design is a crucial task in system development and is included in a typical information systems programme as a core course. This paper presented a preliminary study on gender differences in studying a systems analysis and design course of an undergraduate programme. Results indicated that male students outperformed female…

Pseudomonas gallaeciensis sp. nov., isolated from crude-oil-contaminated intertidal sand samples after the Prestige oil spill.

PubMed

Mulet, Magdalena; Sánchez, David; Rodríguez, Ana C; Nogales, Balbina; Bosch, Rafael; Busquets, Antonio; Gomila, Margarita; Lalucat, Jorge; García-Valdés, Elena

2018-04-11

Strains V113 T , V92 and V120 have been isolated from sand samples taken at the Atlantic intertidal shore in Galicia, Spain, after the Prestige oil spill. A preliminary analysis of the 16S rRNA and the partial rpoD gene sequences indicated that these strains belonged to the Pseudomonas genus, but they were distinct from any known Pseudomonas species. They were extensively characterized by a polyphasic taxonomic approach and phylogenetic data that confirmed that these strains belonged to the Pseudomonas pertucinogena group. Phylogenetic analysis of 16S rRNA, gyrB and rpoD gene sequences showed that the three strains were 99% similar and were closely related to members of the P. pertucinogena group, with less than 94% similarity to strains of established species; Pseudomonas pachastrellae was the closest relative. The Average Nucleotide Index based on blast values was 89.0% between V113 T and the P. pachastrellae type strain, below the accepted species level (95%). The predominant cellular fatty acid contents and whole cell protein profiles determined by MALDI-TOF mass spectrometry also differentiated the studied strains from known Pseudomonas species. We therefore conclude that strains V113 T , V92 and V120 represent a novel species of Pseudomonas, for which the name Pseudomonas gallaeciensis is proposed; the type strain is V113 T (=CCUG 67583 T =LMG 29038 T ). Copyright © 2018 Elsevier GmbH. All rights reserved.

A Chinese patient with peritoneal dialysis-related peritonitis caused by Gordonia terrae: a case report.

PubMed

Hou, Chenrui; Yang, Yun; Li, Ziyang

2017-02-28

Gordonia terrae is a rare cause of clinical infections, with only 23 reported cases. We report the first case of peritoneal dialysis-related peritonitis caused by Gordonia terrae in mainland China. A 52-year-old man developed peritoneal dialysis-related peritonitis and received preliminary antibiotic treatment. After claiming that his symptoms had been resolved, the patient insisted on being discharged (despite our recommendations) and did not receive continued treatment after leaving the hospital. A telephone follow-up with the patient's relatives revealed that the patient died 3 months later. Routine testing did not identify the bacterial strain responsible for the infection, although matrix-assisted laser desorption/ionization time-of-flight mass spectrometry identified the strain as Gordonia rubropertincta. However, a 16S rRNA sequence analysis using an isolate from the peritoneal fluid culture revealed that the responsible strain was actually Gordonia terrae. Similar to this case, all previously reported cases have involved a delayed diagnosis and initial treatment failure, and the definitive diagnosis required a 16S rRNA sequence analysis. Changes from an inappropriate antibiotic therapy to an appropriate one have relied on microbiological testing and were performed 7-32 days after the initial treatment. The findings from our case and the previously reported cases indicate that peritoneal dialysis-related peritonitis caused by Gordonia terrae can be difficult to identify and treat. It may be especially challenging to diagnose these cases in countries with limited diagnostic resources.

Global patterns in coronavirus diversity

PubMed Central

Johnson, Christine K.; Greig, Denise J.; Kramer, Sarah; Che, Xiaoyu; Wells, Heather; Hicks, Allison L.; Joly, Damien O.; Wolfe, Nathan D.; Daszak, Peter; Karesh, William; Lipkin, W. I.; Morse, Stephen S.; Mazet, Jonna A. K.

2017-01-01

Abstract Since the emergence of Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) and Middle East Respiratory Syndrom Coronavirus (MERS-CoV) it has become increasingly clear that bats are important reservoirs of CoVs. Despite this, only 6% of all CoV sequences in GenBank are from bats. The remaining 94% largely consist of known pathogens of public health or agricultural significance, indicating that current research effort is heavily biased towards describing known diseases rather than the ‘pre-emergent’ diversity in bats. Our study addresses this critical gap, and focuses on resource poor countries where the risk of zoonotic emergence is believed to be highest. We surveyed the diversity of CoVs in multiple host taxa from twenty countries to explore the factors driving viral diversity at a global scale. We identified sequences representing 100 discrete phylogenetic clusters, ninety-one of which were found in bats, and used ecological and epidemiologic analyses to show that patterns of CoV diversity correlate with those of bat diversity. This cements bats as the major evolutionary reservoirs and ecological drivers of CoV diversity. Co-phylogenetic reconciliation analysis was also used to show that host switching has contributed to CoV evolution, and a preliminary analysis suggests that regional variation exists in the dynamics of this process. Overall our study represents a model for exploring global viral diversity and advances our fundamental understanding of CoV biodiversity and the potential risk factors associated with zoonotic emergence. PMID:28630747

Study of aircraft centered navigation, guidance, and traffic situation system concept for terminal area operation

NASA Technical Reports Server (NTRS)

Anderson, W. W.; Will, R. W.; Grantham, C.

1972-01-01

A concept for automating the control of air traffic in the terminal area in which the primary man-machine interface is the cockpit is described. The ground and airborne inputs required for implementing this concept are discussed. Digital data link requirements of 10,000 bits per second are explained. A particular implementation of this concept including a sequencing and separation algorithm which generates flight paths and implements a natural order landing sequence is presented. Onboard computer/display avionics utilizing a traffic situation display is described. A preliminary simulation of this concept has been developed which includes a simple, efficient sequencing algorithm and a complete aircraft dynamics model. This simulated jet transport was flown through automated terminal-area traffic situations by pilots using relatively sophisticated displays, and pilot performance and observations are discussed.

Space power system scheduling using an expert system

NASA Technical Reports Server (NTRS)

Bahrami, K. A.; Biefeld, E.; Costello, L.; Klein, J. W.

1986-01-01

A most pressing problem in space exploration is timely spacecraft power system sequence generation, which requires the scheduling of a set of loads given a set of resource constraints. This is particularly important after an anomaly or failure. This paper discusses the power scheduling problem and how the software program, Plan-It, can be used as a consultant for scheduling power system activities. Modeling of power activities, human interface, and two of the many strategies used by Plan-It are discussed. Preliminary results showing the development of a conflict-free sequence from an initial sequence with conflicts is presented. It shows that a 4-day schedule can be generated in a matter of a few minutes, which provides sufficient time in many cases to aid the crew in the replanning of loads and generation use following a failure or anomaly.

Development and preliminary evaluation of a 90K Axiom® SNP array for the allo-octoploid cultivated strawberry Fragaria ×ananassa

USDA-ARS?s Scientific Manuscript database

A high-throughput genotyping platform is needed to enable marker-assisted breeding in the allo-octoploid cultivated strawberry Fragaria ×ananassa. Short-read sequences from one diploid and 19 octoploid accessions were aligned to the diploid Fragaria vesca ‘Hawaii 4’ reference genome to identify sing...

Transforming Undergraduate Students into Junior Researchers: Oxidation-Reduction Sequence as a Problem-Based Case Study

ERIC Educational Resources Information Center

Saloranta, Tiina; Lo¨nnqvist, Jan-Erik; Eklund, Patrik C.

2016-01-01

In our upper-level undergraduate laboratory course in organic chemistry we focus on a research-oriented task in a context-based and problem-based learning approach. The course starts with a preliminary training period where the students learn how to safely and independently perform synthesis and purification procedures and to operate the most…

A Method for the Control of Multigrasp Myoelectric Prosthetic Hands

PubMed Central

Dalley, Skyler Ashton; Varol, Huseyin Atakan; Goldfarb, Michael

2012-01-01

This paper presents the design and preliminary experimental validation of a multigrasp myoelectric controller. The described method enables direct and proportional control of multigrasp prosthetic hand motion among nine characteristic postures using two surface electromyography electrodes. To assess the efficacy of the control method, five nonamputee subjects utilized the multigrasp myoelectric controller to command the motion of a virtual prosthesis between random sequences of target hand postures in a series of experimental trials. For comparison, the same subjects also utilized a data glove, worn on their native hand, to command the motion of the virtual prosthesis for similar sequences of target postures during each trial. The time required to transition from posture to posture and the percentage of correctly completed transitions were evaluated to characterize the ability to control the virtual prosthesis using each method. The average overall transition times across all subjects were found to be 1.49 and 0.81 s for the multigrasp myoelectric controller and the native hand, respectively. The average transition completion rates for both were found to be the same (99.2%). Supplemental videos demonstrate the virtual prosthesis experiments, as well as a preliminary hardware implementation. PMID:22180515

SRB thermal curtain design support

NASA Technical Reports Server (NTRS)

Lundblad, Wayne E.

1990-01-01

The objective during this time period was to perform a preliminary thermal analysis using some measured and estimated thermal properties on the angle-interlock materials. This preliminary thermal analysis is to serve as a guide for identifying any potential problems in blanket construction and identifying future tests.

Highway Vehicle Retrofit Evaluation : Phase I. Analysis and Preliminary Evaluation Results. Volume 1. Sections 1 through 3.

DOT National Transportation Integrated Search

1975-11-01

This report in two volumes presents an analysis and preliminary evaluation of selected used-car and light-truck fuel economy retrofit devices. In particular, information is provided that depicts the performance characteristics of retrofit devices tha...

Discovery of Neuropeptides in the Nematode Ascaris suum by Database Mining and Tandem Mass Spectrometry

PubMed Central

Jarecki, Jessica L.; Frey, Brian L.; Smith, Lloyd M.; Stretton, Antony O.

2011-01-01

Liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) was used to discover peptides in extracts of the large parasitic nematode Ascaris suum. This required the assembly of a new database of known and predicted peptides. In addition to those already sequenced, peptides were either previously predicted to be processed from precursor proteins identified in an A. suum library of expressed sequence tags (ESTs), or newly predicted from a library of A. suum genome survey sequences (GSSs). The predicted MS/MS fragmentation patterns of this collection of real and putative peptides were compared with the actual fragmentation patterns found in the MS/MS spectra of peptides fractionated by MS; this enabled individual peptides to be sequenced. Many previously identified peptides were found, and 21 novel peptides were discovered. Thus, this approach is very useful, despite the fact that the available GSS database is still preliminary, having only 1X coverage. PMID:21524146

Three-dimensional sampling perfection with application-optimised contrasts using a different flip angle evolutions sequence for routine imaging of the spine: preliminary experience

PubMed Central

Tins, B; Cassar-Pullicino, V; Haddaway, M; Nachtrab, U

2012-01-01

Objectives The bulk of spinal imaging is still performed with conventional two-dimensional sequences. This study assesses the suitability of three-dimensional sampling perfection with application-optimised contrasts using a different flip angle evolutions (SPACE) sequence for routine spinal imaging. Methods 62 MRI examinations of the spine were evaluated by 2 examiners in consensus for the depiction of anatomy and presence of artefact. We noted pathologies that might be missed using the SPACE sequence only or the SPACE and a sagittal T1 weighted sequence. The reference standards were sagittal and axial T1 weighted and T2 weighted sequences. At a later date the evaluation was repeated by one of the original examiners and an additional examiner. Results There was good agreement of the single evaluations and consensus evaluation for the conventional sequences: κ>0.8, confidence interval (CI)>0.6–1.0. For the SPACE sequence, depiction of anatomy was very good for 84% of cases, with high interobserver agreement, but there was poor interobserver agreement for other cases. For artefact assessment of SPACE, κ=0.92, CI=0.92–1.0. The SPACE sequence was superior to conventional sequences for depiction of anatomy and artefact resistance. The SPACE sequence occasionally missed bone marrow oedema. In conjunction with sagittal T1 weighted sequences, no abnormality was missed. The isotropic SPACE sequence was superior to conventional sequences in imaging difficult anatomy such as in scoliosis and spondylolysis. Conclusion The SPACE sequence allows excellent assessment of anatomy owing to high spatial resolution and resistance to artefact. The sensitivity for bone marrow abnormalities is limited. PMID:22374284

Three-dimensional sampling perfection with application-optimised contrasts using a different flip angle evolutions sequence for routine imaging of the spine: preliminary experience.

PubMed

Tins, B; Cassar-Pullicino, V; Haddaway, M; Nachtrab, U

2012-08-01

The bulk of spinal imaging is still performed with conventional two-dimensional sequences. This study assesses the suitability of three-dimensional sampling perfection with application-optimised contrasts using a different flip angle evolutions (SPACE) sequence for routine spinal imaging. 62 MRI examinations of the spine were evaluated by 2 examiners in consensus for the depiction of anatomy and presence of artefact. We noted pathologies that might be missed using the SPACE sequence only or the SPACE and a sagittal T(1) weighted sequence. The reference standards were sagittal and axial T(1) weighted and T(2) weighted sequences. At a later date the evaluation was repeated by one of the original examiners and an additional examiner. There was good agreement of the single evaluations and consensus evaluation for the conventional sequences: κ>0.8, confidence interval (CI)>0.6-1.0. For the SPACE sequence, depiction of anatomy was very good for 84% of cases, with high interobserver agreement, but there was poor interobserver agreement for other cases. For artefact assessment of SPACE, κ=0.92, CI=0.92-1.0. The SPACE sequence was superior to conventional sequences for depiction of anatomy and artefact resistance. The SPACE sequence occasionally missed bone marrow oedema. In conjunction with sagittal T(1) weighted sequences, no abnormality was missed. The isotropic SPACE sequence was superior to conventional sequences in imaging difficult anatomy such as in scoliosis and spondylolysis. The SPACE sequence allows excellent assessment of anatomy owing to high spatial resolution and resistance to artefact. The sensitivity for bone marrow abnormalities is limited.

The engineering design integration (EDIN) system. [digital computer program complex

NASA Technical Reports Server (NTRS)

Glatt, C. R.; Hirsch, G. N.; Alford, G. E.; Colquitt, W. N.; Reiners, S. J.

1974-01-01

A digital computer program complex for the evaluation of aerospace vehicle preliminary designs is described. The system consists of a Univac 1100 series computer and peripherals using the Exec 8 operating system, a set of demand access terminals of the alphanumeric and graphics types, and a library of independent computer programs. Modification of the partial run streams, data base maintenance and construction, and control of program sequencing are provided by a data manipulation program called the DLG processor. The executive control of library program execution is performed by the Univac Exec 8 operating system through a user established run stream. A combination of demand and batch operations is employed in the evaluation of preliminary designs. Applications accomplished with the EDIN system are described.

The development of 10 novel polymorphic microsatellite markers through next generation sequencing and a preliminary population genetic analysis for the endangered Glenelg spiny crayfish, Euastacus bispinosus.

PubMed

Miller, Adam D; Van Rooyen, Anthony; Sweeney, Oisín F; Whiterod, Nick S; Weeks, Andrew R

2013-07-01

The Glenelg spiny crayfish, Euastacus bispinosus, is an iconic freshwater invertebrate of south eastern Australia and listed as 'endangered' under the Environment Protection and Biodiversity Conservation Act 1999, and 'vulnerable' under the International Union for Conservation of Nature's Red List. The species has suffered major population declines as a result of over-fishing, low environmental flows, the introduction of invasive fish species and habitat degradation. In order to develop an effective conservation strategy, patterns of gene flow, genetic structure and genetic diversity across the species distribution need to be clearly understood. In this study we develop a suite of polymorphic microsatellite markers by next generation sequencing. A total of 15 polymorphic loci were identified and 10 characterized using 22 individuals from the lower Glenelg River. We observed low to moderate genetic variation across most loci (mean number of alleles per locus = 2.80; mean expected heterozygosity = 0.36) with no evidence of individual loci deviating significantly from Hardy-Weinberg equilibrium. Marker independence was confirmed with tests for linkage disequilibrium, and analyses indicated no evidence of null alleles across loci. Individuals from two additional sites (Crawford River, Victoria; Ewens Ponds Conservation Park, South Australia) were genotyped at all 10 loci and a preliminary investigation of genetic diversity and population structure was undertaken. Analyses indicate high levels of genetic differentiation among sample locations (F ST = 0.49), while the Ewens Ponds population is genetically homogeneous, indicating a likely small founder group and ongoing inbreeding. Management actions will be needed to restore genetic diversity in this and possibly other at risk populations. These markers will provide a valuable resource for future population genetic assessments so that an effective framework can be developed for implementing conservation strategies for E. bispinosus.

Preliminary experience with a novel method of three-dimensional co-registration of prostate cancer digital histology and in vivo multiparametric MRI.

PubMed

Orczyk, C; Rusinek, H; Rosenkrantz, A B; Mikheev, A; Deng, F-M; Melamed, J; Taneja, S S

2013-12-01

To assess a novel method of three-dimensional (3D) co-registration of prostate cancer digital histology and in-vivo multiparametric magnetic resonance imaging (mpMRI) image sets for clinical usefulness. A software platform was developed to achieve 3D co-registration. This software was prospectively applied to three patients who underwent radical prostatectomy. Data comprised in-vivo mpMRI [T2-weighted, dynamic contrast-enhanced weighted images (DCE); apparent diffusion coefficient (ADC)], ex-vivo T2-weighted imaging, 3D-rebuilt pathological specimen, and digital histology. Internal landmarks from zonal anatomy served as reference points for assessing co-registration accuracy and precision. Applying a method of deformable transformation based on 22 internal landmarks, a 1.6 mm accuracy was reached to align T2-weighted images and the 3D-rebuilt pathological specimen, an improvement over rigid transformation of 32% (p = 0.003). The 22 zonal anatomy landmarks were more accurately mapped using deformable transformation than rigid transformation (p = 0.0008). An automatic method based on mutual information, enabled automation of the process and to include perfusion and diffusion MRI images. Evaluation of co-registration accuracy using the volume overlap index (Dice index) met clinically relevant requirements, ranging from 0.81-0.96 for sequences tested. Ex-vivo images of the specimen did not significantly improve co-registration accuracy. This preliminary analysis suggests that deformable transformation based on zonal anatomy landmarks is accurate in the co-registration of mpMRI and histology. Including diffusion and perfusion sequences in the same 3D space as histology is essential further clinical information. The ability to localize cancer in 3D space may improve targeting for image-guided biopsy, focal therapy, and disease quantification in surveillance protocols. Copyright © 2013 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

Genetic abnormalities in bicuspid aortic valve root phenotype: preliminary results.

