A severe combined immunodeficient-hu in vivo mouse model of human primary mantle cell lymphoma.
Wang, Michael; Zhang, Liang; Han, Xiaohong; Yang, Jing; Qian, Jianfei; Hong, Sungyoul; Lin, Pei; Shi, Yuankai; Romaguera, Jorge; Kwak, Larry W; Yi, Qing
2008-04-01
To establish a severe combined immunodeficient (SCID)-hu in vivo mouse model of human primary mantle cell lymphoma (MCL) for the study of the biology and novel therapy of human MCL. Primary MCL cells were isolated from spleen, lymph node, bone marrow aspirates, or peripheral blood of six different patients and injected respectively into human bone chips, which had been s.c. implanted in SCID-hu. Circulating human beta(2)-microglobulin in mouse serum was used to monitor the engraftment and growth of patient's MCL cells. H&E staining and immunohistochemical staining with anti-human CD20 and cyclin D1 antibodies were used to confirm the tumor growth and migration. Increasing levels of circulating human beta(2)-microglobulin in mouse serum indicated that the patient's MCL cells were engrafted successfully into human bone chip of SCID-hu mice. The engraftment and growth of patient's MCL cells were dependent on human bone marrow microenvironment. Immunohistochemical staining with anti-human CD20 and cyclin D1 antibodies confirmed that patient's MCL cells were able to not only survive and propagate in the bone marrow microenvironment of the human fetal bone chips, but also similar to the human disease, migrate to lymph nodes, spleen, bone marrow, and gastrointestinal tract of host mice. Treatment of MCL-bearing SCID-hu mice with atiprimod, a novel antitumor compound against the protection of bone marrow stromal cells, induced tumor regression. This is the first human primary MCL animal model that should be useful for the biological and therapeutic research on MCL.
Zhang, Jinchao; Liu, Cuilian; Sun, Jing; Liu, Dandan; Wang, Peng
2010-01-01
The effects of water extract of Cajanus cajan (Linn.) Millsp. (Leguminosae) leaves (WECML) on the osteogenic and adipogenic differentiation of mouse primary bone marrow stromal cells (BMSCs) and the adipocytic trans-differentiation of mouse primary osteoblasts (OBs) were studied. The results indicated that WECML promoted the proliferation of BMSCs and OBs at most concentrations. WECML promoted the osteogenic differentiation and formation of mineralized matrix nodules of BMSCs at concentrations of 0.1, 1, and 10 microg/mL, but inhibited the osteogenic differentiation and formation of mineralized matrix nodules of BMSCs at concentration of 0.01 microg/mL. WECML inhibited the adipogenic differentiation of BMSCs and adipocytic trans-differentiation of OBs at concentrations of 0.001, 0.1, 1, 10, and 100 microg/mL, but had no effects at concentration of 0.01 microg/mL. The results suggest that WECML has protective effects on bone and these protective effects may be mediated by decreasing adipocytic cell formation from BMSCs, which may promote the proliferation, differentiation, and mineralization function of OBs. The defined active ingredients in the WECML and the active mechanism need to be further studied.
Liu, Chao; Wang, Xiaofang; Zhang, Hua; Xie, Xiaohua; Liu, Peihong; Liu, Ying; Jani, Priyam H.; Lu, Yongbo; Chen, Shuo; Qin, Chunlin
2016-01-01
Fam20c is essential for the normal mineralization of dentin and bone. The generation of odontoblast and osteoblast cell lines carrying floxed Fam20c allele can offer valuable tools for the study of the roles of Fam20c in the mineralization of dentin and bone. The limited capability of the primary odontoblasts and osteoblasts to proliferate necessitates the development of odontoblast and osteoblast cell lines serving as substitutes for the study of differentiation and mineralization of the odontoblasts and osteoblasts. In this study, we established and characterized immortalized mouse floxed Fam20c dental papilla mesenchymal and osteoblast cell lines. The isolated primary mouse floxed Fam20c dental papilla mesenchymal cells and osteoblasts were immortalized by the infection of lentivirus containing Simian Virus 40 T-antigen (SV40 T-Ag). The immortalization of floxed Fam20c dental papilla mesenchymal cells and osteoblasts was verified by the long-term passages and genomic integration of SV40 T-Ag. The immortalized floxed Fam20c dental papilla mesenchymal and osteoblast cell lines not only proliferated at a high rate and retained the morphology of their primary counterparts, but also preserved the dentin and bone specific gene expression as the primary dental papilla mesenchymal cells and osteoblasts did. Consistently, the capability of the primary floxed Fam20c dental papilla mesenchymal cells and osteoblasts to mineralize was also inherited by the immortalized dental papilla mesenchymal and osteoblast cell lines. Thus, we have successfully generated the immortalized mouse floxed Fam20c dental papilla mesenchymal and osteoblast cell lines. PMID:25833681
Liu, Chao; Wang, Xiaofang; Zhang, Hua; Xie, Xiaohua; Liu, Peihong; Liu, Ying; Jani, Priyam H; Lu, Yongbo; Chen, Shuo; Qin, Chunlin
2015-11-01
Fam20c is essential for the normal mineralization of dentin and bone. The generation of odontoblast and osteoblast cell lines carrying floxed Fam20c allele can offer valuable tools for the study of the roles of Fam20c in the mineralization of dentin and bone. The limited capability of the primary odontoblasts and osteoblasts to proliferate necessitates the development of odontoblast and osteoblast cell lines serving as substitutes for the study of differentiation and mineralization of the odontoblasts and osteoblasts. In this study, we established and characterized immortalized mouse floxed Fam20c dental papilla mesenchymal and osteoblast cell lines. The isolated primary mouse floxed Fam20c dental papilla mesenchymal cells and osteoblasts were immortalized by the infection of lentivirus containing Simian Virus 40 T-antigen (SV40 T-Ag). The immortalization of floxed Fam20c dental papilla mesenchymal cells and osteoblasts was verified by the long-term passages and genomic integration of SV40 T-Ag. The immortalized floxed Fam20c dental papilla mesenchymal and osteoblast cell lines not only proliferated at a high rate and retained the morphology of their primary counterparts, but also preserved the dentin and bone specific gene expression as the primary dental papilla mesenchymal cells and osteoblasts did. Consistently, the capability of the primary floxed Fam20c dental papilla mesenchymal cells and osteoblasts to mineralize was also inherited by the immortalized dental papilla mesenchymal and osteoblast cell lines. Thus, we have successfully generated the immortalized mouse floxed Fam20c dental papilla mesenchymal and osteoblast cell lines. © 2015 Wiley Periodicals, Inc.
Wu, Li-an; Feng, Junsheng; Wang, Lynn; Mu, Yan-dong; Baker, Andrew; Donly, Kevin J.; Harris, Stephen E.; MacDougall, Mary; Chen, Shuo
2011-01-01
Bone morphogenetic protein 2 (Bmp2) is essential for osteoblast differentiation and osteogenesis. Generation of floxed Bmp2 osteoblast cell lines is a valuable tool for studying the effects of Bmp2 on osteoblast differentiation and its signaling pathways during skeletal metabolism. Due to relatively limited sources of primary osteoblasts, we have developed cell lines that serve as good surrogate models for the study of osteoblast cell differentiation and bone mineralization. In this study, we established and characterized immortalized mouse floxed Bmp2 osteoblast cell lines. Primary mouse floxed Bmp2 osteoblasts were transfected with pSV3-neo and clonally selected. These transfected cells were verified by PCR and immunohistochemistry. To determine the genotype and phenotype of the immortalized cells, cell morphology, proliferation, differentiation and mineralization were analyzed. Also, expression of osteoblast-related gene markers including Runx2, Osx, ATF4, Dlx3, bone sialoprotein, dentin matrix protein 1, osteonectin, osteocalcin and osteopontin were examined by quantitative RT-PCR and immunohistochemistry. These results showed that immortalized floxed Bmp2 osteoblasts had a higher proliferation rate but preserved their genotypic and phenotypic characteristics similar to the primary cells. Thus, we, for the first time, describe the development of immortalized mouse floxed Bmp2 osteoblast cell lines and present a useful model to study osteoblast biology mediated by BMP2 and its downstream signaling transduction pathways. PMID:21271257
Cilia/Ift protein and motor -related bone diseases and mouse models.
Yuan, Xue; Yang, Shuying
2015-01-01
Primary cilia are essential cellular organelles projecting from the cell surface to sense and transduce developmental signaling. They are tiny but have complicated structures containing microtubule (MT)-based internal structures (the axoneme) and mother centriole formed basal body. Intraflagellar transport (Ift) operated by Ift proteins and motors are indispensable for cilia formation and function. Mutations in Ift proteins or Ift motors cause various human diseases, some of which have severe bone defects. Over the last few decades, major advances have occurred in understanding the roles of these proteins and cilia in bone development and remodeling by examining cilia/Ift protein-related human diseases and establishing mouse transgenic models. In this review, we describe current advances in the understanding of the cilia/Ift structure and function. We further summarize cilia/Ift-related human diseases and current mouse models with an emphasis on bone-related phenotypes, cilia morphology, and signaling pathways.
Effects of the activin A-myostatin-follistatin system on aging bone and muscle progenitor cells
Bowser, Matthew; Herberg, Samuel; Arounleut, Phonepasong; Shi, Xingming; Fulzele, Sadanand; Hill, William D.; Isales, Carlos M.; Hamrick, Mark W.
2013-01-01
The activin A-myostatin-follistatin system is thought to play an important role in the regulation of muscle and bone mass throughout growth, development, and aging; however, the effects of these ligands on progenitor cell proliferation and differentiation in muscle and bone are not well understood. In addition, age-associated changes in the relative expression of these factors in musculoskeletal tissues have not been described. We therefore examined changes in protein levels of activin A, follistatin, and myostatin (GDF-8) in both muscle and bone with age in C57BL6 mice using ELISA. We then investigated the effects of activin A, myostatin and follistatin on the proliferation and differentiation of primary myoblasts and mouse bone marrow stromal cells (BMSCs) in vitro. Myostatin levels and the myostatin:follistatin ratio increased with age in the primarily slow-twitch mouse soleus muscle, whereas the pattern was reversed with age in the fast-twitch extensor digitorum longus muscle. Myostatin levels and the myostatin: follistatin ratio increased significantly (+75%) in mouse bone marrow with age, as did activin A levels (+17%). Follistatin increased the proliferation of primary myoblasts from both young and aged mice, whereas myostatin increased proliferation of younger myoblasts but decreased proliferation of older myoblasts. Myostatin reduced proliferation of both young and aged BMSCs in a dose-dependent fashion, and activin A increased mineralization in both young and aged BMSCs. Together these data suggest that aging in mice is accompanied by changes in the expression of activin A and myostatin, as well as changes in the response of bone and muscle progenitor cells to these factors. Myostatin appears to play a particularly important role in the impaired proliferative capacity of muscle and bone progenitor cells from aged mice. PMID:23178301
ORRISS, ISABEL R.; HAJJAWI, MARK O.R.; HUESA, CARMEN; MACRAE, VICKY E.; ARNETT, TIMOTHY R.
2014-01-01
The in vitro culture of calvarial osteoblasts from neonatal rodents remains an important method for studying the regulation of bone formation. The widespread use of transgenic mice has created a particular need for a reliable, simple method that allows the differentiation and bone-forming activity of murine osteoblasts to be studied. In the present study, we established such a method and identified key differences in optimal culture conditions between mouse and rat osteoblasts. Cells isolated from neonatal rodent calvariae by collagenase digestion were cultured for 14–28 days before staining for tissue non-specific alkaline phosphatase (TNAP) and bone mineralisation (alizarin red). The reliable differentiation of mouse osteoblasts, resulting in abundant TNAP expression and the formation of mineralised ‘trabecular-shaped’ bone nodules, occurred only following culture in α minimum essential medium (αMEM) and took 21–28 days. Dexamethasone (10 nM) inhibited bone mineralisation in the mouse osteoblasts. By contrast, TNAP expression and bone formation by rat osteoblasts were observed following culture in both αMEM and Dulbecco’s modified Eagle’s medium (DMEM) after approximately 14 days (although ~3-fold more effectively in αMEM) and was strongly dependent on dexamethasone. Both the mouse and rat osteoblasts required ascorbate (50 μg/ml) for osteogenic differentiation and β-glycerophosphate (2 mM) for mineralisation. The rat and mouse osteoblasts showed similar sensitivity to the well-established inhibitors of mineralisation, inorganic pyrophosphate (PPi) and adenosine triphosphate (ATP; 1–100 μM). The high efficiency of osteogenic differentiation observed following culture in αMEM, compared with culture in DMEM possibly reflects the richer formulation of the former. These findings offer a reliable technique for inducing mouse osteoblasts to form bone in vitro and a more effective method for culturing bone-forming rat osteoblasts. PMID:25200658
The Influence of Primary Microenvironment on Prostate Cancer Osteoblastic Bone Lesion Development
2015-09-01
for inhibiting PCa bone lesion development: 3a. Basic fibroblast growth factor (bFGF) in PC3 bone metastasis: bFGF was identified by cytokine...II receptor (TβRII) knockout (Tgfbr2 KO) mouse models. Col1creERT/Tgfbr2 KO (Col/Tgfbr2 KO), which have TGF-β signaling specific KO in fibroblasts ... fibroblasts and osteoblasts in the bone by Colcre/Tgfbr2 KO, or in the myeloid lineage cells, including osteoclasts in the bone by LysMcre/Tgfbr2 KO
New mouse models for metabolic bone diseases generated by genome-wide ENU mutagenesis.
Sabrautzki, Sibylle; Rubio-Aliaga, Isabel; Hans, Wolfgang; Fuchs, Helmut; Rathkolb, Birgit; Calzada-Wack, Julia; Cohrs, Christian M; Klaften, Matthias; Seedorf, Hartwig; Eck, Sebastian; Benet-Pagès, Ana; Favor, Jack; Esposito, Irene; Strom, Tim M; Wolf, Eckhard; Lorenz-Depiereux, Bettina; Hrabě de Angelis, Martin
2012-08-01
Metabolic bone disorders arise as primary diseases or may be secondary due to a multitude of organ malfunctions. Animal models are required to understand the molecular mechanisms responsible for the imbalances of bone metabolism in disturbed bone mineralization diseases. Here we present the isolation of mutant mouse models for metabolic bone diseases by phenotyping blood parameters that target bone turnover within the large-scale genome-wide Munich ENU Mutagenesis Project. A screening panel of three clinical parameters, also commonly used as biochemical markers in patients with metabolic bone diseases, was chosen. Total alkaline phosphatase activity and total calcium and inorganic phosphate levels in plasma samples of F1 offspring produced from ENU-mutagenized C3HeB/FeJ male mice were measured. Screening of 9,540 mice led to the identification of 257 phenodeviants of which 190 were tested by genetic confirmation crosses. Seventy-one new dominant mutant lines showing alterations of at least one of the biochemical parameters of interest were confirmed. Fifteen mutations among three genes (Phex, Casr, and Alpl) have been identified by positional-candidate gene approaches and one mutation of the Asgr1 gene, which was identified by next-generation sequencing. All new mutant mouse lines are offered as a resource for the scientific community.
Krieger, Nancy S; Bushinsky, David A
2017-10-01
Serum fibroblast growth factor 23 (FGF23) increases progressively in chronic kidney disease (CKD) and is associated with increased mortality. FGF23 is synthesized in osteoblasts and osteocytes; however, the factors regulating its production are not clear. Patients with CKD have decreased renal acid excretion leading to metabolic acidosis (MET). During MET, acid is buffered by bone with release of mineral calcium (Ca) and phosphate (P). MET increases intracellular Ca signaling and cyclooxygenase 2 (COX2)-induced prostaglandin production in the osteoblast, leading to decreased bone formation and increased bone resorption. We found that MET directly stimulates FGF23 in mouse bone organ cultures and primary osteoblasts. We hypothesized that MET increases FGF23 through similar pathways that lead to bone resorption. Neonatal mouse calvariae were incubated in neutral (NTL, pH = 7.44, Pco 2 = 38 mmHg, [HCO 3 - ] = 27 mM) or acid (MET, pH = 7.18, Pco 2 = 37 mmHg, [HCO 3 - ] = 13 mM) medium without or with 2-APB (50 μM), an inhibitor of intracellular Ca signaling or NS-398 (1 μM), an inhibitor of COX2. Each agent significantly inhibited MET stimulation of medium FGF23 protein and calvarial FGF23 RNA as well as bone resorption at 48 h. To exclude the potential contribution of MET-induced bone P release, we utilized primary calvarial osteoblasts. In these cells each agent inhibited MET stimulation of FGF23 RNA expression at 6 h. Thus stimulation of FGF23 by MET in mouse osteoblasts utilizes the same initial signaling pathways as MET-induced bone resorption. Therapeutic interventions directed toward correction of MET, especially in CKD, have the potential to not only prevent bone resorption but also lower FGF23 and perhaps decrease mortality. Copyright © 2017 the American Physiological Society.
Early-onset type 2 diabetes impairs skeletal acquisition in the male TALLYHO/JngJ mouse.
Devlin, M J; Van Vliet, M; Motyl, K; Karim, L; Brooks, D J; Louis, L; Conlon, C; Rosen, C J; Bouxsein, M L
2014-10-01
Type 2 diabetes (T2D) incidence in adolescents is rising and may interfere with peak bone mass acquisition. We tested the effects of early-onset T2D on bone mass, microarchitecture, and strength in the TALLYHO/JngJ mouse, which develops T2D by 8 weeks of age. We assessed metabolism and skeletal acquisition in male TALLYHO/JngJ and SWR/J controls (n = 8-10/group) from 4 weeks to 8 and 17 weeks of age. Tallyho mice were obese; had an approximately 2-fold higher leptin and percentage body fat; and had lower bone mineral density vs SWR at all time points (P < .03 for all). Tallyho had severe deficits in distal femur trabecular bone volume fraction (-54%), trabecular number (-27%), and connectivity density (-82%) (P < .01 for all). Bone formation was higher in Tallyho mice at 8 weeks but lower by 17 weeks of age vs SWR despite similar numbers of osteoblasts. Bone marrow adiposity was 7- to 50-fold higher in Tallyho vs SWR. In vitro, primary bone marrow stromal cell differentiation into osteoblast and adipocyte lineages was similar in SWR and Tallyho, suggesting skeletal deficits were not due to intrinsic defects in Tallyho bone-forming cells. These data suggest the Tallyho mouse might be a useful model to study the skeletal effects of adolescent T2D.
Gender-dependence of bone structure and properties in adult osteogenesis imperfecta murine model.
Yao, Xiaomei; Carleton, Stephanie M; Kettle, Arin D; Melander, Jennifer; Phillips, Charlotte L; Wang, Yong
2013-06-01
Osteogenesis imperfecta (OI) is a dominant skeletal disorder characterized by bone fragility and deformities. Though the oim mouse model has been the most widely studied of the OI models, it has only recently been suggested to exhibit gender-dependent differences in bone mineralization. To characterize the impact of gender on the morphometry/ultra-structure, mechanical properties, and biochemical composition of oim bone on the congenic C57BL/J6 background, 4-month-old oim/oim, +/oim, and wild-type (wt) female and male tibiae were evaluated using micro-computed tomography, three-point bending, and Raman spectroscopy. Dramatic gender differences were evident in both cortical and trabecular bone morphological and geometric parameters. Male mice had inherently more bone and increased moment of inertia than genotype-matched female counterparts with corresponding increases in bone biomechanical strength. The primary influence of gender was structure/geometry in bone growth and mechanical properties, whereas the mineral/matrix composition and hydroxyproline content of bone were influenced primarily by the oim collagen mutation. This study provides evidence of the importance of gender in the evaluation and interpretation of potential therapeutic strategies when using mouse models of OI.
Gender-dependence of bone structure and properties in adult osteogenesis imperfecta murine model
Yao, Xiaomei; Carleton, Stephanie M.; Kettle, Arin D; Melander, Jennifer; Phillips, Charlotte L.; Wang, Yong
2013-01-01
Osteogenesis imperfecta (OI) is a dominant skeletal disorder characterized by bone fragility and deformities. Though the oim mouse model has been the most widely studied of the OI models, it has only recently been suggested to exhibit gender-dependent differences in bone mineralization. To characterize the impact of gender on the morphometry/ultra-structure, mechanical properties, and biochemical composition of oim bone on the congenic C57BL/J6 background, 4-month-old oim/oim, +/oim, and wild-type (wt) female and male tibiae were evaluated using micro-computed tomography, three-point bending, and Raman spectroscopy. Dramatic gender differences were evident in both cortical and trabecular bone morphological and geometric parameters. Male mice had inherently more bone and increased moment of inertia than genotype-matched female counterparts with corresponding increases in bone biomechanical strength. The primary influence of gender was structure/geometry in bone growth and mechanical properties, whereas the mineral/matrix composition, hydroxyproline content of bone were influenced primarily by the oim collagen mutation. This study provides evidence of the importance of gender in the evaluation and interpretation of potential therapeutic strategies when using mouse models of OI. PMID:23536112
Monfoulet, Laurent; Malaval, Luc; Aubin, Jane E; Rittling, Susan R; Gadeau, Alain P; Fricain, Jean-Christophe; Chassande, Olivier
2010-02-01
Bone healing is a complex multi-step process, which depends on the position and size of the lesion, and on the mechanical stability of the wounded area. To address more specifically the mechanisms involved in cortical bone healing, we created drill-hole defects in the cortex of mouse femur, a lesion that triggers intramembranous repair, and compared the roles of bone sialoprotein (BSP) and osteopontin (OPN), two proteins of the extracellular matrix, in the repair process. Bone regeneration was analyzed by ex vivo microcomputerized X-ray tomography and histomorphometry of bones of BSP-deficient, OPN-deficient and wild-type mice. In all mouse strains, the cortical gap was bridged with woven bone within 2 weeks and no mineralized tissue was observed in the marrow. Within 3 weeks, lamellar cortical bone filled the gap. The amount and degree of mineralization of the woven bone was not affected by OPN deficiency, but cortical bone healing was delayed in BSP-deficient mice due to delayed mineralization. Gene expression studies showed a higher amount of BSP transcripts in the repair bone of OPN-deficient mice, suggesting a possible compensation of OPN function by BSP in OPN-null mice. Our data suggest that BSP, but not OPN, plays a role in primary bone formation and mineralization of newly formed bone during the process of cortical bone healing. (c) 2009 Elsevier Inc. All rights reserved.
Jin, Gu; Wang, Fang-Fang; Li, Tao; Jia, Dong-Dong; Shen, Yong; Xu, Hai-Chao
2018-04-26
BACKGROUND Neogambogic acid (NGA) is used in traditional Chinese medicine. The aim of this study was to investigate the effects of NGA on gene signaling pathways involved in osteoclastogenesis in mouse bone marrow-derived monocyte/macrophages (BMMs) and on bone resorption in vitro. MATERIAL AND METHODS Primary mouse BMMs were cultured with increasing concentrations of NGA. Real-time polymerase chain reaction was used to study the expression of mRNAs corresponding to gene products specific to receptor activator of NF-κB ligand (RANKL)-induced osteoclast differentiation, including tartrate-resistant acid phosphatase (TRAP), calcitonin receptor (CTR), cathepsin K (CTSK), and nuclear factor of activated T cells c1 (NFATc1). A cell counting kit-8 assay was used to evaluate cell proliferation. Western blotting and confocal immunofluorescence microscopy were used to investigate the signaling pathways. A bone resorption model was used to quantify bone resorption. RESULTS An NGA dose of ≤0.4 μg/ml had no significant effect on the proliferation of mouse BMMs in vitro (P>0.05); concentrations of between 0.1-0.4 μg/ml significantly inhibited RANKL-induced osteoclastogenesis (P<0.01) in a dose-dependent manner. Compared with the control group, NGA significantly reduced RANKL-induced bone resorption in vitro (P <0.01), and downregulated the expression of osteoclast-related mRNAs of TRAP, CTR, CTSK, and NFATc1. NGA suppressed the activation of JNK but not the p38 signaling pathway and significantly reduced NF-κB p65 phosphorylation and the nuclear transport of NF-κB molecules, which inhibited NFATc1 expression. CONCLUSIONS NGA suppressed RANKL-induced osteoclastogenesis by inhibiting the JNK and NF-κB pathways in mouse BMMs in vitro and reduced osteoclastic bone resorption.
Generation of human acute lymphoblastic leukemia xenografts for use in oncology drug discovery
Holmfeldt, Linda
2015-01-01
The establishment of reproducible mouse models of acute lymphoblastic leukemia (ALL) is necessary to provide in vivo therapeutic models that recapitulate human ALL, and for amplification of limiting amounts of primary tumor material. A frequently used model is the primary xenograft model that utilizes immunocompromised mice and involves injection of primary patient tumor specimens into mice, and subsequent serial passaging of the tumors by retransplants of cells harvested from the mouse bone marrow and spleen. The tumors generated can then be used for genomic profiling, ex vivo compound testing, mechanistic studies and retransplantation. This unit describes detailed procedures for the establishment and maintenance of primary ALL xenograft panels for potential use in basic research or translational studies. PMID:25737157
Pelletier, Margery G. H.; Szymczak, Klaudia; Barbeau, Anna M.; Prata, Gianna N.; O’Fallon, Kevin S.; Gaines, Peter
2016-01-01
Neutrophils and macrophages differentiate from common myeloid progenitors in the bone marrow, where they undergo nuclear morphologic changes during maturation. During this process, both cell types acquire critical innate immune functions that include phagocytosis of pathogens, and for neutrophils the release of nuclear material called nuclear extracellular traps (NETs). Primary cells used to study these functions are typically purified from mature mouse tissues, but bone marrow-derived ex vivo cultures provide more abundant numbers of progenitors and functionally mature cells. Routine analyses of these cells use conventional microscopy and flow cytometry, which present limitations; microscopy is laborious and subjective, whereas flow cytometry lacks spatial resolution. Here we describe methods to generate enriched populations of neutrophils or macrophages from cryopreserved mouse bone marrow cultured ex vivo, and to use imaging flow cytometry that combines the resolution of microscopy with flow cytometry to analyze cells for morphologic features, phagocytosis, and NETosis. PMID:27663441
Effects of suspension-induced osteopenia on the mechanical behaviour of mouse long bones
NASA Technical Reports Server (NTRS)
Simske, S. J.; Greenberg, A. R.; Luttges, M. W.; Spooner, B. S. (Principal Investigator)
1991-01-01
Whereas most studies of tail-suspension induced osteopenia have utilized rat femora, the present study investigated the effects of a 14 day tail-suspension on the mechanical behaviour of mice femora, tibiae and humeri. Force-deflection properties were obtained via three-point bending for long bones from suspended and control mice. Whole bone behaviour was characterized by converting the force-deflection values to stiffness, strength, ductility and energy parameters which were not normalized for specimen geometry. The effects of a systematic variation in the deflection rate over the range 0.1-10 mm min-1 were also evaluated. Statistical analysis indicated that the primary effect of the tail-suspension period was lowered bone mass which was manifested mechanically through lower values of the bone strength parameters. These effects were similar in the bones of both the fore and hind limbs. The results also demonstrated that the stiffness, ductility and energy characteristics were much less influenced by the tail-suspension. Whereas a significant dependence of the bone strength values upon deflection rate was observed for the femora and humeri, the other mechanical parameters were less sensitive. Based upon the nature of the physical and mechanical changes observed in the long bones following tail-suspension, the mouse appears to be a suitable animal model for the study of osteopenia.
Defective Bone Repair in C57Bl6 Mice With Acute Systemic Inflammation.