PubMed

Girdauskas, Evaldas; Geist, Lisa; Disha, Kushtrim; Kazakbaev, Iliaz; Groß, Tatiana; Schulz, Solveig; Ungelenk, Martin; Kuntze, Thomas; Reichenspurner, Hermann; Kurth, Ingo

2017-07-01

Genetic defects associated with bicuspid aortopathy have been infrequently analysed. Our goal was to examine the prevalence of rare genetic variants in patients with a bicuspid aortic valve (BAV) with a root phenotype using next-generation sequencing technology. We investigated a total of 124 patients with BAV with a root dilatation phenotype who underwent aortic valve ± proximal aortic surgery at a single institution (BAV database, n  = 812) during a 20-year period (1995-2015). Cross-sectional follow-up revealed 63 (51%) patients who were still alive and willing to participate. Systematic follow-up visits were scheduled from March to December 2015 and included aortic imaging as well as peripheral blood sampling for genetic testing. Next-generation sequencing libraries were prepared using a custom-made HaloPlex HS gene panel and included 20 candidate genes known to be associated with aortopathy and BAV. The primary end-point was the prevalence of genetic defects in our study cohort. A total of 63 patients (mean age 46 ± 10 years, 92% men) with BAV root phenotype and mean post-aortic valve replacement follow-up of 10.3 ± 4.9 years were included. Our genetic analysis yielded a wide spectrum of rare, potentially or likely pathogenic variants in 19 (30%) patients, with NOTCH1 variants being the most common ( n  = 6). Moreover, deleterious variants were revealed in AXIN1 ( n  = 3), NOS3 ( n  = 3), ELN ( n  = 2), FBN1 ( n  = 2) , FN1 ( n  = 2) and rarely in other candidate genes. Our preliminary study demonstrates a high prevalence and a wide spectrum of rare genetic variants in patients with the BAV root phenotype, indicative of the potentially congenital origin of associated aortopathy in this specific BAV cohort. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

40 CFR 154.31 - Notices of Preliminary Determination.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., retail food prices, and otherwise on the agricultural economy. (3) Send the proposed notices and analysis... PROGRAMS SPECIAL REVIEW PROCEDURES Procedures § 154.31 Notices of Preliminary Determination. The Administrator shall prepare a Notice of Preliminary Determination after the close of the comment period on a...

33 CFR 279.7 - Information collection and preliminary analysis.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 3 2013-07-01 2013-07-01 false Information collection and preliminary analysis. 279.7 Section 279.7 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.7 Information...

33 CFR 279.7 - Information collection and preliminary analysis.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 3 2014-07-01 2014-07-01 false Information collection and preliminary analysis. 279.7 Section 279.7 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.7 Information...

33 CFR 279.7 - Information collection and preliminary analysis.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 3 2012-07-01 2012-07-01 false Information collection and preliminary analysis. 279.7 Section 279.7 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE RESOURCE USE: ESTABLISHMENT OF OBJECTIVES § 279.7 Information...

Preliminary analysis of coronal electron content measurements from spacecraft Helios A around first solar occultation

NASA Technical Reports Server (NTRS)

Edenhofer, P.; Esposito, P. B.; Martin, W. L.; Zygielbaum, A. I.; Hansen, R. T.; Hansen, S. F.; Lueneburg, E.

1977-01-01

Steady-state and dynamical features of the electron density distribution in the solar corona emerge from a preliminary analysis of Helios A electron content measurements. There are strong indications that correlations can be established with earth-bound K-coronagraph measurements.

Study on the Preliminary Design of ARGO-M Operation System

NASA Astrophysics Data System (ADS)

Seo, Yoon-Kyung; Lim, Hyung-Chul; Rew, Dong-Young; Jo, Jung Hyun; Park, Jong-Uk; Park, Eun-Seo; Park, Jang-Hyun

2010-12-01

Korea Astronomy and Space Science Institute has been developing one mobile satellite laser ranging system named as accurate ranging system for geodetic observation-mobile (ARGO-M). Preliminary design of ARGO-M operation system (AOS) which is one of the ARGO-M subsystems was completed in 2009. Preliminary design results are applied to the following development phase by performing detailed design with analysis of pre-defined requirements and analysis of the derived specifications. This paper addresses the preliminary design of the whole AOS. The design results in operation and control part which is a key part in the operation system are described in detail. Analysis results of the interface between operation-supporting hardware and the control computer are summarized, which is necessary in defining the requirements for the operation-supporting hardware. Results of this study are expected to be used in the critical design phase to finalize the design process.

On-line prediction of yield grade, longissimus muscle area, preliminary yield grade, adjusted preliminary yield grade, and marbling score using the MARC beef carcass image analysis system.

PubMed

Shackelford, S D; Wheeler, T L; Koohmaraie, M

2003-01-01

The present experiment was conducted to evaluate the ability of the U.S. Meat Animal Research Center's beef carcass image analysis system to predict calculated yield grade, longissimus muscle area, preliminary yield grade, adjusted preliminary yield grade, and marbling score under commercial beef processing conditions. In two commercial beef-processing facilities, image analysis was conducted on 800 carcasses on the beef-grading chain immediately after the conventional USDA beef quality and yield grades were applied. Carcasses were blocked by plant and observed calculated yield grade. The carcasses were then separated, with 400 carcasses assigned to a calibration data set that was used to develop regression equations, and the remaining 400 carcasses assigned to a prediction data set used to validate the regression equations. Prediction equations, which included image analysis variables and hot carcass weight, accounted for 90, 88, 90, 88, and 76% of the variation in calculated yield grade, longissimus muscle area, preliminary yield grade, adjusted preliminary yield grade, and marbling score, respectively, in the prediction data set. In comparison, the official USDA yield grade as applied by online graders accounted for 73% of the variation in calculated yield grade. The technology described herein could be used by the beef industry to more accurately determine beef yield grades; however, this system does not provide an accurate enough prediction of marbling score to be used without USDA grader interaction for USDA quality grading.

Word structures of Granada Spanish-speaking preschoolers with typical versus protracted phonological development.

PubMed

Bernhardt, B May; Hanson, R; Perez, D; Ávila, C; Lleó, C; Stemberger, J P; Carballo, G; Mendoza, E; Fresneda, D; Chávez-Peón, M

2015-01-01

Research on children's word structure development is limited. Yet, phonological intervention aims to accelerate the acquisition of both speech-sounds and word structure, such as word length, stress or shapes in CV sequences. Until normative studies and meta-analyses provide in-depth information on this topic, smaller investigations can provide initial benchmarks for clinical purposes. To provide preliminary reference data for word structure development in a variety of Spanish with highly restricted coda use: Granada Spanish (similar to many Hispano-American varieties). To be clinically applicable, such data would need to show differences by age, developmental typicality and word structure complexity. Thus, older typically developing (TD) children were expected to show higher accuracy than younger children and those with protracted phonological development (PPD). Complex or phonologically marked forms (e.g. multisyllabic words, clusters) were expected to be late developing. Participants were 59 children aged 3-5 years in Granada, Spain: 30 TD children, and 29 with PPD and no additional language impairments. Single words were digitally recorded by a native Spanish speaker using a 103-word list and transcribed by native Spanish speakers, with confirmation by a second transcriber team and acoustic analysis. The program Phon 1.5 provided quantitative data. In accordance with expectations, the TD and older age groups had better-established word structures than the younger children and those with PPD. Complexity was also relevant: more structural mismatches occurred in multisyllabic words, initial unstressed syllables and clusters. Heterosyllabic consonant sequences were more accurate than syllable-initial sequences. The most common structural mismatch pattern overall was consonant deletion, with syllable deletion most common in 3-year-olds and children with PPD. The current study provides preliminary reference data for word structure development in a Spanish variety with restricted coda use, both by age and types of word structures. Between ages 3 and 5 years, global measures (whole word match, word shape match) distinguished children with typical versus protracted phonological development. By age 4, children with typical development showed near-mastery of word structures, whereas 4- and 5-year-olds with PPD continued to show syllable deletion and cluster reduction, especially in multisyllabic words. The results underline the relevance of multisyllabic words and words with clusters in Spanish phonological assessment and the utility of word structure data for identification of protracted phonological development. © 2014 Royal College of Speech and Language Therapists.

Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.

PubMed

Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping

2012-04-25

A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.

First report of the post-fire morel Morchella exuberans in eastern North America.

PubMed

Miller, Andrew N; Raudabaugh, Daniel B; Iturriaga, Teresa; Matheny, P Brandon; Petersen, Ronald H; Hughes, Karen W; Gube, Matthias; Powers, Rob A; James, Timothy Y; O'Donnell, Kerry

2017-01-01

Reports of true morels (Morchella) fruiting on conifer burn sites are common in western North America where five different fire-adapted species of black morels (Elata Clade) have been documented based on multilocus phylogenetic analyses. Fruiting of post-fire morels in eastern North America, by comparison, are rare and limited to a report from Minnesota in 1977 and eastern Ontario in 1991. Here, nuc rDNA internal transcribed spacer (ITS1-5.8S-ITS2 = ITS) sequences were used to identify the post-fire morel that fruited in great abundance the year following the 2012 Duck Lake Fire in the Upper Peninsula of Michigan and after the 2016 large-scale fire in the Great Smoky Mountains National Park in Tennessee as M. exuberans. A preliminary phylogenetic analysis suggests that the collections from eastern North America may be more closely related to those from Europe than from western North America, Europe, and China.

CORRTEX Diagnostic Deployment for the SPE-III experiment, 24 July 2012: Fielding Report and Preliminary Data Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sandoval, Thomas D.; Schultz-Fellenz, Emily S.

2012-08-29

The Continuous Reflectometry for Radius vs Time Experiments (CORRTEX) diagnostic system was deployed for the third explosives test in the Source Physics Experiment (SPE) sequence to monitor and verify several conditions of the experiment including the detonation velocity of the explosive package and functioning of explosive initiators. Six distance-marked coaxial cables were installed on the SPE-III explosives canister, and key locations documented through along-cable length measurements and photography. CORRTEX uses electrical-pulse time-domain reflectometry to continuously record the two-way transit time (TWTT) of the cables. As the shock front of the detonation advances, the coaxial cable is shorted or destroyed, andmore » the resulting TWTT also decreases. Interpretation of these changes as a function of TWTT can be converted to positional measurements using known parameters of the cables.« less

Phase Diversity Applied to Sunspot Observations

NASA Astrophysics Data System (ADS)

Tritschler, A.; Schmidt, W.; Knolker, M.

We present preliminary results of a multi-colour phase diversity experiment carried out with the Multichannel Filter System of the Vacuum Tower Telescope at the Observatorio del Teide on Tenerife. We apply phase-diversity imaging to a time sequence of sunspot filtergrams taken in three continuum bands and correct the seeing influence for each image. A newly developed phase diversity device allowing for the projection of both the focused and the defocused image onto a single CCD chip was used in one of the wavelength channels. With the information about the wavefront obtained by the image reconstruction algorithm the restoration of the other two bands can be performed as well. The processed and restored data set will then be used to derive the temperature and proper motion of the umbral dots. Data analysis is still under way, and final results will be given in a forthcoming article.

A novel gene: sawD related to the differentiation of streptomyces ansochromogenes.

PubMed

Gang, L; Wei, C; Yuqing, T; Huarong, T; Chater, K F; Buttner, M J

1999-01-01

A 1.3 kb DNA fragment was cloned from a total DNA library of Streptomyces ansochromogenes using Southern hybridization. Nucleotide sequencing analysis indicated that the 1320 bp DNA fragment contained a complete open reading frame (ORF). In search of databases, the deduced product of ORF containing 213 amino acids is homologous to the serine protease of Caulobacter cresceatus, and a conserved serine-catalytic active site (GPSAG) exists. The gene was designated as sawD. The function of this gene was studied with the strategy of gene disruption, and the result showed that the sawD may be related to sporulation and especially to the spore septation in Streptomyces ansochromogenes. The preliminary result indicated that sawD mutant could produce abundant pigment in contrast with the wild type, it seems that sawD gene may be involved in pigment biosynthesis, and this gene is also dispensable for biosynthesis of nikkomycin in Streptomyces ansochromogenes.

Curing genetic disease with gene therapy.

PubMed

Williams, David A

2014-01-01

Development of viral vectors that allow high efficiency gene transfer into mammalian cells in the early 1980s foresaw the treatment of severe monogenic diseases in humans. The application of gene transfer using viral vectors has been successful in diseases of the blood and immune systems, albeit with several curative studies also showing serious adverse events (SAEs). In children with X-linked severe combined immunodeficiency (SCID-X1), chronic granulomatous disease, and Wiskott-Aldrich syndrome, these SAEs were caused by inappropriate activation of oncogenes. Subsequent studies have defined the vector sequences responsible for these transforming events. Members of the Transatlantic Gene Therapy Consortium [TAGTC] have collaboratively developed new vectors that have proven safer in preclinical studies and used these vectors in new clinical trials in SCID-X1. These trials have shown evidence of early efficacy and preliminary integration analysis data from the SCID-X1 trial suggest an improved safety profile.

Preliminary testing for the Markov property of the fifteen chromatin states of the Broad Histone Track.

PubMed

Lee, Kyung-Eun; Park, Hyun-Seok

2015-01-01

Epigenetic computational analyses based on Markov chains can integrate dependencies between regions in the genome that are directly adjacent. In this paper, the BED files of fifteen chromatin states of the Broad Histone Track of the ENCODE project are parsed, and comparative nucleotide frequencies of regional chromatin blocks are thoroughly analyzed to detect the Markov property in them. We perform various tests to examine the Markov property embedded in a frequency domain by checking for the presence of the Markov property in the various chromatin states. We apply these tests to each region of the fifteen chromatin states. The results of our simulation indicate that some of the chromatin states possess a stronger Markov property than others. We discuss the significance of our findings in statistical models of nucleotide sequences that are necessary for the computational analysis of functional units in noncoding DNA.

Confirming and denying in co-construction processes: a case study of an adult with cerebral palsy and two familiar partners.

PubMed

Hörmeyer, Ina; Renner, Gregor

2013-09-01

For individuals with complex communication needs, one of the most frequent communicative strategies is the co-construction of meaning with familiar partners. This preliminary single-case study gives insight into a special sequential pattern of co-construction processes - the search sequence - particularly in relation to the processes of confirming and denying meanings proposed by familiar interaction partners. Five different conversations between an adult with cerebral palsy and complex communication needs and two familiar co-participants were videotaped and analyzed using the methodology of conversation analysis (CA). The study revealed that confirmations and denials are not simply two alternative actions, but that several possibilities to realize confirmations and denials exist that differ in their frequency and that have different consequences for the sequential context. This study of confirmations and denials demonstrates that co-construction processes are more complex than have previously been documented.

Curing Genetic Disease with Gene Therapy

PubMed Central

Williams, David A.

2014-01-01

Development of viral vectors that allow high efficiency gene transfer into mammalian cells in the early 1980s foresaw the treatment of severe monogenic diseases in humans. The application of gene transfer using viral vectors has been successful in diseases of the blood and immune systems, albeit with several curative studies also showing serious adverse events (SAEs). In children with X-linked severe combined immunodeficiency (SCID-X1), chronic granulomatous disease, and Wiskott-Aldrich syndrome, these SAEs were caused by inappropriate activation of oncogenes. Subsequent studies have defined the vector sequences responsible for these transforming events. Members of the Transatlantic Gene Therapy Consortium [TAGTC] have collaboratively developed new vectors that have proven safer in preclinical studies and used these vectors in new clinical trials in SCID-X1. These trials have shown evidence of early efficacy and preliminary integration analysis data from the SCID-X1 trial suggest an improved safety profile. PMID:25125725

Artificial delta growth

NASA Astrophysics Data System (ADS)

Mikeš, Daniel

2010-05-01

A deltaic sedimentary system has a point source; sediment is carried over the delta plain by distributary channels away from the point source and deposited at the delta front by distributary mouth bars. The established methods to describe such a sedimentary system are "bedding analysis", "facies analysis", and "basin analysis". We shall call the ambient conditions "input" and the rock record "output". There exist a number of methods to deduce input from output, e.g. "Sequence stratigraphy" (a.o. Vail et al. 1977, Catuneanu et al. 2009), "Shoreline trajectory" (a.o. Helland-Hansen & Martinsen 1996, Helland-Hansen & Hampson 2009) on the one hand and the complex use of established techniques on the other (a.o. Miall & Miall 2001, Miall & Miall 2002). None of these deductive methods seems to be sufficient. I claim that the common errors in all these attempts are the following: (1) a sedimentary system is four-dimensional (3+1) and a lesser dimensional analysis is insufficient; (2) a sedimentary system is complex and any empirical/deductive analysis is non-unique. The proper approach to the problem is therefore the theoretical/inductive analysis. To that end we performed six scenarios of a scaled version of a passive margin delta in a flume tank. The scenarios have identical stepwise tectonic subsidence and semi-cyclic sealevel, but different supply curves, i.e. supply is: constant, highly-frequent, proportional to sealevel, inversely proportional to sealevel, lagging to sealevel, ahead of sealevel. The preliminary results are indicative. Lobe-switching occurs frequently and hence locally sedimentation occurs shortly and hiatuses are substantial; therefore events in 2D (+1) cross-sections don't correlate temporally. The number of sedimentary cycles disequals the number of sealevel cycles. Lobe-switching and stepwise tectonic subsidence cause onlap/transgression. Erosional unconformities are local diachronous events, whereas maximum flooding surfaces are regional synchronous events. The evolution of the different scenarios is significantly different. These results demonstrate that the complexity of the deltaic system merits the inductive approach. References: Catuneanu, O. et al., 2009. Towards the standardization of sequence stratigraphy. Earth-Science Reviews, v. 92, p. 1-33. Helland-Hansen, W., and Martinsen, O.J., 1996, Shoreline trajectories and sequences: description of variable depositional dip scenarios: Journal of Sedimentary Research, v. 66, p. 670-688. Helland-Hansen, W. and Hampson, G.J., 2009, Trajectory analysis: concepts and applications. In: Basin Research Special Publication 21, p. 454-483. Miall, A.D., Miall, C.E., 2001, Sequence stratigraphy as a scientific enterprise: the evolution and persistence of conflicting paradigms, Earth Science Reviews, v. 54, p. 321-348. Miall, C.E., Miall, A.D., 2002, The Exxon Factor: the roles of corporate and academic science in the emergence and success of a new global model of sequence stratigraphy, Sociological Quarterly, v. 43-3, p. 307-334. Vail, P.R., Mitchum Jr., R.M., Todd, R.G., Widmier, J.M., Thompson III, S., Sangree, J.B., Bubb, J.N., Hatlelid, W.G., 1977. Seismic stratigraphy and global changes of sea-level. In: Payton, C.E. (Ed.), Seismic Stratigraphy-Applications to Hydrocarbon Exploration. American Association of Petroleum Geologists Memoir, v. 26, p. 49-212.