Behrends, D A; Hui, D; Gao, C; Awlia, A; Al-Saran, Y; Li, A; Henderson, J E; Martineau, P A
2017-03-01
Bone repair is initiated with a local inflammatory response to injury. The presence of systemic inflammation impairs bone healing and often leads to malunion, although the underlying mechanisms remain poorly defined. Our research objective was to use a mouse model of cortical bone repair to determine the effect of systemic inflammation on cells in the bone healing microenvironment. QUESTION/PURPOSES: (1) Does systemic inflammation, induced by lipopolysaccharide (LPS) administration affect the quantity and quality of regenerating bone in primary bone healing? (2) Does systemic inflammation alter vascularization and the number or activity of inflammatory cells, osteoblasts, and osteoclasts in the bone healing microenvironment? Cortical defects were drilled in the femoral diaphysis of female and male C57BL/6 mice aged 5 to 9 months that were treated with daily systemic injections of LPS or physiologic saline as control for 7 days. Mice were euthanized at 1 week (Control, n = 7; LPS, n = 8), 2 weeks (Control, n = 7; LPS, n = 8), and 6 weeks (Control, n = 9; LPS, n = 8) after surgery. The quantity (bone volume per tissue volume [BV/TV]) and microarchitecture (trabecular separation and thickness, porosity) of bone in the defect were quantified with time using microCT. The presence or activity of vascular endothelial cells (CD34), macrophages (F4/80), osteoblasts (alkaline phosphatase [ALP]), and osteoclasts (tartrate-resistant acid phosphatase [TRAP]) were evaluated using histochemical analyses. Only one of eight defects was bridged completely 6 weeks after surgery in LPS-injected mouse bones compared with seven of nine defects in the control mouse bones (odds ratio [OR], 0.04; 95% CI, 0.003-0.560; p = 0.007). The decrease in cortical bone in LPS-treated mice was reflected in reduced BV/TV (21% ± 4% vs 39% ± 10%; p < 0.01), increased trabecular separation (240 ± 36 μm vs 171 ± 29 μm; p < 0.01), decreased trabecular thickness (81 ± 18 μm vs 110 ± 22 μm; p = 0.02), and porosity (79% ± 4% vs 60% ± 10%; p < 0.01) at 6 weeks postoperative. Defective healing was accompanied by decreased CD34 (1.1 ± 0.6 vs 3.4 ± 0.9; p < 0.01), ALP (1.9 ± 0.9 vs 6.1 ± 3.2; p = 0.03), and TRAP (3.3 ± 4.7 vs 7.2 ± 4.0; p = 0.01) activity, and increased F4/80 (13 ± 2.6 vs 6.8 ± 1.7; p < 0.01) activity at 2 weeks postoperative. The results indicate that LPS-induced systemic inflammation reduced the amount and impaired the quality of bone regenerated in mouse femurs. The effects were associated with impaired revascularization, decreased bone turnover by osteoblasts and osteoclasts, and by increased catabolic activity by macrophages. Results from this preclinical study support clinical observations of impaired primary bone healing in patients with systemic inflammation. Based on our data, local administration of VEGF in the callus to stimulate revascularization, or transplantation of stem cells to enhance bone turnover represent potentially feasible approaches to improve outcomes in clinical practice.
Metabolic acidosis increases fibroblast growth factor 23 in neonatal mouse bone
Culbertson, Christopher D.; Kyker-Snowman, Kelly; Bushinsky, David A.
2012-01-01
Fibroblast growth factor 23 (FGF23) significantly increases with declining renal function, leading to reduced renal tubular phosphate reabsorption, decreased 1,25-dihydroxyvitamin D, and increased left ventricular hypertrophy. Elevated FGF23 is associated with increased mortality. FGF23 is synthesized in osteoblasts and osteocytes; however, the mechanisms by which it is regulated are not clear. Patients with chronic kidney disease have decreased renal acid excretion leading to metabolic acidosis, which has a direct effect on bone cell activity. We hypothesized that metabolic acidosis would directly increase bone cell FGF23 production. Using cultured neonatal mouse calvariae, we found that metabolic acidosis increased medium FGF23 protein levels as well as FGF23 RNA expression at 24 h and 48 h compared with incubation in neutral pH medium. To exclude that the increased FGF23 was secondary to metabolic acidosis-induced release of bone mineral phosphate, we cultured primary calvarial osteoblasts. In these cells, metabolic acidosis increased FGF23 RNA expression at 6 h compared with incubation in neutral pH medium. Thus metabolic acidosis directly increases FGF23 mRNA and protein in mouse bone. If these results are confirmed in humans with chronic kidney disease, therapeutic interventions to mitigate acidosis, such as bicarbonate administration, may also lower levels of FGF23, decrease left ventricular hypertrophy, and perhaps even decrease mortality. PMID:22647635
Yu, Fang; Shi, Ying; Wang, Junfeng; Li, Juan; Fan, Daping; Ai, Walden
2013-01-01
Increasing evidence indicates that myeloid-derived suppressor cells (MDSCs) negatively regulate immune responses during tumor progression, inflammation and infection. However, the underlying molecular mechanisms of their development and mobilization remain to be fully delineated. Kruppel-like factor KLF4 is a transcription factor that has an oncogenic function in breast cancer development, but its function in tumor microenvironment, a critical component for tumorigenesis, has not been examined. By using a spontaneously metastatic 4T1 breast cancer mouse model and an immunodeficient NOD/SCID mouse model, we demonstrated that KLF4 knockdown delayed tumor development and inhibited pulmonary metastasis, which was accompanied by decreased accumulation of MDSCs in bone marrow, spleens and primary tumors. Mechanistically, we found that KLF4 knockdown resulted in a significant decrease of circulating GM-CSF, an important cytokine for MDSC biology. Consistently, recombinant GM-CSF restored the frequency of MDSCs in purified bone marrow cells incubated with conditioned medium from KLF4 deficient cells. In addition, we identified CXCL5 as a critical mediator to enhance the expression and function of GM-CSF. Reduced CXCL5 expression by KLF4 knockdown in primary tumors and breast cancer cells was correlated with a decreased GM-CSF expression in our mouse models. Finally, we found that CXCL5/CXCR2 axis facilitated MDSC migration and that anti-GM-CSF antibodies neutralized CXCL5-induced accumulation of MDSCs. Taken together, our data suggest that KLF4 modulates maintenance of MDSCs in bone marrow by inducing GM-CSF production via CXCL5 and regulates recruitment of MDSCs into the primary tumors through the CXCL5/CXCR2 axis, both of which contribute to KLF4-mediated mammary tumor development. PMID:23737434
Lu, Shun; Wang, Jing; Ye, Jixing; Zou, Yulong; Zhu, Yunxiao; Wei, Qiang; Wang, Xin; Tang, Shengli; Liu, Hao; Fan, Jiaming; Zhang, Fugui; Farina, Evan M; Mohammed, Maryam M; Song, Dongzhe; Liao, Junyi; Huang, Jiayi; Guo, Dan; Lu, Minpeng; Liu, Feng; Liu, Jianxiang; Li, Li; Ma, Chao; Hu, Xue; Lee, Michael J; Reid, Russell R; Ameer, Guillermo A; Zhou, Dongsheng; He, Tongchuan
2016-01-01
Regenerative medicine and bone tissue engineering using mesenchymal stem cells (MSCs) hold great promise as an effective approach to bone and skeletal reconstruction. While adipose tissue harbors MSC-like progenitors, or multipotent adipose-derived cells (MADs), it is important to identify and characterize potential biological factors that can effectively induce osteogenic differentiation of MADs. To overcome the time-consuming and technically challenging process of isolating and culturing primary MADs, here we establish and characterize the reversibly immortalized mouse multipotent adipose-derived cells (iMADs). The isolated mouse primary inguinal MAD cells are reversibly immortalized via the retrovirus-mediated expression of SV40 T antigen flanked with FRT sites. The iMADs are shown to express most common MSC markers. FLP-mediated removal of SV40 T antigen effectively reduces the proliferative activity and cell survival of iMADs, indicating the immortalization is reversible. Using the highly osteogenic BMP9, we find that the iMADs are highly responsive to BMP9 stimulation, express multiple lineage regulators, and undergo osteogenic differentiation in vitro upon BMP9 stimulation. Furthermore, we demonstrate that BMP9-stimulated iMADs form robust ectopic bone with a thermoresponsive biodegradable scaffold material. Collectively, our results demonstrate that the reversibly immortalized iMADs exhibit the characteristics of multipotent MSCs and are highly responsive to BMP9-induced osteogenic differentiation. Thus, the iMADs should provide a valuable resource for the study of MAD biology, which would ultimately enable us to develop novel and efficacious strategies for MAD-based bone tissue engineering.
A methodology for the investigation of toughness and crack propagation in mouse bone.
Carriero, Alessandra; Zimmermann, Elizabeth A; Shefelbine, Sandra J; Ritchie, Robert O
2014-11-01
Bone fracture is a health concern for those with aged bone and brittle bone diseases. Mouse bone is widely used as a model of human bone, especially to investigate preclinical treatment strategies. However, little is known about the mechanisms of mouse bone fracture and its similarities and differences from fracture in human bone. In this work we present a methodology to investigate the fracture toughness during crack initiation and crack propagation for mouse bone. Mouse femora were dissected, polished on their periosteal surface, notched on the posterior surface at their mid-diaphysis, and tested in three-point bending under displacement control at a rate of 0.1mm/min using an in situ loading stage within an environmental scanning electron microscope. We obtained high-resolution real-time imaging of the crack initiation and propagation in mouse bone. From the images we can measure the crack extension at each step of the crack growth and calculate the toughness of the bone (in terms of stress intensity factor (K) and work to fracture (Wf)) as a function of stable crack length (Δa), thus generating a resistance curve for the mouse bone. The technique presented here provides insight into the evolution of microdamage and the toughening mechanisms that resist crack propagation, which are essential for preclinical development of treatments to enhance bone quality and combat fracture risk. Copyright © 2014 Elsevier Ltd. All rights reserved.
Leukemia inhibitory factor: a novel bone-active cytokine.
Reid, L R; Lowe, C; Cornish, J; Skinner, S J; Hilton, D J; Willson, T A; Gearing, D P; Martin, T J
1990-03-01
A number of cytokines have been found to be potent regulators of bone resorption and to share the properties originally attributed to osteoclast-activating factor. One such activity, differentiation-inducing factor (DIF, D-factor) from mouse spleen cells, shares a number of biological and biochemical properties with the recently characterized and cloned leukemia inhibitory factor (LIF). We have assessed the effects of recombinant LIF on bone resorption and other parameters in neonatal mouse calvaria. Both recombinant murine and human (h) LIFs stimulated 45Ca release from prelabeled calvaria in a dose-dependent manner. The increase in bone resorption was associated with an increase in the number of osteoclasts per mm2 bone. The osteolytic effect of hLIF were blocked by 10(-7) M indomethacin. hLIF also stimulated incorporation of [3H] thymidine into calvaria, but the dose-response relationship was distinct from that for bone resorption, and this effect was not blocked by indomethacin. Similarly, hLIF increased [3H]phenylalanine incorporation into calvaria, and this was also not inhibited by indomethacin. It is concluded that LIF stimulates bone resorption by a mechanism involving prostaglandin production, but that a distinct mechanism is responsible for its stimulation of DNA and protein synthesis. The primary structure of LIF differs from that of other fully characterized, bone-active cytokines, and it, thus, represents a novel factor which may be involved in the normal regulation of bone cell function.
Phenotypic research on senile osteoporosis caused by SIRT6 deficiency
Zhang, De-Mao; Cui, Di-Xin; Xu, Ruo-Shi; Zhou, Ya-Chuan; Zheng, Li-Wei; Liu, Peng; Zhou, Xue-Dong
2016-01-01
Osteoporosis is a serious public bone metabolic disease. However, the mechanisms underlying bone loss combined with ageing, which is known as senile osteoporosis, remains unknown. Here we show the detailed phenotype of this disease caused by SIRT6 knock out (KO) in mice. To the best of our knowledge, this is the first study to reveal that SIRT6 is expressed in both bone marrow stroma cells and bone-related cells in both mouse and human models, which suggests that SIRT6 is an important regulator in bone metabolism. SIRT6-KO mice exhibit a significant decrease in body weight and remarkable dwarfism. The skeleton of the SIRT6-KO mouse is deficient in cartilage and mineralized bone tissue. Moreover, the osteocalcin concentration in blood is lower, which suggests that bone mass is markedly lost. Besides, the tartrate-resistant acid phosphatase 5b (TRAP5b) concentration is much higher, which suggests that bone resorption is overactive. Both trabecular and cortical bones exhibit severe osteopenia, and the bone mineral density is decreased. Moreover, double-labelling analysis shows that bone formation is much slower. To determine whether SIRT6 directly regulates bone metabolism, we cultured primary bone marrow stromal cells for osteogenesis and osteoclastogenesis separately to avoid indirect interference in vivo responses such as inflammation. Taken together, these results show that SIRT6 can directly regulate osteoblast proliferation and differentiation, resulting in attenuation in mineralization. Furthermore, SIRT6 can directly regulate osteoclast differentiation and results in a higher number of small osteoclasts, which may be related to overactive bone resorption. PMID:27357320
Baker, Amelia H; Watt, James; Huang, Cassie K; Gerstenfeld, Louis C; Schlezinger, Jennifer J
2015-06-15
Organotins are members of the environmental obesogen class of contaminants because they activate peroxisome proliferator-activated receptor γ (PPARγ), the essential regulator of adipogenesis. Exposure to thiazolidinediones (PPARγ ligands used to treat type 2 diabetes) is associated with increased fractures. Diminished bone quality likely results from PPARγ's role in promoting adipogenesis while suppressing osteogenesis of bone marrow multipotent mesenchymal stromal cells (BM-MSC). We hypothesized that tributyltin (TBT) would be a potent modifier of BM-MSC differentiation and a negative regulator of bone formation. Organotins interact with both PPARγ and retinoid X receptors (RXR), suggesting that they activate multiple nuclear receptor pathways. To investigate the role of RXR in the actions of TBT, the effects of PPARγ (rosiglitazone) and RXR (bexarotene, LG100268) agonists were compared to the effects of TBT in BMS2 cells and primary mouse BM-MSC cultures. In BMS2 cells, TBT induced the expression of Fabp4, Abca1, and Tgm2 in an RXR-dependent manner. All agonists suppressed osteogenesis in primary mouse BM-MSC cultures, based on decreased alkaline phosphatase activity, mineralization, and expression of osteoblast-related genes. While rosiglitazone and TBT strongly activated adipogenesis, based on lipid accumulation and expression of adipocyte-related genes, the RXR agonists did not. Extending these analyses to other RXR heterodimers showed that TBT and the RXR agonists activated the liver X receptor pathway, whereas rosiglitazone did not. Application of either a PPARγ antagonist (T0070907) or an RXR antagonist (HX531) significantly reduced rosiglitazone-induced suppression of bone nodule formation. Only the RXR antagonist significantly reduced LG100268- and TBT-induced bone suppression. The RXR antagonist also inhibited LG100268- and TBT-induced expression of Abca1, an LXR target gene, in primary BM-MSC cultures. These results provide novel evidence that TBT activates multiple nuclear receptor pathways in BM-MSCs, activation of RXR is sufficient to suppress osteogenesis, and TBT suppresses osteogenesis largely through its direct interaction with RXR.
Establishment of a patient-derived orthotopic osteosarcoma mouse model.
Blattmann, Claudia; Thiemann, Markus; Stenzinger, Albrecht; Roth, Eva K; Dittmar, Anne; Witt, Hendrik; Lehner, Burkhard; Renker, Eva; Jugold, Manfred; Eichwald, Viktoria; Weichert, Wilko; Huber, Peter E; Kulozik, Andreas E
2015-04-30
Osteosarcoma (OS) is the most common pediatric primary malignant bone tumor. As the prognosis for patients following standard treatment did not improve for almost three decades, functional preclinical models that closely reflect important clinical cancer characteristics are urgently needed to develop and evaluate new treatment strategies. The objective of this study was to establish an orthotopic xenotransplanted mouse model using patient-derived tumor tissue. Fresh tumor tissue from an adolescent female patient with osteosarcoma after relapse was surgically xenografted into the right tibia of 6 immunodeficient BALB/c Nu/Nu mice as well as cultured into medium. Tumor growth was serially assessed by palpation and with magnetic resonance imaging (MRI). In parallel, a primary cell line of the same tumor was established. Histology and high-resolution array-based comparative genomic hybridization (aCGH) were used to investigate both phenotypic and genotypic characteristics of different passages of human xenografts and the cell line compared to the tissue of origin. A primary OS cell line and a primary patient-derived orthotopic xenotranplanted mouse model were established. MRI analyses and histopathology demonstrated an identical architecture in the primary tumor and in the xenografts. Array-CGH analyses of the cell line and all xenografts showed highly comparable patterns of genomic progression. So far, three further primary patient-derived orthotopic xenotranplanted mouse models could be established. We report the first orthotopic OS mouse model generated by transplantation of tumor fragments directly harvested from the patient. This model represents the morphologic and genomic identity of the primary tumor and provides a preclinical platform to evaluate new treatment strategies in OS.
Walker, Emma C.; McGregor, Narelle E.; Poulton, Ingrid J.; Solano, Melissa; Pompolo, Sueli; Fernandes, Tania J.; Constable, Matthew J.; Nicholson, Geoff C.; Zhang, Jian-Guo; Nicola, Nicos A.; Gillespie, Matthew T.; Martin, T. John; Sims, Natalie A.
2010-01-01
Effective osteoporosis therapy requires agents that increase the amount and/or quality of bone. Any modification of osteoclast-mediated bone resorption by disease or drug treatment, however, elicits a parallel change in osteoblast-mediated bone formation because the processes are tightly coupled. Anabolic approaches now focus on uncoupling osteoblast action from osteoclast formation, for example, by inhibiting sclerostin, an inhibitor of bone formation that does not influence osteoclast differentiation. Here, we report that oncostatin M (OSM) is produced by osteoblasts and osteocytes in mouse bone and that it has distinct effects when acting through 2 different receptors, OSM receptor (OSMR) and leukemia inhibitory factor receptor (LIFR). Specifically, mouse OSM (mOSM) inhibited sclerostin production in a stromal cell line and in primary murine osteoblast cultures by acting through LIFR. In contrast, when acting through OSMR, mOSM stimulated RANKL production and osteoclast formation. A key role for OSMR in bone turnover was confirmed by the osteopetrotic phenotype of mice lacking OSMR. Furthermore, in contrast to the accepted model, in which mOSM acts only through OSMR, mOSM inhibited sclerostin expression in Osmr–/– osteoblasts and enhanced bone formation in vivo. These data reveal what we believe to be a novel pathway by which bone formation can be stimulated independently of bone resorption and provide new insights into OSMR and LIFR signaling that are relevant to other medical conditions, including cardiovascular and neurodegenerative diseases and cancer. PMID:20051625
Dong, Yifei; Arif, Arif A.; Poon, Grace F. T.; Hardman, Blair; Dosanjh, Manisha; Johnson, Pauline
2016-01-01
Macrophages and dendritic cells (DCs) are innate immune cells found in tissues and lymphoid organs that play a key role in the defense against pathogens. However, they are difficult to isolate in sufficient numbers to study them in detail, therefore, in vitro models have been developed. In vitro cultures of bone marrow-derived macrophages and dendritic cells are well-established and valuable methods for immunological studies. Here, a method for culturing and identifying both DCs and macrophages from a single culture of primary mouse bone marrow cells using the cytokine granulocyte macrophage colony-stimulating factor (GM-CSF) is described. This protocol is based on the established procedure first developed by Lutz et al. in 1999 for bone marrow-derived DCs. The culture is heterogeneous, and MHCII and fluoresceinated hyaluronan (FL-HA) are used to distinguish macrophages from immature and mature DCs. These GM-CSF derived macrophages provide a convenient source of in vitro derived macrophages that closely resemble alveolar macrophages in both phenotype and function. PMID:27404290
Propagating Humanized BLT Mice for the Study of Human Immunology and Immunotherapy.
Smith, Drake J; Lin, Levina J; Moon, Heesung; Pham, Alexander T; Wang, Xi; Liu, Siyuan; Ji, Sunjong; Rezek, Valerie; Shimizu, Saki; Ruiz, Marlene; Lam, Jennifer; Janzen, Deanna M; Memarzadeh, Sanaz; Kohn, Donald B; Zack, Jerome A; Kitchen, Scott G; An, Dong Sung; Yang, Lili
2016-12-15
The humanized bone marrow-liver-thymus (BLT) mouse model harbors a nearly complete human immune system, therefore providing a powerful tool to study human immunology and immunotherapy. However, its application is greatly limited by the restricted supply of human CD34 + hematopoietic stem cells and fetal thymus tissues that are needed to generate these mice. The restriction is especially significant for the study of human immune systems with special genetic traits, such as certain human leukocyte antigen (HLA) haplotypes or monogene deficiencies. To circumvent this critical limitation, we have developed a method to quickly propagate established BLT mice. Through secondary transfer of bone marrow cells and human thymus implants from BLT mice into NSG (NOD/SCID/IL-2Rγ -/- ) recipient mice, we were able to expand one primary BLT mouse into a colony of 4-5 proBLT (propagated BLT) mice in 6-8 weeks. These proBLT mice reconstituted human immune cells, including T cells, at levels comparable to those of their primary BLT donor mouse. They also faithfully inherited the human immune cell genetic traits from their donor BLT mouse, such as the HLA-A2 haplotype that is of special interest for studying HLA-A2-restricted human T cell immunotherapies. Moreover, an EGFP reporter gene engineered into the human immune system was stably passed from BLT to proBLT mice, making proBLT mice suitable for studying human immune cell gene therapy. This method provides an opportunity to overcome a critical hurdle to utilizing the BLT humanized mouse model and enables its more widespread use as a valuable preclinical research tool.
Tridax procumbens flavonoids promote osteoblast differentiation and bone formation.
Al Mamun, Md Abdullah; Hosen, Mohammad Jakir; Islam, Kamrul; Khatun, Amina; Alam, M Masihul; Al-Bari, Md Abdul Alim
2015-11-18
Tridax procumbens flavonoids (TPFs) are well known for their medicinal properties among local natives. Besides traditionally used for dropsy, anemia, arthritis, gout, asthma, ulcer, piles, and urinary problems, it is also used in treating gastric problems, body pain, and rheumatic pains of joints. TPFs have been reported to increase osteogenic functioning in mesenchymal stem cells. Our previous study showed that TPFs were significantly suppressed the RANKL-induced differentiation of osteoclasts and bone resorption. However, the effects of TPFs to promote osteoblasts differentiation and bone formation remain unclear. TPFs were isolated from Tridax procumbens and investigated for their effects on osteoblasts differentiation and bone formation by using primary mouse calvarial osteoblasts. TPFs promoted osteoblast differentiation in a dose-dependent manner demonstrated by up-regulation of alkaline phosphatase and osteocalcin. TPFs also upregulated osteoblast differentiation related genes, including osteocalcin, osterix, and Runx2 in primary osteoblasts. TPFs treated primary osteoblast cells showed significant upregulation of bone morphogenetic proteins (BMPs) including Bmp-2, Bmp-4, and Bmp-7. Addition of noggin, a BMP specific-antagonist, inhibited TPFs induced upregulation of the osteocalcin, osterix, and Runx2. Our findings point towards the induction of osteoblast differentiation by TPFs and suggested that TPFs could be a potential anabolic agent to treat patients with bone loss-associated diseases such as osteoporosis.
Margulies, B S; DeBoyace, S D; Damron, T A; Allen, M J
2015-10-01
Ewing's sarcoma of bone is a primary childhood malignancy of bone that is treated with X-radiation therapy in combination with surgical excision and chemotherapy. To better study Ewing's sarcoma of bone we developed a novel model of primary Ewing's sarcoma of bone and then treated animals with X-radiation therapy. We identified that uncontrolled tumor resulted in lytic bone destruction while X-radiation therapy decreased lytic bone destruction and increased limb-length asymmetry, a common, crippling complication of X-radiation therapy. Osteoclasts were indentified adjacent to the tumor, however, we were unable to detect RANK-ligand in the Ewing's tumor cells in vitro, which lead us to investigate alternate mechanisms for osteoclast formation. Ewing's sarcoma tumor cells and archival Ewing's sarcoma of bone tumor biopsy samples were shown to express MCSF, which could promote osteoclast formation. Increased monocyte numbers were detected in peripheral blood and spleen in animals with untreated Ewing's sarcoma tumor while monocyte number in animals treated with x-radiation had normal numbers of monocytes. Our data suggest that our Ewing's sarcoma of bone model will be useful in the study Ewing's sarcoma tumor progression in parallel with the effects of chemotherapy and X-radiation therapy. Copyright © 2015 Elsevier Inc. All rights reserved.
Margulies, BS; DeBoyace, SD; Damron, TA; Allen, MJ
2015-01-01
Ewing's sarcoma of bone is a primary childhood malignancy of bone that is treated with X-radiation therapy in combination with surgical excision and chemotherapy. To better study Ewing's sarcoma of bone we developed a novel model of primary Ewing's sarcoma of bone and then treated animals with X-radiation therapy. We identified that uncontrolled tumor resulted in lytic bone destruction while X-radiation therapy decreased lytic bone destruction and increased limb-length asymmetry, a common, crippling complication of X-radiation therapy. Osteoclasts were indentified adjacent to the tumor, however, we were unable to detect RANK-ligand in the Ewing's tumor cells in vitro, which lead us to investigate alternate mechanisms for osteoclast formation. Ewing's sarcoma tumor cells and archival Ewing's sarcoma of bone tumor biopsy samples were shown to express MCSF, which could promote osteoclast formation. Increased monocyte numbers were detected in peripheral blood and spleen in animals with untreated Ewing's sarcoma tumor while monocyte number in animals treated with x-radiation had normal numbers of monocytes. Our data suggest that our Ewing's sarcoma of bone model will be useful in the study Ewing's sarcoma tumor progression in parallel with the effects of chemotherapy and X-radiation therapy. PMID:26051470
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshikawa, H.; Masuhara, K.; Takaoka, K.
1985-01-01
The X-linked hypophosphatemic mouse (Hyp) has been proposed as a model for the human familial hypophosphatemia (the most common form of vitamin D-resistant rickets). An osteosarcoma-derived bone-inducing substance was subcutaneously implanted into the Hyp mouse. The implant was consistently replaced by cartilage tissue at 2 weeks after implantation. The cartilage matrix seemed to be normal, according to the histological examination, and 35sulphur (TVS) uptake was also normal. Up to 4 weeks after implantation the cartilage matrix was completely replaced by unmineralized bone matrix and hematopoietic bone marrow. Osteoid tissue arising from the implantation of bone inducing substance in the Hypmore » mouse showed no radiologic or histologic sign of calcification. These findings suggest that the abnormalities of endochondral ossification in the Hyp mouse might be characterized by the failure of mineralization in cartilage and bone matrix. Analysis of the effects of bone-inducing substance on the Hyp mouse may help to give greater insight into the mechanism and treatment of human familial hypophosphatemia.« less
Watt, James; Schlezinger, Jennifer J.
2015-01-01
Environmental obesogens are a newly recognized category of endocrine disrupting chemicals that have been implicated in contributing to the rising rates of obesity in the United States. While obesity is typically regarded as an increase in visceral fat, adipocyte accumulation in the bone has been linked to increased fracture risk, lower bone density, and osteoporosis. Exposure to environmental toxicants that activate peroxisome proliferator activated receptor γ (PPARγ), a critical regulator of the balance of differentiation between adipogenesis and osteogenesis, may contribute to the increasing prevalence of osteoporosis. However, induction of adipogenesis and suppression of osteogenesis are separable activities of PPARγ, and ligands may selectively alter these activities. It currently is unknown whether suppression of osteogenesis is a common toxic endpoint of environmental PPARγ ligands. Using a primary mouse bone marrow culture model, we tested the hypothesis that environmental toxicants acting as PPARγ agonists divert the differentiation pathway of bone marrow-derived multipotent mesenchymal stromal cells towards adipogenesis and away from osteogenesis. The toxicants tested included the organotins tributyltin and triphenyltin, a ubiquitous phthalate metabolite (mono-(2-ethylhexyl) phthalate, MEHP), and two brominated flame retardants (tetrabromobisphenol-a, TBBPA, and mono-(2-ethylhexyl) tetrabromophthalate, METBP). All of the compounds activated PPARγ1 and 2. All compounds increased adipogenesis (lipid accumulation, Fabp4 expression) and suppressed osteogenesis (alkaline phosphatase activity, Osx expression) in mouse primary bone marrow cultures, but with different potencies and efficacies. Despite structural dissimilarities, there was a strong negative correlation between efficacies to induce adipogenesis and suppress osteogenesis, with the organotins being distinct in their exceptional ability to suppress osteogenesis. As human exposure to a mixture of toxicants is likely, albeit at low doses, the fact that multiple toxicants are capable of suppressing bone formation supports the hypothesis that environmental PPARγ ligands represent an emerging threat to human bone health. PMID:25777084
Keratin 13 expression reprograms bone and brain metastases of human prostate cancer cells.