Principle component analysis to separate deformation signals from multiple sources during a 2015 intrusive sequence at Kīlauea Volcano

NASA Astrophysics Data System (ADS)

Johanson, I. A.; Miklius, A.; Poland, M. P.

2016-12-01

A sequence of magmatic events in April-May 2015 at Kīlauea Volcano produced a complex deformation pattern that can be described by multiple deforming sources, active simultaneously. The 2015 intrusive sequence began with inflation in the volcano's summit caldera near Halema`uma`u (HMM) Crater, which continued over a few weeks, followed by rapid deflation of the HMM source and inflation of a source in the south caldera region during the next few days. In Kīlauea Volcano's summit area, multiple deformation centers are active at varying times, and all contribute to the overall pattern observed with GPS, tiltmeters, and InSAR. Isolating the contribution of different signals related to each source is a challenge and complicates the determination of optimal source geometry for the underlying magma bodies. We used principle component analysis of continuous GPS time series from the 2015 intrusion sequence to determine three basis vectors which together account for 83% of the variance in the data set. The three basis vectors are non-orthogonal and not strictly the principle components of the data set. In addition to separating deformation sources in the continuous GPS data, the basis vectors provide a means to scale the contribution of each source in a given interferogram. This provides an additional constraint in a joint model of GPS and InSAR data (COSMO-SkyMed and Sentinel-1A) to determine source geometry. The first basis vector corresponds with inflation in the south caldera region, an area long recognized as the location of a long-term storage reservoir. The second vector represents deformation of the HMM source, which is in the same location as a previously modeled shallow reservoir, however InSAR data suggest a more complicated source. Preliminary modeling of the deformation attributed to the third basis vector shows that it is consistent with inflation of a steeply dipping ellipsoid centered below Keanakāko`i crater, southeast of HMM. Keanakāko`i crater is the locus of a known, intermittently active deformation source, which was not previously recognized to have been active during the 2015 event.

Seismic clusters analysis in Northeastern Italy by the nearest-neighbor approach

NASA Astrophysics Data System (ADS)

Peresan, Antonella; Gentili, Stefania

2018-01-01

The main features of earthquake clusters in Northeastern Italy are explored, with the aim to get new insights on local scale patterns of seismicity in the area. The study is based on a systematic analysis of robustly and uniformly detected seismic clusters, which are identified by a statistical method, based on nearest-neighbor distances of events in the space-time-energy domain. The method permits us to highlight and investigate the internal structure of earthquake sequences, and to differentiate the spatial properties of seismicity according to the different topological features of the clusters structure. To analyze seismicity of Northeastern Italy, we use information from local OGS bulletins, compiled at the National Institute of Oceanography and Experimental Geophysics since 1977. A preliminary reappraisal of the earthquake bulletins is carried out and the area of sufficient completeness is outlined. Various techniques are considered to estimate the scaling parameters that characterize earthquakes occurrence in the region, namely the b-value and the fractal dimension of epicenters distribution, required for the application of the nearest-neighbor technique. Specifically, average robust estimates of the parameters of the Unified Scaling Law for Earthquakes, USLE, are assessed for the whole outlined region and are used to compute the nearest-neighbor distances. Clusters identification by the nearest-neighbor method turn out quite reliable and robust with respect to the minimum magnitude cutoff of the input catalog; the identified clusters are well consistent with those obtained from manual aftershocks identification of selected sequences. We demonstrate that the earthquake clusters have distinct preferred geographic locations, and we identify two areas that differ substantially in the examined clustering properties. Specifically, burst-like sequences are associated with the north-western part and swarm-like sequences with the south-eastern part of the study region. The territorial heterogeneity of earthquakes clustering is in good agreement with spatial variability of scaling parameters identified by the USLE. In particular, the fractal dimension is higher to the west (about 1.2-1.4), suggesting a spatially more distributed seismicity, compared to the eastern parte of the investigated territory, where fractal dimension is very low (about 0.8-1.0).

Use of low frequency repetitive transcranial magnetic stimulation to reduce context-dependent learning in people with Parkinson's disease.

PubMed

Lee, Ya-Yun; Fisher, Beth E

2017-05-22

Compared with age-matched non-disabled adults, people with Parkinson's disease (PD) demonstrated greater context-dependent learning, a phenomenon in which an individual shows inferior motor performance when the testing environmental context is different from the original practice context. Additionally, enhanced context- dependency has been shown to be associated with an increased activation of the dorsolateral prefrontal cortex (DLPFC). This study aimed to determine whether context-dependent learning in people with PD could be reduced by decreasing DLPFC activation with low frequency repetitive transcranial magnetic stimulation (rTMS). Quasi-experimental pre-post test controlled study. University laboratory. Twenty-seven participants (18 individuals with PD and 9 age-matched non- disabled adults) were recruited into the PD, PD_rTMS (PD participants who received low frequency rTMS), and Control groups. All participants practiced a finger sequence task containing 3 sequences embedded within specific contexts (colored circles and spatial location on a computer screen) on the first day. On day 2, the participants were tested under the SWITCH and SAME conditions. In the SWITCH condition, the sequence-context association changed from that of practice; in the SAME condition, the sequence-context association remained the same as practice. The PD_rTMS group received 1 Hz rTMS applied over the left DLPFC on the second day before the testing conditions. Switch cost, the performance difference between the SWITCH and SAME conditions, was calculated to indicate context-dependency. All participants improved throughout practice on the first day. Analysis of the switch cost revealed a significant group main effect (p = 0.050). Post-hoc analysis revealed that the PD_rTMS group had significantly smaller switch cost than the PD group (p = 0.031) but not the Control group. Low frequency rTMS applied over DLPFC reduced context-dependency in people with PD. The findings provide a preliminary evidence of using low frequency rTMS as an adjuvant intervention approach to facilitate individuals with PD to generalize a learned motor task from one environmental context to another.

An Analysis of Pulsating Subdwarf B Star EPIC 203948264 Observed During Campaign 2 of K2

NASA Astrophysics Data System (ADS)

Ketzer, Laura; Reed, Mike

2017-10-01

We present a preliminary analysis of the newly-discovered pulsating subdwarf B (sdB) star EPIC 203948264. The target was observed for 83 days in short cadence mode during Campaign 2 of K2, the two-gyro mission of the Kepler space telescope. A time-series analysis of the data revealed 22 independent pulsation frequencies in the g-mode region ranging from 100 to 600 μHz (0:5 to 2:8 hours). The main method we use to identify pulsation modes is asymptotic period spacing, and we were able to assign all but one of the pulsations to either l = 1 or l = 2. The average period spacings of both sequences are 261:34 ± 0.78 s and 151:18 ± 0.34 s, respectively. The pulsation amplitudes range from 0.77 ppt down to the detection limit at 0.212 ppt, and are not stable over the duration of the campaign. We detected one possible low-amplitude, l = 2, rotationally split multiplet, which allowed us to constrain the rotation period to 46 days or longer. This makes EPIC 203948264 another slowly rotating sdB star.

A non-toxic microbial surfactant from Marinobacter hydrocarbonoclasticus SdK644 for crude oil solubilization enhancement.

PubMed

Zenati, Billal; Chebbi, Alif; Badis, Abdelmalek; Eddouaouda, Kamel; Boutoumi, Hocine; El Hattab, Mohamed; Hentati, Dorra; Chelbi, Manel; Sayadi, Sami; Chamkha, Mohamed; Franzetti, Andrea

2018-06-15

This study aims to investigate the ability of a biosurfactant produced by Marinobacter hydrocarbonoclasticus strain SdK644 isolated from hydrocarbon contaminated sediment to enhance the solubilization rate of crude oil contaminated seawater. Phylogenetic analysis shows that strain SdK644 was very closely related to M. hydrocarbonoclasticus with 16S rRNA gene sequence similarity of 97.44%. Using waste frying oil as inducer carbon source, the producing biosurfactant by strain SdK644 was applied to improve crude oil solubilization in seawater. The preliminary characterization of the produced biosurfactant by FT-IR analysis indicates its possible classification in a glycolipids group. Results from crude oil solubilization assay showed that SdK644 strain biosurfactant was 2-fold greater than Tween 80 surfactant in crude oil solubilization and 12-fold higher than seawater control, as shown by GC-MS analysis of aliphatic compounds. Furthermore, this bioactive compound was shown to be nontoxic against Artemia larvae in short-term acute toxicity bioassay. Generally, the results showed the possible use of M. hydrocarbonoclasticus strain SdK644 biosurfactant in bioremediation processes of the marine environments. Copyright © 2018 Elsevier Inc. All rights reserved.

Acoustic analysis in Mudejar-Gothic churches: Experimental results

NASA Astrophysics Data System (ADS)

Galindo, Miguel; Zamarreño, Teófilo; Girón, Sara

2005-05-01

This paper describes the preliminary results of research work in acoustics, conducted in a set of 12 Mudejar-Gothic churches in the city of Seville in the south of Spain. Despite common architectural style, the churches feature individual characteristics and have volumes ranging from 3947 to 10 708 m3. Acoustic parameters were measured in unoccupied churches according to the ISO-3382 standard. An extensive experimental study was carried out using impulse response analysis through a maximum length sequence measurement system in each church. It covered aspects such as reverberation (reverberation times, early decay times), distribution of sound levels (sound strength); early to late sound energy parameters derived from the impulse responses (center time, clarity for speech, clarity, definition, lateral energy fraction), and speech intelligibility (rapid speech transmission index), which all take both spectral and spatial distribution into account. Background noise was also measured to obtain the NR indices. The study describes the acoustic field inside each temple and establishes a discussion for each one of the acoustic descriptors mentioned by using the theoretical models available and the principles of architectural acoustics. Analysis of the quality of the spaces for music and speech is carried out according to the most widespread criteria for auditoria. .

Acoustic analysis in Mudejar-Gothic churches: experimental results.

PubMed

Galindo, Miguel; Zamarreño, Teófilo; Girón, Sara

2005-05-01

This paper describes the preliminary results of research work in acoustics, conducted in a set of 12 Mudejar-Gothic churches in the city of Seville in the south of Spain. Despite common architectural style, the churches feature individual characteristics and have volumes ranging from 3947 to 10 708 m3. Acoustic parameters were measured in unoccupied churches according to the ISO-3382 standard. An extensive experimental study was carried out using impulse response analysis through a maximum length sequence measurement system in each church. It covered aspects such as reverberation (reverberation times, early decay times), distribution of sound levels (sound strength); early to late sound energy parameters derived from the impulse responses (center time, clarity for speech, clarity, definition, lateral energy fraction), and speech intelligibility (rapid speech transmission index), which all take both spectral and spatial distribution into account. Background noise was also measured to obtain the NR indices. The study describes the acoustic field inside each temple and establishes a discussion for each one of the acoustic descriptors mentioned by using the theoretical models available and the principles of architectural acoustics. Analysis of the quality of the spaces for music and speech is carried out according to the most widespread criteria for auditoria.

Technical-economical analysis of selected decentralized technologies for municipal wastewater treatment in the city of Rome.

PubMed

Gavasci, Renato; Chiavola, Agostina; Spizzirri, Massimo

2010-01-01

Several wastewater treatment technologies were evaluated as alternative systems to the more traditional centralized continuous flow system to serve decentralized areas of the city of Rome (Italy). For instance, the following technologies were selected: (1) Constructed wetlands, (2) Membrane Biological Reactor, (3) Deep Shaft, (4) Sequencing Batch Reactor, and (5) Combined Filtration and UV-disinfection. Such systems were distinguished based on the limits they are potentially capable of accomplishing on the effluent. Consequently, the SBR and DS were grouped together for their capability to comply with the standards for the discharge into surface waters (according to the Italian D.Lgs. 152/06, Table 1, All. 5), whereas the MBR and tertiary system (Filtration+UVc-disinfection) were considered together as they should be able to allow effluent discharge into soil (according to the Italian D.Lgs. 152/06, Table 4, All. 5) and/or reuse (according to the Italian D.M. 185/03). Both groups of technologies were evaluated in comparison with the more common continuous flow treatment sequence consisting of a biological activated sludge tank followed by the secondary settlement, with final chlorination. CWs were studied separately as a solution for decentralized urban areas with limited population. After the analysis of the main technical features, an economical estimate was carried out taking into account the investment, operation and maintenance costs as a function of the plant's capacity. The analysis was based on real data provided by the Company who manages the entire water system of the City of Rome (Acea Ato 2 S.p.A.). A preliminary design of the treatment plants using some of the selected technologies was finally carried out.

The CNO Bi-cycle in the Open Cluster NGC 752

NASA Astrophysics Data System (ADS)

Hawkins, Keith; Schuler, S.; King, J.; The, L.

2011-01-01

The CNO bi-cycle is the primary energy source for main sequence stars more massive than the sun. To test our understanding of stellar evolution models using the CNO bi-cycle, we have undertaken light-element (CNO) abundance analysis of three main sequence dwarf stars and three red giant stars in the open cluster NGC 752 utilizing high resolution (R 50,000) spectroscopy from the Keck Observatory. Preliminary results indicate, as expected, there is a depletion of carbon in the giants relative to the dwarfs. Additional analysis is needed to determine if the amount of depletion is in line with model predictions, as seen in the Hyades open cluster. Oxygen abundances are derived from the high-excitation O I triplet, and there is a 0.19 dex offset in the [O/H] abundances between the giants and dwarfs which may be explained by non-local thermodynamic equilibrium (NLTE), although further analysis is needed to verify this. The standard procedure for spectroscopically determining stellar parameters used here allows for a measurement of the cluster metallicity, [Fe/H] = 0.04 ± 0.02. In addition to the Fe abundances we have determined Na, Mg, and Al abundances to determine the status of other nucleosynthesis processes. The Na, Mg and Al abundances of the giants are enhanced relative to the dwarfs, which is consistent with similar findings in giants of other open clusters. Support for K. Hawkins was provided by the NOAO/KPNO Research Experiences for Undergraduates (REU) Program which is funded by the National Science Foundation Research Experiences for Undergraduates Program and the Department of Defense ASSURE program through Scientific Program Order No. 13 (AST-0754223) of the Cooperative Agreement No. AST-0132798 between the Association of Universities for Research in Astronomy (AURA) and the NSF.

Genomic Analysis of Attenuation in Pandemic Vibrio parahaemolyticus

NASA Astrophysics Data System (ADS)

Pinnell, L. J.; Tallman, J. J., III; Turner, J.

2016-02-01

A critical problem in the prevention and treatment of infectious disease is the ability to differentiate virulent from avirulent bacterial strains. The distinction is commonly based on the presence or absence of specific virulence-associated genes. Alternately, serotypic or phylogenetic typing can accurately differentiate virulent from avirulent strains. When these approaches fail, more discriminatory analysis is needed. Pandemic Vibiro parahaemolyticus, distinguishable by genotyping (thermostable direct hemolysin or tdh), serotyping (O3:K6) and multilocus sequence typing (ST3), is regarded as a highly virulent clonal complex. We have previously shown, through population genetics and cytotoxicity testing, that some pandemic strains isolated from environmental sources are avirulent. To investigate the basis for attenuation, we sequenced the draft genomes of 10 pandemic V. parahaemolyticus isolates originating from environmental (N = 7) and clinical sources (N = 3). Genomic comparison of these 10 draft genomes, and the pandemic type strain (RIMD2210633), revealed a large core genome (5,158,719 bp) and a much smaller accessory genome (141,403 bp). The accessory genome was largely comprised of hypothetical proteins; however, several genes encoded phage-related proteins. Phylogenetic analysis, based on 2,902 single nucleotide polymorphisms in the core genome, did not reveal a discernable pattern. Current efforts are focused on the identification of insertions, deletions and point mutations that may alter protein expression or protein function. Preliminary results show that attenuated strains lack the virulence-associated vacB gene (VP1890). This gene encodes a 741 amino acid exoribonuclease homologous to exoribonucleases known to modulate virulence in Salmonella enterica and Helicobacter pylori. The correlation between attenuation and the absence of this gene, suggests that VP1890 plays an important role in human pathogenesis.