Li, Qinlong; Yin, Lijuan; Jones, Lawrence W; Chu, Gina C-Y; Wu, Jason B-Y; Huang, Jen-Ming; Li, Quanlin; You, Sungyong; Kim, Jayoung; Lu, Yi-Tsung; Mrdenovic, Stefan; Wang, Ruoxiang; Freeman, Michael R; Garraway, Isla; Lewis, Michael S; Chung, Leland W K; Zhau, Haiyen E
2016-12-20
Lethal progression of prostate cancer metastasis can be improved by developing animal models that recapitulate the clinical conditions. We report here that cytokeratin 13 (KRT13), an intermediate filament protein, plays a directive role in prostate cancer bone, brain, and soft tissue metastases. KRT13 expression was elevated in bone, brain, and soft tissue metastatic prostate cancer cell lines and in primary and metastatic clinical prostate, lung, and breast cancer specimens. When KRT13 expression was determined at a single cell level in primary tumor tissues of 44 prostate cancer cases, KRT13 level predicted bone metastasis and the overall survival of prostate cancer patients. Genetically enforced KRT13 expression in human prostate cancer cell lines drove metastases toward mouse bone, brain and soft tissues through a RANKL-independent mechanism, as KRT13 altered the expression of genes associated with EMT, stemness, neuroendocrine/neuromimicry, osteomimicry, development, and extracellular matrices, but not receptor activator NF-κB ligand (RANKL) signaling networks in prostate cancer cells. Our results suggest new inhibitors targeting RANKL-independent pathways should be developed for the treatment of prostate cancer bone and soft tissue metastases.
Mangiferin positively regulates osteoblast differentiation and suppresses osteoclast differentiation
Sekiguchi, Yuusuke; Mano, Hiroshi; Nakatani, Sachie; Shimizu, Jun; Kataoka, Aya; Ogura, Kana; Kimira, Yoshifumi; Ebata, Midori; Wada, Masahiro
2017-01-01
Mangiferin is a polyphenolic compound present in Salacia reticulata. It has been reported to reduce bone destruction and inhibit osteoclastic differentiation. This study aimed to determine whether mangiferin directly affects osteoblast and osteoclast proliferation and differentiation, and gene expression in MC3T3-E1 osteoblastic cells and osteoclast-like cells derived from primary mouse bone marrow macrophage cells. Mangiferin induced significantly greater WST-1 activity, indicating increased cell proliferation. Mangiferin induced significantly increased alkaline phosphatase staining, indicating greater cell differentiation. Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated that mangiferin significantly increased the mRNA level of runt-related transcription factor 2 (RunX2), but did not affect RunX1 mRNA expression. Mangiferin significantly reduced the formation of tartrate-resistant acid phosphatase-positive multinuclear cells. RT-PCR demonstrated that mangiferin significantly increased the mRNA level of estrogen receptor β (ERβ), but did not affect the expression of other osteoclast-associated genes. Mangiferin may inhibit osteoclastic bone resorption by suppressing differentiation of osteoclasts and promoting expression of ERβ mRNA in mouse bone marrow macrophage cells. It also has potential to promote osteoblastic bone formation by promoting cell proliferation and inducing cell differentiation in preosteoblast MC3T3-E1 cells via RunX2. Mangiferin may therefore be useful in improving bone disease outcomes. PMID:28627701
Sekiguchi, Yuusuke; Mano, Hiroshi; Nakatani, Sachie; Shimizu, Jun; Kataoka, Aya; Ogura, Kana; Kimira, Yoshifumi; Ebata, Midori; Wada, Masahiro
2017-08-01
Mangiferin is a polyphenolic compound present in Salacia reticulata. It has been reported to reduce bone destruction and inhibit osteoclastic differentiation. This study aimed to determine whether mangiferin directly affects osteoblast and osteoclast proliferation and differentiation, and gene expression in MC3T3‑E1 osteoblastic cells and osteoclast‑like cells derived from primary mouse bone marrow macrophage cells. Mangiferin induced significantly greater WST‑1 activity, indicating increased cell proliferation. Mangiferin induced significantly increased alkaline phosphatase staining, indicating greater cell differentiation. Reverse transcription‑polymerase chain reaction (RT‑PCR) demonstrated that mangiferin significantly increased the mRNA level of runt‑related transcription factor 2 (RunX2), but did not affect RunX1 mRNA expression. Mangiferin significantly reduced the formation of tartrate‑resistant acid phosphatase‑positive multinuclear cells. RT‑PCR demonstrated that mangiferin significantly increased the mRNA level of estrogen receptor β (ERβ), but did not affect the expression of other osteoclast‑associated genes. Mangiferin may inhibit osteoclastic bone resorption by suppressing differentiation of osteoclasts and promoting expression of ERβ mRNA in mouse bone marrow macrophage cells. It also has potential to promote osteoblastic bone formation by promoting cell proliferation and inducing cell differentiation in preosteoblast MC3T3‑E1 cells via RunX2. Mangiferin may therefore be useful in improving bone disease outcomes.
Effects of gentamicin and monomer on bone. An in vitro study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pedersen, J.G.; Lund, B.
1988-01-01
Gentamicin-loaded bone cement is used with increasing frequency in primary and revision arthroplasty. Considering the high local concentration and the well-known toxic effect of gentamicin on the kidney, a similar inhibiting effect on bone tissue might be expected. In a series of in vitro studies using paired mouse calvaries cultured for 2 days, the authors found a dose-dependent decrease in the release of previously incorporated calcium-45 (UVCa) or tritiated proline and a decrease in alkaline phosphatase activity. In combination with methylmethacrylate, a small additional reduction in UVCa release and a marked decrease in alkaline phosphatase activity were recorded. These resultsmore » indicate that released gentamicin and monomer from antibiotic-supplemented bone cement depresses bone turnover and might thus play an important part in the pathogenesis of loosening.« less
Bijelić, Nikola; Belovari, Tatjana; Stolnik, Dunja; Lovrić, Ivana; Baus Lončar, Mirela
2017-08-01
Trefoil factor family 3 (Tff3) peptide is present during intrauterine endochondral ossification in mice, and its deficiency affects cancellous bone quality in secondary ossification centers of mouse tibiae. The aim of this study was to quantitatively analyze parameters describing the growth plate and primary ossification centers in tibiae of 1-month-old wild-type and Tff3 knock-out mice (n=5 per genotype) by using free and open-source software. Digital photographs of the growth plates and trabecular bone were processed by open-source computer programs GIMP and FIJI. Histomorphometric parameters were calculated using measurements made with FIJI. Tff3 knock-out mice had significantly smaller trabecular number and significantly larger trabecular separation. Trabecular bone volume, trabecular bone surface, and trabecular thickness showed no significant difference between the two groups. Although such histomorphological differences were found in the cancellous bone structure, no significant differences were found in the epiphyseal plate histomorphology. Tff3 peptide probably has an effect on the formation and quality of the cancellous bone in the primary ossification centers, but not through disrupting the epiphyseal plate morphology. This work emphasizes the benefits of using free and open-source programs for morphological studies in life sciences.
Huang, Henry; Skelly, Jordan D; Ayers, David C; Song, Jie
2017-02-09
Age is the primary risk factor for osteoarthritis (OA), yet surgical OA mouse models such as destabilization of the medial meniscus (DMM) used for evaluating disease-modifying OA targets are frequently performed on young adult mice only. This study investigates how age affects cartilage and subchondral bone changes in mouse joints following DMM. DMM was performed on male C57BL/6 mice at 4 months (4 M), 12 months (12 M) and 19+ months (19 M+) and on females at 12 M and 18 M+. Two months after surgery, operated and unoperated contralateral knees were harvested and evaluated using cartilage histology scores and μCT quantification of subchondral bone plate thickness and osteophyte formation. The 12 M and 19 M+ male mice developed more cartilage erosions and thicker subchondral bone plates after DMM than 4 M males. The size of osteophytes trended up with age, while the bone volume fraction was significantly higher in the 19 M+ group. Furthermore, 12 M females developed milder OA than males as indicated by less cartilage degradation, less subchondral bone plate sclerosis and smaller osteophytes. Our results reveal distinct age/gender-dependent structural changes in joint cartilage and subchondral bone post-DMM, facilitating more thoughtful selection of murine age/gender when using this surgical technique for translational OA research.
Huang, Henry; Skelly, Jordan D.; Ayers, David C.; Song, Jie
2017-01-01
Age is the primary risk factor for osteoarthritis (OA), yet surgical OA mouse models such as destabilization of the medial meniscus (DMM) used for evaluating disease-modifying OA targets are frequently performed on young adult mice only. This study investigates how age affects cartilage and subchondral bone changes in mouse joints following DMM. DMM was performed on male C57BL/6 mice at 4 months (4 M), 12 months (12 M) and 19+ months (19 M+) and on females at 12 M and 18 M+. Two months after surgery, operated and unoperated contralateral knees were harvested and evaluated using cartilage histology scores and μCT quantification of subchondral bone plate thickness and osteophyte formation. The 12 M and 19 M+ male mice developed more cartilage erosions and thicker subchondral bone plates after DMM than 4 M males. The size of osteophytes trended up with age, while the bone volume fraction was significantly higher in the 19 M+ group. Furthermore, 12 M females developed milder OA than males as indicated by less cartilage degradation, less subchondral bone plate sclerosis and smaller osteophytes. Our results reveal distinct age/gender-dependent structural changes in joint cartilage and subchondral bone post-DMM, facilitating more thoughtful selection of murine age/gender when using this surgical technique for translational OA research. PMID:28181577
Nussler, Andreas K; Wildemann, Britt; Freude, Thomas; Litzka, Christian; Soldo, Petra; Friess, Helmut; Hammad, Seddik; Hengstler, Jan G; Braun, Karl F; Trak-Smayra, Viviane; Godoy, Patricio; Ehnert, Sabrina
2014-04-01
Patients with chronic liver diseases frequently exhibit decreased bone mineral densities (BMD), which is defined as hepatic osteodystrophy (HOD). HOD is a multifactorial disease whose regulatory mechanisms are barely understood. Thus, an early diagnosis and therapy is hardly possible. Therefore, the aim of our study consisted in characterizing a mouse model reflecting the human pathomechanism. Serum samples were collected from patients with chronic liver diseases and 12-week old C57Bl6/N mice after 6-week treatment with carbon tetrachloride (CCl4). Repetitive injections of CCl4 induced liver damage in mice, resembling liver fibrosis in patients, as assessed by serum analysis and histological staining. Although CCl4 did not affect primary osteoblast cultures, μCT analysis revealed significantly decreased BMD, bone volume, trabecular number and thickness in CCl4-treated mice. In both HOD patients and CCl4-treated mice, an altered vitamin D metabolism with decreased CYP27A1, CYP2R1, vitamin D-binding protein GC and increased 7-dehydrocholesterol reductase hepatic gene expression, results in decreased 25-OH vitamin D serum levels. Moreover, both groups exhibit excessively high active transforming growth factor-beta (TGF-β) serum levels, inhibiting osteoblast function in vitro. Summarizing, our mouse model presents possible mediators of HOD, e.g. altered vitamin D metabolism and increased active TGF-β. Liver damage and significant changes in bone structure and mineralization are already visible by μCT analysis after 6 weeks of CCl4 treatment. This fast response and easy transferability makes it an ideal model to investigate specific gene functions in HOD.
Increased bone formation in mice lacking apolipoprotein E.
Schilling, Arndt F; Schinke, Thorsten; Münch, Christian; Gebauer, Matthias; Niemeier, Andreas; Priemel, Matthias; Streichert, Thomas; Rueger, Johannes M; Amling, Michael
2005-02-01
ApoE is a plasma protein that plays a major role in lipoprotein metabolism. Here we describe that ApoE expression is strongly induced on mineralization of primary osteoblast cultures. ApoE-deficient mice display an increased bone formation rate compared with wildtype controls, thereby showing that ApoE has a physiologic function in bone remodeling. Apolipoprotein E (ApoE) is a protein component of lipoproteins and facilitates their clearance from the circulation. This is confirmed by the phenotype of ApoE-deficient mice that have high plasma cholesterol levels and spontaneously develop atherosclerotic lesions. The bone phenotype of these mice has not been analyzed to date, although an association between certain ApoE alleles and BMD has been reported. Primary osteoblasts were isolated from newborn mouse calvariae and mineralized ex vivo. A genome-wide expression analysis was performed during the course of differentiation using the Affymetrix gene chip system. Bones from ApoE-deficient mice and wildtype controls were analyzed using radiography, micro CT imaging, and undecalcified histology. Cellular activities were assessed using dynamic histomorphometry and by measuring urinary collagen degradation products. Lipoprotein uptake assays were performed with (125)I-labeled triglyceride-rich lipoprotein-remnants (TRL-R) using primary osteoblasts from wildtype and ApoE-deficient mice. Serum concentrations of osteocalcin were determined by radioimmunoassay after hydroxyapatite chromatography. ApoE expression is strongly induced on mineralization of primary osteoblast cultures ex vivo. Mice lacking ApoE display a high bone mass phenotype that is caused by an increased bone formation rate, whereas bone resorption is not affected. This phenotype may be explained by a decreased uptake of triglyceride-rich lipoproteins by osteoblasts, resulting in elevated levels of undercarboxylated osteocalcin in the serum of ApoE-deficient mice. The specific induction of ApoE gene expression during osteoblast differentiation along with the increased bone formation rate observed in ApoE-deficient mice shows that ApoE has a physiologic role as a regulator of osteoblast function.
Absence of bone sialoprotein (BSP) impairs cortical defect repair in mouse long bone.
Malaval, Luc; Monfoulet, Laurent; Fabre, Thierry; Pothuaud, Laurent; Bareille, Reine; Miraux, Sylvain; Thiaudiere, Eric; Raffard, Gerard; Franconi, Jean-Michel; Lafage-Proust, Marie-Hélène; Aubin, Jane E; Vico, Laurence; Amédée, Joëlle
2009-11-01
Matrix proteins of the SIBLING family interact with bone cells and with bone mineral and are thus in a key position to regulate bone development, remodeling and repair. Within this family, bone sialoprotein (BSP) is highly expressed by osteoblasts, hypertrophic chondrocytes and osteoclasts. We recently reported that mice lacking BSP (BSP-/-) have very low trabecular bone turnover. In the present study, we set up an experimental model of bone repair by drilling a 1 mm diameter hole in the cortical bone of femurs in both BSP-/- and +/+ mice. A non-invasive MRI imaging and bone quantification procedure was designed to follow bone regeneration, and these data were extended by microCT imaging and histomorphometry on undecalcified sections for analysis at cellular level. These combined approaches revealed that the repair process as reflected in defect-refilling in the cortical area was significantly delayed in BSP-/- mice compared to +/+ mice. Concomitantly, histomorphometry showed that formation, mineralization and remodeling of repair (primary) bone in the medulla were delayed in BSP-/- mice, with lower osteoid and osteoclast surfaces at day 15. In conclusion, the absence of BSP delays bone repair at least in part by impairing both new bone formation and osteoclast activity.
Four-point bending protocols to study the effects of dynamic strain in osteoblastic cells in vitro.
Galea, Gabriel L; Price, Joanna S
2015-01-01
Strain engendered within bone tissue by mechanical loading of the skeleton is a major influence on the processes of bone modeling and remodeling and so a critical determinant of bone mass and architecture. The cells best placed to respond to strain in bone tissue are the resident osteocytes and osteoblasts. To address the mechanisms of strain-related responses in osteoblast-like cells, our group uses both in vivo and in vitro approaches, including a system of four-point bending of the substrate on which cells are cultured. A range of cell lines can be studied using this system but we routinely compare their responses to those in primary cultures of osteoblast-like cells derived from explants of mouse long bones. These cells show a range of well-characterized responses to physiological levels of strain, including increased proliferation, which in vivo is a feature of the osteogenic response.
ALS-associated mutation SOD1G93A leads to abnormal mitochondrial dynamics in osteocytes.
Wang, Huan; Yi, Jianxun; Li, Xuejun; Xiao, Yajuan; Dhakal, Kamal; Zhou, Jingsong
2018-01-01
While the death of motor neuron is a pathological hallmark of amyotrophic lateral sclerosis (ALS), defects in other cell types or organs may also actively contribute to ALS disease progression. ALS patients experience progressive skeletal muscle wasting that may not only exacerbate neuronal degeneration, but likely has a significant impact on bone function. In our previous published study, we have discovered severe bone loss in an ALS mouse model with overexpression of ALS-associated mutation SOD1 G93A (G93A). Here we further provide a mechanistic understanding of the bone loss in ALS animal and cellular models. Combining mitochondrial fluorescent indicators and confocal live cell imaging, we discovered abnormalities in mitochondrial network and dynamics in primary osteocytes derived from the same ALS mouse model G93A. Those mitochondrial defects occur in ALS mice after the onset of neuromuscular symptoms, indicating that mitochondria in bone cells respond to muscle atrophy during ALS disease progression. To examine whether ALS mutation has a direct contribution to mitochondrial dysfunction independent of muscle atrophy, we evaluated mitochondrial morphology and motility in cultured osteocytes (MLO-Y4) with overexpression of mitochondrial targeted SOD1 G93A . Compared with osteocytes overexpressing the wild type SOD1 as a control, the SOD1 G93A osteocytes showed similar defects in mitochondrial network and dynamic as that of the primary osteocytes derived from the ALS mouse model. In addition, we further discovered that overexpression of SOD1 G93A enhanced the expression level of dynamin-related protein 1 (Drp1), a key protein promoting mitochondrial fission activity, and reduced the expression level of optic atrophy protein 1 (OPA1), a key protein related to mitochondrial fusion. A specific mitochondrial fission inhibitor (Mdivi-1) partially reversed the effect of SOD1 G93A on mitochondrial network and dynamics, indicating that SOD1 G93A likely promotes mitochondrial fission, but suppresses the fusion activity. Our data provide the first evidence that mitochondria show abnormality in osteocytes derived from an ALS mouse model. The accumulation of mutant SOD1 G93A protein inside mitochondria directly causes dysfunction in mitochondrial dynamics in cultured MLO-Y4 osteocytes. In addition, the ALS mutation SOD1 G93A -mediated dysfunction in mitochondrial dynamics is associated with an enhanced apoptosis in osteocytes, which could be a potential mechanism underlying the bone loss during ALS progression. Copyright © 2017 Elsevier Inc. All rights reserved.
Frara, Nagat; Abdelmagid, Samir M; Sondag, Gregory R; Moussa, Fouad M; Yingling, Vanessa R; Owen, Thomas A; Popoff, Steven N; Barbe, Mary F; Safadi, Fayez F
2016-01-01
Initial identification of osteoactivin (OA)/glycoprotein non-melanoma clone B (gpnmb) was demonstrated in an osteopetrotic rat model, where OA expression was increased threefold in mutant bones, compared to normal. OA mRNA and protein expression increase during active bone regeneration post-fracture, and primary rat osteoblasts show increased OA expression during differentiation in vitro. To further examine OA/gpnmb as an osteoinductive agent, we characterized the skeletal phenotype of transgenic mouse overexpressing OA/gpnmb under the CMV-promoter (OA-Tg). Western blot analysis showed increased OA/gpnmb in OA-Tg osteoblasts, compared to wild-type (WT). In OA-Tg mouse femurs versus WT littermates, micro-CT analysis showed increased trabecular bone volume and thickness, and cortical bone thickness; histomorphometry showed increased osteoblast numbers, bone formation and mineral apposition rates in OA-Tg mice; and biomechanical testing showed higher peak moment and stiffness. Given that OA/gpnmb is also over-expressed in osteoclasts in OA-Tg mice, we evaluated bone resorption by ELISA and histomorphometry, and observed decreased serum CTX-1 and RANK-L, and decreased osteoclast numbers in OA-Tg, compared to WT mice, indicating decreased bone remodeling in OA-Tg mice. The proliferation rate of OA-Tg osteoblasts in vitro was higher, compared to WT, as was alkaline phosphatase staining and activity, the latter indicating enhanced differentiation of OA-Tg osteoprogenitors. Quantitative RT-PCR analysis showed increased TGF-β1 and TGF-β receptors I and II expression in OA-Tg osteoblasts, compared to WT. Together, these data suggest that OA overexpression has an osteoinductive effect on bone mass in vivo and stimulates osteoprogenitor differentiation ex vivo. © 2015 Wiley Periodicals, Inc.
Monomethylarsonous acid (MMA+3) Inhibits IL-7 Signaling in Mouse Pre-B Cells
Ezeh, Peace C.; Xu, Huan; Lauer, Fredine T.; Liu, Ke Jian; Hudson, Laurie G.; Burchiel, Scott W.
2016-01-01
Our previously published data show that As+3 in vivo and in vitro, at very low concentrations, inhibits lymphoid, but not myeloid stem cell development in mouse bone marrow. We also showed that the As+3 metabolite, monomethylarsonous acid (MMA+3), was responsible for the observed pre-B cell toxicity caused by As+3. Interleukin-7 (IL-7) is the primary growth factor responsible for pre-lymphoid development in mouse and human bone marrow, and Signal Transducer and Activator of Transcription 5 (STAT5) is a transcriptional factor in the IL-7 signaling pathway. We found that MMA+3 inhibited STAT5 phosphorylation at a concentration as low as 50 nM in mouse bone marrow pre-B cells. Inhibition of STAT5 phosphorylation by As+3 occurred only at a concentration of 500 nM. In the IL-7 dependent mouse pre-B 2E8 cell line, we also found selective inhibition of STAT5 phosphorylation by MMA+3, and this inhibition was dependent on effects on JAK3 phosphorylation. IL-7 receptor expression on 2E8 cell surface was also suppressed by 50 nM MMA+3 at 18 h. As further evidence for the inhibition of STAT5, we found that the induction of several genes required in B cell development, cyclin D1, E2A, EBF1, and PAX5, were selectively inhibited by MMA+3. Since 2E8 cells lack the enzymes responsible for the conversion of As+3 to MMA+3 in vitro, the results of these studies suggest that As+3 induced inhibition of pre-B cell formation in vivo is likely dependent on the formation of MMA+3 which in turn inhibits IL-7 signaling at several steps in mouse pre-B cells. PMID:26518055
Biomechanical properties of bone in a mouse model of Rett syndrome
Kamal, Bushra; Russell, David; Payne, Anthony; Constante, Diogo; Tanner, K. Elizabeth; Isaksson, Hanna; Mathavan, Neashan; Cobb, Stuart R.
2015-01-01
Rett syndrome (RTT) is an X-linked genetic disorder and a major cause of intellectual disability in girls. Mutations in the methyl-CpG binding protein 2 (MECP2) gene are the primary cause of the disorder. Despite the dominant neurological phenotypes, MECP2 is expressed ubiquitously throughout the body and a number of peripheral phenotypes such as scoliosis, reduced bone mineral density and skeletal fractures are also common and important clinical features of the disorder. In order to explore whether MeCP2 protein deficiency results in altered structural and functional properties of bone and to test the potential reversibility of any defects, we have conducted a series of histological, imaging and biomechanical tests of bone in a functional knockout mouse model of RTT. Both hemizygous Mecp2stop/y male mice in which Mecp2 is silenced in all cells and female Mecp2stop/+ mice in which Mecp2 is silenced in ~ 50% of cells as a consequence of random X-chromosome inactivation, revealed significant reductions in cortical bone stiffness, microhardness and tensile modulus. Microstructural analysis also revealed alterations in both cortical and cancellous femoral bone between wild-type and MeCP2-deficient mice. Furthermore, unsilencing of Mecp2 in adult mice cre-mediated stop cassette deletion resulted in a restoration of biomechanical properties (stiffness, microhardness) towards wild-type levels. These results show that MeCP2-deficiency results in overt, but potentially reversible, alterations in the biomechanical integrity of bone and highlights the importance of targeting skeletal phenotypes in considering the development of pharmacological and gene-based therapies. PMID:25445449
Gou, Shanmiao; Liu, Tao; Li, Xiangsheng; Cui, Jing; Wan, Chidan; Wang, Chunyou
2012-01-01
Bone marrow-derived mesenchymal stem cells (bMSCs) contribute to tissue repair and regeneration. Cell fusion between somatic cells and bMSCs to form hybrid cells may have an important role in tissue repair through the subsequent reprogramming of the somatic cell nucleus. Few studies have assessed the mesenchymal characteristics of fusion-induced hybrid cells and their survival mechanisms. In this study, we investigated the effect of cell fusion on the biological characteristics of pancreatic ductal cells (PDCs) and on the survival mechanism of hybrid cells. To this end, we generated mouse-mouse hybrid cells in vitro by polyethylene glycol-mediated fusion of primary mouse bMSCs with primary mouse PDCs. Hybrid cells showed an enhanced capacity for proliferation and self-renewal compared with PDCs. No PDC had the capacity for anchorage-independent growth or invasion into Matrigel, but some hybrid cells were able to form colonies in soft agar and invade Matrigel. Expression of the tumor suppressor protein p53, which initiates apoptosis, was detected in hybrid cells but not in PDCs or bMSCs. However, the p53 deacetylase, sirtuin 1 (SIRT1), was also detected in hybrid cells, and the level of acetylated p53, the active form, was low. The addition of nicotinamide (Nam) inhibited the deacetylation activity of SIRT1 on p53 and induced cell apoptosis in hybrid cells. This study demonstrated that PDCs could obtain high proliferation rates, self-renewal capabilities, and mesenchymal characteristics by fusion with bMSCs. SIRT1 expression in the hybrid cells attenuated their apoptosis. Copyright © 2012 S. Karger AG, Basel.
Lee, Edmund C; Fitzgerald, Michael; Bannerman, Bret; Donelan, Jill; Bano, Kristen; Terkelsen, Jennifer; Bradley, Daniel P; Subakan, Ozlem; Silva, Matthew D; Liu, Ray; Pickard, Michael; Li, Zhi; Tayber, Olga; Li, Ping; Hales, Paul; Carsillo, Mary; Neppalli, Vishala T; Berger, Allison J; Kupperman, Erik; Manfredi, Mark; Bolen, Joseph B; Van Ness, Brian; Janz, Siegfried
2011-12-01
The clinical success of the first-in-class proteasome inhibitor bortezomib (VELCADE) has validated the proteasome as a therapeutic target for treating human cancers. MLN9708 is an investigational proteasome inhibitor that, compared with bortezomib, has improved pharmacokinetics, pharmacodynamics, and antitumor activity in preclinical studies. Here, we focused on evaluating the in vivo activity of MLN2238 (the biologically active form of MLN9708) in a variety of mouse models of hematologic malignancies, including tumor xenograft models derived from a human lymphoma cell line and primary human lymphoma tissue, and genetically engineered mouse (GEM) models of plasma cell malignancies (PCM). Both cell line-derived OCI-Ly10 and primary human lymphoma-derived PHTX22L xenograft models of diffuse large B-cell lymphoma were used to evaluate the pharmacodynamics and antitumor effects of MLN2238 and bortezomib. The iMyc(Cα)/Bcl-X(L) GEM model was used to assess their effects on de novo PCM and overall survival. The newly developed DP54-Luc-disseminated model of iMyc(Cα)/Bcl-X(L) was used to determine antitumor activity and effects on osteolytic bone disease. MLN2238 has an improved pharmacodynamic profile and antitumor activity compared with bortezomib in both OCI-Ly10 and PHTX22L models. Although both MLN2238 and bortezomib prolonged overall survival, reduced splenomegaly, and attenuated IgG2a levels in the iMyc(Cα)/Bcl-X(L) GEM model, only MLN2238 alleviated osteolytic bone disease in the DP54-Luc model. Our results clearly showed the antitumor activity of MLN2238 in a variety of mouse models of B-cell lymphoma and PCM, supporting its clinical development. MLN9708 is being evaluated in multiple phase I and I/II trials. ©2011 AACR.
Tominari, Tsukasa; Ichimaru, Ryota; Yoshinouchi, Shosei; Matsumoto, Chiho; Watanabe, Kenta; Hirata, Michiko; Grundler, Florian M W; Inada, Masaki; Miyaura, Chisato
2017-12-01
(-)-Epigallocatechin-3- O -gallate (EGCG), present in green tea, exhibits antioxidant and antiallergy effects. EGCG3″Me, a 3- O -methylated derivative of EGCG, has been reported to show similar biological functions; the inhibitory activity of EGCG3″Me in a mouse allergy model was more potent than that of EGCG, probably due to the efficiency of absorption from the intestine. However, the functional potency of these EGCGs is controversial in each disease model. We previously observed that EGCG suppressed inflammatory bone resorption and prevented alveolar bone loss in a mouse model of periodontosis. In this study, we examined the role of EGCG3″Me in bone resorption using a mouse model of periodontitis. Lipopolysaccharide (LPS)-induced osteoclast formation was suppressed by adding EGCG3″Me to cocultures of osteoblasts and bone marrow cells, and LPS-induced bone resorption was also inhibited by EGCG3″Me in calvarial organ cultures. EGCG3″Me acted on osteoblasts and suppressed prostaglandin E (PGE) production, which is critical for inflammatory bone resorption, by inhibiting the expression of COX-2 and mPGES-1, key enzymes for PGE synthesis. In osteoclast precursor macrophages, EGCG3″Me suppressed RANKL-dependent differentiation into mature osteoclasts. In a mouse model of periodontitis, LPS-induced bone resorption was suppressed by EGCG3″Me in organ culture of mouse alveolar bone, and the alveolar bone loss was further attenuated by the treatment of EGCG3″Me in the lower gingiva in vivo . EGCG3″Me may be a potential natural compound for the protection of inflammatory bone loss in periodontitis.
Development, validation and characterization of a novel mouse model of Adynamic Bone Disease (ABD).
Ng, Adeline H; Willett, Thomas L; Alman, Benjamin A; Grynpas, Marc D
2014-11-01
The etiology of Adynamic Bone Disease (ABD) is poorly understood but the hallmark of ABD is a lack of bone turnover. ABD occurs in renal osteodystrophy (ROD) and is suspected to occur in elderly patients on long-term anti-resorptive therapy. A major clinical concern of ABD is diminished bone quality and an increased fracture risk. To our knowledge, experimental animal models for ABD other than ROD-ABD have not been developed or studied. The objectives of this study were to develop a mouse model of ABD without the complications of renal ablation, and to characterize changes in bone quality in ABD relative to controls. To re-create the adynamic bone condition, 4-month old female Col2.3Δtk mice were treated with ganciclovir to specifically ablate osteoblasts, and pamidronate was used to inhibit osteoclastic resorption. Four groups of animals were used to characterize bone quality in ABD: Normal bone controls, No Formation controls, No Resorption controls, and an Adynamic group. After a 6-week treatment period, the animals were sacrificed and the bones were harvested for analyses. Bone quality assessments were conducted using established techniques including bone histology, quantitative backscattered electron imaging (qBEI), dual energy X-ray absorptiometry (DXA), microcomputed tomography (microCT), and biomechanical testing. Histomorphometry confirmed osteoblast-related hallmarks of ABD in our mouse model. Bone formation was near complete suppression in the No Formation and Adynamic specimens. Inhibition of bone resorption in the Adynamic group was confirmed by tartrate-resistant acid phosphatase (TRAP) stain. Normal bone mineral density and architecture were maintained in the Adynamic group, whereas the No Formation group showed a reduction in bone mineral content and trabecular thickness relative to the Adynamic group. As expected, the No Formation group had a more hypomineralized profile and the Adynamic group had a higher mean mineralization profile that is similar to suppressed bone turnover in human. This data confirms successful replication of the adynamic bone condition in a mouse without the complication of renal ablation. Our approach is the first model of ABD that uses pharmacological manipulation in a transgenic mouse to mimic the bone cellular dynamics observed in the human ABD condition. We plan to use our mouse model to investigate the adynamic bone condition in aging and to study changes to bone quality and fracture risk as a consequence of over-suppressed bone turnover. Copyright © 2014 Elsevier Inc. All rights reserved.
Absence of ERRα in Female Mice Confers Resistance to Bone Loss Induced by Age or Estrogen-Deficiency
Rabier, Bénédicte; Monfoulet, Laurent; Dine, Julien; Macari, Claire; Espallergues, Julie; Horard, Béatrice; Giguère, Vincent; Cohen-Solal, Martine; Chassande, Olivier; Vanacker, Jean-Marc
2009-01-01
Background ERRα is an orphan member of the nuclear hormone receptor superfamily, which acts as a transcription factor and is involved in various metabolic processes. ERRα is also highly expressed in ossification zones during mouse development as well as in human bones and cell lines. Previous data have shown that this receptor up-modulates the expression of osteopontin, which acts as an inhibitor of bone mineralization and whose absence results in resistance to ovariectomy-induced bone loss. Altogether this suggests that ERRα may negatively regulate bone mass and could impact on bone fragility that occurs in the absence of estrogens. Methods/Principal Findings In this report, we have determined the in vivo effect of ERRα on bone, using knock-out mice. Relative to wild type animals, female ERRαKO bones do not age and are resistant to bone loss induced by estrogen-withdrawal. Strikingly male ERRαKO mice are indistinguishable from their wild type counterparts, both at the unchallenged or gonadectomized state. Using primary cell cultures originating from ERRαKO bone marrow, we also show that ERRα acts as an inhibitor of osteoblast differentiation. Conclusion/Significance Down-regulating ERRα could thus be beneficial against osteoporosis. PMID:19936213
Al Mamun, Md Abdullah; Hosen, Mohammad Jakir; Khatun, Amina; Alam, M Masihul; Al-Bari, Md Abdul Alim
2017-09-08
The Tridax procumbens extracts (TPE) are known for their ethno-medicinal properties to increase osteogenic functioning in mesenchymal stem cells. Recently, we found that the T. procumbens flavonoids (TPF) significantly suppressed the RANKL-induced osteoclasts differentiation and bone resorption. The TPF also promoted osteoblasts differentiation and bone formation demonstrated by increasing bone formation markers in cultured mouse primary osteoblasts. However, the effects of the TPF on in vivo bone formation remain unclear. In this study, we investigated the effects of the TPF on in vivo bone formation, injected the TPF (20 mg/kg) twice a day in the low calcium diet mice and killed them after 21 day. Radiographic and histomorphometric analyses were performed on the dissected bones to determine the anabolic effects of the TPF. Bone mineral density and bone mineral content of the TPF-treated mice were significantly increased compared to the control mice. Bone formation-related indices like osteoblast number, osteoblast surface, bone volume, mineralizing surface, mineral apposition rate and bone formation rate were significantly increased in the TPF-treated mice compared to the control mice. Our findings point towards the stimulation of bone formation by TPF, suggested that the TPF could be a potential natural anabolic agent to treat patients with bone loss-associated diseases such as osteoporosis.
Li, Xiaofeng; Xue, Chunchun; Wang, Libo; Tang, Dezhi; Huang, Jian; Zhao, Yongjian; Chen, Yan; Zhao, Dongfeng; Shi, Qi; Wang, Yongjun; Shu, Bing
2016-10-01
The present study aimed to investigate the effects of osthole on osteoclast formation and bone loss in a mouse model of 5/6 nephrectomy. The mice in control and osthole groups were treated 1 month following 5/6 nephrectomy with either a placebo or osthole, respectively. At 2 months post‑nephrectomy, the L4 vertebrae were harvested. The bone mineral density (BMD) of cancellous bone was measured using micro‑CT and tartrate‑resistant acid phosphatase (TRAP) staining was performed to evaluate osteoclast formation. Immunohistochemistry staining and reverse transcription‑quantitative polymerase chain reaction were performed to detect the expression of nuclear factor of activated T‑cells, cytoplasmic‑1 (NFATc‑1), c‑Fos, cathepsin K, Trap, matrix metalloproteinase 9 (Mmp9), osteoprotegerin (Opg) and receptor activator for nuclear factor‑κB ligand (Rankl). Bone marrow cells were cultured with osthole, and osteoclast formation was shown by TRAP staining. Primary calvaria osteoblasts were cultured with osthole, and expression levels of Opg and Rankl were detected. Compared with the sham group, the BMD of mice in model group was significantly reduced. The numbers of osteoclasts and the expression levels of NFATc‑1, c‑Fos, cathepsin K and Mmp9 were significantly increased. Compared with the control group, the mice in the osthole group exhibited increased BMD of the L4 vertebrae, a reduction in osteoclast numbers and decreased expression levels of NFATc‑1, c‑Fos, cathepsin K and Mmp9. In vitro experiments also showed that osteoclast formation was decreased following treatment with osthole. Osteoprotegerin (Opg)/receptor activator for nuclear factor‑κB ligand (Rankl) was upregulated by osthole treatment in the L4 vertebrae and in primary cultures of calvarial osteoblasts. Osthole inhibited osteoclast formation and partially reversed the bone loss induced by 5/6 nephrectomy in mice through the upregulation of OPG/RANKL.
Ramcharan, M A; Faillace, M E; Guengerich, Z; Williams, V A; Jepsen, K J
2017-03-01
How cortical and trabecular bone co-develop to establish a mechanically functional structure is not well understood. Comparing early postnatal differences in morphology of lumbar vertebral bodies for three inbred mouse strains identified coordinated changes within and between cortical and trabecular traits. These early coordinate changes defined the phenotypic differences among the inbred mouse strains. Age-related changes in cortical and trabecular traits have been well studied; however, very little is known about how these bone tissues co-develop from day 1 of postnatal growth to establish functional structures by adulthood. In this study, we aimed to establish how cortical and trabecular tissues within the lumbar vertebral body change during growth for three inbred mouse strains that express wide variation in adult bone structure and function. Bone traits were quantified for lumbar vertebral bodies of female A/J, C57BL/6J (B6), and C3H/HeJ (C3H) inbred mouse strains from 1 to 105 days of age (n = 6-10 mice/age/strain). Inter-strain differences in external bone size were observed as early as 1 day of age. Reciprocal and rapid changes in the trabecular bone volume fraction and alignment in the direction of axial compression were observed by 7 days of age. Importantly, the inter-strain difference in adult trabecular bone volume fraction was established by 7 days of age. Early variation in external bone size and trabecular architecture was followed by progressive increases in cortical area between 28 and 105 days of age, with the greatest increases in cortical area seen in the mouse strain with the lowest trabecular mass. Establishing the temporal changes in bone morphology for three inbred mouse strains revealed that genetic variation in adult trabecular traits were established early in postnatal development. Early variation in trabecular architecture preceded strain-specific increases in cortical area and changes in cortical thickness. This study established the sequence of how cortical and trabecular traits co-develop during growth, which is important for identifying critical early ages to further focus on intervention studies that optimize adult bone strength.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoner, R.D.; Bond, V.P.
1963-01-14
Immunological competence of immunized mouse bone marrow, spleen, lymph node, and thymus cells was demonstrated when specific recall tetanus antitoxin responses were elicited after transfer of these cells to isologous irradiated mice or rats. Lesser amounts of antibody were obtained as the genetic strain distance was increased between the relation of donor and host in the parental to F/sub 1/ and in the homologous combination within the same species. It was not possible in the heterologous situation to elicit significant amounts of antibody from rat bone marrow and other lymphoid cells following their transplantation into irradiated mice. Minimal but notmore » significant antibody responses were elicited from cells obtained from immunized rat spleen and thymus tissue. In a few experiments, it was possible to elicit antibody formation from a buffy coat suspension of circulating white cells following their transfer to irradiated recipients. Isologous nonimmunized bone marrow did not stimulate or hasten recovery of the ability to eiicit secondary antibody responses in previously immunized irradiated mice. The capacity to elicit primary antibody responses to tetanus toxoid was depressed in parental-bone-marrow-protected F/sub 1/ mice when these chimeras exhibited varying degrees of secondary disease. The depression of primary antibody responses in irradiated F/sub 1/ mice given parental bone marrow provides evidence for a donor mediated immunological depression of antibody synthesis by host-lymphoid tissues. (auth)« less
Polycythemia is associated with bone loss and reduced osteoblast activity in mice.
Oikonomidou, P R; Casu, C; Yang, Z; Crielaard, B; Shim, J H; Rivella, S; Vogiatzi, M G
2016-04-01
Increased fragility has been described in humans with polycythemia vera (PV). Herein, we describe an osteoporotic phenotype associated with decreased osteoblast activity in a mouse model of PV and another mouse of polycythemia and elevated circulating erythropoietin (EPO). Our results are important for patients with PV or those treated with recombinant EPO (rEPO). PV and other myeloproliferative syndromes have been recently associated with an increased risk for fractures. However, the presence of osteoporosis in these patients has not been well documented. EPO, a hormone primarily known to stimulate erythropoiesis, has been shown recently to regulate bone homeostasis in mice. The aim of this study was to examine the bone phenotype of a mouse model of PV and compare it to that of animals with polycythemia caused by elevated circulating EPO. Bone mass and remodeling were evaluated by micro-computed tomography and histomorphometry. The JAK2(V617F) knock-in mouse, a model of human PV, manifests polycythemia and low circulating EPO levels. Results from this mouse were compared to wild type (wt) controls and the tg6 transgenic mouse that shows polycythemia caused by increased constitutive expression of EPO. Compared to wt, both JAK2(V617F) and tg6 mice had a decrease in trabecular bone mass. Tg6 mice showed an additional modest decrease in cortical thickness and cortical bone volume per tissue volume (P < 0.01) suggesting a more severe bone phenotype than JAK2(V617F). Decreased osteoblast numbers and bone formation along with normal osteoclast numbers and activity were found in both mice. This study indicates that PV is associated with low bone mass and decreased osteoblast activity in mice. Our results support future studies of osteoporosis in affected humans. Polycythemia caused by chronically elevated circulating EPO also results in bone loss, and implications on patients treated with rEPO should be evaluated.
Biomechanical properties of bone in a mouse model of Rett syndrome.
Kamal, Bushra; Russell, David; Payne, Anthony; Constante, Diogo; Tanner, K Elizabeth; Isaksson, Hanna; Mathavan, Neashan; Cobb, Stuart R
2015-02-01
Rett syndrome (RTT) is an X-linked genetic disorder and a major cause of intellectual disability in girls. Mutations in the methyl-CpG binding protein 2 (MECP2) gene are the primary cause of the disorder. Despite the dominant neurological phenotypes, MECP2 is expressed ubiquitously throughout the body and a number of peripheral phenotypes such as scoliosis, reduced bone mineral density and skeletal fractures are also common and important clinical features of the disorder. In order to explore whether MeCP2 protein deficiency results in altered structural and functional properties of bone and to test the potential reversibility of any defects, we have conducted a series of histological, imaging and biomechanical tests of bone in a functional knockout mouse model of RTT. Both hemizygous Mecp2(stop/y) male mice in which Mecp2 is silenced in all cells and female Mecp2(stop/+) mice in which Mecp2 is silenced in ~50% of cells as a consequence of random X-chromosome inactivation, revealed significant reductions in cortical bone stiffness, microhardness and tensile modulus. Microstructural analysis also revealed alterations in both cortical and cancellous femoral bone between wild-type and MeCP2-deficient mice. Furthermore, unsilencing of Mecp2 in adult mice cre-mediated stop cassette deletion resulted in a restoration of biomechanical properties (stiffness, microhardness) towards wild-type levels. These results show that MeCP2-deficiency results in overt, but potentially reversible, alterations in the biomechanical integrity of bone and highlights the importance of targeting skeletal phenotypes in considering the development of pharmacological and gene-based therapies. Copyright © 2014. Published by Elsevier Inc.
Boregowda, Siddaraju; Krishnappa, Veena; Chambers, Jeremy; LoGrasso, Phillip V.; Lai, Wen-Tzu; Ortiz, Luis A.; Phinney, Donald G.
2013-01-01
Large scale expansion of human mesenchymal stem cells (MSCs) is routinely performed for clinical therapy. In contrast, developing protocols for large scale expansion of primary mouse MSCs has been more difficult due to unique aspects of rodent biology. Currently, established methods to isolate mouse MSCs select for rapidly dividing subpopulations that emerge from bone marrow cultures following long-term (months) expansion in atmospheric oxygen. Herein, we demonstrate that exposure to atmospheric oxygen rapidly induced p53, TOP2A and BAX expression and mitochondrial ROS generation in primary mouse MSCs resulting in oxidative stress, reduced cell viability and inhibition of cell proliferation. Alternatively, procurement and culture in 5% oxygen supported more prolific expansion of the CD45−ve/CD44+ve cell fraction in marrow, produced increased MSC yields following immuno-depletion, and supported sustained MSC growth resulting in a 2300-fold increase in cumulative cell yield by 4th passage. MSCs cultured in 5% oxygen also exhibited enhanced tri-lineage differentiation. The oxygen-induced stress response was dependent upon p53 since siRNA mediated knockdown of p53 in wild type cells or exposure of p53−/− MSCs to atmospheric oxygen failed to induce ROS generation, reduce viability, or arrest cell growth. These data indicate that long-term culture expansion of mouse MSCs in atmospheric oxygen selects for clones with absent or impaired p53 function, which allows cells to escape oxygen-induced growth inhibition. In contrast, expansion in 5% oxygen generates large numbers of primary mouse MSCs that retain sensitivity to atmospheric oxygen, and therefore a functional p53 protein, even after long-term expansion in vitro. PMID:22367737
The Relevance of Mouse Models for Investigating Age-Related Bone Loss in Humans
2013-01-01
Mice are increasingly used for investigation of the pathophysiology of osteoporosis because their genome is easily manipulated, and their skeleton is similar to that of humans. Unlike the human skeleton, however, the murine skeleton continues to grow slowly after puberty and lacks osteonal remodeling of cortical bone. Yet, like humans, mice exhibit loss of cancellous bone, thinning of cortical bone, and increased cortical porosity with advancing age. Histologic evidence in mice and humans alike indicates that inadequate osteoblast-mediated refilling of resorption cavities created during bone remodeling is responsible. Mouse models of progeria also show bone loss and skeletal defects associated with senescence of early osteoblast progenitors. Additionally, mouse models of atherosclerosis, which often occurs in osteoporotic participants, also suffer bone loss, suggesting that common diseases of aging share pathophysiological pathways. Knowledge of the causes of skeletal fragility in mice should therefore be applicable to humans if inherent limitations are recognized. PMID:23689830
Delta-Tocotrienol: Radiation Protection and Effects on Signal Transduction Pathways
2011-06-15
Delta- Tocotrienol : Radiation Protection and Effects on Signal Transduction Pathways Venkataraman Srinivasan, PhD Mang Xiao, MD Principal...2011 2. REPORT TYPE 3. DATES COVERED 00-00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Delta- Tocotrienol : Radiation Protection And Effects On...Mechanisms? 17 Survival of γ-irradiated mouse bone marrow and primary human hematopoietic CD34+ cells was significantly enhanced by Delta- tocotrienol (DT3
Rowan, Daniel J.; Tomatsu, Shunji; Grubb, Jeffrey H.; Montaño, Adriana M.; Sly, William S.
2012-01-01
Summary Mucopolysaccharidoses (MPS) are a group of lysosomal storage diseases caused by mutations in lysosomal enzymes involved in degradation of glycosaminoglycans (GAGs). Patients with MPS grow poorly and become physically disabled due to systemic bone disease. While many of the major skeletal effects in mouse models for MPS have been described, no detailed analysis that compares GAGs levels and characteristics of bone by micro-CT has been done. The aims of this study were to assess severity of bone dysplasia among four MPS mouse models (MPS I, IIIA, IVA and VII), to determine the relationship between severity of bone dysplasia and serum keratan sulfate (KS) and heparan sulfate (HS) levels in those models, and to explore the mechanism of KS elevation in MPS I, IIIA, and VII mouse models. Clinically, MPS VII mice had the most severe bone pathology; however, MPS I and IVA mice also showed skeletal pathology. MPS I and VII mice showed severe bone dysplasia, higher bone mineral density, narrowed spinal canal, and shorter sclerotic bones by micro-CT and radiographs. Serum KS and HS levels were elevated in MPS I, IIIA, and VII mice. Severity of skeletal disease displayed by micro-CT, radiographs and histopathology correlated with the level of KS elevation. We showed that elevated HS levels in MPS mouse models could inhibit N-acetylgalactosamine-6-sulfate sulfatase enzyme. These studies suggest that KS could be released from chondrocytes affected by accumulation of other GAGs and that KS could be useful as a biomarker for severity of bone dysplasia in MPS disorders. PMID:22971960
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Li-An; Department of Pediatric Dentistry, School of Stomatology, The Fourth Military Medical University, Xi-an; Yuan, Guohua
Generation of a floxed Bmp2/4 osteoblast cell line is a valuable tool for studying the modulatory effects of Bmp2 and Bmp4 on osteoblast differentiation as well as relevant molecular events. In this study, primary floxed Bmp2/4 mouse osteoblasts were cultured and transfected with simian virus 40 large T-antigen. Transfection was verified by polymerase chain reaction (PCR) and immunohistochemistry. To examine the characteristics of the transfected cells, morphology, proliferation and mineralization were analyzed, expression of cell-specific genes including Runx2, ATF4, Dlx3, Osx, dentin matrix protein 1, bone sialoprotein, osteopontin, osteocalcin, osteonectin and collagen type I was detected. These results show thatmore » transfected floxed Bmp2/4 osteoblasts bypassed senescence with a higher proliferation rate, but retain the genotypic and phenotypic characteristics similar to the primary cells. Thus, we for the first time demonstrate the establishment of an immortalized mouse floxed Bmp2/4 osteoblast cell line.« less
[Local injection of exogenous nerve growth factor improves early bone maturation of implants].
Yao, Yang; Du, Yu; Gu, Xia; Guang, Meng-Kai; Huang, Bo; Gong, Ping
2018-04-01
To investigate the effects of nerve growth factor (NGF) in the osteogenic action of implants and the maturation and reconstruction changes in bone tissues in the early stage of osseointegration. The mouse implant model was established by placing titanium in the femoral head of the mouse and locally injecting NGF in the implant zone. On 1, 2 and 4 weeks after operation, stain samples were collected from animals using hematoxylin-eosin (HE) staining and Masson staining. The effect of NGF on the bone maturation was compared at different time points of early stage osseointegration. The results of HE and Masson staining indicated that the local injection of external NGF can up-regulate bone mass, amount of bone trabecula, and bone maturity in the mouse model. The mature bone rate in treatment group of 1 week and 4 weeks after operation were significantly higher than those in the control group (P<0.05). NGF can shorten the period of bone maturation.
Gao, Jianjun; Tiwari-Pandey, Rashmi; Samadfam, Rana; Yang, Yinzhi; Miao, Dengshun; Karaplis, Andrew C; Sairam, M Ram; Goltzman, David
2007-06-01
Osteoporosis is a leading public health problem. Although a major cause in women is thought to be a decline in estrogen, it has recently been proposed that FSH or follitropin is required for osteoporotic bone loss. We examined the FSH receptor null mouse (FORKO mouse) to determine whether altered ovarian function could induce bone loss independent of FSH action. By 3 months of age, FORKO mice developed age-dependent declines in bone mineral density and trabecular bone volume of the lumbar spine and femur, which could be partly reversed by ovarian transplantation. Bilateral ovariectomy reduced elevated circulating testosterone levels in FORKO mice and decreased bone mass to levels indistinguishable from those in ovariectomized wild-type controls. Androgen receptor blockade and especially aromatase inhibition each produced bone volume reductions in the FORKO mouse. The results indicate that ovarian secretory products, notably estrogen, and peripheral conversion of ovarian androgen to estrogen can alter bone homeostasis independent of any bone resorptive action of FSH.
Engineering a humanized bone organ model in mice to study bone metastases.
Martine, Laure C; Holzapfel, Boris M; McGovern, Jacqui A; Wagner, Ferdinand; Quent, Verena M; Hesami, Parisa; Wunner, Felix M; Vaquette, Cedryck; De-Juan-Pardo, Elena M; Brown, Toby D; Nowlan, Bianca; Wu, Dan Jing; Hutmacher, Cosmo Orlando; Moi, Davide; Oussenko, Tatiana; Piccinini, Elia; Zandstra, Peter W; Mazzieri, Roberta; Lévesque, Jean-Pierre; Dalton, Paul D; Taubenberger, Anna V; Hutmacher, Dietmar W
2017-04-01
Current in vivo models for investigating human primary bone tumors and cancer metastasis to the bone rely on the injection of human cancer cells into the mouse skeleton. This approach does not mimic species-specific mechanisms occurring in human diseases and may preclude successful clinical translation. We have developed a protocol to engineer humanized bone within immunodeficient hosts, which can be adapted to study the interactions between human cancer cells and a humanized bone microenvironment in vivo. A researcher trained in the principles of tissue engineering will be able to execute the protocol and yield study results within 4-6 months. Additive biomanufactured scaffolds seeded and cultured with human bone-forming cells are implanted ectopically in combination with osteogenic factors into mice to generate a physiological bone 'organ', which is partially humanized. The model comprises human bone cells and secreted extracellular matrix (ECM); however, other components of the engineered tissue, such as the vasculature, are of murine origin. The model can be further humanized through the engraftment of human hematopoietic stem cells (HSCs) that can lead to human hematopoiesis within the murine host. The humanized organ bone model has been well characterized and validated and allows dissection of some of the mechanisms of the bone metastatic processes in prostate and breast cancer.