Molecular Analysis of a Novel Methanesulfonic Acid Monooxygenase from the Methylotroph Methylosulfonomonas methylovora

PubMed Central

de Marco, Paolo; Moradas-Ferreira, Pedro; Higgins, Timothy P.; McDonald, Ian; Kenna, Elizabeth M.; Murrell, J. Colin

1999-01-01

Methylosulfonomonas methylovora M2 is an unusual gram-negative methylotrophic bacterium that can grow on methanesulfonic acid (MSA) as the sole source of carbon and energy. Oxidation of MSA by this bacterium is carried out by a multicomponent MSA monooxygenase (MSAMO). Cloning and sequencing of a 7.5-kbp SphI fragment of chromosomal DNA revealed four tightly linked genes encoding this novel monooxygenase. Analysis of the deduced MSAMO polypeptide sequences indicated that the enzyme contains a two-component hydroxylase of the mononuclear-iron-center type. The large subunit of the hydroxylase, MsmA (48 kDa), contains a typical Rieske-type [2Fe–2S] center with an unusual iron-binding motif and, together with the small subunit of the hydroxylase, MsmB (20 kDa), showed a high degree of identity with a number of dioxygenase enzymes. However, the other components of the MSAMO, MsmC, the ferredoxin component, and MsmD, the reductase, more closely resemble those found in other classes of oxygenases. MsmC has a high degree of identity to ferredoxins from toluene and methane monooxygenases, which are enzymes characterized by possessing hydroxylases containing μ-oxo bridge binuclear iron centers. MsmD is a reductase of 38 kDa with a typical chloroplast-like [2Fe–2S] center and conserved flavin adenine dinucleotide- and NAD-binding motifs and is similar to a number of mono- and dioxygenase reductase components. Preliminary analysis of the genes encoding MSAMO from a marine MSA-degrading bacterium, Marinosulfonomonas methylotropha, revealed the presence of msm genes highly related to those found in Methylosulfonomonas, suggesting that MSAMO is a novel type of oxygenase that may be conserved in all MSA-utilizing bacteria. PMID:10094704

Preliminary Design and Evaluation of Portable Electronic Flight Progress Strips

NASA Technical Reports Server (NTRS)

Doble, Nathan A.; Hansman, R. John

2002-01-01

There has been growing interest in using electronic alternatives to the paper Flight Progress Strip (FPS) for air traffic control. However, most research has been centered on radar-based control environments, and has not considered the unique operational needs of the airport air traffic control tower. Based on an analysis of the human factors issues for control tower Decision Support Tool (DST) interfaces, a requirement has been identified for an interaction mechanism which replicates the advantages of the paper FPS (e.g., head-up operation, portability) but also enables input and output with DSTs. An approach has been developed which uses a Portable Electronic FPS that has attributes of both a paper strip and an electronic strip. The prototype flight strip system uses Personal Digital Assistants (PDAs) to replace individual paper strips in addition to a central management interface which is displayed on a desktop computer. Each PDA is connected to the management interface via a wireless local area network. The Portable Electronic FPSs replicate the core functionality of paper flight strips and have additional features which provide a heads-up interface to a DST. A departure DST is used as a motivating example. The central management interface is used for aircraft scheduling and sequencing and provides an overview of airport departure operations. This paper will present the design of the Portable Electronic FPS system as well as preliminary evaluation results.

Expression, purification and preliminary X-ray diffraction studies of VERNALIZATION1208–341 from Arabidopsis thaliana

PubMed Central

King, Gordon; Hill, Justine M.; Martin, Jennifer L.; Mylne, Joshua S.

2009-01-01

VERNALIZATION1 (VRN1) is required in the model plant Arabidopsis thaliana for the epigenetic suppression of the floral repressor FLC by prolonged cold treatment. Stable suppression of FLC accelerates flowering, a physiological process known as vernalization. VRN1 is a 341-residue DNA-binding protein that contains two plant-specific B3 domains (B3a and B3b), a putative nuclear localization sequence (NLS) and two putative PEST domains. VRN1208–341 includes the second B3 domain and a region upstream that is highly conserved in the VRN1 orthologues of other dicotyledonous plants. VRN1208–341 was crystallized by the hanging-drop method in 0.05 M sodium acetate pH 6.0 containing 1.0 M NaCl and 18%(w/v) PEG 3350. Preliminary X-ray diffraction data analysis revealed that the VRN1208–341 crystal diffracted to 2.1 Å and belonged to space group C2, with unit-cell parameters a = 105.2, b = 47.9, c = 61.2 Å, α = 90.0, β = 115.4, γ = 90.0°. Assuming that two molecules occupy the asymmetric unit, a Matthews coefficient of 2.05 Å3 Da−1 and a solvent content of 40.1% were calculated. PMID:19255487

Sequence-Stratigraphic Analysis of the Regional Observation Monitoring Program (ROMP) 29A Test Corehole and Its Relation to Carbonate Porosity and Regional Transmissivity in the Floridan Aquifer System, Highlands County, Florida

USGS Publications Warehouse

Ward, W. C.; Cunningham, K.J.; Renken, R.A.; Wacker, M.A.; Carlson, J.I.

2003-01-01

An analysis was made to describe and interpret the lithology of a part of the Upper Floridan aquifer penetrated by the Regional Observation Monitoring Program (ROMP) 29A test corehole in Highlands County, Florida. This information was integrated into a one-dimensional hydrostratigraphic model that delineates candidate flow zones and confining units in the context of sequence stratigraphy. Results from this test corehole will serve as a starting point to build a robust three-dimensional sequence-stratigraphic framework of the Floridan aquifer system. The ROMP 29A test corehole penetrated the Avon Park Formation, Ocala Limestone, Suwannee Limestone, and Hawthorn Group of middle Eocene to Pliocene age. The part of the Avon Park Formation penetrated in the ROMP 29A test corehole contains two composite depositional sequences. A transgressive systems tract and a highstand systems tract were interpreted for the upper composite sequence; however, only a highstand systems tract was interpreted for the lower composite sequence of the deeper Avon Park stratigraphic section. The composite depositional sequences are composed of at least five high-frequency depositional sequences. These sequences contain high-frequency cycle sets that are an amalgamation of vertically stacked high-frequency cycles. Three types of high-frequency cycles have been identified in the Avon Park Formation: peritidal, shallow subtidal, and deeper subtidal high-frequency cycles. The vertical distribution of carbonate-rock diffuse flow zones within the Avon Park Formation is heterogeneous. Porous vuggy intervals are less than 10 feet, and most are much thinner. The volumetric arrangement of the diffuse flow zones shows that most occur in the highstand systems tract of the lower composite sequence of the Avon Park Formation as compared to the upper composite sequence, which contains both a backstepping transgressive systems tract and a prograding highstand systems tract. Although the porous and permeable layers are not thick, some intervals may exhibit lateral continuity because of their deposition on a broad low-relief ramp. A thick interval of thin vuggy zones and open faults forms thin conduit flow zones mixed with relatively thicker carbonate-rock diffuse flow zones between a depth of 1,070 and 1,244 feet below land surface (bottom of the test corehole). This interval is the most transmissive part of the Avon Park Formation penetrated in the ROMP 29A test corehole and is included in the highstand systems tract of the lower composite sequence. The Ocala Limestone is considered to be a semiconfining unit and contains three depositional sequences penetrated by the ROMP 29A test corehole. Deposited within deeper subtidal depositional cycles, no zones of enhanced porosity and permeability are expected in the Ocala Limestone. A thin erosional remnant of the shallow marine Suwannee Limestone overlies the Ocala Limestone, and permeability seems to be comparatively low because moldic porosity is poorly connected. Rocks that comprise the lower Hawthorn Group, Suwannee Limestone, and Ocala Limestone form a permeable upper zone of the Upper Floridan aquifer, and rocks of the lower Ocala Limestone and Avon Park Formation form a permeable lower zone of the Upper Floridan aquifer. On the basis of a preliminary analysis of transmissivity estimates for wells located north of Lake Okeechobee, spatial relations among groups of relatively high and low transmissivity values within the upper zone are evident. Upper zone transmissivity is generally less than 10,000 feet squared per day in areas located south of a line that extends through Charlotte, Sarasota, DeSoto, Highlands, Polk, Osceola, Okeechobee, and St. Lucie Counties. Transmissivity patterns within the lower zone of the Avon Park Formation cannot be regionally assessed because insufficient data over a wide areal extent have not been compiled.

Precisely locating the Klamath Falls, Oregon, earthquakes

USGS Publications Warehouse

Qamar, A.; Meagher, K.L.

1993-01-01

In this article we present preliminary results of a close-in, instrumental study of the Klamath Falls earthquake sequence, carried as a cooperative effort by scientists from the U.S Geological Survey (USGS) and universities in Washington, Orgeon, and California. In addition to obtaining much mroe accurate earthquake locations, this study has improved our understanding of the relationship between seismicity and mapped faults in the region. 

Preliminary definition and evaluation of advanced space concepts. Volume 1: Executive summary

NASA Technical Reports Server (NTRS)

Bekey, I.

1978-01-01

A study was made to develop the characteristics, cost, and performance of a few of the more attractive application concepts, and to compare them against leading terrestrial alternatives, in order to determine their potential, identify those deserving further NASA attention and possible inclusion into the formal development planning sequence, and serve to initiate a dialogue with the using community and agencies.

Extending the Bacillus cereus group genomics to putative food-borne pathogens of different toxicity.

PubMed

Lapidus, Alla; Goltsman, Eugene; Auger, Sandrine; Galleron, Nathalie; Ségurens, Béatrice; Dossat, Carole; Land, Miriam L; Broussolle, Veronique; Brillard, Julien; Guinebretiere, Marie-Helene; Sanchis, Vincent; Nguen-The, Christophe; Lereclus, Didier; Richardson, Paul; Wincker, Patrick; Weissenbach, Jean; Ehrlich, S Dusko; Sorokin, Alexei

2008-01-30

The Bacillus cereus group represents sporulating soil bacteria containing pathogenic strains which may cause diarrheic or emetic food poisoning outbreaks. Multiple locus sequence typing revealed a presence in natural samples of these bacteria of about 30 clonal complexes. Application of genomic methods to this group was however biased due to the major interest for representatives closely related to Bacillus anthracis. Albeit the most important food-borne pathogens were not yet defined, existing data indicate that they are scattered all over the phylogenetic tree. The preliminary analysis of the sequences of three genomes discussed in this paper narrows down the gaps in our knowledge of the B. cereus group. The strain NVH391-98 is a rare but particularly severe food-borne pathogen. Sequencing revealed that the strain should be a representative of a novel bacterial species, for which the name Bacillus cytotoxis or Bacillus cytotoxicus is proposed. This strain has a reduced genome size compared to other B. cereus group strains. Genome analysis revealed absence of sigma B factor and the presence of genes encoding diarrheic Nhe toxin, not detected earlier. The strain B. cereus F837/76 represents a clonal complex close to that of B. anthracis. Including F837/76, three such B. cereus strains had been sequenced. Alignment of genomes suggests that B. anthracis is their common ancestor. Since such strains often emerge from clinical cases, they merit a special attention. The third strain, KBAB4, is a typical facultative psychrophile generally found in soil. Phylogenic studies show that in nature it is the most active group in terms of gene exchange. Genomic sequence revealed high presence of extra-chromosomal genetic material (about 530kb) that may account for this phenomenon. Genes coding Nhe-like toxin were found on a big plasmid in this strain. This may indicate a potential mechanism of toxicity spread from the psychrophile strain community. The results of this genomic work and ecological compartments of different strains incite to consider a necessity of creating prophylactic vaccines against bacteria closely related to NVH391-98 and F837/76. Presumably developing of such vaccines can be based on the properties of non-pathogenic strains such as KBAB4 or ATCC14579 reported here or earlier. By comparing the protein coding genes of strains being sequenced in this project to others we estimate the shared proteome, or core genome, in the B. cereus group to be 3000+/-200 genes and the total proteome, or pan-genome, to be 20-25,000 genes.

A Deep-Coverage Tomato BAC Library and Prospects Toward Development of an STC Framework for Genome Sequencing

PubMed Central

Budiman, Muhammad A.; Mao, Long; Wood, Todd C.; Wing, Rod A.

2000-01-01

Recently a new strategy using BAC end sequences as sequence-tagged connectors (STCs) was proposed for whole-genome sequencing projects. In this study, we present the construction and detailed characterization of a 15.0 haploid genome equivalent BAC library for the cultivated tomato, Lycopersicon esculentum cv. Heinz 1706. The library contains 129,024 clones with an average insert size of 117.5 kb and a chloroplast content of 1.11%. BAC end sequences from 1490 ends were generated and analyzed as a preliminary evaluation for using this library to develop an STC framework to sequence the tomato genome. A total of 1205 BAC end sequences (80.9%) were obtained, with an average length of 360 high-quality bases, and were searched against the GenBank database. Using a cutoff expectation value of <10−6, and combining the results from BLASTN, BLASTX, and TBLASTX searches, 24.3% of the BAC end sequences were similar to known sequences, of which almost half (48.7%) share sequence similarities to retrotransposons and 7% to known genes. Some of the transposable element sequences were the first reported in tomato, such as sequences similar to maize transposon Activator (Ac) ORF and tobacco pararetrovirus-like sequences. Interestingly, there were no BAC end sequences similar to the highly repeated TGRI and TGRII elements. However, the majority (70.3%) of STCs did not share significant sequence similarities to any sequences in GenBank at either the DNA or predicted protein levels, indicating that a large portion of the tomato genome is still unknown. Our data demonstrate that this BAC library is suitable for developing an STC database to sequence the tomato genome. The advantages of developing an STC framework for whole-genome sequencing of tomato are discussed. [The BAC end sequences described in this paper have been deposited in the GenBank data library under accession nos. AQ367111–AQ368361.] PMID:10645957

A structurally driven analysis of thiol reactivity in mammalian albumins.

PubMed

Spiga, Ottavia; Summa, Domenico; Cirri, Simone; Bernini, Andrea; Venditti, Vincenzo; De Chiara, Matteo; Priora, Raffaella; Frosali, Simona; Margaritis, Antonios; Di Giuseppe, Danila; Di Simplicio, Paolo; Niccolai, Neri

2011-04-01

Understanding the structural basis of protein redox activity is still an open question. Hence, by using a structural genomics approach, different albumins have been chosen to correlate protein structural features with the corresponding reaction rates of thiol exchange between albumin and disulfide DTNB. Predicted structures of rat, porcine, and bovine albumins have been compared with the experimentally derived human albumin. High structural similarity among these four albumins can be observed, in spite of their markedly different reactivity with DTNB. Sequence alignments offered preliminary hints on the contributions of sequence-specific local environments modulating albumin reactivity. Molecular dynamics simulations performed on experimental and predicted albumin structures reveal that thiolation rates are influenced by hydrogen bonding pattern and stability of the acceptor C34 sulphur atom with donor groups of nearby residues. Atom depth evolution of albumin C34 thiol groups has been monitored during Molecular Dynamic trajectories. The most reactive albumins appeared also the ones presenting the C34 sulphur atom on the protein surface with the highest accessibility. High C34 sulphur atom reactivity in rat and porcine albumins seems to be determined by the presence of additional positively charged amino acid residues favoring both the C34 S⁻ form and the approach of DTNB. Copyright © 2011 Wiley Periodicals, Inc.

Study of the Socratic method during cognitive restructuring.

PubMed

Froján-Parga, María Xesús; Calero-Elvira, Ana; Montaño-Fidalgo, Montserrat

2011-01-01

Cognitive restructuring, in particular in the form of the Socratic method, is widely used by clinicians. However, little research has been published with respect to underlying processes, which has hindered well-accepted explanations of its effectiveness. The aim of this study is to present a new method of analysis of the Socratic method during cognitive restructuring based on the observation of the therapist's verbal behaviour. Using recordings from clinical sessions, 18 sequences were selected in which the Socratic method was applied by six cognitive-behavioural therapists working at a private clinical centre in Madrid. The recordings involved eight patients requiring therapy for various psychological problems. Observations were coded using a category system designed by the authors and that classifies the therapist's verbal behaviour into seven hypothesized functions based on basic behavioural operations. We used the Observer XT software to code the observed sequences. The results are summarized through a preliminary model which considers three different phases of the Socratic method and some functions of the therapist's verbal behaviour in each of these phases: discriminative and reinforcement functions in the starting phase, informative and motivational functions in the course of the debate, and instructional and reinforcement functions in the final phase. We discuss the long-term potential clinical benefits of the current proposal.  Copyright © 2010 John Wiley & Sons, Ltd.

In Silico Functional Networks Identified in Fish Nucleated Red Blood Cells by Means of Transcriptomic and Proteomic Profiling.

PubMed

Puente-Marin, Sara; Nombela, Iván; Ciordia, Sergio; Mena, María Carmen; Chico, Verónica; Coll, Julio; Ortega-Villaizan, María Del Mar

2018-04-09

Nucleated red blood cells (RBCs) of fish have, in the last decade, been implicated in several immune-related functions, such as antiviral response, phagocytosis or cytokine-mediated signaling. RNA-sequencing (RNA-seq) and label-free shotgun proteomic analyses were carried out for in silico functional pathway profiling of rainbow trout RBCs. For RNA-seq, a de novo assembly was conducted, in order to create a transcriptome database for RBCs. For proteome profiling, we developed a proteomic method that combined: (a) fractionation into cytosolic and membrane fractions, (b) hemoglobin removal of the cytosolic fraction, (c) protein digestion, and (d) a novel step with pH reversed-phase peptide fractionation and final Liquid Chromatography Electrospray Ionization Tandem Mass Spectrometric (LC ESI-MS/MS) analysis of each fraction. Combined transcriptome- and proteome- sequencing data identified, in silico, novel and striking immune functional networks for rainbow trout nucleated RBCs, which are mainly linked to innate and adaptive immunity. Functional pathways related to regulation of hematopoietic cell differentiation, antigen presentation via major histocompatibility complex class II (MHCII), leukocyte differentiation and regulation of leukocyte activation were identified. These preliminary findings further implicate nucleated RBCs in immune function, such as antigen presentation and leukocyte activation.

In Silico Functional Networks Identified in Fish Nucleated Red Blood Cells by Means of Transcriptomic and Proteomic Profiling

PubMed Central

Puente-Marin, Sara; Ciordia, Sergio; Mena, María Carmen; Chico, Verónica; Coll, Julio

2018-01-01

Nucleated red blood cells (RBCs) of fish have, in the last decade, been implicated in several immune-related functions, such as antiviral response, phagocytosis or cytokine-mediated signaling. RNA-sequencing (RNA-seq) and label-free shotgun proteomic analyses were carried out for in silico functional pathway profiling of rainbow trout RBCs. For RNA-seq, a de novo assembly was conducted, in order to create a transcriptome database for RBCs. For proteome profiling, we developed a proteomic method that combined: (a) fractionation into cytosolic and membrane fractions, (b) hemoglobin removal of the cytosolic fraction, (c) protein digestion, and (d) a novel step with pH reversed-phase peptide fractionation and final Liquid Chromatography Electrospray Ionization Tandem Mass Spectrometric (LC ESI-MS/MS) analysis of each fraction. Combined transcriptome- and proteome- sequencing data identified, in silico, novel and striking immune functional networks for rainbow trout nucleated RBCs, which are mainly linked to innate and adaptive immunity. Functional pathways related to regulation of hematopoietic cell differentiation, antigen presentation via major histocompatibility complex class II (MHCII), leukocyte differentiation and regulation of leukocyte activation were identified. These preliminary findings further implicate nucleated RBCs in immune function, such as antigen presentation and leukocyte activation. PMID:29642539

A preliminary investigation into the genetic variation and population structure of Taenia hydatigena from Sardinia, Italy.

PubMed

Boufana, Belgees; Scala, Antonio; Lahmar, Samia; Pointing, Steve; Craig, Philip S; Dessì, Giorgia; Zidda, Antonella; Pipia, Anna Paola; Varcasia, Antonio

2015-11-30

Cysticercosis caused by the metacestode stage of Taenia hydatigena is endemic in Sardinia. Information on the genetic variation of this parasite is important for epidemiological studies and implementation of control programs. Using two mitochondrial genes, the cytochrome c oxidase subunit 1 (cox1) and the NADH dehydrogenase subunit 1 (ND1) we investigated the genetic variation and population structure of Cysticercus tenuicollis from Sardinian intermediate hosts and compared it to that from other hosts from various geographical regions. The parsimony cox1 network analysis indicated the existence of a common lineage for T. hydatigena and the overall diversity and neutrality indices indicated demographic expansion. Using the cox1 sequences, low pairwise fixation index (Fst) values were recorded for Sardinian, Iranian and Palestinian sheep C. tenuicollis which suggested the absence of genetic differentiation. Using the ND1 sequences, C. tenuicollis from Sardinian sheep appeared to be differentiated from those of goat and pig origin. In addition, goat C. tenuicollis were genetically different from adult T. hydatigena as indicated by the statistically significant Fst value. Our results are consistent with biochemical and morphological studies that suggest the existence of variants of T. hydatigena. Copyright © 2015 Elsevier B.V. All rights reserved.

Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

PubMed

Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

2015-10-19

Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

Characterization of the juvenile green turtle (Chelonia mydas) microbiome throughout an ontogenetic shift from pelagic to neritic habitats

USGS Publications Warehouse

Price, James T.; Paladino, Frank V.; Lamont, Margaret M.; Witherington, Blair E.; Bates, Scott T.; Soule, Tanya

2017-01-01

The gut microbiome of herbivorous animals consists of organisms that efficiently digest the structural carbohydrates of ingested plant material. Green turtles (Chelonia mydas) provide an interesting model of change in these microbial communities because they undergo a pronounced shift from a surface-pelagic distribution and omnivorous diet to a neritic distribution and herbivorous diet. As an alternative to direct sampling of the gut, we investigated the cloacal microbiomes of juvenile green turtles before and after recruitment to neritic waters to observe any changes in their microbial community structure. Cloacal swabs were taken from individual turtles for analysis of the 16S rRNA gene sequences using Illumina sequencing. One fecal sample was also obtained, allowing for a preliminary comparison with the bacterial community of the cloaca. We found significant variation in the juvenile green turtle bacterial communities between pelagic and neritic habitats, suggesting that environmental and dietary factors support different bacterial communities in green turtles from these habitats. This is the first study to characterize the cloacal microbiome of green turtles in the context of their ontogenetic shifts, which could provide valuable insight into the origins of their gut bacteria and how the microbial community supports their shift to herbivory.

Molecular cloning of allelopathy related genes and their relation to HHO in Eupatorium adenophorum.

PubMed

Guo, Huiming; Pei, Xixiang; Wan, Fanghao; Cheng, Hongmei

2011-10-01

In this study, conserved sequence regions of HMGR, DXR, and CHS (encoding 3-hydroxy-3-methylglutaryl-CoA reductase, 1-deoxyxylulose-5-phosphate reductoisomerase and chalcone synthase, respectively) were amplified by reverse transcriptase (RT)-PCR from Eupatorium adenophorum. Quantitative real-time PCR showed that the expression of CHS was related to the level of HHO, an allelochemical isolated from E. adenophorum. Semi-quantitative RT-PCR showed that there was no significant difference in expression of genes among three different tissues, except for CHS. Southern blotting indicated that at least three CHS genes are present in the E. adenophorum genome. A full-length cDNA from CHS genes (named EaCHS1, GenBank ID: FJ913888) was cloned. The 1,455 bp cDNA contained an open reading frame (1,206 bp) encoding a protein of 401 amino acids. Preliminary bioinformatics analysis of EaCHS1 revealed that EaCHS1 was a member of CHS family, the subcellular localization predicted that EaCHS1 was a cytoplasmic protein. To the best of our knowledge, this is the first report of conserved sequences of these genes and of a full-length EaCHS1 gene in E. adenophorum. The results indicated that CHS gene is related to allelopathy of E. adenophorum.

Sequential and prosodic design of English and Greek non-valenced news receipts.

PubMed

Kaimaki, Marianna

2012-03-01

Results arising from a prosodic and interactional study of the organization of everyday talk in English suggest that news receipts can be grouped into two categories: valenced (e.g., oh good) and non-valenced (e.g., oh really). In-depth investigation of both valenced and non-valenced news receipts shows that differences in their prosodic design do not seem to affect the sequential structure of the news informing sequence. News receipts with falling and rising pitch may have the same uptake and are treated in the same way by co-participants. A preliminary study of a Greek telephone corpus yielded the following receipts of news announcements: a malista, a(h) orea, a ne, a, oh. These are news markers composed of a standalone particle or a particle followed by an adverb or a response token (ne). Analysis of the sequential and prosodic design of Greek news announcement sequences is made to determine any interactional patterns and/or prosodic constraints. By examining the way in which co-participants display their interpretation of these turns I show that the phonological systems of contrast are different depending on the sequential environment, in much the same way that consonantal systems of contrast are not the same syllable initially and finally.

Automatic Human Movement Assessment With Switching Linear Dynamic System: Motion Segmentation and Motor Performance.

PubMed

de Souza Baptista, Roberto; Bo, Antonio P L; Hayashibe, Mitsuhiro

2017-06-01

Performance assessment of human movement is critical in diagnosis and motor-control rehabilitation. Recent developments in portable sensor technology enable clinicians to measure spatiotemporal aspects to aid in the neurological assessment. However, the extraction of quantitative information from such measurements is usually done manually through visual inspection. This paper presents a novel framework for automatic human movement assessment that executes segmentation and motor performance parameter extraction in time-series of measurements from a sequence of human movements. We use the elements of a Switching Linear Dynamic System model as building blocks to translate formal definitions and procedures from human movement analysis. Our approach provides a method for users with no expertise in signal processing to create models for movements using labeled dataset and later use it for automatic assessment. We validated our framework on preliminary tests involving six healthy adult subjects that executed common movements in functional tests and rehabilitation exercise sessions, such as sit-to-stand and lateral elevation of the arms and five elderly subjects, two of which with limited mobility, that executed the sit-to-stand movement. The proposed method worked on random motion sequences for the dual purpose of movement segmentation (accuracy of 72%-100%) and motor performance assessment (mean error of 0%-12%).

Localization and recognition of traffic signs for automated vehicle control systems

NASA Astrophysics Data System (ADS)

Zadeh, Mahmoud M.; Kasvand, T.; Suen, Ching Y.

1998-01-01

We present a computer vision system for detection and recognition of traffic signs. Such systems are required to assist drivers and for guidance and control of autonomous vehicles on roads and city streets. For experiments we use sequences of digitized photographs and off-line analysis. The system contains four stages. First, region segmentation based on color pixel classification called SRSM. SRSM limits the search to regions of interest in the scene. Second, we use edge tracing to find parts of outer edges of signs which are circular or straight, corresponding to the geometrical shapes of traffic signs. The third step is geometrical analysis of the outer edge and preliminary recognition of each candidate region, which may be a potential traffic sign. The final step in recognition uses color combinations within each region and model matching. This system maybe used for recognition of other types of objects, provided that the geometrical shape and color content remain reasonably constant. The method is reliable, easy to implement, and fast, This differs form the road signs recognition method in the PROMETEUS. The overall structure of the approach is sketched.

Preliminary analysis of murine cytotoxic T cell responses to the proteins of the flavivirus Kunjin using vaccinia virus expression.

PubMed

Parrish, C R; Coia, G; Hill, A; Müllbacher, A; Westaway, E G; Blanden, R V

1991-07-01

A series of recombinant vaccinia viruses expressing various parts of the entire Kunjin virus (KUN) coding region was used to analyse the cytotoxic T (Tc) cell responses to KUN. CBA/H mice inoculated with KUN or West Nile virus were shown to develop responses to KUN or various vaccinia virus expression constructs in either primary cytotoxic assays, or after secondary stimulation of the Tc cells in vitro with KUN antigens. Tc cells from CBA mice showed the strongest response to target cells infected with recombinant vaccinia viruses expressing parts of the KUN NS3 and NS4A proteins, and only a weak response to the other structural or non-structural proteins. Further analysis of deleted versions of the NS3-NS4A region showed that the main epitope recognized was derived from a sequence of 99 amino acids spanning parts of NS3 and NS4A. No other major epitopes were detected by Tc cells from CBA mice in the remaining 3333 amino acids of the KUN polypeptide.

A preliminary report on the genetic variation in pointed gourd (Trichosanthes dioica Roxb.) as assessed by random amplified polymorphic DNA.

PubMed

Adhikari, S; Biswas, A; Bandyopadhyay, T K; Ghosh, P D

2014-06-01

Pointed gourd (Trichosanthes dioica Roxb.) is an economically important cucurbit and is extensively propagated through vegetative means, viz vine and root cuttings. As the accessions are poorly characterized it is important at the beginning of a breeding programme to discriminate among available genotypes to establish the level of genetic diversity. The genetic diversity of 10 pointed gourd races, referred to as accessions was evaluated. DNA profiling was generated using 10 sequence independent RAPD markers. A total of 58 scorable loci were observed out of which 18 (31.03%) loci were considered polymorphic. Genetic diversity parameters [average and effective number of alleles, Shannon's index, percent polymorphism, Nei's gene diversity, polymorphic information content (PIC)] for RAPD along with UPGMA clustering based on Jaccard's coefficient were estimated. The UPGMA dendogram constructed based on RAPD analysis in 10 pointed gourd accessions were found to be grouped in a single cluster and may represent members of one heterotic group. RAPD analysis showed promise as an effective tool in estimating genetic polymorphism in different accessions of pointed gourd.

Purification, crystallization and preliminary X-ray crystallographic analysis of a cysteine-rich secretory protein (CRISP) from Naja atra venom.

PubMed

Wang, Yu-Ling; Goh, King-Xiang; Wu, Wen-guey; Chen, Chun-Jung

2004-10-01

Cysteine-rich secretory proteins (CRISPs) play an important role in the innate immune system and are transcriptionally regulated by androgens in several tissues. The proteins are mostly found in the epididymis and granules of mammals, whilst a number of snake venoms also contain CRISP-family proteins. The natrin protein from the venom of Naja atra (Taiwan cobra), which belongs to a family of CRISPs and has a cysteine-rich C-terminal amino-acid sequence, has been purified using a three-stage chromatography procedure and crystals suitable for X-ray analysis have been obtained using the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 1.58 A resolution using synchrotron radiation; the crystals belong to space group C222(1), with unit-cell parameters a = 59.172, b = 65.038, c = 243.156 A. There are two protein molecules in the asymmetric unit and the Matthews coefficient is estimated to be 2.35 A3 Da(-1), corresponding to a solvent content of 47.60%.

Preliminary Results From the Chile-Illapel Aftershock Experiment (CHILLAX)

NASA Astrophysics Data System (ADS)

Roecker, S. W.; Russo, R. M.; Comte, D.; Carrizo, D.; Peyrat, S.; Opazo, T.; Peña, G.; Farrell, M. E.; Moore, J.; Glick, R.; Rodriguez, E. E.

2016-12-01

On September 16, 2015, the Mw 8.3 Illapel earthquake ruptured a segment of the Nazca-South America subduction zone directly to the north of the 2010 Maule Mw 8.8 earthquake. Soon afterwards, a team from the Departamento de Geofisica, University of Chile, installed 18 short period sensors on land above the rupture to record aftershocks. A month later, the network was upgraded and expanded with funding from NSF RAPID to 20 broad band stations, loaned by IRIS PASSCAL. The installation of the Chile-Illapel Aftershock Experiment (CHILLAX) was completed in mid-November, 2015, and will operate until November, 2016. Preliminary analysis of data collected to date indicates an average detection rate of about 1000 locatable aftershocks per month. The combined CHILLAX and Maule aftershock deployments will yield the first modern-instrumentation observations of the zone of along-strike rupture termination that separates these temporally related and spatially adjacent megathrust rupture zones. Additionally, seismic observations of this part of the Nazca subduction zone are relatively sparse, and an aftershock sequence provides an opportunity to fill this gap efficiently. Preliminary analysis of CHILLAX network data revealed unexpected patterns in seismicity down dip from the rupture zone, in the unusual "flat slab" region to the east. Compared to the Maule event, the Illapel rupture apparently generated a more significant increase in seismicity in the 60-200 km depth range, suggesting that it "lit up" the subducted Nazca plate. Although high strain rates due to rupture might extend brittle failure into normally ductile regions, such an effect at these depths by the relatively low magnitude Illapel event is unusual. A perhaps more intriguing result is the frequent occurrence of events at depths significantly below that of the "flat slab". Attribution of this apparent second, deeper slab segment to event mislocations would require unrealistic seismic heterogeneity, We hypothesize that either the subduction of thick, buoyant crust of the Juan Fernandez Ridge has resulted in a slab tear, or that the "flat" seismicity is not occuring within the Nazca slab, but instead within the overriding South American lithosphere. In the latter case, the shallower flat slab earthquakes may represent a nascent delamination event.

Improved Analysis of Nanopore Sequence Data and Scanning Nanopore Techniques

NASA Astrophysics Data System (ADS)

Szalay, Tamas

The field of nanopore research has been driven by the need to inexpensively and rapidly sequence DNA. In order to help realize this goal, this thesis describes the PoreSeq algorithm that identifies and corrects errors in real-world nanopore sequencing data and improves the accuracy of de novo genome assembly with increasing coverage depth. The approach relies on modeling the possible sources of uncertainty that occur as DNA advances through the nanopore and then using this model to find the sequence that best explains multiple reads of the same region of DNA. PoreSeq increases nanopore sequencing read accuracy of M13 bacteriophage DNA from 85% to 99% at 100X coverage. We also use the algorithm to assemble E. coli with 30X coverage and the lambda genome at a range of coverages from 3X to 50X. Additionally, we classify sequence variants at an order of magnitude lower coverage than is possible with existing methods. This thesis also reports preliminary progress towards controlling the motion of DNA using two nanopores instead of one. The speed at which the DNA travels through the nanopore needs to be carefully controlled to facilitate the detection of individual bases. A second nanopore in close proximity to the first could be used to slow or stop the motion of the DNA in order to enable a more accurate readout. The fabrication process for a new pyramidal nanopore geometry was developed in order to facilitate the positioning of the nanopores. This thesis demonstrates that two of them can be placed close enough to interact with a single molecule of DNA, which is a prerequisite for being able to use the driving force of the pores to exert fine control over the motion of the DNA. Another strategy for reading the DNA is to trap it completely with one pore and to move the second nanopore instead. To that end, this thesis also shows that a single strand of immobilized DNA can be captured in a scanning nanopore and examined for a full hour, with data from many scans at many different voltages obtained in order to detect a bound protein placed partway along the molecule.

Preliminary catalog of pictures taken on the lunar surface during the Apollo 16 mission

NASA Technical Reports Server (NTRS)

Batson, R. M.; Carson, K. B.; Reed, V. S.; Tyner, R. L.

1972-01-01

A catalog of all pictures taken from the lunar module or the lunar surface during the Apollo 16 lunar stay is presented. The tabulations are arranged for the following specific uses: (1) given the number of a particular frame, find its location in the sequence of lunar surface activity, the station from which it was taken and the subject matter of the picture; (2) given a particular location or activity within the sequence of lunar surface activity, find the pictures taken at that time and their subject matter; and (3) given a sample number from the voice transcript listed, find the designation assigned to the same sample by the lunar receiving laboratory.

Identification of largemouth bass virus in the introduced Northern Snakehead inhabiting the Chesapeake Bay watershed.

PubMed

Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J

2013-09-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Identification of largemouth bass virus in the introduced Northern snakehead inhabiting the Cheasapeake Bay watershed

USGS Publications Warehouse

Iwanowicz, Luke R.; Densmore, Christine L.; Hahn, Cassidy M.; McAllister, Phillip; Odenkirk, John

2013-01-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Streamwise-Localized Solutions with natural 1-fold symmetry

NASA Astrophysics Data System (ADS)

Altmeyer, Sebastian; Willis, Ashley; Hof, Björn

2014-11-01

It has been proposed in recent years that turbulence is organized around unstable invariant solutions, which provide the building blocks of the chaotic dynamics. In direct numerical simulations of pipe flow we show that when imposing a minimal symmetry constraint (reflection in an axial plane only) the formation of turbulence can indeed be explained by dynamical systems concepts. The hypersurface separating laminar from turbulent motion, the edge of turbulence, is spanned by the stable manifolds of an exact invariant solution, a periodic orbit of a spatially localized structure. The turbulent states themselves (turbulent puffs in this case) are shown to arise in a bifurcation sequence from a related localized solution (the upper branch orbit). The rather complex bifurcation sequence involves secondary Hopf bifurcations, frequency locking and a period doubling cascade until eventually turbulent puffs arise. In addition we report preliminary results of the transition sequence for pipe flow without symmetry constraints.

Preliminary Analysis of Helicopter Options to Support Tunisian Counterterrorism Operations

DTIC Science & Technology

2016-04-27

locations along roads and tracks in border areas, and small settlements in complex terrain (Figure 1, right; examples shown in Figure 2). Analysis For...political implications. In this preliminary analysis , we focus on the question of cost-effectiveness in the UH-60M’s primary role: Which alternative...platforms could perform the assault mission, and at what cost? The core of our analysis is detailed modeling of key “mission tasks” on a sortie-by-sortie

Measurements of RF heating during 3.0-T MRI of a pig implanted with deep brain stimulator.