Age dependent regulation of bone-mass and renal function by the MEPE ASARM-motif
Zelenchuk, Lesya V; Hedge, Anne-Marie; Rowe, Peter S N
2015-01-01
Context Mice with null mutations in Matrix Extracellular Phosphoglycoprotein (MEPE) have increased bone mass, increased trabecular density and abnormal cancellous bone (MN-mice). These defects worsen with age and MEPE over expression induces opposite effects. Also, Genome Wide Association studies show MEPE plays a major role in bone mass. We hypothesized the conserved C-terminal MEPE ASARM-motif is chiefly responsible for regulating bone mass and trabecular structure. Design To test our theory we over expressed C-terminal ASARM-peptide in MN-mice using the Col1α1 promoter (MNAt-mice). We then compared the bone and renal phenotypes of the MNAt-mouse with the MN-mouse and the X-linked hypophosphatemic rickets mouse (HYP). The HYP mouse over expresses ASARM-peptides and is defective for the PHEX gene. Results The MN-mouse developed increased bone mass, bone strength and trabecular abnormalities that worsened markedly with age. Defects in bone formation were chiefly responsible with suppressed sclerostin and increased active β-catenin. Increased uric acid levels also suggested abnormalities in purine-metabolism and a reduced fractional excretion of uric acid signaled additional renal transport changes. The MN mouse developed a worsening hyperphosphatemia and reduced FGF23 with age. An increase in the fractional excretion of phosphate (FEP) despite the hyperphosphatemia confirms an imbalance in kidney-intestinal phosphate regulation. Also, the MN mice showed an increased creatinine clearance suggesting hyperfiltration. A reversal of the MN bone-renal phenotype changes occurred with the MNAt mice including the apparent hyperfiltration. The MNAt mice also developed localized hypomineralization, hypophosphatemia and increased FGF23. Conclusions The C-terminal ASARM-motif plays a major role in regulating bone–mass and cancellous structure as mice age. In healthy mice, the processing and release of free ASARM-peptide is chiefly responsible for preserving normal bone and renal function. Free ASARM-peptide also effects renal mineral phosphate handling by influencing FGF23 expression. These findings have implications for understanding age-dependent osteoporosis, unraveling drug-targets and developing treatments. PMID:26051469
Chung, Hwa-Jin; Kyung Kim, Won; Joo Park, Hyen; Cho, Lan; Kim, Me-Riong; Kim, Min Jeong; Shin, Joon-Shik; Ho Lee, Jin; Ha, In-Hyuk; Kook Lee, Sang
2016-02-17
Harpagide, an iridoid glucoside, is a constituent of the root of Harpagophytum procumbens var. sublobatum (Engl.) Stapf, Devil's claw which has been used in patients with osteoarthritis (OA). In the present study, we investigated the anti-osteoporotic potential of harpagide and its underlying mechanism of action in in vitro cell culture and in vivo bone loss animal models. Harpagide was obtained from the alkalic hydrolysis of harpagoside, a major constituent of H. procumbens var. sublobatum Analysis of biomarkers for bone formation in osteoblastic MC3T3-E1 cells and bone resorption in osteoclast cells derived from mouse bone marrow cells was performed to evaluate the mechanism of action. The protective activity of harpagide against bone loss was also evaluated in ovariectomized (OVX) mouse model. Harpagide improved bone properties by stimulating the process of differentiation and maturation of osteoblast cells and suppressing the process of RANKL-induced differentiation of osteoclast cells. In OVX-induced bone loss mouse model, oral administration of harpagide significantly improved recovery of bone mineral density, trabecular bone volume, and trabecular number in the femur. Harpagide also prevented increase of trabecular separation and structure model index induced by OVX. Harpagide effectively inhibited the serum levels of biochemical markers of bone loss, including alkaline phosphatase, osteocalcin, C-terminal telopeptide, and tartrate-resistant acid phosphatase. Taken together, the present study demonstrates that harpagide has a potential for prevention of bone loss in OVX mice by regulating the stimulation of osteoblast differentiation and the suppression of osteoclast formation. Therefore, these findings suggest that harpagide might serve as a bioactive compound derived from H. procumbens var. sublobatum for improvement of age-dependent bone destruction disease. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Weivoda, Megan M; Ruan, Ming; Pederson, Larry; Hachfeld, Christine; Davey, Rachel A; Zajac, Jeffrey D; Westendorf, Jennifer J; Khosla, Sundeep; Oursler, Merry Jo
2016-01-01
Osteoblast-mediated bone formation is coupled to osteoclast-mediated bone resorption. These processes become uncoupled with age, leading to increased risk for debilitating fractures. Therefore, understanding how osteoblasts are recruited to sites of resorption is vital to treating age-related bone loss. Osteoclasts release and activate TGF-β from the bone matrix. Here we show that osteoclastspecific inhibition of TGF-β receptor signaling in mice results in osteopenia due to reduced osteoblast numbers with no significant impact on osteoclast numbers or activity. TGF-β induced osteoclast expression of Wnt1, a protein crucial to normal bone formation, and this response was blocked by impaired TGF-β receptor signaling. Osteoclasts in aged murine bones had lower TGF-β signaling and Wnt1 expression in vivo. Ex vivo stimulation of osteoclasts derived from young or old mouse bone marrow macrophages showed no difference in TGF-β–induced Wnt1 expression. However, young osteoclasts expressed reduced Wnt1 when cultured on aged mouse bone chips compared to young mouse bone chips, consistent with decreased skeletal TGF-β availability with age. Therefore, osteoclast responses to TGF-β are essential for coupling bone resorption to bone formation, and modulating this pathway may provide opportunities to treat age-related bone loss. PMID:26108893
Monomethylarsonous acid (MMA+3) Inhibits IL-7 Signaling in Mouse Pre-B Cells.
Ezeh, Peace C; Xu, Huan; Lauer, Fredine T; Liu, Ke Jian; Hudson, Laurie G; Burchiel, Scott W
2016-02-01
Our previously published data show that As(+3) in vivo and in vitro, at very low concentrations, inhibits lymphoid, but not myeloid stem cell development in mouse bone marrow. We also showed that the As(+3) metabolite, monomethylarsonous acid (MMA(+3)), was responsible for the observed pre-B cell toxicity caused by As(+3). Interleukin-7 (IL-7) is the primary growth factor responsible for pre-lymphoid development in mouse and human bone marrow, and Signal Transducer and Activator of Transcription 5 (STAT5) is a transcriptional factor in the IL-7 signaling pathway. We found that MMA(+3) inhibited STAT5 phosphorylation at a concentration as low as 50 nM in mouse bone marrow pre-B cells. Inhibition of STAT5 phosphorylation by As(+3) occurred only at a concentration of 500 nM. In the IL-7 dependent mouse pre-B 2E8 cell line, we also found selective inhibition of STAT5 phosphorylation by MMA(+3), and this inhibition was dependent on effects on JAK3 phosphorylation. IL-7 receptor expression on 2E8 cell surface was also suppressed by 50 nM MMA(+3) at 18 h. As further evidence for the inhibition of STAT5, we found that the induction of several genes required in B cell development, cyclin D1, E2A, EBF1, and PAX5, were selectively inhibited by MMA(+3). Since 2E8 cells lack the enzymes responsible for the conversion of As(+3) to MMA(+3) in vitro, the results of these studies suggest that As(+3) induced inhibition of pre-B cell formation in vivo is likely dependent on the formation of MMA(+3) which in turn inhibits IL-7 signaling at several steps in mouse pre-B cells. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Alvarez, Marta B; Childress, Paul; Philip, Binu K; Gerard-O'Riley, Rita; Hanlon, Michael; Herbert, Brittney-Shea; Robling, Alexander G; Pavalko, Fredrick M; Bidwell, Joseph P
2012-05-01
Intermittent parathyroid hormone (PTH) adds new bone to the osteoporotic skeleton; the transcription factor Nmp4/CIZ represses PTH-induced bone formation in mice and as a consequence is a potential drug target for improving hormone clinical efficacy. To explore the impact of Nmp4/CIZ on osteoblast phenotype, we immortalized bone marrow stromal cells from wildtype (WT) and Nmp4-knockout (KO) mice using murine telomerase reverse transcriptase. Clonal lines were initially chosen based on their positive staining for alkaline phosphatase and capacity for mineralization. Disabling Nmp4/CIZ had no gross impact on osteoblast phenotype development. WT and KO clones exhibited identical sustained growth, reduced population doubling times, extended maintenance of the mature osteoblast phenotype, and competency for differentiating toward the osteoblast and adipocyte lineages. Additional screening of the immortalized cells for PTH-responsiveness permitted further studies with single WT and KO clones. We recently demonstrated that PTH-induced c-fos femoral mRNA expression is enhanced in Nmp4-KO mice and in the present study we observed that hormone stimulated either an equivalent or modestly enhanced increase in c-fos mRNA expression in both primary null and KO clone cells depending on PTH concentration. The null primary osteoblasts and KO clone cells exhibited a transiently enhanced response to bone morphogenetic protein 2 (BMP2). The clones exhibited lower and higher expressions of the PTH receptor (Pthr1) and the BMP2 receptor (Bmpr1a, Alk3), respectively, as compared to primary cells. These immortalized cell lines will provide a valuable tool for disentangling the complex functional roles underlying Nmp4/CIZ regulation of bone anabolism. Copyright © 2011 Wiley Periodicals, Inc.
Ohba, Seigo; Sumita, Yoshinori; Umebayashi, Mayumi; Yoshimura, Hitoshi; Yoshida, Hisato; Matsuda, Shinpei; Kimura, Hideki; Asahina, Izumi; Sano, Kazuo
2016-01-01
The aim of this study was to assess newly formed onlay bone on mouse calvarial bone using a new artificial bone material, a hydroxyapatite/collagen composite, with total blood or platelet-rich plasma. The hydroxyapatite/collagen composite material with normal saline, total blood or platelet-rich plasma was transplanted on mouse calvarial bone. The mice were sacrificed and the specimens were harvested four weeks after surgery. The newly formed bone area was measured on hematoxylin and eosin stained specimens using Image J software. The hydroxyapatite/collagen composite materials with total blood or platelet-rich plasma induced a significantly greater amount of newly formed bone than that with normal saline. Moreover, bone marrow was observed four weeks after surgery in the transplanted materials with total blood or platelet-rich plasma but not with normal saline. However, there were no significant differences in the amount of newly formed bone between materials used with total blood versus platelet-rich plasma. The hydroxyapatite/collagen composite material was valid for onlay bone augmentation and this material should be soaked in total blood or platelet-rich plasma prior to transplantation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Wahnschaffe, U; Bitsch, A; Kielhorn, J; Mangelsdorf, I
2005-01-01
As part of a larger literature study on transgenic animals in mutagenicity testing, test results from the transgenic mutagenicity assays (lacI model; commercially available as the Big Blue® mouse, and the lacZ model; commercially available as the Muta™Mouse), were compared with the results on the same substances in the more traditional mouse bone marrow micronucleus test. 39 substances were found which had been tested in the micronucleus assay and in the above transgenic mouse systems. Although, the transgenic animal mutation assay is not directly comparable with the micronucleus test, because different genetic endpoints are examined: chromosome aberration versus gene mutation, the results for the majority of substances were in agreement. Both test systems, the transgenic mouse assay and the mouse bone marrow micronucleus test, have advantages and they complement each other. However, the transgenic animal assay has some distinct advantages over the micronucleus test: it is not restricted to one target organ and detects systemic as well as local mutagenic effects. PMID:15655069
Anatomical Variation of the Tarsus in Common Inbred Mouse Strains.
Richbourg, Heather A; Martin, Matthew J; Schachner, Emma R; McNulty, Margaret A
2017-03-01
Rodent models are used for a variety of orthopedic research applications; however, anatomy references include mostly artistic representations. Advanced imaging techniques, including micro-computed tomography (microCT), can provide more accurate representations of subtle anatomical characteristics. A recent microCT atlas of laboratory mouse (Mus musculus) anatomy depicts the central and tarsal bone III (T3) as a single bone, differing from previous references. Fusion of tarsal bones is generally characterized as pathological secondary to mutations associated with growth factors, and normal variation has not been documented in the mouse tarsus. Therefore, it is unclear if this fusion is a normal or a pathological characteristic. The aim of this study is to characterize the tarsus of the laboratory mouse and compare it to the rat and selected outgroup species (i.e., white-footed mouse) via microCT and histology to determine if the central and T3 are separate or fused into a single bone. Laboratory mice (C57/Bl6 [n = 17] and BalbC [n = 2]) and rats (n = 5) were scanned with microCT. A representative laboratory mouse from each strain was evaluated histologically via serial sagittal sections through the mid-tarsus. General pedal anatomy was similar between all species; however, the central and T3 bones were fused in all laboratory mice but not the rat or white-footed mouse. A band of hyaline cartilage was identified within the fused bone of the laboratory mice. We conclude that the fusion found is a normal characteristic in laboratory mice, but timing of the fusion remains ambiguous. Anat Rec, 300:450-459, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
In Vivo Axial Loading of the Mouse Tibia
Melville, Katherine M.; Robling, Alexander G.
2015-01-01
Summary Non-invasive methods to apply controlled, cyclic loads to the living skeleton are used as an anabolic agent to stimulate new bone formation in adults and enhance bone mass accrual in growing animals. These methods are also invaluable for understanding bone signaling pathways. Our focus here is on a particular loading model: in vivo axial compression of the mouse tibia. An advantage of loading the tibia is that changes are present in both the cancellous envelope of the proximal tibia and the cortical bone of the tibial diaphysis. To load the tibia of the mouse axially in vivo, a cyclic compressive load is applied up to five times a week to a single tibia per mouse for a duration lasting from 1 day to 6 weeks. With the contralateral limb as an internal control, the anabolic response of the skeleton to mechanical stimuli can be studied in a pairwise experimental design. Here, we describe the key parameters that must be considered before beginning an in vivo mouse tibial loading experiment, including methods for in vivo strain gauging of the tibial midshaft, and then we describe general methods for loading the mouse tibia for an experiment lasting multiple days. PMID:25331046
Gopalakrishnapillai, Anilkumar; Kolb, E Anders; Dhanan, Priyanka; Mason, Robert W; Napper, Andrew; Barwe, Sonali P
2015-01-01
The bone marrow microenvironment plays an important role in acute lymphoblastic leukemia (ALL) cell proliferation, maintenance, and resistance to chemotherapy. Annexin II (ANX2) is abundantly expressed on bone marrow cells and complexes with p11 to form ANX2/p11-hetero-tetramer (ANX2T). We present evidence that p11 is upregulated in refractory ALL cell lines and patient samples. A small molecule inhibitor that disrupts ANX2/p11 interaction (ANX2T inhibitor), an anti-ANX2 antibody, and knockdown of p11, abrogated ALL cell adhesion to osteoblasts, indicating that ANX2/p11 interaction facilitates binding and retention of ALL cells in the bone marrow. Furthermore, ANX2T inhibitor increased the sensitivity of primary ALL cells co-cultured with osteoblasts to dexamethasone and vincristine induced cell death. Finally, in an orthotopic leukemia xenograft mouse model, the number of ALL cells homing to the bone marrow was reduced by 40-50% in mice injected with anti-ANX2 antibody, anti-p11 antibody or ANX2T inhibitor compared to respective controls. In a long-term engraftment assay, the percentage of ALL cells in mouse blood, bone marrow and spleen was reduced in mice treated with agents that disrupt ANX2/p11 interaction. These data show that disruption of ANX2/p11 interaction results in reduced ALL cell adhesion to osteoblasts, increased ALL cell sensitization to chemotherapy, and suppression of ALL cell homing and engraftment.
Lattanzi, Wanda; Parrilla, Claudio; Fetoni, Annarita; Logroscino, Giandomenico; Straface, Giuseppe; Pecorini, Giovanni; Stigliano, Egidio; Tampieri, Anna; Bedini, Rossella; Pecci, Raffaella; Michetti, Fabrizio; Gambotto, Andrea; Robbins, Paul D.; Pola, Enrico
2012-01-01
Local gene transfer of the human LIM Mineralization Protein (LMP), a novel intracellular positive regulator of the osteoblast differentiation program, can induce efficient bone formation in rodents. In order to develop a clinically relevant gene therapy approach to facilitate bone healing, we have used primary dermal fibroblasts transduced ex vivo with Ad.LMP3 and seeded on an hydroxyapatite/collagen matrix prior to autologous implantation. Here we demonstrate that genetically modified autologous dermal fibroblasts expressing Ad.LMP-3 are able to induce ectopic bone formation following implantation of the matrix into the mouse triceps and paravertebral muscles. Moreover, implantation of the Ad.LMP-3-modified dermal fibroblasts into a rat mandibular bone critical size defect model results in efficient healing as determined by X-ray, histology and three dimensional micro computed tomography (3DμCT). These results demonstrate the effectiveness of the non-secreted intracellular osteogenic factor LMP-3, in inducing bone formation in vivo. Moreover, the utilization of autologous dermal fibroblasts implanted on a biomaterial represents a promising approach for possible future clinical applications aimed at inducing new bone formation. PMID:18633445
Hu, Xue; Li, Li; Yu, Xinyi; Zhang, Ruyi; Yan, Shujuan; Zeng, Zongyue; Shu, Yi; Zhao, Chen; Wu, Xingye; Lei, Jiayan; Li, Yasha; Zhang, Wenwen; Yang, Chao; Wu, Ke; Wu, Ying; An, Liping; Huang, Shifeng; Ji, Xiaojuan; Gong, Cheng; Yuan, Chengfu; Zhang, Linghuan; Liu, Wei; Huang, Bo; Feng, Yixiao; Zhang, Bo; Haydon, Rex C; Luu, Hue H; Reid, Russell R; Lee, Michael J; Wolf, Jennifer Moriatis; Yu, Zebo; He, Tong-Chuan
2017-12-19
Mesenchymal stem cells (MSCs) are multipotent non-hematopoietic progenitor cells that can undergo self-renewal and differentiate into multi-lineages. Bone marrow stromal stem cells (BMSCs) represent one of the most commonly-used MSCs. In order to overcome the technical challenge of maintaining primary BMSCs in long-term culture, here we seek to establish reversibly immortalized mouse BMSCs (imBMSCs). By exploiting CRISPR/Cas9-based homology-directed-repair (HDR) mechanism, we target SV40T to mouse Rosa26 locus and efficiently immortalize mouse BMSCs (i.e., imBMSCs). We also immortalize BMSCs with retroviral vector SSR #41 and establish imBMSC41 as a control line. Both imBMSCs and imBMSC41 exhibit long-term proliferative capability although imBMSC41 cells have a higher proliferation rate. SV40T mRNA expression is 130% higher in imBMSC41 than that in imBMSCs. However, FLP expression leads to 86% reduction of SV40T expression in imBMSCs, compared with 63% in imBMSC41 cells. Quantitative genomic PCR analysis indicates that the average copy number of SV40T and hygromycin is 1.05 for imBMSCs and 2.07 for imBMSC41, respectively. Moreover, FLP expression removes 92% of SV40T in imBMSCs at the genome DNA level, compared with 58% of that in imBMSC41 cells, indicating CRISPR/Cas9 HDR-mediated immortalization of BMSCs can be more effectively reversed than that of retrovirus-mediated random integrations. Nonetheless, both imBMSCs and imBMSC41 lines express MSC markers and are highly responsive to BMP9-induced osteogenic, chondrogenic and adipogenic differentiation in vitro and in vivo . Thus, the engineered imBMSCs can be used as a promising alternative source of primary MSCs for basic and translational research in the fields of MSC biology and regenerative medicine.
Lee, Edmund C.; Fitzgerald, Michael; Bannerman, Bret; Donelan, Jill; Bano, Kristen; Terkelsen, Jennifer; Bradley, Daniel P.; Subakan, Ozlem; Silva, Matthew D.; Liu, Ray; Pickard, Michael; Li, Zhi; Tayber, Olga; Li, Ping; Hales, Paul; Carsillo, Mary; Neppalli, Vishala T.; Berger, Allison J.; Kupperman, Erik; Manfredi, Mark; Bolen, Joseph B.; Van Ness, Brian; Janz, Siegfried
2012-01-01
Purpose The clinical success of the first-in-class proteasome inhibitor bortezomib (VELCADE) has validated the proteasome as a therapeutic target for treating human cancers. MLN9708 is an investigational proteasome inhibitor that, compared with bortezomib, has improved pharmacokinetics, pharmacodynamics, and antitumor activity in preclinical studies. Here, we focused on evaluating the in vivo activity of MLN2238 (the biologically active form of MLN9708) in a variety of mouse models of hematologic malignancies, including tumor xenograft models derived from a human lymphoma cell line and primary human lymphoma tissue, and genetically engineered mouse (GEM) models of plasma cell malignancies (PCM). Experimental Design Both cell line–derived OCI-Ly10 and primary human lymphoma–derived PHTX22L xenograft models of diffuse large B-cell lymphoma were used to evaluate the pharmacodynamics and antitumor effects of MLN2238 and bortezomib. The iMycCα/Bcl-XL GEM model was used to assess their effects on de novo PCM and overall survival. The newly developed DP54-Luc–disseminated model of iMycCα/ Bcl-XL was used to determine antitumor activity and effects on osteolytic bone disease. Results MLN2238 has an improved pharmacodynamic profile and antitumor activity compared with bortezomib in both OCI-Ly10 and PHTX22L models. Although both MLN2238 and bortezomib prolonged overall survival, reduced splenomegaly, and attenuated IgG2a levels in the iMycCα/Bcl-XL GEM model, only MLN2238 alleviated osteolytic bone disease in the DP54-Luc model. Conclusions Our results clearly showed the antitumor activity of MLN2238 in a variety of mouse models of B-cell lymphoma and PCM, supporting its clinical development. MLN9708 is being evaluated in multiple phase I and I/II trials. PMID:21903769
Hu, Xue; Li, Li; Yu, Xinyi; Zhang, Ruyi; Yan, Shujuan; Zeng, Zongyue; Shu, Yi; Zhao, Chen; Wu, Xingye; Lei, Jiayan; Li, Yasha; Zhang, Wenwen; Yang, Chao; Wu, Ke; Wu, Ying; An, Liping; Huang, Shifeng; Ji, Xiaojuan; Gong, Cheng; Yuan, Chengfu; Zhang, Linghuan; Liu, Wei; Huang, Bo; Feng, Yixiao; Zhang, Bo; Haydon, Rex C.; Luu, Hue H.; Reid, Russell R.; Lee, Michael J.; Wolf, Jennifer Moriatis; Yu, Zebo; He, Tong-Chuan
2017-01-01
Mesenchymal stem cells (MSCs) are multipotent non-hematopoietic progenitor cells that can undergo self-renewal and differentiate into multi-lineages. Bone marrow stromal stem cells (BMSCs) represent one of the most commonly-used MSCs. In order to overcome the technical challenge of maintaining primary BMSCs in long-term culture, here we seek to establish reversibly immortalized mouse BMSCs (imBMSCs). By exploiting CRISPR/Cas9-based homology-directed-repair (HDR) mechanism, we target SV40T to mouse Rosa26 locus and efficiently immortalize mouse BMSCs (i.e., imBMSCs). We also immortalize BMSCs with retroviral vector SSR #41 and establish imBMSC41 as a control line. Both imBMSCs and imBMSC41 exhibit long-term proliferative capability although imBMSC41 cells have a higher proliferation rate. SV40T mRNA expression is 130% higher in imBMSC41 than that in imBMSCs. However, FLP expression leads to 86% reduction of SV40T expression in imBMSCs, compared with 63% in imBMSC41 cells. Quantitative genomic PCR analysis indicates that the average copy number of SV40T and hygromycin is 1.05 for imBMSCs and 2.07 for imBMSC41, respectively. Moreover, FLP expression removes 92% of SV40T in imBMSCs at the genome DNA level, compared with 58% of that in imBMSC41 cells, indicating CRISPR/Cas9 HDR-mediated immortalization of BMSCs can be more effectively reversed than that of retrovirus-mediated random integrations. Nonetheless, both imBMSCs and imBMSC41 lines express MSC markers and are highly responsive to BMP9-induced osteogenic, chondrogenic and adipogenic differentiation in vitro and in vivo. Thus, the engineered imBMSCs can be used as a promising alternative source of primary MSCs for basic and translational research in the fields of MSC biology and regenerative medicine. PMID:29340096
Bernard, Quentin; Wang, Zhenping; Di Nardo, Anna; Boulanger, Nathalie
2017-06-27
Borrelia burgdorferi (sensu lato), the causative agent of Lyme borreliosis is a bacterium transmitted by hard ticks, Ixodes spp. Bacteria are injected into the host skin during the tick blood meal with tick saliva. There, Borrelia and saliva interact together with skin cells such as keratinocytes, fibroblasts, mast cells and other specific immune cells before disseminating to target organs. To study the role of mast cells in the transmission of Lyme borreliosis, we isolated mouse primary mast cells from bone marrow and incubated them in the presence of Borrelia burgdorferi (sensu stricto) and tick salivary gland extract. We further analyzed their potential role in vivo, in a mouse model of deficient in mast cells (Kit wsh-/- mice). To our knowledge, we report here for the first time the bacteria ability to induce the inflammatory response of mouse primary mast cells. We show that OspC, a major surface lipoprotein involved in the early transmission of Borrelia, induces the degranulation of primary mast cells but has a limited effect on the overall inflammatory response of these cells. In contrast, whole bacteria have an opposite effect. We also show that mast cell activation is significantly inhibited by tick salivary gland extract. Finally, we demonstrate that mast cells are likely not the only host cells involved in the early transmission and dissemination of Borrelia since the use of mast cell deficient Kit wsh-/- mice shows a limited impact on these two processes in the context of this mouse genetic background. The absence of mast cells did not change the replication rate of Borrelia in the skin. However, in the absence of mast cells, Borrelia dissemination to the joints was faster. Mast cells do not control skin bacterial proliferation during primary infection and the establishment of the primary infection, as shown in the C57BL/6 mouse model studied. Nevertheless, the Borrelia induced cytotokine modulation on mast cells might be involved in long term and/or repeated infections and protect from Lyme borreliosis due to the development of a hypersensitivity to tick saliva.
Antika, Lucia Dwi; Lee, Eun-Jung; Kim, Yun-Ho; Kang, Min-Kyung; Park, Sin-Hye; Kim, Dong Yeon; Oh, Hyeongjoo; Choi, Yean-Jung; Kang, Young-Hee
2017-11-01
Osteoporosis is one of the most prevalent forms of age-related bone diseases. Increased bone loss with advancing age has become a grave public health concern. This study examined whether phlorizin and phloretin, dihydrochalcones in apple peels, inhibited senile osteoporosis through enhancing osteoblastogenic bone formation in cell-based and aged mouse models. Submicromolar phloretin and phlorizin markedly stimulated osteoblast differentiation of MC3T3-E1 cells with increased transcription of Runx2 and osteocalcin. Senescence-accelerated resistant mouse strain prone-6 (SAMP6) mice were orally supplemented with 10 mg/kg phlorizin and phloretin daily for 12 weeks. Male senescence-accelerated resistant mouse strain R1 mice were employed as a nonosteoporotic age-matched control. Oral administration of ploretin and phorizin boosted bone mineralization in all the bones of femur, tibia and vertebra of SAMP6. In particular, phlorizin reduced serum RANKL/OPG ratio and diminished TRAP-positive osteoclasts in trabecular bones of SAMP6. Additionally, treating phlorizin to SAMP6 inhibited the osteoporotic resorption in distal femoral bones through up-regulating expression of BMP-2 and collagen-1 and decreasing production of matrix-degrading cathepsin K and MMP-9. Finally, phlorizin and phloretin antagonized GSK-3β induction and β-catenin phosphorylation in osteoblasts and aged mouse bones. Therefore, phlorizin and phloretin were potential therapeutic agents encumbering senile osteoporosis through promoting bone-forming osteoblastogenesis via modulation of GSK-3β/β-catenin-dependent signaling. Copyright © 2017 Elsevier Inc. All rights reserved.
Analysis of Mouse Growth Plate Development
Mangiavini, Laura; Merceron, Christophe; Schipani, Ernestina
2016-01-01
To investigate skeletal development, pathophysiological mechanisms of cartilage and bone disease, and eventually assess innovative treatments, the mouse is a very important resource. During embryonic development, mesenchymal condensations are formed, and cells within these mesenchymal condensations either directly differentiate into osteoblasts and give origin to intramembranous bone, or differentiate into chondrocytes and form a cartilaginous anlage. The cartilaginous anlage or fetal growth plate is then replaced with bone. This process is also called endochondral bone development, and it is responsible for the generation of most of our skeleton. In this Review, we will discuss in detail the most common in vivo and in vitro techniques our laboratory is currently using for the analysis of the mouse fetal growth plate during development. PMID:26928664
Matsumoto, Kenichi; Shimo, Tsuyoshi; Kurio, Naito; Okui, Tatsuo; Ibaragi, Soichiro; Kunisada, Yuki; Obata, Kyoichi; Masui, Masanori; Pai, Pang; Horikiri, Yuu; Yamanaka, Nobuyuki; Takigawa, Masaharu; Sasaki, Akira
2018-06-01
Low-intensity pulsed ultrasound (LIPUS) has been used as an adjunct to fracture healing therapies, but the mechanisms underlying its action are not known. We reported that sonic hedgehog (SHH) signaling was activated in osteoblasts at the dynamic remodeling site of a bone fracture. Mechanical stimulation is a crucial factor in bone remodeling, and it is related to the primary cilia as a sensor of hedgehog signaling. Here we observed that LIPUS promoted callus formation in accord with Gli2-positive cells after 14 days at the mouse femur fractured site compared with a control group. An immunofluorescence analysis showed that the numbers of primary cilia and cilia/osterix double-positive osteoblasts were increased at the fracture site by LIPUS. LIPUS stimulated not only the number and the length of primary cilia, but also the levels of ciliated protein, Ift88 mRNA, and SHH, Gli1, and Gli2 in MC3T3-E1 cells. Further experiments revealed that LIPUS stimulated osteogenic differentiation in the presence of smoothened agonist (SAG) treatment. These results indicate that LIPUS stimulates osteogenic differentiation and the maturation of osteoblasts by a primary cilium-mediated activation of hedgehog signaling. © 2017 Wiley Periodicals, Inc.
Shen, Jia; James, Aaron W.; Zhang, Xinli; Pang, Shen; Zara, Janette N.; Asatrian, Greg; Chiang, Michael; Lee, Min; Khadarian, Kevork; Nguyen, Alan; Lee, Kevin S.; Siu, Ronald K.; Tetradis, Sotirios; Ting, Kang; Soo, Chia
2017-01-01
The differentiation factor NEL-like molecule-1 (NELL-1) has been reported as osteoinductive in multiple in vivo preclinical models. Bone morphogenetic protein (BMP)-2 is used clinically for skeletal repair, but in vivo administration can induce abnormal, adipose-filled, poor-quality bone. We demonstrate that NELL-1 combined with BMP2 significantly optimizes osteogenesis in a rodent femoral segmental defect model by minimizing the formation of BMP2-induced adipose-filled cystlike bone. In vitro studies using the mouse bone marrow stromal cell line M2-10B4 and human primary bone marrow stromal cells have confirmed that NELL-1 enhances BMP2-induced osteogenesis and inhibits BMP2-induced adipogenesis. Importantly, the ability of NELL-1 to direct BMP2-treated cells toward osteogenesis and away from adipogenesis requires intact canonical Wnt signaling. Overall, these studies establish the feasibility of combining NELL-1 with BMP2 to improve clinical bone regeneration and provide mechanistic insight into canonical Wnt pathway activity during NELL-1 and BMP2 osteogenesis. The novel abilities of NELL-1 to stimulate Wnt signaling and to repress adipogenesis may highlight new treatment approaches for bone loss in osteoporosis. PMID:26772960
BOOT-HANDFORD, R. P.; MICHAELIDIS, T. M.; HILLARBY, M. C.; ZAMBELLI, A.; DENTON, J.; HOYLAND, J. A.; FREEMONT, A. J.; GRANT, M. E.; WALLIS, G. A.
1998-01-01
Histological examination of long bones from 1-day-old bcl-2 knockout and age-matched control mice revealed no obvious differences in length of bone, growth plate architecture or stage of endochondral ossification. In 35-day-old bcl-2 knockout mice that are growth retarded or ‘dwarfed’, the proliferative zone of the growth plate appeared slightly thinner and the secondary centres of ossification less well developed than their age-matched wild-type controls. The most marked histological effects of bcl-2 ablation were on osteoblasts and bone. 35-day-old knockout mouse bones exhibited far greater numbers of osteoblasts than controls and the osteoblasts had a cuboidal phenotype in comparison with the normal flattened cell appearance. In addition, the collagen deposited by the osteoblasts in the bcl-2 knockout mouse bone was disorganized in comparison with control tissue and had a pseudo-woven appearance. The results suggest an important role for Bcl-2 in controlling osteoblast phenotype and bone deposition in vivo. PMID:10193316
Marques da Costa, Maria Eugenia; Daudigeos-Dubus, Estelle; Gomez-Brouchet, Anne; Bawa, Olivia; Rouffiac, Valerie; Serra, Massimo; Scotlandi, Katia; Santos, Conceição; Geoerger, Birgit; Gaspar, Nathalie
2018-03-01
Osteosarcoma is one of the most common primary bone tumors in childhood and adolescence. Metastases occurrence at diagnosis or during disease evolution is the main therapeutic challenge. New drug evaluation to improve patient survival requires the development of various preclinical models mimicking at best the complexity of the disease and its metastatic potential. We describe here the development and characteristics of two orthotopic bioluminescent (Luc/mKate2) cell-derived xenograft (CDX) models, Saos-2-B-Luc/mKate2-CDX and HOS-Luc/mKate2-CDX, in different immune (nude and NSG mouse strains) and bone (intratibial and paratibial with periosteum activation) contexts. IVIS SpectrumCT system allowed both longitudinal computed tomography (CT) and bioluminescence real-time follow-up of primary tumor growth and metastatic spread, which was confirmed by histology. The murine immune context influenced tumor engraftment, primary tumor growth, and metastatic spread to lungs, bone, and spleen (an unusual localization in humans). Engraftment in NSG mice was found superior to that found in nude mice and intratibial bone environment more favorable to engraftment compared to paratibial injection. The genetic background of the two CDX models also led to distinct primary tumor behavior observed on CT scan. Saos-2-B-Luc/mKate2-CDX showed osteocondensed, HOS-Luc/mKate2-CDX osteolytic morphology. Bioluminescence defined a faster growth of the primary tumor and metastases in Saos-2-B-Luc/mKate2-CDX than in HOS-Luc/mKate2-CDX. The early detection of primary tumor growth and metastatic spread by bioluminescence allows an improved exploration of osteosarcoma disease at tumor progression, and metastatic spread, as well as the evaluations of anticancer treatments. Our orthotopic models with metastatic spread bring complementary information to other types of existing osteosarcoma models. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
A mouse model with postnatal endolymphatic hydrops and hearing loss
Megerian, Cliff A.; Semaan, Maroun T.; Aftab, Saba; Kisley, Lauren B.; Zheng, Qing Yin; Pawlowski, Karen S.; Wright, Charles G.; Alagramam, Kumar N.
2010-01-01
Endolymphatic hydrops (ELH), hearing loss and neuronal degeneration occur together in a variety of clinically significant disorders, including Meniere’s disease (MD). However, the sequence of these pathological changes and their relationship to each other are not well understood. In this regard, an animal model that spontaneously develops these features postnatally would be useful for research purposes. A search for such a model led us to the PhexHyp-Duk mouse, a mutant allele of the Phex gene causing X-linked hypophosphatemic rickets. The hemizygous male (PhexHyp-Duk/Y) was previously reported to exhibit various abnormalities during adulthood, including thickening of bone, ELH and hearing loss. The reported inner-ear phenotype was suggestive of progressive pathology and spontaneous development of ELH postnatally, but not conclusive. The main focuses of this report are to further characterize the inner ear phenotype in PhexHyp-Duk/Y mice and to test the hypotheses that (a) the PhexHyp-Duk/Y mouse develops ELH and hearing loss postnatally, and (b) the development of ELH in the PhexHyp-Duk/Y mouse is associated with obstruction of the endolymphatic duct (ED) due to thickening of the surrounding bone. Auditory brainstem response (ABR) recordings at various times points and histological analysis of representative temporal bones reveal that PhexHyp-Duk/Y mice typically develop adult onset, asymmetric, progressive hearing loss closely followed by the onset of ELH. ABR and histological data show that functional degeneration precedes structural degeneration. The major degenerative correlate of hearing loss and ELH in the mutants is the primary loss of spiral ganglion cells. Further, PhexHyp-Duk/Y mice develop ELH without evidence of ED obstruction, supporting the idea that ELH can be induced by a mechanism other than the blockade of longitudinal flow of endolymphatic fluid, and occlusion of ED is not a prerequisite for the development of ELH in patients. PMID:18289812
Mushroom Extracts Decrease Bone Resorption and Improve Bone Formation.
Erjavec, Igor; Brkljacic, Jelena; Vukicevic, Slobodan; Jakopovic, Boris; Jakopovich, Ivan
2016-01-01
Mushroom extracts have shown promising effects in the treatment of cancer and various chronic diseases. Osteoporosis is considered one of the most widespread chronic diseases, for which currently available therapies show mixed results. In this research we investigated the in vitro effects of water extracts of the culinary-medicinal mushrooms Trametes versicolor, Grifola frondosa, Lentinus edodes, and Pleurotus ostreatus on a MC3T3-E1 mouse osteoblast-like cell line, primary rat osteoblasts, and primary rat osteoclasts. In an animal osteoporosis model, rats were ovariectomized and then fed 2 mushroom blends of G. frondosa and L. edodes for 42 days. Bone loss was monitored using densitometry (dual-energy X-ray absorptiometry) and micro computed tomography. In the concentration test, mushroom extracts showed no toxic effect on MC3T3-E1 cells; a dose of 24 µg/mL showed the most proliferative effect. Mushroom extracts of T. versicolor, G. frondosa, and L. edodes inhibited osteoclast activity, whereas the extract of L. edodes increased osteoblast mineralization and the production of osteocalcin, a specific osteoblastic marker. In animals, mushroom extracts did not prevent trabecular bone loss in the long bones. However, we show for the first time that the treatment with a combination of extracts from L. edodes and G. frondosa significantly reduced trabecular bone loss at the lumbar spine. Inhibitory properties of extracts from L. edodes on osteoclasts and the promotion of osteoblasts in vitro, together with the potential to decrease lumbar spine bone loss in an animal osteoporosis model, indicate that medicinal mushroom extracts can be considered as a preventive treatment and/or a supplement to pharmacotherapy to enhance its effectiveness and ameliorate its harmful side effects.
ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling
Masuda, Tetsuro; Endo, Motoyoshi; Yamamoto, Yutaka; Odagiri, Haruki; Kadomatsu, Tsuyoshi; Nakamura, Takayuki; Tanoue, Hironori; Ito, Hitoshi; Yugami, Masaki; Miyata, Keishi; Morinaga, Jun; Horiguchi, Haruki; Motokawa, Ikuyo; Terada, Kazutoyo; Morioka, Masaki Suimye; Manabe, Ichiro; Iwase, Hirotaka; Mizuta, Hiroshi; Oike, Yuichi
2015-01-01
Bone metastasis of breast cancer cells is a major concern, as it causes increased morbidity and mortality in patients. Bone tissue-derived CXCL12 preferentially recruits breast cancer cells expressing CXCR4 to bone metastatic sites. Thus, understanding how CXCR4 expression is regulated in breast cancer cells could suggest approaches to decrease bone metastasis of breast tumor cells. Here, we show that tumor cell-derived angiopoietin-like protein 2 (ANGPTL2) increases responsiveness of breast cancer cells to CXCL12 by promoting up-regulation of CXCR4 in those cells. In addition, we used a xenograft mouse model established by intracardiac injection of tumor cells to show that ANGPTL2 knockdown in breast cancer cells attenuates tumor cell responsiveness to CXCL12 by decreasing CXCR4 expression in those cells, thereby decreasing bone metastasis. Finally, we found that ANGPTL2 and CXCR4 expression levels within primary tumor tissues from breast cancer patients are positively correlated. We conclude that tumor cell-derived ANGPTL2 may increase bone metastasis by enhancing breast tumor cell responsiveness to CXCL12 signaling through up-regulation of tumor cell CXCR4 expression. These findings may suggest novel therapeutic approaches to treat metastatic breast cancer. PMID:25773070
Matsumoto, Shigeru; Tominari, Tsukasa; Matsumoto, Chiho; Yoshinouchi, Shosei; Ichimaru, Ryota; Watanabe, Kenta; Hirata, Michiko; Grundler, Florian M W; Miyaura, Chisato; Inada, Masaki
2018-01-20
Polymethoxyflavonoids (PMFs) are a family of the natural compounds that mainly compise nobiletin, tangeretin, heptamethoxyflavone (HMF), and tetramethoxyflavone (TMF) in citrus fruits. PMFs have shown various biological functions, including anti-oxidative effects. We previously showed that nobiletin, tangeretin, and HMF all inhibited interleukin (IL)-1-mediated osteoclast differentiation via the inhibition of prostaglandin E2 synthesis. In this study, we created an original mixture of PMFs (nobiletin, tangeretin, HMF, and TMF) and examined whether or not PMFs exhibit co-operative inhibitory effects on osteoclastogenesis and bone resorption. In a coculture of bone marrow cells and osteoblasts, PMFs dose-dependently inhibited IL-1-induced osteoclast differentiation and bone resorption. The optimum concentration of PMFs was lower than that of nobiletin alone in the suppression of osteoclast differentiation, suggesting that the potency of PMFs was stronger than that of nobiletin in vitro. The oral administration of PMFs recovered the femoral bone loss induced by estrogen deficiency in ovariectomized mice. We further tested the effects of PMFs on lipopolysaccharide-induced bone resorption in mouse alveolar bone. In an ex vivo experimental model for periodontitis, PMFs significantly suppressed the bone-resorbing activity in organ cultures of mouse alveolar bone. These results indicate that a mixture of purified nobiletin, tangeretin, HMF, and TMF exhibits a co-operative inhibitory effect for the protection against bone loss in a mouse model of bone disease, suggesting that PMFs may be potential candidates for the prevention of bone resorption diseases, such as osteoporosis and periodontitis.
Promoting Endochondral Bone Repair Using Human Osteoarthritic Articular Chondrocytes.
Bahney, Chelsea S; Jacobs, Linsey; Tamai, Robert; Hu, Diane; Luan, Tammy F; Wang, Miqi; Reddy, Sanjay; Park, Michelle; Limburg, Sonja; Kim, Hubert T; Marcucio, Ralph; Kuo, Alfred C
2016-03-01
Current tissue engineering strategies to heal critical-size bone defects through direct bone formation are limited by incomplete integration of grafts with host bone and incomplete graft vascularization. An alternative strategy for bone regeneration is the use of cartilage grafts that form bone through endochondral ossification. Endochondral cartilages stimulate angiogenesis and are remodeled into bone, but are found in very small quantities in growth plates and healing fractures. We sought to develop engineered endochondral cartilage grafts using osteoarthritic (OA) articular chondrocytes as a cell source. Such chondrocytes often undergo hypertrophy, which is a characteristic of endochondral cartilages. We compared the ability of unmodified human OA (hOA) cartilage and cartilage grafts formed in vitro from hOA chondrocytes to undergo endochondral ossification in mice. Scaffold-free engineered chondrocyte grafts were generated by pelleting chondrocytes, followed by culture with transforming growth factor-β1 (TGF-β1) and bone morphogenetic protein 4. Samples derived from either primary or passaged chondrocytes were implanted subcutaneously into immunocompromised mice. Grafts derived from passaged chondrocytes from three patients were implanted into critical-size tibial defects in mice. Bone formation was assessed with histology after 4 weeks of implantation. The composition of tibial repair tissue was quantified with histomorphometry. Engineered cartilage grafts generated from passaged OA chondrocytes underwent endochondral ossification after implantation either subcutaneously or in bone. Cartilage grafts integrated with host bone at 15 out of 16 junctions. Grafts variably remodeled into woven bone, with the proportion of bony repair tissue in tibial defects ranging from 22% to 85% (average 48%). Bony repair tissue bridged the tibial defects in half of the animals. In contrast, unmodified OA cartilage and engineered grafts formed from primary chondrocytes did not undergo endochondral ossification in vivo. hOA chondrocytes can adopt an endochondral phenotype after passaging and TGF-β superfamily treatment. Engineered endochondral cartilage grafts can integrate with host bone, undergo ossification, and heal critical-size long-bone defects in a mouse model. However, additional methods to further enhance ossification of these grafts are required before the clinical translation of this approach.
Petty, Sandra J; Milligan, Carol J; Todaro, Marian; Richards, Kay L; Kularathna, Pamuditha K; Pagel, Charles N; French, Chris R; Hill-Yardin, Elisa L; O'Brien, Terence J; Wark, John D; Mackie, Eleanor J; Petrou, Steven
2016-09-01
Fracture risk is a serious comorbidity in epilepsy and may relate to the use of antiepileptic drugs (AEDs). Many AEDs inhibit ion channel function, and the expression of these channels in osteoblasts raises the question of whether altered bone signaling increases bone fragility. We aimed to confirm the expression of voltage-gated sodium (NaV ) channels in mouse osteoblasts, and to investigate the action of carbamazepine and phenytoin on NaV channels. Immunocytochemistry was performed on primary calvarial osteoblasts extracted from neonatal C57BL/6J mice and additional RNA sequencing (RNASeq) was included to confirm expression of NaV . Whole-cell patch-clamp recordings were made to identify the native currents expressed and to assess the actions of carbamazepine (50 μm) or phenytoin (50 μm). NaV expression was demonstrated with immunocytochemistry, RNA sequencing, and functionally, with demonstration of robust tetrodotoxin-sensitive and voltage-activated inward currents. Application of carbamazepine or phenytoin resulted in significant inhibition of current amplitude for carbamazepine (31.6 ± 5.9%, n = 9; p < 0.001), and for phenytoin (35.5 ± 6.9%, n = 7; p < 0.001). Mouse osteoblasts express NaV , and native NaV currents are blocked by carbamazepine and phenytoin, supporting our hypothesis that AEDs can directly influence osteoblast function and potentially affect bone strength. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.
Mouse Models in Bone Marrow Transplantation and Adoptive Cellular Therapy
Arber, Caroline; Brenner, Malcolm K.; Reddy, Pavan
2014-01-01
Mouse models of transplantation have been indispensable to the development of bone marrow transplantation (BMT). Their role in the generation of basic science knowledge is invaluable and is subject to discussion below. However, this article focuses on the direct role and relevance of mouse models towards the clinical development and advances in BMT and adoptive T-cell therapy for human diseases. The authors aim to present a thoughtful perspective on the pros and cons of mouse models while noting that despite imperfections these models are obligatory for the development of science-based medicine. PMID:24216170
Jepsen, Karl J; Silva, Matthew J; Vashishth, Deepak; Guo, X Edward; van der Meulen, Marjolein CH
2016-01-01
Mice are widely used in studies of skeletal biology, and assessment of their bones by mechanical testing is a critical step when evaluating the functional effects of an experimental perturbation. For example, a gene knockout may target a pathway important in bone formation and result in a “low bone mass” phenotype. But how well does the skeleton bear functional loads; eg, how much do bones deform during loading and how resistant are bones to fracture? By systematic evaluation of bone morphological, densitometric, and mechanical properties, investigators can establish the “biomechanical mechanisms” whereby an experimental perturbation alters whole-bone mechanical function. The goal of this review is to clarify these biomechanical mechanisms and to make recommendations for systematically evaluating phenotypic changes in mouse bones, with a focus on long-bone diaphyses and cortical bone. Further, minimum reportable standards for testing conditions and outcome variables are suggested that will improve the comparison of data across studies. Basic biomechanical principles are reviewed, followed by a description of the cross-sectional morphological properties that best inform the net cellular effects of a given experimental perturbation and are most relevant to biomechanical function. Although morphology is critical, whole-bone mechanical properties can only be determined accurately by a mechanical test. The functional importance of stiffness, maximum load, postyield displacement, and work-to-fracture are reviewed. Because bone and body size are often strongly related, strategies to adjust whole-bone properties for body mass are detailed. Finally, a comprehensive framework is presented using real data, and several examples from the literature are reviewed to illustrate how to synthesize morphological, tissue-level, and whole-bone mechanical properties of mouse long bones. PMID:25917136
Tang, Wei; Tian, Jingjing; Zheng, Qiang; Yan, Lin; Wang, Jiangxue; Li, Zhou; Wang, Zhong Lin
2015-08-25
Bone remodeling or orthodontic treatment is usually a long-term process. It is highly desirable to speed up the process for effective medical treatment. In this work, a self-powered low-level laser cure system for osteogenesis is developed using the power generated by the triboelectric nanogenerator. It is found that the system significantly accelerated the mouse embryonic osteoblasts' proliferation and differentiation, which is essential for bone and tooth healing. The system is further demonstrated to be driven by a living creature's motions, such as human walking or a mouse's breathing, suggesting its practical use as a portable or implantable clinical cure for bone remodeling or orthodontic treatment.
NASA Technical Reports Server (NTRS)
Veldhuijzen, Jean Paul; Vanloon, Jack J. W. A.
1994-01-01
An experiment using isolated skeletal tissues under microgravity, is reported. Fetal mouse long bones (metatarsals) were cultured for 4 days in the Biorack facility of Spacelab during the IML-1 (International Microgravity Laboratory) mission of the Space Shuttle. Overall growth was not affected, however glucose consumption was significantly reduced under microgravity. Mineralization of the diaphysis was also strongly reduced under microgravity as compared to the on-board 1 g group. In contrast, mineral resorption by osteoclasts was signficantly increased. These results indicate that these fetal mouse long bones are a sensitive and useful model to further study the cellular mechanisms involved in the changed mineral metabolism of skeletal tissues under microgravity.
Primary Neoplasms of Bones in Mice: Retrospective Study and Review of Literature
Kavirayani, A. M.; Sundberg, J. P.; Foreman, O.
2011-01-01
To compare and summarize the mechanisms, frequencies of occurrence, and classification schemes of spontaneous, experimental, and genetically engineered, mouse skeletal neoplasms, the literature was reviewed and archived case material at The Jackson Laboratory examined. The frequency of occurrence of spontaneous bone neoplasms was less than 1% for most strains, with the exceptions of osteomas in CF-1 (5.5% and 10% in two studies) and OF-1 outbred strains (35%), and osteosarcomas in NOD/ShiLtJ (11.5%) and NOD derived (7.1%) mice. The frequency was 100% for osteochondromas induced by conditional inactivation of exostoses (multiple) 1 (Ext1) in chondrocytes, osteosarcomas induced by tibial intramedullary inoculation of Moloney’s murine sarcoma virus, and osteosarcomas induced by conditional inactivation of Trp53-with or without inactivation of Rb1-in osteoblast precursors. Spontaneous osteogenic neoplasms were more frequent than spontaneous cartilaginous and vascular types. Malignant neoplasms were more frequent than benign ones. The age of occurrence for spontaneous neoplasms ranged from 37 to 720 (Mean 316.35) days for benign, and 35 to 990 (Mean 299.28) days for malignant neoplasms. In genetically engineered mice, the average age of occurrence ranged from 28 to 70 days for benign, and from 35 to 690 days for malignant neoplasms. Histologically, non-osteogenic neoplasms were similar across strains and mutant stocks; osteogenic neoplasms exhibited greater diversity. This comparison and summarization of mouse bone neoplasms provides valuable information for the selection of strains to create, compare, and validate models of bone neoplasms. PMID:21343597
Yoon, Sung-Hee; Sugamori, Kim S; Grynpas, Marc D; Mitchell, Jane
2016-01-01
Patients with Duchenne muscular dystrophy are at increased risk of decreased bone mineral density and bone fracture as a result of inactivity. To determine if antiresorptive bisphosphonates could improve bone quality and their effects on muscle we studied the Mdx mouse, treated with pamidronate during peak bone growth at 5 and 6 weeks of age, and examined the outcome at 13 weeks of age. Pamidronate increased cortical bone architecture and strength in femurs with increased resistance to fracture. While overall long bone growth was not affected by pamidronate, there was significant inhibition of remodeling in metaphyseal trabecular bone with evidence of residual calcified cartilage. Pamidronate treatment had positive effects on skeletal muscle in the Mdx mice with decreased serum and muscle creatine kinase and evidence of improved muscle histology and grip strength. Copyright © 2015 Elsevier B.V. All rights reserved.
Montgomery, Scott R; Nargizyan, Taya; Meliton, Vicente; Nachtergaele, Sigrid; Rohatgi, Rajat; Stappenbeck, Frank; Jung, Michael E; Johnson, Jared S; Aghdasi, Bayan; Tian, Haijun; Weintraub, Gil; Inoue, Hirokazu; Atti, Elisa; Tetradis, Sotirios; Pereira, Renata C; Hokugo, Akishige; Alobaidaan, Raed; Tan, Yanlin; Hahn, Theodor J; Wang, Jeffrey C; Parhami, Farhad
2014-08-01
Osteogenic factors are often used in orthopedics to promote bone growth, improve fracture healing, and induce spine fusion. Osteogenic oxysterols are naturally occurring molecules that were shown to induce osteogenic differentiation in vitro and promote spine fusion in vivo. The purpose of this study was to identify an osteogenic oxysterol more suitable for clinical development than those previously reported, and evaluate its ability to promote osteogenesis in vitro and spine fusion in rats in vivo. Among more than 100 oxysterol analogues synthesized, Oxy133 induced significant expression of osteogenic markers Runx2, osterix (OSX), alkaline phosphatase (ALP), bone sialoprotein (BSP), and osteocalcin (OCN) in C3H10T1/2 mouse embryonic fibroblasts and in M2-10B4 mouse marrow stromal cells. Oxy133-induced activation of an 8X-Gli luciferase reporter, its direct binding to Smoothened, and the inhibition of Oxy133-induced osteogenic effects by the Hedgehog (Hh) pathway inhibitor, cyclopamine, demonstrated the role of Hh pathway in mediating osteogenic responses to Oxy133. Oxy133 did not stimulate osteogenesis via BMP or Wnt signaling. Oxy133 induced the expression of OSX, BSP, and OCN, and stimulated robust mineralization in primary human mesenchymal stem cells. In vivo, bilateral spine fusion occurred through endochondral ossification and was observed in animals treated with Oxy133 at the fusion site on X-ray after 4 weeks and confirmed with manual assessment, micro-CT (µCT), and histology after 8 weeks, with equal efficiency to recombinant human bone morphogenetic protein-2 (rhBMP-2). Unlike rhBMP-2, Oxy133 did not induce adipogenesis in the fusion mass and resulted in denser bone evidenced by greater bone volume/tissue volume (BV/TV) ratio and smaller trabecular separation. Findings here suggest that Oxy133 has significant potential as an osteogenic molecule with greater ease of synthesis and improved time to fusion compared to previously studied oxysterols. Small molecule osteogenic oxysterols may serve as the next generation of bone anabolic agents for therapeutic development. © 2014 American Society for Bone and Mineral Research.
Notsu, Masakazu; Yamaguchi, Toru; Okazaki, Kyoko; Tanaka, Ken-ichiro; Ogawa, Noriko; Kanazawa, Ippei; Sugimoto, Toshitsugu
2014-07-01
In diabetic patients, advanced glycation end products (AGEs) cause bone fragility because of deterioration of bone quality. We previously showed that AGEs suppressed the mineralization of mouse stromal ST2 cells. TGF-β is abundant in bone, and enhancement of its signal causes bone quality deterioration. However, whether TGF-β signaling is involved in the AGE-induced suppression of mineralization during the osteoblast lineage remains unknown. We therefore examined the roles of TGF-β in the AGE-induced suppression of mineralization of ST2 cells and human mesenchymal stem cells. AGE3 significantly (P < .001) inhibited mineralization in both cell types, whereas transfection with small interfering RNA for the receptor for AGEs (RAGEs) significantly (P < .05) recovered this process in ST2 cells. AGE3 increased (P < .001) the expression of TGF-β mRNA and protein, which was partially antagonized by transfection with RAGE small interfering RNA. Treatment with a TGF-β type I receptor kinase inhibitor, SD208, recovered AGE3-induced decreases in osterix (P < .001) and osteocalcin (P < .05) and antagonized the AGE3-induced increase in Runx2 mRNA expression in ST2 cells (P < .001). Moreover, SD208 completely and dose dependently rescued AGE3-induced suppression of mineralization in both cell types. In contrast, SD208 intensified AGE3-induced suppression of cell proliferation as well as AGE3-induced apoptosis in proliferating ST2 cells. These findings indicate that, after cells become confluent, AGE3 partially inhibits the differentiation and mineralization of osteoblastic cells by binding to RAGE and increasing TGF-β expression and secretion. They also suggest that TGF-β adversely affects bone quality not only in primary osteoporosis but also in diabetes-related bone disorder.
Murata, Koichi; Kitaori, Toshiyuki; Oishi, Shinya; Watanabe, Naoki; Yoshitomi, Hiroyuki; Tanida, Shimei; Ishikawa, Masahiro; Kasahara, Takashi; Shibuya, Hideyuki; Fujii, Nobutaka; Nagasawa, Takashi; Nakamura, Takashi; Ito, Hiromu
2012-01-01
Stromal cell-derived factor 1 (SDF-1/CXCL12/PBSF) plays important roles in the biological and physiological functions of haematopoietic and mesenchymal stem cells. This chemokine regulates the formation of multiple organ systems during embryogenesis. However, its roles in skeletal development remain unclear. Here we investigated the roles of SDF-1 in chondrocyte differentiation. We demonstrated that SDF-1 protein was expressed at pre-hypertrophic and hypertrophic chondrocytes in the newly formed endochondral callus of rib fracture as well as in the growth plate of normal mouse tibia by immunohistochemical analysis. Using SDF-1(-/-) mouse embryo, we histologically showed that the total length of the whole humeri of SDF-1(-/-) mice was significantly shorter than that of wild-type mice, which was contributed mainly by shorter hypertrophic and calcified zones in SDF-1(-/-) mice. Actin cytoskeleton of hypertrophic chondrocytes in SDF-1(-/-) mouse humeri showed less F-actin and rounder shape than that of wild-type mice. Primary chondrocytes from SDF-1(-/-) mice showed the enhanced formation of philopodia and loss of F-actin. The administration of SDF-1 to primary chondrocytes of wild-type mice and SDF-1(-/-) mice promoted the formation of actin stress fibers. Organ culture of embryonic metatarsals from SDF-1(-/-) mice showed the growth delay, which was recovered by an exogenous administration of SDF-1. mRNA expression of type X collagen in metatarsals and in primary chondrocytes of SDF-1(-/-) mouse embryo was down-regulated while the administration of SDF-1 to metatarsals recovered. These data suggests that SDF-1 regulates the actin organization and stimulates bone growth by mediating chondrocyte hypertrophy.