PubMed

Gorny, Krzysztof R; Presti, Michael F; Goerss, Stephan J; Hwang, Sun C; Jang, Dong-Pyo; Kim, Inyong; Min, Hoon-Ki; Shu, Yunhong; Favazza, Christopher P; Lee, Kendall H; Bernstein, Matt A

2013-06-01

To present preliminary, in vivo temperature measurements during MRI of a pig implanted with a deep brain stimulation (DBS) system. DBS system (Medtronic Inc., Minneapolis, MN) was implanted in the brain of an anesthetized pig. 3.0-T MRI was performed with a T/R head coil using the low-SAR GRE EPI and IR-prepped GRE sequences (SAR: 0.42 and 0.39 W/kg, respectively), and the high-SAR 4-echo RF spin echo (SAR: 2.9 W/kg). Fluoroptic thermometry was used to directly measure RF-related heating at the DBS electrodes, and at the implantable pulse generator (IPG). For reference the measurements were repeated in the same pig at 1.5 T and, at both field strengths, in a phantom. At 3.0T, the maximal temperature elevations at DBS electrodes were 0.46 °C and 2.3 °C, for the low- and high-SAR sequences, respectively. No heating was observed on the implanted IPG during any of the measurements. Measurements of in vivo heating differed from those obtained in the phantom. The 3.0-T MRI using GRE EPI and IR-prepped GRE sequences resulted in local temperature elevations at DBS electrodes of no more than 0.46 °C. Although no extrapolation should be made to human exams and much further study will be needed, these preliminary data are encouraging for the future use 3.0-T MRI in patients with DBS. Copyright © 2013 Elsevier Inc. All rights reserved.

Preliminary results of high resolution magneto-biostratigraphy of continental sequences in Chapala Basin, Southwestern Mexico

NASA Astrophysics Data System (ADS)

Mendez Cardenas, D. L.; Benammi, M.

2007-05-01

Chapala Lake is south from Guadalajara, Jalisco State (Southwestern Mexico). Belongs to a series of Pliocenic lakes along the Mexican Volcanic Belt. It is localized in the Chapala rift, and the entire area is controlled by the tectonic setting of the Colima, Tepic and Chapala rifts, constituting the triple junction rift-rift-rift. The deposits studied belong to volcanosedimentary sequences, composed by lacustrine and fluvial associations alternated with units of ash and pumice. The faunistic component reported consists at least of 27 mammals species, and the sediments were there're in have to work with special attention for seek rodents by handpicking. Probably these rodents will be the clue to determine the deposits correlation. Core demagnetization shows that they are low-coercivity magnetic minerals like magnetite or Ti-magnetite. It was verified that the characteristic magnetization corresponds to MNRp and the inversion test resulted good. Rodents are represented by Geomynae, Sigmondontinae and Sciurinae. The Geomynae family is the most common, and the faunistic association indicates Blancan age. This also allows a correlation with the polarity pattern in the GSS between 3,6 and 2,6 Ma. Actually, is known that this kind of studies in continental sequences supported with paleontological record of vertebrates could give us a more precised calibration of the age of such deposits. Allowing better understanding of the evolution of these mammals and their path trough geological record. This work shows the preliminary results of rodents palaeontology and high resolution magneto-stratigraphy in the units from to Chapala Basin.

Measurements of RF Heating during 3.0T MRI of a Pig Implanted with Deep Brain Stimulator

PubMed Central

Gorny, Krzysztof R; Presti, Michael F; Goerss, Stephan J; Hwang, Sun C; Jang, Dong-Pyo; Kim, Inyong; Shu, Yunhong; Favazza, Christopher P; Lee, Kendall H; Bernstein, Matt A

2012-01-01

Purpose To present preliminary, in vivo temperature measurements during MRI of a pig implanted with a deep brain stimulation (DBS) system. Materials and Methods DBS system (Medtronic Inc., Minneapolis, MN) was implanted in the brain of an anesthetized pig. 3.0T MRI was performed with a T/R head coil using the low-SAR GRE EPI and IR-prepped GRE sequences (SAR: 0.42 W/kg and 0.39 W/kg, respectively), and the high-SAR 4-echo RF spin echo (SAR: 2.9 W/kg). Fluoroptic thermometry was used to directly measure RF-related heating at the DBS electrodes, and at the implantable pulse generator (IPG). For reference the measurements were repeated in the same pig at 1.5T and, at both field strengths, in a phantom. Results At 3.0T, the maximal temperature elevations at DBS electrodes were 0.46 °C and 2.3 °C, for the low- and high-SAR sequences, respectively. No heating was observed on the implanted IPG during any of the measurements. Measurements of in-vivo heating differed from those obtained in the phantom. Conclusion The 3.0T MRI using GRE EPI and IR-prepped GRE sequences resulted in local temperature elevations at DBS electrodes of no more than 0.46°C. Although no extrapolation should be made to human exams and much further study will be needed, these preliminary data are encouraging for the future use 3.0T MRI in patients with DBS. PMID:23228310

Toxic release consequence analysis tool (TORCAT) for inherently safer design plant.

PubMed

Shariff, Azmi Mohd; Zaini, Dzulkarnain

2010-10-15

Many major accidents due to toxic release in the past have caused many fatalities such as the tragedy of MIC release in Bhopal, India (1984). One of the approaches is to use inherently safer design technique that utilizes inherent safety principle to eliminate or minimize accidents rather than to control the hazard. This technique is best implemented in preliminary design stage where the consequence of toxic release can be evaluated and necessary design improvements can be implemented to eliminate or minimize the accidents to as low as reasonably practicable (ALARP) without resorting to costly protective system. However, currently there is no commercial tool available that has such capability. This paper reports on the preliminary findings on the development of a prototype tool for consequence analysis and design improvement via inherent safety principle by utilizing an integrated process design simulator with toxic release consequence analysis model. The consequence analysis based on the worst-case scenarios during process flowsheeting stage were conducted as case studies. The preliminary finding shows that toxic release consequences analysis tool (TORCAT) has capability to eliminate or minimize the potential toxic release accidents by adopting the inherent safety principle early in preliminary design stage. 2010 Elsevier B.V. All rights reserved.

Airport Surface Delays and Causes: A Preliminary Analysis

NASA Technical Reports Server (NTRS)

Chin, David K.; Goldberg, Jay; Tang, Tammy

1997-01-01

This report summarizes FAA Program Analysis and Operations Research Service (ASD-400)/Lockheed Martin activities and findings related to airport surface delays and causes, in support of NASA Langley Research Center's Terminal Area Productivity (TAP) Program. The activities described in this report were initiated in June 1995. A preliminary report was published on September 30, 1995. The final report incorporates data collection forms filled out by traffic managers, other FAA staff, and an airline for the New York City area, some updates, data previously requested from various sources to support this analysis, and further quantification and documentation than in the preliminary report. This final report is based on data available as of April 12, 1996. This report incorporates data obtained from review and analysis of data bases and literature, discussions/interviews with engineers, air-traffic staff, other FAA technical personnel, and airline staff, site visits, and a survey on surface delays and causes. It includes analysis of delay statistics; preliminary findings and conclusions on surface movement, surface delay sources and causes, runway occupancy time (ROT), and airport characteristics impacting surface operations and delays; and site-specific data on the New York City area airports, which are the focus airports for this report.

Polyphenism in social insects: insights from a transcriptome-wide analysis of gene expression in the life stages of the key pollinator, Bombus terrestris

PubMed Central

2011-01-01

Background Understanding polyphenism, the ability of a single genome to express multiple morphologically and behaviourally distinct phenotypes, is an important goal for evolutionary and developmental biology. Polyphenism has been key to the evolution of the Hymenoptera, and particularly the social Hymenoptera where the genome of a single species regulates distinct larval stages, sexual dimorphism and physical castes within the female sex. Transcriptomic analyses of social Hymenoptera will therefore provide unique insights into how changes in gene expression underlie such complexity. Here we describe gene expression in individual specimens of the pre-adult stages, sexes and castes of the key pollinator, the buff-tailed bumblebee Bombus terrestris. Results cDNA was prepared from mRNA from five life cycle stages (one larva, one pupa, one male, one gyne and two workers) and a total of 1,610,742 expressed sequence tags (ESTs) were generated using Roche 454 technology, substantially increasing the sequence data available for this important species. Overlapping ESTs were assembled into 36,354 B. terrestris putative transcripts, and functionally annotated. A preliminary assessment of differences in gene expression across non-replicated specimens from the pre-adult stages, castes and sexes was performed using R-STAT analysis. Individual samples from the life cycle stages of the bumblebee differed in the expression of a wide array of genes, including genes involved in amino acid storage, metabolism, immunity and olfaction. Conclusions Detailed analyses of immune and olfaction gene expression across phenotypes demonstrated how transcriptomic analyses can inform our understanding of processes central to the biology of B. terrestris and the social Hymenoptera in general. For example, examination of immunity-related genes identified high conservation of important immunity pathway components across individual specimens from the life cycle stages while olfactory-related genes exhibited differential expression with a wider repertoire of gene expression within adults, especially sexuals, in comparison to immature stages. As there is an absence of replication across the samples, the results of this study are preliminary but provide a number of candidate genes which may be related to distinct phenotypic stage expression. This comprehensive transcriptome catalogue will provide an important gene discovery resource for directed programmes in ecology, evolution and conservation of a key pollinator. PMID:22185240

Whole-body Magnetic Resonance Imaging in Inflammatory Arthritis: Systematic Literature Review and First Steps Toward Standardization and an OMERACT Scoring System.

PubMed

Østergaard, Mikkel; Eshed, Iris; Althoff, Christian E; Poggenborg, Rene P; Diekhoff, Torsten; Krabbe, Simon; Weckbach, Sabine; Lambert, Robert G W; Pedersen, Susanne J; Maksymowych, Walter P; Peterfy, Charles G; Freeston, Jane; Bird, Paul; Conaghan, Philip G; Hermann, Kay-Geert A

2017-11-01

Whole-body magnetic resonance imaging (WB-MRI) is a relatively new technique that can enable assessment of the overall inflammatory status of people with arthritis, but standards for image acquisition, definitions of key pathologies, and a quantification system are required. Our aim was to perform a systematic literature review (SLR) and to develop consensus definitions of key pathologies, anatomical locations for assessment, a set of MRI sequences and imaging planes for the different body regions, and a preliminary scoring system for WB-MRI in inflammatory arthritis. An SLR was initially performed, searching for WB-MRI studies in arthritis, osteoarthritis, spondyloarthritis, or enthesitis. These results were presented to a meeting of the MRI in Arthritis Working Group together with an MR image review. Following this, preliminary standards for WB-MRI in inflammatory arthritides were developed with further iteration at the Working Group meetings at the Outcome Measures in Rheumatology (OMERACT) 2016. The SLR identified 10 relevant original articles (7 cross-sectional and 3 longitudinal, mostly focusing on synovitis and/or enthesitis in spondyloarthritis, 4 with reproducibility data). The Working Group decided on inflammation in peripheral joints and entheses as primary focus areas, and then developed consensus MRI definitions for these pathologies, selected anatomical locations for assessment, agreed on a core set of MRI sequences and imaging planes for the different regions, and proposed a preliminary scoring system. It was decided to test and further develop the system by iterative multireader exercises. These first steps in developing an OMERACT WB-MRI scoring system for use in inflammatory arthritides offer a framework for further testing and refinement.

Microbial Composition and Preliminary Age of Ooids from the Great Salt Lake, Utah

NASA Astrophysics Data System (ADS)

Piazza, O.; Corsetti, F. A.; Stamps, B. W.; Stevenson, B. S.; Bardsley, A.; Hammond, D. E.; Nunn, H. S.; Berelson, W.; Spear, J. R.

2016-12-01

Ooids (laminated coated grains) are common in the geologic record in lacustrine and marine systems. Traditionally interpreted as abiogenic precipitates, recent work suggests that microbial metabolism/byproducts may enhance the calcium carbonate precipitation of some ooids. Thus, the processes that govern ooid formation remain enigmatic, making it difficult to assess their significance as biosigntatures and environmental indicators in modern/ancient environments. The Great Salt Lake, Utah, provides a unique environment to assess the microbial community and growth rate of aragonitic ooids. Ooids collected near Antelope Island were first sieved into coarse, medium, and fine size fractions. One aliquot of each fraction was left untreated and another was washed with ethanol to remove the biomass/biofilm from the exterior. The microbial communities of each aliquot and the surrounding lake water were compared using small subunit rRNA gene sequencing. Since 50% of the ooids studied contain nuclei that were fecal pellets from the Great Salt Lake Artemia (brine shrimp), Artemia pellets were also collected and sequenced to compare to the ooids and the lake water. 228Ra/226Ra of ooids and lake water was measured to evaluate ooid age. Preliminary 228Ra/226Ra results indicate that ooid growth has occurred in the last few decades. Alphaproteobacteria, Deltaproteobacteria, Planctomycetes, and Bacteriodetes were the most abundant bacterial taxa present within ooid samples. In contrast, the lake water was significantly different in composition, dominated by the halophilic Halobacteria (Euryarchaeota). Both the treated and untreated ooids had a microbial community that more closely resembled the composition of the Artemia fecal pellets than the Great Salt Lake water. We conclude that 1) preliminary dating using a novel chronometer suggests very recent ooid formation, and 2) nuclei composition may skew the results when investigating ooid microbial communities.

Section of Morgan formation, Pennsylvanian, at Split Mountain in Dinosaur National Monument, Uintah County, Utah

USGS Publications Warehouse

McCann, Franklin T.; Raman, Norman D.; Henbest, Lloyd G.

1946-01-01

Extension of the oil pool in the Weber sandstone (Pennsylvanian), in the Rangely oil field, Rio Blanco County, Colorado, subsequent to the completion of the filed work on which Preliminary Chart 16 is based, has stimulated special interest in the beds beneath that sandstone as potential oil reservoirs. In compliance with the demand for additional information concerning these beds, a detailed description of the sequence immediately underlying the Weber sandstone at Split Mountain, Utah, is here given. That part of Split Mountain where the section was measured is approximately 35 airline miles northwest of the town of Rangely. The section itself is shown graphically and somewhat generalized in column 8, sheet 2, Preliminary Chart 16. A more detailed graphic section is presented in the accompanying column section.

Repetitive sequences and epigenetic modification: inseparable partners play important roles in the evolution of plant sex chromosomes.

PubMed

Li, Shu-Fen; Zhang, Guo-Jun; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

2016-05-01

The present review discusses the roles of repetitive sequences played in plant sex chromosome evolution, and highlights epigenetic modification as potential mechanism of repetitive sequences involved in sex chromosome evolution. Sex determination in plants is mostly based on sex chromosomes. Classic theory proposes that sex chromosomes evolve from a specific pair of autosomes with emergence of a sex-determining gene(s). Subsequently, the newly formed sex chromosomes stop recombination in a small region around the sex-determining locus, and over time, the non-recombining region expands to almost all parts of the sex chromosomes. Accumulation of repetitive sequences, mostly transposable elements and tandem repeats, is a conspicuous feature of the non-recombining region of the Y chromosome, even in primitive one. Repetitive sequences may play multiple roles in sex chromosome evolution, such as triggering heterochromatization and causing recombination suppression, leading to structural and morphological differentiation of sex chromosomes, and promoting Y chromosome degeneration and X chromosome dosage compensation. In this article, we review the current status of this field, and based on preliminary evidence, we posit that repetitive sequences are involved in sex chromosome evolution probably via epigenetic modification, such as DNA and histone methylation, with small interfering RNAs as the mediator.

LegumeDB1 bioinformatics resource: comparative genomic analysis and novel cross-genera marker identification in lupin and pasture legume species.

PubMed

Moolhuijzen, P; Cakir, M; Hunter, A; Schibeci, D; Macgregor, A; Smith, C; Francki, M; Jones, M G K; Appels, R; Bellgard, M

2006-06-01

The identification of markers in legume pasture crops, which can be associated with traits such as protein and lipid production, disease resistance, and reduced pod shattering, is generally accepted as an important strategy for improving the agronomic performance of these crops. It has been demonstrated that many quantitative trait loci (QTLs) identified in one species can be found in other plant species. Detailed legume comparative genomic analyses can characterize the genome organization between model legume species (e.g., Medicago truncatula, Lotus japonicus) and economically important crops such as soybean (Glycine max), pea (Pisum sativum), chickpea (Cicer arietinum), and lupin (Lupinus angustifolius), thereby identifying candidate gene markers that can be used to track QTLs in lupin and pasture legume breeding. LegumeDB is a Web-based bioinformatics resource for legume researchers. LegumeDB analysis of Medicago truncatula expressed sequence tags (ESTs) has identified novel simple sequence repeat (SSR) markers (16 tested), some of which have been putatively linked to symbiosome membrane proteins in root nodules and cell-wall proteins important in plant-pathogen defence mechanisms. These novel markers by preliminary PCR assays have been detected in Medicago truncatula and detected in at least one other legume species, Lotus japonicus, Glycine max, Cicer arietinum, and (or) Lupinus angustifolius (15/16 tested). Ongoing research has validated some of these markers to map them in a range of legume species that can then be used to compile composite genetic and physical maps. In this paper, we outline the features and capabilities of LegumeDB as an interactive application that provides legume genetic and physical comparative maps, and the efficient feature identification and annotation of the vast tracks of model legume sequences for convenient data integration and visualization. LegumeDB has been used to identify potential novel cross-genera polymorphic legume markers that map to agronomic traits, supporting the accelerated identification of molecular genetic factors underpinning important agronomic attributes in lupin.

Tandem repeat variation near the HIC1 (hypermethylated in cancer 1) promoter predicts outcome of oxaliplatin-based chemotherapy in patients with metastatic colorectal cancer.