A novel microfluidic model can mimic organ-specific metastasis of circulating tumor cells.
Kong, Jing; Luo, Yong; Jin, Dong; An, Fan; Zhang, Wenyuan; Liu, Lilu; Li, Jiao; Fang, Shimeng; Li, Xiaojie; Yang, Xuesong; Lin, Bingcheng; Liu, Tingjiao
2016-11-29
A biomimetic microsystem might compensate costly and time-consuming animal metastatic models. Herein we developed a biomimetic microfluidic model to study cancer metastasis. Primary cells isolated from different organs were cultured on the microlfuidic model to represent individual organs. Breast and salivary gland cancer cells were driven to flow over primary cell culture chambers, mimicking dynamic adhesion of circulating tumor cells (CTCs) to endothelium in vivo. These flowing artificial CTCs showed different metastatic potentials to lung on the microfluidic model. The traditional nude mouse model of lung metastasis was performed to investigate the physiological similarity of the microfluidic model to animal models. It was found that the metastatic potential of different cancer cells assessed by the microfluidic model was in agreement with that assessed by the nude mouse model. Furthermore, it was demonstrated that the metastatic inhibitor AMD3100 inhibited lung metastasis effectively in both the microfluidic model and the nude mouse model. Then the microfluidic model was used to mimick liver and bone metastasis of CTCs and confirm the potential for research of multiple-organ metastasis. Thus, the metastasis of CTCs to different organs was reconstituted on the microfluidic model. It may expand the capabilities of traditional cell culture models, providing a low-cost, time-saving, and rapid alternative to animal models.
DNA-PKcs is critical for telomere capping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilley, David; Tanaka, Hiromi; Hande, M. Prakash
The DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is critical for DNA repair via the non-homologous end joining (NHEJ) pathway. Previously, it was reported that bone marrow cells and spontaneously transformed fibroblasts from SCID (severe combined immunodeficiency) mice have defects in telomere maintenance. The genetically defective SCID mouse arose spontaneously from its parental strain CB17. One known genomic alteration in SCID mice is a truncation of the extreme carboxyl-terminus of DNA-PKcs, but other as yet unidentified alterations may also exist. We have used a defined system, the DNA-PKcs knockout mouse, to investigate specifically the role DNA-PKcs specifically plays in telomere maintenance.more » We report that primary mouse embryonic fibroblasts (MEFs) and primary cultured kidney cells from 6-8 month old DNA-PKcs deficient mice accumulate a large number of telomere fusions, yet still retain wildtype telomere length. Thus, the phenotype of this defect separates the two-telomere related phenotypes, capping and length maintenance. DNA-PKcs deficient MEFs also exhibit elevated levels of chromosome fragments and breaks, which correlate with increased telomere fusions. Based on the high levels of telomere fusions observed in DNA-PKcs deficient cells, we conclude that DNA-PKcs plays an important capping role at the mammalian telomere.« less
Li, Juan; Prins, Daniel; Park, Hyun Jung; Grinfeld, Jacob; Gonzalez-Arias, Carlos; Loughran, Stephen; Dovey, Oliver M; Klampfl, Thorsten; Bennett, Cavan; Hamilton, Tina L; Pask, Dean C; Sneade, Rachel; Williams, Matthew; Aungier, Juliet; Ghevaert, Cedric; Vassiliou, George S; Kent, David G; Green, Anthony R
2018-02-08
Somatic mutations in the endoplasmic reticulum chaperone calreticulin (CALR) are detected in approximately 40% of patients with essential thrombocythemia (ET) and primary myelofibrosis (PMF). Multiple different mutations have been reported, but all result in a +1-bp frameshift and generate a novel protein C terminus. In this study, we generated a conditional mouse knockin model of the most common CALR mutation, a 52-bp deletion. The mutant novel human C-terminal sequence is integrated into the otherwise intact mouse CALR gene and results in mutant CALR expression under the control of the endogenous mouse locus. CALR del/+ mice develop a transplantable ET-like disease with marked thrombocytosis, which is associated with increased and morphologically abnormal megakaryocytes and increased numbers of phenotypically defined hematopoietic stem cells (HSCs). Homozygous CALR del/del mice developed extreme thrombocytosis accompanied by features of MF, including leukocytosis, reduced hematocrit, splenomegaly, and increased bone marrow reticulin. CALR del/+ HSCs were more proliferative in vitro, but neither CALR del/+ nor CALR del/del displayed a competitive transplantation advantage in primary or secondary recipient mice. These results demonstrate the consequences of heterozygous and homozygous CALR mutations and provide a powerful model for dissecting the pathogenesis of CALR-mutant ET and PMF. © 2018 by The American Society of Hematology.
Myricetin Prevents Alveolar Bone Loss in an Experimental Ovariectomized Mouse Model of Periodontitis
Huang, Jialiang; Wu, Chuanlong; Tian, Bo; Zhou, Xiao; Ma, Nian; Qian, Yufen
2016-01-01
Periodontitis is a common chronic inflammatory disease, which leads to alveolar bone resorption. Healthy and functional alveolar bone, which can support the teeth and enable their movement, is very important for orthodontic treatment. Myricetin inhibited osteoclastogenesis by suppressing the expression of some genes, signaling pathways, and cytokines. This study aimed to investigate the effects of myricetin on alveolar bone loss in an ovariectomized (OVX) mouse model of periodontitis as well as in vitro osteoclast formation and bone resorption. Twenty-four healthy eight-week-old C57BL/J6 female mice were assigned randomly to four groups: phosphate-buffered saline (PBS) control (sham) OVX + ligature + PBS (vehicle), and OVX + ligature + low or high (2 or 5 mg∙kg−1∙day−1, respectively) doses of myricetin. Myricetin or PBS was injected intraperitoneally (i.p.) every other day for 30 days. The maxillae were collected and subjected to further examination, including micro-computed tomography (micro-CT), hematoxylin and eosin (H&E) staining, and tartrate-resistant acid phosphatase (TRAP) staining; a resorption pit assay was also performed in vitro to evaluate the effects of myricetin on receptor activator of nuclear factor κ-B ligand (RANKL)-induced osteoclastogenesis. Myricetin, at both high and low doses, prevented alveolar bone resorption and increased alveolar crest height in the mouse model and inhibited osteoclast formation and bone resorption in vitro. However, myricetin was more effective at high dose than at low dose. Our study demonstrated that myricetin had a positive effect on alveolar bone resorption in an OVX mouse model of periodontitis and, therefore, may be a potential agent for the treatment of periodontitis and osteoporosis. PMID:27011174
Hematopoiesis is severely altered in mice with an induced osteoblast deficiency.
Visnjic, Dora; Kalajzic, Zana; Rowe, David W; Katavic, Vedran; Lorenzo, Joseph; Aguila, Hector L
2004-05-01
We previously reported a transgenic mouse model expressing herpesvirus thymidine kinase (TK) gene under the control of a 2.3-kilobase fragment of the rat collagen alpha1 type I promoter (Col2.3 Delta TK). This construct confers lineage-specific expression in developing osteoblasts, allowing the conditional ablation of osteoblast lineage after treatment with ganciclovir (GCV). After GCV treatment these mice have profound alterations on bone formation leading to a progressive bone loss. In addition, treated animals also lose bone marrow cellularity. In this report we characterized hematopoietic parameters in GCV-treated Col2.3 Delta TK mice, and we show that after treatment transgenic animals lose lymphoid, erythroid, and myeloid progenitors in the bone marrow, followed by decreases in the number of hematopoietic stem cells (HSCs). Together with the decrease in bone marrow hematopoiesis, active extramedullary hematopoiesis was observed in the spleen and liver, as measured by an increase in peripheral HSCs and active primary in vitro hematopoiesis. After withdrawal of GCV, osteoblasts reappeared in the bone compartment together with a recovery of medullary and decrease in extramedullary hematopoiesis. These observations directly demonstrate the role of osteoblasts in hematopoiesis and provide a model to study the interactions between the mesenchymal and hematopoietic compartments in the marrow.
Deletion of ameloblastin exon 6 is associated with amelogenesis imperfecta
Poulter, James A.; Murillo, Gina; Brookes, Steven J.; Smith, Claire E. L.; Parry, David A.; Silva, Sandra; Kirkham, Jennifer; Inglehearn, Chris F.; Mighell, Alan J.
2014-01-01
Amelogenesis imperfecta (AI) describes a heterogeneous group of inherited dental enamel defects reflecting failure of normal amelogenesis. Ameloblastin (AMBN) is the second most abundant enamel matrix protein expressed during amelogenesis. The pivotal role of AMBN in amelogenesis has been confirmed experimentally using mouse models. However, no AMBN mutations have been associated with human AI. Using autozygosity mapping and exome sequencing, we identified genomic deletion of AMBN exon 6 in a second cousin consanguineous family with three of the six children having hypoplastic AI. The genomic deletion corresponds to an in-frame deletion of 79 amino acids, shortening the protein from 447 to 368 residues. Exfoliated primary teeth (unmatched to genotype) were available from family members. The most severely affected had thin, aprismatic enamel (similar to that reported in mice homozygous for Ambn lacking exons 5 and 6). Other teeth exhibited thicker but largely aprismatic enamel. One tooth had apparently normal enamel. It has been suggested that AMBN may function in bone development. No clinically obvious bone or other co-segregating health problems were identified in the family investigated. This study confirms for the first time that AMBN mutations cause non-syndromic human AI and that mouse models with disrupted Ambn function are valid. PMID:24858907
Campbell, J Preston; Karolak, Matthew R; Ma, Yun; Perrien, Daniel S; Masood-Campbell, S Kathryn; Penner, Niki L; Munoz, Steve A; Zijlstra, Andries; Yang, Xiangli; Sterling, Julie A; Elefteriou, Florent
2012-07-01
Bone and lung metastases are responsible for the majority of deaths in patients with breast cancer. Following treatment of the primary cancer, emotional and psychosocial factors within this population precipitate time to recurrence and death, however the underlying mechanism(s) remain unclear. Using a mouse model of bone metastasis, we provide experimental evidence that activation of the sympathetic nervous system, which is one of many pathophysiological consequences of severe stress and depression, promotes MDA-231 breast cancer cell colonization of bone via a neurohormonal effect on the host bone marrow stroma. We demonstrate that induction of RANKL expression in bone marrow osteoblasts, following β2AR stimulation, increases the migration of metastatic MDA-231 cells in vitro, independently of SDF1-CXCR4 signaling. We also show that the stimulatory effect of endogenous (chronic stress) or pharmacologic sympathetic activation on breast cancer bone metastasis in vivo can be blocked with the β-blocker propranolol, and by knockdown of RANK expression in MDA-231 cells. These findings indicate that RANKL promotes breast cancer cell metastasis to bone via its pro-migratory effect on breast cancer cells, independently of its effect on bone turnover. The emerging clinical implication, supported by recent epidemiological studies, is that βAR-blockers and drugs interfering with RANKL signaling, such as Denosumab, could increase patient survival if used as adjuvant therapy to inhibit both the early colonization of bone by metastatic breast cancer cells and the initiation of the "vicious cycle" of bone destruction induced by these cells.
Valverde, Paloma; Zhang, Jin; Fix, Amanda; Zhu, Ji; Ma, Wenli; Tu, Qisheng; Chen, Jake
2008-11-01
The purpose of this study was to determine the effects of bone sialoprotein (BSP) overexpression in bone metabolism in vivo by using a homozygous transgenic mouse line that constitutively overexpresses mouse BSP cDNA driven by the cytomegalovirus (CMV) promoter. CMV-BSP transgenic (TG) mice and wildtype mice were weighed, and their length, BMD, and trabecular bone volume were measured. Serum levels of RANKL, osteocalcin, osteoprotegerin (OPG), TRACP5b, and PTH were determined. Bone histomorphometry, von Kossa staining, RT-PCR analysis, Western blot, MTS assay, in vitro mineralization assay, and TRACP staining were also performed to delineate phenotypes of this transgenic mouse line. Compared with wildtype mice, adult TG mice exhibit mild dwarfism, lower values of BMD, and lower trabecular bone volume. TG mice serum contained increased calcium levels and decreased PTH levels, whereas the levels of phosphorus and magnesium were within normal limits. TG mice serum also exhibited lower levels of osteoblast differentiation markers and higher levels of markers, indicating osteoclastic activity and bone resorption. H&E staining, TRACP staining, and bone histomorphometry showed that adult TG bones were thinner and the number of giant osteoclasts in TG mice was higher, whereas there were no significant alterations in osteoblast numbers between TG mice and WT mice. Furthermore, the vertical length of the hypertrophic zone in TG mice was slightly enlarged. Moreover, ex vivo experiments indicated that overexpression of BSP decreased osteoblast population and increased osteoclastic activity. Partly because of its effects in enhancing osteoclastic activity and decreasing osteoblast population, BSP overexpression leads to an uncoupling of bone formation and resorption, which in turn results in osteopenia and mild dwarfism in mice. These findings are expected to help the development of therapies to metabolic bone diseases characterized by high serum level of BSP.
In vitro and in vivo evidence for orphan nuclear receptor RORα function in bone metabolism
Meyer, Thomas; Kneissel, Michaela; Mariani, Jean; Fournier, Brigitte
2000-01-01
Bone is a major target site for steroid hormone action. Steroid hormones like cortisol, vitamin D, and estradiol are responsible for principal events associated with bone formation and resorption. Over the past decade, new members of the nuclear hormone gene family have been identified that lack known ligands. These orphan receptors can be used to uncover signaling molecules that regulate yet unidentified physiological networks. In the present study the function of retinoic acid receptor-related orphan receptor (ROR) α in bone metabolism has been examined. We showed that RORα and RORγ, but not RORβ, are expressed in mesenchymal stem cells derived from bone marrow. Interestingly, for RORα we observed an increased messenger signal expression between control cells and cells undergoing osteogenic differentiation. Furthermore, the direct activation of mouse bone sialoprotein by RORα, typically 7-fold, has been shown. In contrast, transient overexpression of RORα overrides the activation of the osteocalcin promoter by 1α,25-dihydroxyvitamin D3. In addition, we have investigated bone mass parameters and bone geometry in the mouse mutant staggerer (sg/sg), a mouse strain that carries a deletion within the RORα gene. Homozygote mutants have thin long bones compared with the heterozygote animals and wild-type littermates. More interestingly, the bones of the sg/sg animals are osteopenic as indicated by the comparison of bone mineral contents of sg/sg animals to the heterozygote and wild-type animals. We conclude that these in vitro and in vivo results suggest a function for RORα in bone biology. RORα most likely acts by direct modulation of a bone matrix component. PMID:10900268
Poliachik, Sandra L.; Khokhlova, Tatiana D.; Wang, Yak-Nam; Simon, Julianna C.; Bailey, Michael R.
2015-01-01
Bone loss can result from bed rest, space flight, spinal cord injury or age-related hormonal changes. Current bone loss mitigation techniques include pharmaceutical interventions, exercise, pulsed ultrasound targeted to bone and whole body vibration. In this study, we attempted to mitigate paralysis-induced bone loss by applying focused ultrasound to the midbelly of a paralyzed muscle. We employed a mouse model of disuse that uses onabotulinumtoxinA-induced paralysis, which causes rapid bone loss in 5 d. A focused 2 MHz transducer applied pulsed exposures with pulse repetition frequency mimicking that of motor neuron firing during walking (80 Hz), standing (20 Hz), or the standard pulsed ultrasound frequency used in fracture healing (1 kHz). Exposures were applied daily to calf muscle for 4 consecutive d. Trabecular bone changes were characterized using micro-computed tomography. Our results indicated that application of certain focused pulsed ultrasound parameters was able to mitigate some of the paralysis-induced bone loss. PMID:24857416
NASA Astrophysics Data System (ADS)
Maher, Jason R.; Takahata, Masahiko; Awad, Hani A.; Berger, Andrew J.
2011-08-01
Although glucocorticoids are frequently prescribed for the symptomatic management of inflammatory disorders such as rheumatoid arthritis, extended glucocorticoid exposure is the leading cause of physician-induced osteoporosis and leaves patients at a high risk of fracture. To study the biochemical effects of glucocorticoid exposure and how they might affect biomechanical properties of the bone, Raman spectra were acquired from ex vivo tibiae of glucocorticoid- and placebo-treated wild-type mice and a transgenic mouse model of rheumatoid arthritis. Statistically significant spectral differences were observed due to both treatment regimen and mouse genotype. These differences are attributed to changes in the overall bone mineral composition, as well as the degree of phosphate mineralization in tibial cortical bone. In addition, partial least squares regression was used to generate a Raman-based prediction of each tibia's biomechanical strength as quantified by a torsion test. The Raman-based predictions were as accurate as those produced by microcomputed tomography derived parameters, and more accurate than the clinically-used parameter of bone mineral density. These results suggest that Raman spectroscopy could be a valuable tool for monitoring bone biochemistry in studies of bone diseases such as osteoporosis, including tests of drugs being developed to combat these diseases.
Koide, M; Okahashi, N; Tanaka, R; Kazuno, K; Shibasaki, K; Yamazaki, Y; Kaneko, K; Ueda, N; Ohguchi, M; Ishihara, Y; Noguchi, T; Nishihara, T
1999-09-01
It is known that bone resorption is mediated by osteoclasts, and lipopolysaccharide (LPS) and inflammatory mediators such as interleukin-1 (IL-1) and prostaglandin E2 (PGE2) induce osteoclast differentiation from haemopoietic cells, 2-aminoethanesulphonic acid, which is known as taurine, is an important nutrient and is added to most synthetic human infant milk formulas. In this study, it was found that 2-aminoethanesulphonic acid inhibits the stimulation of bone resorption mediated by LPS of the periodontopathic microorganism Actinobacillus actinomycetemcomitans Y4 in organ cultures of newborn mouse calvaria. The effect of 2-aminoethanesulphonic acid on the development and survival of osteoclast-like multinucleated cells produced in a mouse bone-marrow culture system was also examined. 2-aminoethanesulphonic acid (100 microg/ml) suppressed the formation of these osteoclast-like cells in the presence of LPS of A. actinomycetemcomitans Y4, IL-1alpha or PGE2 in mouse marrow cultures. On the other hand, 2-aminoethanesulphonic acid did not inhibit 1alpha, 25-dihydroxyvitamin D3-mediated osteoclast differentiation. Although IL-1alpha elongated the survival of the osteoclast-like cells, 2-aminoethanesulphonic acid blocked the supportive effect of IL-1alpha on osteoclast survival. 2-aminoethanesulphonic acid showed no effect on the growth of mouse osteoblasts. Finally, it was found that 2-aminoethanesulphonic acid inhibited alveolar bone resorption in experimental periodontitis in hamsters. These results suggest that 2-aminoethanesulphonic acid is an effective agent in preventing inflammatory bone resorption in periodontal diseases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vuong, A; Chow, J
Purpose: This study investigated the surface dose variation in preclinical irradiation using small animal, when monoenergetic photon beams with energy range from 50 keV to 1.25 MeV were used. Methods: Inhomogeneous, homogeneous and bone-tissue homogeneous mouse phantom based on the same CT image set were used. The homogeneous and bone-tissue homogeneous phantom were created with the relative electron density of all and only bone voxels of the mouse overridden to one, respectively. Monte Carlo simulation based on the EGSnrc-based code was used to calculate the surface dose, when the phantoms were irradiated by a 360° photon arc with energies rangingmore » from 50 keV to 1.25 MeV. The mean surface doses of the three phantoms were calculated. In addition, the surface doses from partial arcs, 45°–315°, 125°–225°, 45°–125° and 225°–315° covering the anterior, posterior, right lateral and left lateral region of the mouse were determined using different photon beam energies. Results: When the prescribed dose at the isocenter of the mouse was 2 Gy, the maximum mean surface doses, found at the 50-keV photon beams, were 0.358 Gy, 0.363 Gy and 0.350 Gy for the inhomogeneous, homogeneous and bone-tissue homogeneous mouse phantom, respectively. The mean surface dose of the mouse was found decreasing with an increase of the photon beam energy. For surface dose in different orientations, the lateral regions of the mouse were receiving lower dose than the anterior and posterior regions. This may be due to the increase of beam attenuation along the horizontal (left-right) axis than the vertical (anterior-posterior) in the mouse. Conclusion: It is concluded that consideration of phantom inhomogeneity in the dose calculation resulted in a lower mean surface dose of the mouse. The mean surface dose also decreased with an increase of photon beam energy in the kilovoltage range.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Polusani, Srikanth R.; Kar, Rekha; Riquelme, Manuel A.
2011-08-05
Highlights: {yields} Humans with severe forms of cytochrome P450 oxidoreductase (CYPOR) mutations show bone defects as observed in Antley-Bixler Syndrome. {yields} First report showing knockdown of CYPOR in osteoblasts decreased Connexin 43 (Cx43) protein levels. Cx43 is known to play an important role in bone modeling. {yields} Knockdown of CYPOR decreased Gap Junctional Intercellular Communication and hemichannel activity. {yields} Knockdown of CYPOR decreased Cx43 in mouse primary calvarial osteoblasts. {yields} Decreased Cx43 expression was observed at the transcriptional level. -- Abstract: Cytochrome P450 oxidoreductase (CYPOR) is a microsomal electron-transferring enzyme containing both FAD and FMN as co-factors, which provides themore » reducing equivalents to various redox partners, such as cytochromes P450 (CYPs), heme oxygenase (HO), cytochrome b{sub 5} and squalene monooxygenase. Human patients with severe forms of CYPOR mutation show bone defects such as cranio- and humeroradial synostoses and long bone fractures, known as Antley-Bixler-like Syndrome (ABS). To elucidate the role of CYPOR in bone, we knocked-down CYPOR in multiple osteoblast cell lines using RNAi technology. In this study, knock-down of CYPOR decreased the expression of Connexin 43 (Cx43), known to play a critical role in bone formation, modeling, and remodeling. Knock-down of CYPOR also decreased Gap Junction Intercellular Communication (GJIC) and hemichannel activity. Promoter luciferase assays revealed that the decrease in expression of Cx43 in CYPOR knock-down cells was due to transcriptional repression. Primary osteoblasts isolated from bone specific Por knock-down mice calvariae confirmed the findings in the cell lines. Taken together, our study provides novel insights into the regulation of gap junction function by CYPOR and suggests that Cx43 may play an important role(s) in CYPOR-mediated bone defects seen in patients.« less
2014-01-01
Background Ewing’s sarcoma (ES) is the second most frequent primitive malignant bone tumor in adolescents with a very poor prognosis for high risk patients, mainly when lung metastases are detected (overall survival <15% at 5 years). Zoledronic acid (ZA) is a potent inhibitor of bone resorption which induces osteoclast apoptosis. Our previous studies showed a strong therapeutic potential of ZA as it inhibits ES cell growth in vitro and ES primary tumor growth in vivo in a mouse model developed in bone site. However, no data are available on lung metastasis. Therefore, the aim of this study was to determine the effect of ZA on ES cell invasion and metastatic properties. Methods Invasion assays were performed in vitro in Boyden’s chambers covered with Matrigel. Matrix Metalloproteinase (MMP) activity was analyzed by zymography in ES cell culture supernatant. In vivo, a relevant model of spontaneous lung metastases which disseminate from primary ES tumor was induced by the orthotopic injection of 106 human ES cells in the tibia medullar cavity of nude mice. The effect of ZA (50 μg/kg, 3x/week) was studied over a 4-week period. Lung metastases were observed macroscopically at autopsy and analysed by histology. Results ZA induced a strong inhibition of ES cell invasion, probably due to down regulation of MMP-2 and −9 activities as analyzed by zymography. In vivo, ZA inhibits the dissemination of spontaneous lung metastases from a primary ES tumor but had no effect on the growth of established lung metastases. Conclusion These results suggest that ZA could be used early in the treatment of ES to inhibit bone tumor growth but also to prevent the early metastatic events to the lungs. PMID:24612486
Su, Nan; Sun, Qidi; Li, Can; Lu, Xiumin; Qi, Huabing; Chen, Siyu; Yang, Jing; Du, Xiaolan; Zhao, Ling; He, Qifen; Jin, Min; Shen, Yue; Chen, Di; Chen, Lin
2010-01-01
Achondroplasia (ACH) is a short-limbed dwarfism resulting from gain-of-function mutations in fibroblast growth factor receptor 3 (FGFR3). Previous studies have shown that ACH patients have impaired chondrogenesis, but the effects of FGFR3 on bone formation and bone remodeling at adult stages of ACH have not been fully investigated. Using micro-computed tomography and histomorphometric analyses, we found that 2-month-old Fgfr3G369C/+ mice (mouse model mimicking human ACH) showed decreased bone mass due to reduced trabecular bone volume and bone mineral density, defect in bone mineralization and increased osteoclast numbers and activity. Compared with primary cultures of bone marrow stromal cells (BMSCs) from wild-type mice, Fgfr3G369C/+ cultures showed decreased cell proliferation, increased osteogenic differentiation including up-regulation of alkaline phosphatase activity and expressions of osteoblast marker genes, and reduced bone matrix mineralization. Furthermore, our studies also suggest that decreased cell proliferation and enhanced osteogenic differentiation observed in Fgfr3G369C/+ BMSCs are caused by up-regulation of p38 phosphorylation and that enhanced Erk1/2 activity is responsible for the impaired bone matrix mineralization. In addition, in vitro osteoclast formation and bone resorption assays demonstrated that osteoclast numbers and bone resorption area were increased in cultured bone marrow cells derived from Fgfr3G369C/+ mice. These findings demonstrate that gain-of-function mutation in FGFR3 leads to decreased bone mass by regulating both osteoblast and osteoclast activities. Our studies provide new insight into the mechanism underlying the development of ACH. PMID:20053668
Kiernan, Jeffrey; Hu, Sally; Grynpas, Marc D; Davies, John E; Stanford, William L
2016-05-01
Age-related osteoporosis is driven by defects in the tissue-resident mesenchymal stromal cells (MSCs), a heterogeneous population of musculoskeletal progenitors that includes skeletal stem cells. MSC decline leads to reduced bone formation, causing loss of bone volume and the breakdown of bony microarchitecture crucial to trabecular strength. Furthermore, the low-turnover state precipitated by MSC loss leads to low-quality bone that is unable to perform remodeling-mediated maintenance--replacing old damaged bone with new healthy tissue. Using minimally expanded exogenous MSCs injected systemically into a mouse model of human age-related osteoporosis, we show long-term engraftment and markedly increased bone formation. This led to improved bone quality and turnover and, importantly, sustained microarchitectural competence. These data establish proof of concept that MSC transplantation may be used to prevent or treat human age-related osteoporosis. This study shows that a single dose of minimally expanded mesenchymal stromal cells (MSCs) injected systemically into a mouse model of human age-related osteoporosis display long-term engraftment and prevent the decline in bone formation, bone quality, and microarchitectural competence. This work adds to a growing body of evidence suggesting that the decline of MSCs associated with age-related osteoporosis is a major transformative event in the progression of the disease. Furthermore, it establishes proof of concept that MSC transplantation may be a viable therapeutic strategy to treat or prevent human age-related osteoporosis. ©AlphaMed Press.
Kiernan, Jeffrey; Hu, Sally; Grynpas, Marc D.