PubMed

Okazaki, Satoshi; Schirripa, Marta; Loupakis, Fotios; Cao, Shu; Zhang, Wu; Yang, Dongyun; Ning, Yan; Berger, Martin D; Miyamoto, Yuji; Suenaga, Mitsukuni; Iqubal, Syma; Barzi, Afsaneh; Cremolini, Chiara; Falcone, Alfredo; Battaglin, Francesca; Salvatore, Lisa; Borelli, Beatrice; Helentjaris, Timothy G; Lenz, Heinz-Josef

2017-11-15

The hypermethylated in cancer 1/sirtuin 1 (HIC1/SIRT1) axis plays an important role in regulating the nucleotide excision repair pathway, which is the main oxaliplatin-induced damage-repair system. On the basis of prior evidence that the variable number of tandem repeat (VNTR) sequence located near the promoter lesion of HIC1 is associated with HIC1 gene expression, the authors tested the hypothesis that this VNTR is associated with clinical outcome in patients with metastatic colorectal cancer who receive oxaliplatin-based chemotherapy. Four independent cohorts were tested. Patients who received oxaliplatin-based chemotherapy served as the training cohort (n = 218), and those who received treatment without oxaliplatin served as the control cohort (n = 215). Two cohorts of patients who received oxaliplatin-based chemotherapy were used for validation studies (n = 176 and n = 73). The VNTR sequence near HIC1 was analyzed by polymerase chain reaction analysis and gel electrophoresis and was tested for associations with the response rate, progression-free survival, and overall survival. In the training cohort, patients who harbored at least 5 tandem repeats (TRs) in both alleles had a significantly shorter PFS compared with those who had fewer than 4 TRs in at least 1 allele (9.5 vs 11.6 months; hazard ratio, 1.93; P = .012), and these findings remained statistically significant after multivariate analysis (hazard ratio, 2.00; 95% confidence interval, 1.13-3.54; P = .018). This preliminary association was confirmed in the validation cohort, and patients who had at least 5 TRs in both alleles had a worse PFS compared with the other cohort (7.9 vs 9.8 months; hazard ratio, 1.85; P = .044). The current findings suggest that the VNTR sequence near HIC1 could be a predictive marker for oxaliplatin-based chemotherapy in patients with metastatic colorectal cancer. Cancer 2017;123:4506-14. © 2017 American Cancer Society. © 2017 American Cancer Society.

Selection, characterization, and application of DNA aptamers for detection of Mycobacterium tuberculosis secreted protein MPT64.

PubMed

Sypabekova, Marzhan; Bekmurzayeva, Aliya; Wang, Ronghui; Li, Yanbin; Nogues, Claude; Kanayeva, Damira

2017-05-01

Rapid detection of Mycobacterium tuberculosis (Mtb), an etiological agent of tuberculosis (TB), is important for global control of this disease. Aptamers have emerged as a potential rival for antibodies in therapeutics, diagnostics and biosensing due to their inherent characteristics. The aim of the current study was to select and characterize single-stranded DNA aptamers against MPT64 protein, one of the predominant secreted proteins of Mtb pathogen. Aptamers specific to MPT64 protein were selected in vitro using systematic evolution of ligands through exponential enrichment (SELEX) method. The selection was started with a pool of ssDNA library with randomized 40-nucleotide region. A total of 10 cycles were performed and seventeen aptamers with unique sequences were identified by sequencing. Dot Blot analysis was performed to monitor the SELEX process and to conduct the preliminary tests on the affinity and specificity of aptamers. Enzyme linked oligonucleotide assay (ELONA) showed that most of the aptamers were specific to the MPT64 protein with a linear correlation of R 2  = 0.94 for the most selective. Using Surface Plasmon Resonance (SPR), dissociation equilibrium constant K D of 8.92 nM was obtained. Bioinformatics analysis of the most specific aptamers revealed the existence of a conserved as well as distinct sequences and possible binding site on MPT64. The specificity was determined by testing non-target ESAT-6 and CFP-10. Negligible cross-reactivity confirmed the high specificity of the selected aptamer. The selected aptamer was further tested on clinical sputum samples using ELONA and had sensitivity and specificity of 91.3% and 90%, respectively. Microscopy, culture positivity and nucleotide amplification methods were used as reference standards. The aptamers studied could be further used for the development of medical diagnostic tools and detection assays for Mtb. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

The 2009 L'Aquila earthquake sequence: technical and scientific activities during the emergency and post-emergency phases

NASA Astrophysics Data System (ADS)

Cardinali, Mauro

2010-05-01

The Central Apennines of Italy is an area characterized by significant seismic activity. In this area, individual earthquakes and prolonged seismic sequences produce a variety of ground effects, including landslides. The L'Aquila area, in the Abruzzo Region, was affected by an earthquake sequence that started on December 2008, and continued for several months. The main shock occurred on April 6, 2009, with local magnitude m = 6.3, and was followed by two separate earthquakes on April 7 and April 9, each with a local magnitude m > 5.0. The main shocks caused 308 fatalities, injured more than 1500 people, and left in excess of 65,000 people homeless. Damage to the cultural heritage was also severe, with tens of churches and historical buildings severely damaged or destroyed. The main shocks and some of the most severe aftershocks triggered landslides, chiefly rock falls and minor rock slides that caused damage to towns, individual houses, and the transportation network. Beginning in the immediate aftermath of the event, and continuing during the emergency and post-emergency phases, we assisted the Italian national Department for Civil Protection in the evaluation of local landslide and hydrological risk conditions. Technical and scientific activities focused on: (i) mapping the location, type, and severity of the main ground effects produced by the earthquake shaking, (ii) evaluating and selecting sites for potential new settlements and individual buildings, including a preliminary assessment of the local geomorphological and hydrological conditions; (iii) evaluating rock fall hazard at individual sites, (iv) monitoring slope and ground deformations, and (v) designing and implementing a prototype system for the forecast of the possible occurrence of rainfall-induced landslides. To execute these activates, we exploited a wide range of methods, techniques, and technologies, and we performed repeated field surveys, the interpretation of ground and aerial photographs taken at different times, the analysis and processing of optical and SAR satellite images, and the statistical analysis of rainfall measurements and quantitative weather forecasts.

A deeper view into the significance of simple sequence repeats in pre-miRNAs provides clues for its possible roles in determining the function of microRNAs.

PubMed

Joy, Nisha; Maimoonath Beevi, Y P; Soniya, E V

2018-05-09

The central tenet of 'genome content' has been that the 'non-coding' parts are highly enriched with 'microsatellites' or 'Simple Sequence Repeats' (SSRs). We presume that the presence and change in number of repeat unit (n) of SSRs in different genomic locations may or may not become beneficial, depending on the position of SSRs in a gene. Very few studies have looked into the existence of SSRs in the hair-pin precursors of miRNAs (pre-miRNAs). The interplay between SSRs and miRNAs is not yet clearly understood. Considering the potential significance of SSRs in pre-miRNAs, we analysed the miRNA hair-pin precursors of 171 organisms, which revealed a noticeable (29.8%) existence of SSRs in their pre-miRNAs. The maintenance of SSRs in pre-miRNAs even in the complex, highly evolved phyla like Chordata and Magnoliophyta shed light upon its diverse functions. Putative effects of SSRs in either regulating the biogenesis or function of miRNAs were more underlined based on computational and experimental analysis. A preliminary computational analysis to explore the relevance of such SSRs maintained in pre-miRNA sequences led to the detection of splicing regulatory elements (SREs) either in or near to the SSRs. The absence of SSRs correspondingly decreased the detection of SREs. The present study is the first implication for the possible involvement of SSRs in shaping the SREs to undergo Alternative Splicing events to produce miRNA isoforms in accordance with different stress environments. This part of work well demonstrates the importance of studying such consistently maintained SSRs residing in pre-miRNAs and can enhance more and more research towards deciphering the exact function of SSRs in the near future.

Phylogenetic Relationships of Citrus and Its Relatives Based on matK Gene Sequences

PubMed Central

Penjor, Tshering; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji

2013-01-01

The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that “true citrus fruit trees” could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have comprehensively discussed the classification of this genus. PMID:23638116

Bioinformatic Analysis of Pathogenic Missense Mutations of Activin Receptor Like Kinase 1 Ectodomain

PubMed Central

Scotti, Claudia; Olivieri, Carla; Boeri, Laura; Canzonieri, Cecilia; Ornati, Federica; Buscarini, Elisabetta; Pagella, Fabio; Danesino, Cesare

2011-01-01

Activin A receptor, type II-like kinase 1 (also called ALK1), is a serine-threonine kinase predominantly expressed on endothelial cells surface. Mutations in its ACVRL1 encoding gene (12q11-14) cause type 2 Hereditary Haemorrhagic Telangiectasia (HHT2), an autosomal dominant multisystem vascular dysplasia. The study of the structural effects of mutations is crucial to understand their pathogenic mechanism. However, while an X-ray structure of ALK1 intracellular domain has recently become available (PDB ID: 3MY0), structure determination of ALK1 ectodomain (ALK1EC) has been elusive so far. We here describe the building of a homology model for ALK1EC, followed by an extensive bioinformatic analysis, based on a set of 38 methods, of the effect of missense mutations at the sequence and structural level. ALK1EC potential interaction mode with its ligand BMP9 was then predicted combining modelling and docking data. The calculated model of the ALK1EC allowed mapping and a preliminary characterization of HHT2 associated mutations. Major structural changes and loss of stability of the protein were predicted for several mutations, while others were found to interfere mainly with binding to BMP9 or other interactors, like Endoglin (CD105), whose encoding ENG gene (9q34) mutations are known to cause type 1 HHT. This study gives a preliminary insight into the potential structure of ALK1EC and into the structural effects of HHT2 associated mutations, which can be useful to predict the potential effect of each single mutation, to devise new biological experiments and to interpret the biological significance of new mutations, private mutations, or non-synonymous polymorphisms. PMID:22028876

Development of the 10-11 July 2015 two-stage sequence of multiple emplacements of pyroclastic density currents at Volcán de Colima, México: Insight from associated seismic signals

NASA Astrophysics Data System (ADS)

Zobin, Vyacheslav M.

2018-02-01

The 10-11 July 2015 partial collapses of the lava dome in the crater of Volcán de Colima, México, were accompanied by a sequence of two-stage multiple PDCs, separated by a 15-h interval, with a total bulk volume of 14.2 × 106 m3 of fragmentary material and runout distances reaching 9.1 and 10.3 km, respectively (Reyes-Dávila et al., 2016). Broad-band seismic signals, associated with the PDCs and recorded at seismic station EZ5 installed at a distance of 4 km from the crater, were used for analysis of the 20-h eruption process. This process included two stages of the multiple PDCs emplacements, two one-hour periods of preliminary events to each of the stages, and the inter-stage period. Analysis of seismic signals allowed us to identify the types of volcanic events composing this eruption episode and estimate their quantitative characteristics and spectral parameters of generated seismic signals. It was shown that the seismic signals produced by PDCs emplacements, recorded during the two stages, were characterized by different characteristics. The second stage PDCs had radiated greater seismic energy than the PDCs emplaced during the first stage. Spectral analysis of the seismic signals, produced by PDCs, indicates a clearly separation in frequency content at 1.95 Hz between the higher-frequency events of the first stage and the lower-frequency events of the second stage of the PDCs emplacements. The obtained difference in the spectral contents of the seismic signals, produced by the movement of two multiple PDCs, may be supposed as a consequence of the proposed relative difference in the volumes of the PDCs of two multiple sequences due to a difference in the level of radiated seismic energy and a change in bottom conditions of the ravines during their passing along the ravines. Results of seismic study were used in discussion of the nature of the two-stage eruptive process.

Cloning, sequencing and expression of white rhinoceros (Ceratotherium simum) interferon-gamma (IFN-gamma) and the production of rhinoceros IFN-gamma specific antibodies.

PubMed

Morar, D; Tijhaar, E; Negrea, A; Hendriks, J; van Haarlem, D; Godfroid, J; Michel, A L; Rutten, V P M G

2007-01-15

Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-gamma) assay is used as a routine diagnostic tool to determine infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop reagents to set up a rhinoceros IFN-gamma (RhIFN-gamma) assay. The white rhinoceros IFN-gamma gene was cloned, sequenced and expressed as a mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-gamma shares a homology of 90% with equine IFN-gamma. Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant RhIFN-gamma were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that recombinant as well as native white rhinoceros IFN-gamma was recognised. This preliminary IFN-gamma enzyme-linked immunosorbent assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.

The evolution of energy-transducing systems: Studies with archaebacteria

NASA Technical Reports Server (NTRS)

Stan-Lotter, Helga

1993-01-01

N-ethylmaleimide (NEM) inhibits the ATPase of H. saccharovorum in a nucleotide protectable manner. The bulk of 14C-NEM is incorporated into subunit 1. Inhibition kinetics indicated a single binding site. To determine the sequence around this site, cyanogen bromide peptides of NEM-labeled ATPase enzyme were prepared and separated on Tris-Tricine gels. Autoradiography indicated that the NEM binding site is probably located in a fragment of Mr 10-12 K. This result will be confirmed by N-terminal sequencing of the peptide. Since the cysteinyl residue, to which NEM is bound, may be located at the C-terminal end, purification and proteolytic treatment of the 10 K peptide will be required. One inhibitor of V-type ATPases, fluoresceinisothiocyanate (FITC) inhibited also the ATPase of H. saccharovorum. Preliminary results indicated protection against inhibition by nucleotides. Localization of the binding sited to the major subunits is in progress. An extraction procedure for the membrane sector of the ATPase complex of H. saccharovorum yielded a preparation which was enriched in a peptide of Mr 5 500. Experiments to test the immunological crossreaction with subunit c from the Escherichia coli F-type ATPase and the labeling with 14C-DCCD are currently carried out. Polyclonal antiserum to the smaller of the major subunits of the ATPase from H. saccharovorum (subunit ll) reacts in Western blots strongly with the alpha and beta subunits of the F1 ATPase of E. coli, suggesting highly conserved regions on both types of ATPases. To elucidate further the regions of homology, cyanogen bromide peptides of the beta subunits were prepared for sequence analysis.

Weight distributions for turbo codes using random and nonrandom permutations

NASA Technical Reports Server (NTRS)

Dolinar, S.; Divsalar, D.

1995-01-01

This article takes a preliminary look at the weight distributions achievable for turbo codes using random, nonrandom, and semirandom permutations. Due to the recursiveness of the encoders, it is important to distinguish between self-terminating and non-self-terminating input sequences. The non-self-terminating sequences have little effect on decoder performance, because they accumulate high encoded weight until they are artificially terminated at the end of the block. From probabilistic arguments based on selecting the permutations randomly, it is concluded that the self-terminating weight-2 data sequences are the most important consideration in the design of constituent codes; higher-weight self-terminating sequences have successively decreasing importance. Also, increasing the number of codes and, correspondingly, the number of permutations makes it more and more likely that the bad input sequences will be broken up by one or more of the permuters. It is possible to design nonrandom permutations that ensure that the minimum distance due to weight-2 input sequences grows roughly as the square root of (2N), where N is the block length. However, these nonrandom permutations amplify the bad effects of higher-weight inputs, and as a result they are inferior in performance to randomly selected permutations. But there are 'semirandom' permutations that perform nearly as well as the designed nonrandom permutations with respect to weight-2 input sequences and are not as susceptible to being foiled by higher-weight inputs.

The contribution of the DNA microarray technology to gene expression profiling in Leishmania spp.: a retrospective.

PubMed

Alonso, Ana; Larraga, Vicente; Alcolea, Pedro J

2018-05-07

The first genome project of any living organism excluding viruses, the gammaproteobacteria Haemophilus influenzae, was completed in 1995. Until the last decade, genome sequencing was very tedious because genome survey sequences (GSS) and/or expressed sequence tags (ESTs) belonging to plasmid, cosmid and artificial chromosome genome libraries had to be sequenced and assembled in silico. Nowadays, no genome is completely assembled actually, because gaps and unassembled contigs are always remaining. However, most represent the whole genome of the organism of origin from a practical point of view. The first genome sequencing projects of trypanosomatid parasites were completed in 2005 following those strategies, and belong to Leishmania major, Trypanosoma cruzi and T. brucei. The functional genomics era rapidly developed on the basis of the microarray technology and has been evolving. In the case of the genus Leishmania, substantial biological information about differentiation in the digenetic life cycle of the parasite has been obtained. Later on, next generation sequencing has revolutionized genome sequencing and functional genomics, leading to more sensitive, accurate results by using much less resources. This new technology is more advantageous, but does not invalidate microarray results. In fact, promising vaccine candidates and drug targets have been found on the basis of microarray-based screening and preliminary proof-of-concept tests. Copyright © 2018. Published by Elsevier B.V.

Rapid and reliable species identification of wild mushrooms by matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS).

PubMed

Sugawara, Ryota; Yamada, Sayumi; Tu, Zhihao; Sugawara, Akiko; Suzuki, Kousuke; Hoshiba, Toshihiro; Eisaka, Sadao; Yamaguchi, Akihiro

2016-08-31

Mushrooms are a favourite natural food in many countries. However, some wild species cause food poisoning, sometimes lethal, due to misidentification caused by confusing fruiting bodies similar to those of edible species. The morphological inspection of mycelia, spores and fruiting bodies have been traditionally used for the identification of mushrooms. More recently, DNA sequencing analysis has been successfully applied to mushrooms and to many other species. This study focuses on a simpler and more rapid methodology for the identification of wild mushrooms via protein profiling based on matrix-assisted laser desorption/ionization mass spectrometry (MALDI-TOF MS). A preliminary study using 6 commercially available cultivated mushrooms suggested that a more reproducible spectrum was obtained from a portion of the cap than from the stem of a fruiting body by the extraction of proteins with a formic acid-acetonitrile mixture (1 + 1). We used 157 wild mushroom-fruiting bodies collected in the centre of Hokkaido from June to November 2014. Sequencing analysis of a portion of the ribosomal RNA gene provided 134 identifications of mushrooms by genus or species, however 23 samples containing 10 unknown species that had lower concordance rate of the nucleotide sequences in a BLAST search (less than 97%) and 13 samples that had unidentifiable poor or mixed sequencing signals remained unknown. MALDI-TOF MS analysis yielded a reproducible spectrum (frequency of matching score ≥ 2.0 was ≥6 spectra from 12 spectra measurements) for 114 of 157 samples. Profiling scores that matched each other within the database gave correct species identification (with scores of ≥2.0) for 110 samples (96%). An in-house prepared database was constructed from 106 independent species, except for overlapping identifications. We used 48 wild mushrooms that were collected in autumn 2015 to validate the in-house database. As a result, 21 mushrooms were identified at the species level with scores ≥2.0 and 5 mushrooms at the genus level with scores ≥1.7, although the signals of 2 mushrooms were insufficient for analysis. The remaining 20 samples were recognized as "unreliable identification" with scores <1.7. Subsequent DNA analysis confirmed that the correct species or genus identifications were achieved by MALDI-TOF MS for the 26 former samples, whereas the 18 mushrooms with poorly matched scores were species that were not included in the database. Thus, the proposed MALDI-TOF MS coupled with our database could be a powerful tool for the rapid and reliable identification of mushrooms; however, continuous updating of the database is necessary to enrich it with more abundant species. Copyright © 2016 Elsevier B.V. All rights reserved.

LDEF Experiment P0006 Linear Energy Transfer Spectrum Measurement (LETSME) quick look report

NASA Technical Reports Server (NTRS)

1990-01-01

A preliminary analysis of the various passive radiation detector materials included in the P0006 LETSME experiment flown on LDEF (Long Duration Exposure Facility) is presented. It consists of four tasks: (1) readout and analysis of thermoluminescent detectors (TLD); (2) readout and analysis of fission foil/mica detectors; (3) readout and analysis of (6)LiF/CR-39 detectors; and (4) preliminary processing and readout of CR-39 and polycarbonate plastic nuclear track detectors (PNTD).

Design of impact-resistant boron/aluminum large fan blade

NASA Technical Reports Server (NTRS)

Salemme, C. T.; Yokel, S. A.

1978-01-01

The technical program was comprised of two technical tasks. Task 1 encompassed the preliminary boron/aluminum fan blade design effort. Two preliminary designs were evolved. An initial design consisted of 32 blades per stage and was based on material properties extracted from manufactured blades. A final design of 36 blades per stage was based on rule-of-mixture material properties. In Task 2, the selected preliminary blade design was refined via more sophisticated analytical tools. Detailed finite element stress analysis and aero performance analysis were carried out to determine blade material frequencies and directional stresses.

Application of Modified Spin-Echo–based Sequences for Hepatic MR Elastography: Evaluation, Comparison with the Conventional Gradient-Echo Sequence, and Preliminary Clinical Experience

PubMed Central

Mariappan, Yogesh K.; Dzyubak, Bogdan; Glaser, Kevin J.; Venkatesh, Sudhakar K.; Sirlin, Claude B.; Hooker, Jonathan; McGee, Kiaran P.

2017-01-01

Purpose To (a) evaluate modified spin-echo (SE) magnetic resonance (MR) elastographic sequences for acquiring MR images with improved signal-to-noise ratio (SNR) in patients in whom the standard gradient-echo (GRE) MR elastographic sequence yields low hepatic signal intensity and (b) compare the stiffness values obtained with these sequences with those obtained with the conventional GRE sequence. Materials and Methods This HIPAA-compliant retrospective study was approved by the institutional review board; the requirement to obtain informed consent was waived. Data obtained with modified SE and SE echo-planar imaging (EPI) MR elastographic pulse sequences with short echo times were compared with those obtained with the conventional GRE MR elastographic sequence in two patient cohorts, one that exhibited adequate liver signal intensity and one that exhibited low liver signal intensity. Shear stiffness values obtained with the three sequences in 130 patients with successful GRE-based examinations were retrospectively tested for statistical equivalence by using a 5% margin. In 47 patients in whom GRE examinations were considered to have failed because of low SNR, the SNR and confidence level with the SE-based sequences were compared with those with the GRE sequence. Results The results of this study helped confirm the equivalence of SE MR elastography and SE-EPI MR elastography to GRE MR elastography (P = .0212 and P = .0001, respectively). The SE and SE-EPI MR elastographic sequences provided substantially improved SNR and stiffness inversion confidence level in 47 patients in whom GRE MR elastography had failed. Conclusion Modified SE-based MR elastographic sequences provide higher SNR MR elastographic data and reliable stiffness measurements; thus, they enable quantification of stiffness in patients in whom the conventional GRE MR elastographic sequence failed owing to low signal intensity. The equivalence of the three sequences indicates that the current diagnostic thresholds are applicable to SE MR elastographic sequences for assessing liver fibrosis. © RSNA, 2016 PMID:27509543

78 FR 36166 - Diamond Sawblades and Parts Thereof From the People's Republic of China: Final Results of...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-17

... --Financial Ratios --Labor Costs --Oxygen --Steel Types --Truck Freight --The Philippine Data 7. U.S... country of origin designations. On March 19, 2013, we issued a post-preliminary analysis memorandum... Republic of China for the 2010-2011 Period: Post- Preliminary Analysis'' dated March 19, 2013. See also the...

Targeted On-Demand Team Performance App Development

DTIC Science & Technology

2016-10-01

from three sites; 6) Preliminary analysis indicates larger than estimate effect size and study is sufficiently powered for generalizable outcomes...statistical analyses, and examine any resulting qualitative data for trends or connections to statistical outcomes. On Schedule 21 Predictive...Preliminary analysis indicates larger than estimate effect size and study is sufficiently powered for generalizable outcomes.  What opportunities for

Chemical Analysis of the Moon at the Surveyor VII Landing Site: Preliminary Results.

PubMed

Turkevich, A L; Franzgrote, E J; Patterson, J H

1968-10-04

The alpha-scattering experiment aboard Surveyor VII has provided a chemical analysis of the moon in the area of the crater Tycho. The preliminary results indicate a chemical composition similar to that already found at two mare sites, but with a lower concentration of elements of the iron group (titanium through copper).

A Preliminary Analysis of the Outcomes of Students Assisted by VET FEE-HELP: Summary

ERIC Educational Resources Information Center

National Centre for Vocational Education Research (NCVER), 2015

2015-01-01

This summary highlights the key findings from the report "A preliminary analysis of the outcomes of students assisted by VET FEE-HELP". VET FEE-HELP is an income-contingent loan scheme that assists eligible students undertaking certain vocational education training (VET) courses with an approved provider by paying for all or part of…

Correlation of ultrasound imaging of oral swallow with ventilatory alterations in cerebral palsied and normal children: preliminary observations.

PubMed

Kenny, D J; Casas, M J; McPherson, K A

1989-01-01

Preliminary results of an investigation that synchronizes the videotaped output of ultrasound camera and the analog data from physiological measurements of swallowing and ventilation in normal and cerebral palsied (CP) children are presented. Four cerebral palsied children and three control children undertook a single sip-swallow of 5 ml of liquid and a solid mastication-swallow sequence on three occasions according to a defined protocol. The CP children exhibited much more variability and less control of the liquid bolus than did the controls. The ultrasound image clearly demonstrates the lack of control of the posterior of the tongue in many CP children. Some parts of the sequence of oral swallow and the time to achieve maximum anterior displacement of the hyoid bone appear to be slowed. The sequential events of swallowing show less variability as the sip-swallow proceeds from the oral voluntary to pharyngeal and lower involuntary phases. This study also identified a short-latency apnea that appears to accompany a saliva (protective) swallow and a long-latency apnea that accompanies semi-solid or liquid bolus (alimentary) swallows. Further investigations of normal and CP children utilizing a combined diagnostic imaging-physiological measurement approach will follow this initial study.

Molecular biological identification of Babesia, Theileria, and Anaplasma species in cattle in Egypt using PCR assays, gene sequence analysis and a novel DNA microarray.

PubMed

El-Ashker, Maged; Hotzel, Helmut; Gwida, Mayada; El-Beskawy, Mohamed; Silaghi, Cornelia; Tomaso, Herbert

2015-01-30

In this preliminary study, a novel DNA microarray system was tested for the diagnosis of bovine piroplasmosis and anaplasmosis in comparison with microscopy and PCR assay results. In the Dakahlia Governorate, Egypt, 164 cattle were investigated for the presence of piroplasms and Anaplasma species. All investigated cattle were clinically examined. Blood samples were screened for the presence of blood parasites using microscopy and PCR assays. Seventy-one animals were acutely ill, whereas 93 were apparently healthy. In acutely ill cattle, Babesia/Theileria species (n=11) and Anaplasma marginale (n=10) were detected. Mixed infections with Babesia/Theileria spp. and A. marginale were present in two further cases. A. marginale infections were also detected in apparently healthy subjects (n=23). The results of PCR assays were confirmed by DNA sequencing. All samples that were positive by PCR for Babesia/Theileria spp. gave also positive results in the microarray analysis. The microarray chips identified Babesia bovis (n=12) and Babesia bigemina (n=2). Cattle with babesiosis were likely to have hemoglobinuria and nervous signs when compared to those with anaplasmosis that frequently had bloody feces. We conclude that clinical examination in combination with microscopy are still very useful in diagnosing acute cases of babesiosis and anaplasmosis, but a combination of molecular biological diagnostic assays will detect even asymptomatic carriers. In perspective, parallel detection of Babesia/Theileria spp. and A. marginale infections using a single microarray system will be a valuable improvement. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Serotype and genetic diversity of human rhinovirus strains that circulated in Kenya in 2008.

PubMed

Milanoi, Sylvia; Ongus, Juliette R; Gachara, George; Coldren, Rodney; Bulimo, Wallace

2016-05-01

Human rhinoviruses (HRVs) are a well-established cause of the common cold and recent studies indicated that they may be associated with severe acute respiratory illnesses (SARIs) like pneumonia, asthma, and bronchiolitis. Despite global studies on the genetic diversity of the virus, the serotype diversity of these viruses across diverse geographic regions in Kenya has not been characterized. This study sought to characterize the serotype diversity of HRV strains that circulated in Kenya in 2008. A total of 517 archived nasopharyngeal samples collected in a previous respiratory virus surveillance program across Kenya in 2008 were selected. Participants enrolled were outpatients who presented with influenza-like (ILI) symptoms. Real-time RT-PCR was employed for preliminary HRV detection. HRV-positive samples were amplified using RT-PCR and thereafter the nucleotide sequences of the amplicons were determined followed by phylogenetic analysis. Twenty-five percent of the samples tested positive for HRV. Phylogenetic analysis revealed that the Kenyan HRVs clustered into three main species comprising HRV-A (54%), HRV-B (12%), and HRV-C (35%). Overall, 20 different serotypes were identified. Intrastrain sequence homology among the Kenyan strains ranged from 58% to 100% at the nucleotide level and 55% to 100% at the amino acid level. These results show that a wide range of HRV serotypes with different levels of nucleotide variation were present in Kenya. Furthermore, our data show that HRVs contributed substantially to influenza-like illness in Kenya in 2008. © 2016 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

The Stratigraphy and Lithofacies of the Paleoproterozoic Volcaniclastic Sequences in the Cape Three Points Area- Akodda section of the Southern in Ashanti Belt in the Birimian of southwest Ghana

NASA Astrophysics Data System (ADS)

Yoshimaru, S.; Kiyokawa, S.; Ito, T.; Ikehara, M.; Nyame, F. K.; Tetteh, G. M.

2015-12-01

The Paleoproterozoic Era is thought to have experienced one of the most significant changes in earth's environment during earth history. Early continents started to diverge and collide accompanied by first major oxidation of the atmosphere-oceanic system known as the Great Oxidation Environment (GOE). Due to their well-preserved oceanic sedimentary sequences, Paleoproterozoic belts are usually good targets for studies on the history of earth's past environment. In addition, these belts provide great help to understand the nature of the Paleoproterozoic deeper oceanic environments. Birimian greenstone belt in southwestern Ghana is likely to have made up of subduction of oceanic basin to form a volcanic island arc. Birimian rocks are separated by nonconformity from the Tarkwaian Group which is a younger paleoplacer deposit (Perrouty et al., 2012). The Birimian is made up of island-arc volcanic rocks; foreland basin made up of shale, sandstone, quartzite and turbidities derived from 2.17 Ga granite intrusions during Birimian volcanism. In this study, we focused on the coastal area around Cape Three Points at the southernmost part of the Ashanti (Axim-Konongo) belt in Ghana. In the eastern part of the area, excellently preserved Paleoprotorozoic deeper oceanic sedimentary sequences extensively outcrop for over 4km stretch. This volcano-sedimentary sequence has been affected by greenschist facies metamorphism. Structurally, this region preserves S1 cleavage and asymmetrical synform with west vergence and S0 younging to the east. Provisional stratigraphy is very continuous up to more than 2000m thick and, in addition, suggests at least four different fining upward sequences in the area to the east and west of Atwepo, west of Kwetakora and Akodda. These sub-sequences are mainly composed of volcaniclasitc, sandstone, black shale and rare volcanics such as pillow basalt or massive volcanic lava. In other words, this continuous sequence suggests distal submarine volcaniclastic rocks in an oceanic island arc around the West African Craton. Preliminary δ13C analysis gave values of -23.7~ -36.5 ‰ for black shale occupying the middle to upper part of the whole section. The very light carbon isotope ratios suggest deposition of the black shale under highly euxinic conditions like today's Black sea.

The last frontier? High-resolution, near-bottom measurements of the Hawaiian Jurassic magnetic anomaly sequence

NASA Astrophysics Data System (ADS)

Tivey, M.; Tominaga, M.; Sager, W. W.

2012-12-01

The Jurassic sequence of marine magnetic anomalies i.e. older than M29 remain the last part of the marine magnetic anomaly sequence of the geomagnetic polarity timescale (GPTS) that can be gleaned from the ocean crustal record. While Jurassic crust is present in several areas of the world's ocean basins, the oldest and arguably best preserved sequence is in the western Pacific where three lineations sets (Japanese, Hawaiian and Phoenix) converge on the oldest remaining ocean crust on the planet (i.e. crust that has not been subducted). The magnetic anomalies in these 3 lineation sets are marked by low amplitude, relatively indistinct anomalies (tiny wiggles) that collectively have been called the Jurassic quiet Zone (JQZ). Over the past 20 years we have been working on resolving the character and origin of these anomalies with various technologies to improve our resolution of this period. Following an aeromagnetic survey that revealed the possible presence of lineated anomalies older than M29 in the Japanese lineations, we conducted a deeptow magnetometer survey of the Japanese sequence in 1992. In 2002/03 we extended and confirmed this deeptow record with a deeptowed sidescan and magnetometer survey of the Japanese lineation sequence by tying in ODP Hole 801C and extending the anomaly sequence between M29 and M44. These surveys reveal remarkably fast reversals that are lineated and decrease in intensity back in time until M38, prior to which the sequence becomes somewhat confused (the LAZ or low amplitude zone) before recovering in both amplitude and lineated character around Hole 801C (M42). These results are partially supported by recently reported terrestrial magnetostratigraphy records that show the existence of reversals back to M38. A Jurassic GPTS was constructed from this Japanese anomaly sequence, but the overall global significance of the reversal sequence and systematic field intensity changes require confirmation from crustal records created at different spreading centers. In 2011, we undertook the next generation of near-bottom magnetic studies utilizing new autonomous underwater vehicle (AUV) technology (Sentry) and concurrent deeptow and seismic profiling surveys of the Hawaiian anomaly sequence. Preliminary results show a similar anomaly record to the Japanese sequence: an overall decrease in anomaly amplitude from M19 to M38 and a period of low amplitude, which in turn is preceded by a return to stronger amplitude anomalies. The magnetic anomaly correlations between Hawaiian and Japanese sea-surface level profiles confirm the reversal record back in time, at least, to M38. At the mid-water and near-bottom AUV levels, the magnetic data clearly show the short-wavelength anomaly character of the M29-M38 sequence, indicating that the fast reversals observed in the Japanese lineations are also present in the Hawaiian lineation set. The strong similarity of overall anomaly patterns between Japanese and Hawaiian sequences supports the preliminary conclusion that geomagnetic field behavior during the Jurassic was dynamic, with fast reversals and changing intensity, and certainly not "quiet". Finally, AUV surveys provide measurements of the marine magnetic anomaly record whose resolution is limited only by the crustal recording process and crustal magnetic architecture rather than spatial resolution.

Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

NASA Astrophysics Data System (ADS)

Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

2015-10-01

In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

Geochemistry of volcanic rocks from the Wawa greenstone belt

NASA Technical Reports Server (NTRS)

Schulz, K. J.; Sylvester, P. J.; Attoh, K.

1983-01-01

The Wawa greenstone belt is located in the District of Algoma and extends east-northeast from Lake Superior to the western part of the Sudbury District in Ontario, Canada. Recent mapping by Attoh has shown that an unconformity at the base of the Dore' Formation and equivalent sedimentary rocks marks a significant stratigraphic break which can be traced throughout the volcanic belt. This break has been used to subdivide the volcanic-sedimentary into pre- and post-Dore' sequences. The pre-Dore' sequence includes at least two cycles of mafic-to-felsic volcanism, each capped by an iron-formation unit. The post-Dore' sequence includes an older mafic-to-felsic unit, which directly overlies sedimentary rocks correlated with the Dore' Formation, and a younger felsic breccia unit interpreted to have formed as debris flows from a felsic volcanic center. In the present study, samples of both the pre-and post-Dore' volcanic sequences were analyzed for major and trace elements, incuding rare earths (REE). This preliminary study is part of an ongoing program to assess the petrogenesis of the volcanic rocks of the Wawa greenstone belt.

Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

PubMed

Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

2011-12-10

Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

A methodology to event reconstruction from trace images.

PubMed

Milliet, Quentin; Delémont, Olivier; Sapin, Eric; Margot, Pierre

2015-03-01

The widespread use of digital imaging devices for surveillance (CCTV) and entertainment (e.g., mobile phones, compact cameras) has increased the number of images recorded and opportunities to consider the images as traces or documentation of criminal activity. The forensic science literature focuses almost exclusively on technical issues and evidence assessment [1]. Earlier steps in the investigation phase have been neglected and must be considered. This article is the first comprehensive description of a methodology to event reconstruction using images. This formal methodology was conceptualised from practical experiences and applied to different contexts and case studies to test and refine it. Based on this practical analysis, we propose a systematic approach that includes a preliminary analysis followed by four main steps. These steps form a sequence for which the results from each step rely on the previous step. However, the methodology is not linear, but it is a cyclic, iterative progression for obtaining knowledge about an event. The preliminary analysis is a pre-evaluation phase, wherein potential relevance of images is assessed. In the first step, images are detected and collected as pertinent trace material; the second step involves organising and assessing their quality and informative potential. The third step includes reconstruction using clues about space, time and actions. Finally, in the fourth step, the images are evaluated and selected as evidence. These steps are described and illustrated using practical examples. The paper outlines how images elicit information about persons, objects, space, time and actions throughout the investigation process to reconstruct an event step by step. We emphasise the hypothetico-deductive reasoning framework, which demonstrates the contribution of images to generating, refining or eliminating propositions or hypotheses. This methodology provides a sound basis for extending image use as evidence and, more generally, as clues in investigation and crime reconstruction processes. Copyright © 2015 Forensic Science Society. Published by Elsevier Ireland Ltd. All rights reserved.