2016-01-01
Age-related osteoporosis is driven by defects in the tissue-resident mesenchymal stromal cells (MSCs), a heterogeneous population of musculoskeletal progenitors that includes skeletal stem cells. MSC decline leads to reduced bone formation, causing loss of bone volume and the breakdown of bony microarchitecture crucial to trabecular strength. Furthermore, the low-turnover state precipitated by MSC loss leads to low-quality bone that is unable to perform remodeling-mediated maintenance—replacing old damaged bone with new healthy tissue. Using minimally expanded exogenous MSCs injected systemically into a mouse model of human age-related osteoporosis, we show long-term engraftment and markedly increased bone formation. This led to improved bone quality and turnover and, importantly, sustained microarchitectural competence. These data establish proof of concept that MSC transplantation may be used to prevent or treat human age-related osteoporosis. Significance This study shows that a single dose of minimally expanded mesenchymal stromal cells (MSCs) injected systemically into a mouse model of human age-related osteoporosis display long-term engraftment and prevent the decline in bone formation, bone quality, and microarchitectural competence. This work adds to a growing body of evidence suggesting that the decline of MSCs associated with age-related osteoporosis is a major transformative event in the progression of the disease. Furthermore, it establishes proof of concept that MSC transplantation may be a viable therapeutic strategy to treat or prevent human age-related osteoporosis. PMID:26987353
Liu, Wenlong; Dan, Xiuli; Wang, Ting; Lu, William W; Pan, Haobo
2016-11-01
The development of an optimal animal model that could provide fast assessments of the interaction between bone and orthopedic implants is essential for both preclinical and theoretical researches in the design of novel biomaterials. Compared with other animal models, mice have superiority in accessing the well-developed transgenic modification techniques (e.g., cell tracing, knockoff, knockin, and so on), which serve as powerful tools in studying molecular mechanisms. In this study, we introduced the establishment of a mouse model, which was specifically tailored for the assessment of bone-implant interaction in a load-bearing bone marrow microenvironment and could potentially allow the molecular mechanism study of biomaterials by using transgenic technologies. The detailed microsurgery procedures for developing a bone defect (Φ = 0.8 mm) at the metaphysis region of the mouse femur were recorded. According to our results, the osteoconductive and osseointegrative properties of a well-studied 45S5 bioactive glass were confirmed by utilizing our mouse model, verifying the reliability of this model. The feasibility and reliability of the present model were further checked by using other materials as objects of study. Furthermore, our results indicated that this animal model provided a more homogeneous tissue-implant interacting surface than the rat at the early stage of implantation and this is quite meaningful for conducting quantitative analysis. The availability of transgenic techniques to mechanism study of biomaterials was further testified by establishing our model on Nestin-GFP transgenic mice. Intriguingly, the distribution of Nestin + cells was demonstrated to be recruited to the surface of 45S5 glass as early as 3 days postsurgery, indicating that Nestin + lineage stem cells may participate in the subsequent regeneration process. In summary, the bone-implant interaction mouse model could serve as a potential candidate to evaluate the early stage tissue response near the implant surface in a bone marrow microenvironment, and it also shows great potential in making transgenic animal resource applicable to biomaterial studies, so that the design of novel biomaterials could be better guided.
Yang, Haisheng; Embry, Rachel E.; Main, Russell P.
2017-01-01
The skeleton’s osteogenic response to mechanical loading can be affected by loading duration and rest insertion during a series of loading events. Prior animal loading studies have shown that the cortical bone response saturates quickly and short rest insertions between load cycles can enhance cortical bone formation. However, it remains unknown how loading duration and short rest insertion affect load-induced osteogenesis in the mouse tibial compressive loading model, and particularly in cancellous bone. To address this issue, we applied cyclic loading (-9 N peak load; 4 Hz) to the tibiae of three groups of 16 week-old female C57BL/6 mice for two weeks, with a different number of continuous load cycles applied daily to each group (36, 216 and 1200). A fourth group was loaded under 216 daily load cycles with a 10 s rest insertion after every fourth cycle. We found that as few as 36 load cycles per day were able to induce osteogenic responses in both cancellous and cortical bone. Furthermore, while cortical bone area and thickness continued to increase through 1200 cycles, the incremental increase in the osteogenic response decreased as load number increased, indicating a reduced benefit of the increasing number of load cycles. In the proximal metaphyseal cancellous bone, trabecular thickness increased with load up to 216 cycles. We also found that insertion of a 10 s rest between load cycles did not improve the osteogenic response of the cortical or cancellous tissues compared to continuous loading in this model given the age and sex of the mice and the loading parameters used here. These results suggest that relatively few load cycles (e.g. 36) are sufficient to induce osteogenic responses in both cortical and cancellous bone in the mouse tibial loading model. Mechanistic studies using the mouse tibial loading model to examine bone formation and skeletal mechanobiology could be accomplished with relatively few load cycles. PMID:28076363
Xing, Junchao; Jin, Huiyong; Hou, Tianyong; Chang, Zhengqi; Luo, Fei; Wang, Pinpin; Li, Zhiqiang; Xie, Zhao; Xu, Jianzhong
2014-12-01
To understand the cellular mechanism underlying bone defect healing in the context of tissue engineering, a reliable, reproducible, and standardized load-bearing large segmental bone defect model in small animals is indispensable. The aim of this study was to establish and evaluate a bilateral femoral defect model in mice. Donor mouse bone marrow mesenchymal stem cells (mBMSCs) were obtained from six mice (FVB/N) and incorporated into partially demineralized bone matrix scaffolds to construct tissue-engineered bones. In total, 36 GFP(+) mice were used for modeling. Titanium fixation plates with locking steel wires were attached to the femurs for stabilization, and 2-mm-long segmental bone defects were created in the bilateral femoral midshafts. The defects in the left and right femurs were transplanted with tissue-engineered bones and control scaffolds, respectively. The healing process was monitored by x-ray radiography, microcomputed tomography, and histology. The capacity of the transplanted mBMSCs to recruit host CD31(+) cells was investigated by immunofluorescence and real-time polymerase chain reaction. Postoperatively, no complication was observed, except that two mice died of unknown causes. Stable fixation of femurs and implants with full load bearing was achieved in all animals. The process of bone defect repair was significantly accelerated due to the introduction of mBMSCs. Moreover, the transplanted mBMSCs attracted more host CD31(+) endothelial progenitors into the grafts. The present study established a feasible, reproducible, and clinically relevant bilateral femoral large segmental bone defect mouse model. This model is potentially suitable for basic research in the field of bone tissue engineering. Copyright © 2014 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Lloyd, William R.; Sinder, Benjamin P.; Salemi, Joseph; Ominsky, Michael S.; Marini, Joan C.; Caird, Michelle S.; Morris, Michael D.; Kozloff, Kenneth M.
2015-02-01
Osteogenesis imperfecta (OI) is a genetic disorder resulting in defective collagen or collagen-associated proteins and fragile, brittle bones. To date, therapies to improve OI bone mass, such as bisphosphonates, have increased bone mass in the axial skeleton of OI patients, but have shown limited effects at reducing long bone fragility. Sclerostin antibody (Scl- Ab), currently in clinical trials for osteoporosis, stimulates bone formation and may have the potential to reduce long bone fracture rates in OI patients. Scl-Ab has been investigated as an anabolic therapy for OI in the Brtl/+ mouse model of moderately severe Type IV OI. While Scl-Ab increases long bone mass in the Brtl/+ mouse, it is not known whether material properties and composition changes also occur. Here, we report on the effects of Scl-Ab on wild type and Brtl/+ young (3 week) and adult (6 month) male mice. Scl-Ab was administered over 5 weeks (25mg/kg, 2x/week). Raman microspectroscopy and nanoindentation are used for bone composition and biomechanical bone property measurements in excised bone. Fluorescent labels (calcein and alizarin) at 4 time points over the entire treatment period are used to enable measurements at specific tissue age. Differences between wild type and Brtl/+ groups included variations in the mineral and matrix lattices, particularly the phosphate v1, carbonate v1, and the v(CC) proline and hydroxyproline stretch vibrations. Results of Raman spectroscopy corresponded to nanoindentation findings which indicated that old bone (near midcortex) is stiffer (higher elastic modulus) than new bone. We compare and contrast mineral to matrix and carbonate to phosphate ratios in young and adult mice with and without treatment.
EARLY ONSET OF CRANIOSYNOSTOSIS IN AN APERT MOUSE MODEL REVEALS CRITICAL FEATURES OF THIS PATHOLOGY
Holmes, Greg; Rothschild, Gerson; Roy, Upal Basu; Deng, Chu-Xia; Mansukhani, Alka; Basilico, Claudio
2009-01-01
Activating mutations of FGFRs1–3 cause craniosynostosis (CS), the premature fusion of cranial bones, in man and mouse. The mechanisms by which such mutations lead to CS have been variously ascribed to increased osteoblast proliferation, differentiation, and apoptosis, but it is not always clear how these disturbances relate to the process of suture fusion. We have reassessed coronal suture fusion in an Apert Fgfr2 (S252W) mouse model. We find that the critical event of CS is the early loss of basal sutural mesenchyme as the osteogenic fronts, expressing activated Fgfr2, unite to form a contiguous skeletogenic membrane. A mild increase in osteoprogenitor proliferation precedes but does not accompany this event, and apoptosis is insignificant. On the other hand, the more apical coronal suture initially forms appropriately but then undergoes fusion, albeit at a slower rate, accompanied by a significant decrease in osteoprogenitor proliferation, and increased osteoblast maturation. Apoptosis now accompanies fusion, but is restricted to bone fronts in contact with one another. We correlated these in vivo observations with the intrinsic effects of the activated Fgfr2 S252W mutation in primary osteoblasts in culture, which show an increased capacity for both proliferation and differentiation. Our studies suggest that the major determinant of Fgfr2-induced craniosynostosis is the failure to respond to signals that would halt the recruitment or the advancement of osteoprogenitor cells at the sites where sutures should normally form. PMID:19389359
Mechanical loading, damping, and load-driven bone formation in mouse tibiae.
Dodge, Todd; Wanis, Mina; Ayoub, Ramez; Zhao, Liming; Watts, Nelson B; Bhattacharya, Amit; Akkus, Ozan; Robling, Alexander; Yokota, Hiroki
2012-10-01
Mechanical loads play a pivotal role in the growth and maintenance of bone and joints. Although loading can activate anabolic genes and induce bone remodeling, damping is essential for preventing traumatic bone injury and fracture. In this study we investigated the damping capacity of bone, joint tissue, muscle, and skin using a mouse hindlimb model of enhanced loading in conjunction with finite element modeling to model bone curvature. Our hypothesis was that loads were primarily absorbed by the joints and muscle tissue, but that bone also contributed to damping through its compression and natural bending. To test this hypothesis, fresh mouse distal lower limb segments were cyclically loaded in axial compression in sequential bouts, with each subsequent bout having less surrounding tissue. A finite element model was generated to model effects of bone curvature in silico. Two damping-related parameters (phase shift angle and energy loss) were determined from the output of the loading experiments. Interestingly, the experimental results revealed that the knee joint contributed to the largest portion of the damping capacity of the limb, and bone itself accounted for approximately 38% of the total phase shift angle. Computational results showed that normal bone curvature enhanced the damping capacity of the bone by approximately 40%, and the damping effect grew at an accelerated pace as curvature was increased. Although structural curvature reduces critical loads for buckling in beam theory, evolution apparently favors maintaining curvature in the tibia. Histomorphometric analysis of the tibia revealed that in response to axial loading, bone formation was significantly enhanced in the regions that were predicted to receive a curvature-induced bending moment. These results suggest that in addition to bone's compressive damping capacity, surrounding tissues, as well as naturally-occurring bone curvature, also contribute to mechanical damping, which may ultimately affect bone remodeling and bone quality. Copyright © 2012 Elsevier Inc. All rights reserved.
Sweeney, Elizabeth; Roberts, Douglas; Lin, Angela; Guldberg, Robert
2013-01-01
Despite the appreciated interdependence of skeletal and hematopoietic development, the cell and matrix components of the hematopoietic niche remain to be fully defined. Utilizing mice with disrupted function of collagen X (ColX), a major hypertrophic cartilage matrix protein associated with endochondral ossification, our data identified a cytokine defect in trabecular bone cells at the chondro-osseous hematopoietic niche as a cause for aberrant B lymphopoiesis in these mice. Specifically, analysis of ColX transgenic and null mouse chondro-osseous regions via micro-computed tomography revealed an altered trabecular bone environment. Additionally, cocultures with hematopoietic and chondro-osseous cell types highlighted impaired hematopoietic support by ColX transgenic and null mouse derived trabecular bone cells. Further, cytokine arrays with conditioned media from the trabecular osteoblast cocultures suggested an aberrant hematopoietic cytokine milieu within the chondro-osseous niche of the ColX deficient mice. Accordingly, B lymphopoiesis was rescued in the ColX mouse derived trabecular osteoblast cocultures with interlukin-7, stem cell factor, and stromal derived factor-1 supplementation. Moreover, B cell development was restored in vivo after injections of interlukin-7. These data support our hypothesis that endrochondrally-derived trabecular bone cells and matrix constituents provide cytokine-rich niches for hematopoiesis. Furthermore, this study contributes to the emerging concept that niche defects may underlie certain immuno-osseous and hematopoietic disorders. PMID:23656481
Sweeney, Elizabeth; Roberts, Douglas; Lin, Angela; Guldberg, Robert; Jacenko, Olena
2013-10-01
Despite the appreciated interdependence of skeletal and hematopoietic development, the cell and matrix components of the hematopoietic niche remain to be fully defined. Utilizing mice with disrupted function of collagen X (ColX), a major hypertrophic cartilage matrix protein associated with endochondral ossification, our data identified a cytokine defect in trabecular bone cells at the chondro-osseous hematopoietic niche as a cause for aberrant B lymphopoiesis in these mice. Specifically, analysis of ColX transgenic and null mouse chondro-osseous regions via micro-computed tomography revealed an altered trabecular bone environment. Additionally, cocultures with hematopoietic and chondro-osseous cell types highlighted impaired hematopoietic support by ColX transgenic and null mouse derived trabecular bone cells. Further, cytokine arrays with conditioned media from the trabecular osteoblast cocultures suggested an aberrant hematopoietic cytokine milieu within the chondro-osseous niche of the ColX deficient mice. Accordingly, B lymphopoiesis was rescued in the ColX mouse derived trabecular osteoblast cocultures with interlukin-7, stem cell factor, and stromal derived factor-1 supplementation. Moreover, B cell development was restored in vivo after injections of interlukin-7. These data support our hypothesis that endrochondrally-derived trabecular bone cells and matrix constituents provide cytokine-rich niches for hematopoiesis. Furthermore, this study contributes to the emerging concept that niche defects may underlie certain immuno-osseous and hematopoietic disorders.
Jacobsen, Christina M; Schwartz, Marissa A; Roberts, Heather J; Lim, Kyung-Eun; Spevak, Lyudmila; Boskey, Adele L; Zurakowski, David; Robling, Alexander G; Warman, Matthew L
2016-09-01
Osteogenesis Imperfecta (OI) comprises a group of genetic skeletal fragility disorders. The mildest form of OI, Osteogenesis Imperfecta type I, is frequently caused by haploinsufficiency mutations in COL1A1, the gene encoding the α1(I) chain of type 1 collagen. Children with OI type I have a 95-fold higher fracture rate compared to unaffected children. Therapies for OI type I in the pediatric population are limited to anti-catabolic agents. In adults with osteoporosis, anabolic therapies that enhance Wnt signaling in bone improve bone mass, and ongoing clinical trials are determining if these therapies also reduce fracture risk. We performed a proof-of-principle experiment in mice to determine whether enhancing Wnt signaling in bone could benefit children with OI type I. We crossed a mouse model of OI type I (Col1a1(+/Mov13)) with a high bone mass (HBM) mouse (Lrp5(+/p.A214V)) that has increased bone strength from enhanced Wnt signaling. Offspring that inherited the OI and HBM alleles had higher bone mass and strength than mice that inherited the OI allele alone. However, OI+HBM and OI mice still had bones with lower ductility compared to wild-type mice. We conclude that enhancing Wnt signaling does not make OI bone normal, but does improve bone properties that could reduce fracture risk. Therefore, agents that enhance Wnt signaling are likely to benefit children and adults with OI type 1. Copyright © 2016 Elsevier Inc. All rights reserved.
Lowery, Caitlin D; Blosser, Wayne; Dowless, Michele; Knoche, Shelby; Stephens, Jennifer; Li, Huiling; Surguladze, David; Loizos, Nick; Luffer-Atlas, Debra; Oakley, Gerard J; Guo, Qianxu; Iyer, Seema; Rubin, Brian P; Stancato, Louis
2018-02-15
Purpose: Platelet-derived growth factor receptor α (PDGFRα) is implicated in several adult and pediatric malignancies, where activated signaling in tumor cells and/or cells within the microenvironment drive tumorigenesis and disease progression. Olaratumab (LY3012207/IMC-3G3) is a human mAb that exclusively binds to PDGFRα and recently received accelerated FDA approval and conditional EMA approval for treatment of advanced adult sarcoma patients in combination with doxorubicin. In this study, we investigated olaratumab in preclinical models of pediatric bone and soft tissue tumors. Experimental Design: PDGFRα expression was evaluated by qPCR and Western blot analysis. Olaratumab was investigated in in vitro cell proliferation and invasion assays using pediatric osteosarcoma and rhabdoid tumor cell lines. In vivo activity of olaratumab was assessed in preclinical mouse models of pediatric osteosarcoma and malignant rhabdoid tumor. Results: In vitro olaratumab treatment of osteosarcoma and rhabdoid tumor cell lines reduced proliferation and inhibited invasion driven by individual platelet-derived growth factors (PDGFs) or serum. Furthermore, olaratumab delayed primary tumor growth in mouse models of pediatric osteosarcoma and malignant rhabdoid tumor, and this activity was enhanced by combination with either doxorubicin or cisplatin. Conclusions: Overall, these data indicate that olaratumab, alone and in combination with standard of care, blocks the growth of some preclinical PDGFRα-expressing pediatric bone and soft tissue tumor models. Clin Cancer Res; 24(4); 847-57. ©2017 AACR . ©2017 American Association for Cancer Research.
Deletion of Mecom in mouse results in early-onset spinal deformity and osteopenia.
Juneja, Subhash C; Vonica, Alin; Zeiss, Caroline; Lezon-Geyda, Kimberly; Yatsula, Bogdan; Sell, David R; Monnier, Vincent M; Lin, Sharon; Ardito, Thomas; Eyre, David; Reynolds, David; Yao, Zhenqiang; Awad, Hani A; Yu, Hongbo; Wilson, Michael; Honnons, Sylvie; Boyce, Brendan F; Xing, Lianping; Zhang, Yi; Perkins, Archibald S
2014-03-01
Recent studies have indicated a role for a MECOM allele in susceptibility to osteoporotic fractures in humans. We have generated a mutation in Mecom in mouse (termed ME(m1)) via lacZ knock-in into the upstream transcription start site for the gene, resulting in disruption of Mds1 and Mds1-Evi1 transcripts, but not of Evi1 transcripts. We demonstrate that ME(m1/m1) mice have severe kyphoscoliosis that is reminiscent of human congenital or primary kyphoscoliosis. ME(m1/m1) mice appear normal at birth, but by 2weeks, they exhibit a slight lumbar lordosis and narrowed intervertebral space. This progresses to severe lordosis with disc collapse and synostosis, together with kyphoscoliosis. Bone formation and strength testing show that ME(m1/m1) mice have normal bone formation and composition but are osteopenic. While endochondral bone development is normal, it is markedly dysplastic in its organization. Electron micrographs of the 1week postnatal intervertebral discs reveals marked disarray of collagen fibers, consistent with an inherent weakness in the non-osseous connective tissue associated with the spine. These findings indicate that lack of ME leads to a complex defect in both osseous and non-osseous musculoskeletal tissues, including a marked vertebral osteopenia, degeneration of the IVD, and disarray of connective tissues, which is likely due to an inherent inability to establish and/or maintain components of these tissues. Copyright © 2013 Elsevier Inc. All rights reserved.
Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET
Peinado, Héctor; Alečković, Maša; Lavotshkin, Simon; Matei, Irina; Costa-Silva, Bruno; Moreno-Bueno, Gema; Hergueta-Redondo, Marta; Williams, Caitlin; García-Santos, Guillermo; Nitadori-Hoshino, Ayuko; Hoffman, Caitlin; Badal, Karen; Garcia, Benjamin A.; Callahan, Margaret K.; Yuan, Jianda; Martins, Vilma R.; Skog, Johan; Kaplan, Rosandra N.; Brady, Mary S.; Wolchok, Jedd D.; Chapman, Paul B.; Kang, Yibin; Bromberg, Jacqueline; Lyden, David
2013-01-01
Tumor-derived exosomes are emerging mediators of tumorigenesis with tissue-specific addresses and messages. We explored the function of melanoma-derived exosomes in the formation of primary tumor and metastases in mouse and human subjects. Exosomes from highly metastatic melanoma increased the metastatic behavior of primary tumors by permanently “educating” bone marrow (BM) progenitors via the MET receptor. Melanoma-derived exosomes also induced vascular leakiness at pre-metastatic sites, and reprogrammed BM progenitors towards a c-Kit+Tie2+Met+ pro-vasculogenic phenotype. Reducing Met expression in exosomes diminished the pro-metastatic behavior of BM cells. Importantly, MET expression was elevated in circulating CD45−C-KITlow/+TIE2+ BM progenitors from metastatic melanoma subjects. RAB1a, RAB5b, RAB7, and RAB27a were highly expressed in melanoma cells and Rab27a RNA interference decreased exosome production, preventing BM education, tumor growth and metastasis. Finally, we identified an exosome-specific “melanoma signature” with prognostic and therapeutic potential, comprised of TYRP2, VLA-4, HSP70, an HSP90 isoform and the MET oncoprotein. PMID:22635005
Spontaneous osteosarcoma of the femur in a non-obese diabetic mouse
Hong, Sunhwa; Lee, Hyun-A; Choe, Ohmok; Chung, Youngho
2011-01-01
An abnormal swelling was identified in the distal portion of the right femur in a 1-year-old non-obese diabetic (NOD) mouse. Grossly, a large mass of the distal femur was observed in the right femur. Lesions were poorly marginated, associated with destruction of the cancellous and cortical elements of the bone, and showed ossification within the soft tissue component. Histologically, the tumor was identified as a poorly differentiated sarcoma. Histopathologic examination of the bone masses revealed invasive proliferation of poorly differentiated neoplastic mesenchymal cells forming streams, bundles, and nests, which resulted in destruction of normal bone. Neoplastic cells exhibited random variation in cellular appearance and arrangement, as well as matrix composition and abundance. Haphazard and often intermingling patterns of osteogenic, chondroblastic, lipoblastic, and angiogenic tissues were present. Larger areas of neoplastic bone and hyaline cartilage contained multiple large areas of hemorrhage and necrosis bordered by neoplastic cells. The mass was diagnosed as an osteosarcoma. To our knowledge, this is the first spontaneous osteosarcoma in an NOD mouse. PMID:21998615
Role of FGF/FGFR signaling in skeletal development and homeostasis: learning from mouse models
Su, Nan; Jin, Min; Chen, Lin
2014-01-01
Fibroblast growth factor (FGF)/fibroblast growth factor receptor (FGFR) signaling plays essential roles in bone development and diseases. Missense mutations in FGFs and FGFRs in humans can cause various congenital bone diseases, including chondrodysplasia syndromes, craniosynostosis syndromes and syndromes with dysregulated phosphate metabolism. FGF/FGFR signaling is also an important pathway involved in the maintenance of adult bone homeostasis. Multiple kinds of mouse models, mimicking human skeleton diseases caused by missense mutations in FGFs and FGFRs, have been established by knock-in/out and transgenic technologies. These genetically modified mice provide good models for studying the role of FGF/FGFR signaling in skeleton development and homeostasis. In this review, we summarize the mouse models of FGF signaling-related skeleton diseases and recent progresses regarding the molecular mechanisms, underlying the role of FGFs/FGFRs in the regulation of bone development and homeostasis. This review also provides a perspective view on future works to explore the roles of FGF signaling in skeletal development and homeostasis. PMID:26273516
Araujo, John C; Poblenz, Ann; Corn, Paul; Parikh, Nila U; Starbuck, Michael W; Thompson, Jerry T; Lee, Francis; Logothetis, Christopher J; Darnay, Bryant G
2009-11-01
Therapies to target prostate cancer bone metastases have only limited effects. New treatments are focused on the interaction between cancer cells, bone marrow cells and the bone matrix. Osteoclasts play an important role in the development of bone tumors caused by prostate cancer. Since Src kinase has been shown to be necessary for osteoclast function, we hypothesized that dasatinib, a Src family kinase inhibitor, would reduce osteoclast activity and prostate cancer (PC-3) cell-induced osteoclast formation. Dasatinib inhibited RANKL-induced osteoclast differentiation of bone marrow-derived monocytes with an EC(50) of 7.5 nM. PC-3 cells, a human prostate cancer cell line, were able to differentiate RAW 264.7 cells, a murine monocytic cell line, into osteoclasts, and dasatinib inhibited this differentiation. In addition, conditioned medium from PC-3 cell cultures was able to differentiate RAW 264.7 cells into osteoclasts and this too, was inhibited by dasatinib. Even the lowest concentration of dasatinib, 1.25 nmol, inhibited osteoclast differentiation by 29%. Moreover, dasatinib inhibited osteoclast activity by 58% as measured by collagen 1 release. We performed in vitro experiments utilizing the Src family kinase inhibitor dasatinib to target osteoclast activation as a means of inhibiting prostate cancer bone metastases. Dasatinib inhibits osteoclast differentiation of mouse primary bone marrow-derived monocytes and PC-3 cell-induced osteoclast differentiation. Dasatinib also inhibits osteoclast degradation activity. Inhibiting osteoclast differentiation and activity may be an effective targeted therapy in patients with prostate cancer bone metastases.
Ma, Zhong-ping; Liao, Jia-cheng; Zhao, Chang; Cai, Dao-zhang
2015-08-01
Osteoporosis (OP) often increases the risk of bone fracture and other complications and is a major clinical problem. Previous studies have found that high blood pressure is associated with bone formation abnormalities, resulting in increased calcium loss. We have investigated the effect of the antihypertensive drug benidipine on bone marrow stromal cell (BMSC) differentiation into osteoblasts and bone formation under osteoporotic conditions. We used a combination of in vitro and in vivo approaches to test the hypothesis that benidipine promotes murine BMSC differentiation into osteoblasts. Alkaline phosphatase (ALP), osteocalcin (OCN), runt-related transcription factor 2 (RUNX2), β-catenin, and low-density lipoprotein receptor-related protein 5 (LRP5) protein expression was evaluated in primary femoral BMSCs from C57/BL6 mice cultured under osteogenic conditions for 2 weeks to examine the effects of benidipine. An ovariectomized (OVX) mouse model was used to investigate the effect of benidipine treatment for 3 months in vivo. We found that ALP, OCN, and RUNX2 expression was up-regulated and WNT/β-catenin signaling was enhanced in vitro and in vivo. In OVX mice that were intragastrically administered benidipine, bone parameters (trabecular thickness, bone mineral density, and trabecular number) in the distal femoral metaphysis were significantly increased compared with control OVX mice. Consistently, benidipine promoted BMSC differentiation into osteoblasts and protected against bone loss in OVX mice. Therefore, benidipine might be a suitable candidate for the treatment of patients with postmenopausal osteoporosis and hypertension.
Automated Cell Detection and Morphometry on Growth Plate Images of Mouse Bone
Ascenzi, Maria-Grazia; Du, Xia; Harding, James I; Beylerian, Emily N; de Silva, Brian M; Gross, Ben J; Kastein, Hannah K; Wang, Weiguang; Lyons, Karen M; Schaeffer, Hayden
2014-01-01
Microscopy imaging of mouse growth plates is extensively used in biology to understand the effect of specific molecules on various stages of normal bone development and on bone disease. Until now, such image analysis has been conducted by manual detection. In fact, when existing automated detection techniques were applied, morphological variations across the growth plate and heterogeneity of image background color, including the faint presence of cells (chondrocytes) located deeper in tissue away from the image’s plane of focus, and lack of cell-specific features, interfered with identification of cell. We propose the first method of automated detection and morphometry applicable to images of cells in the growth plate of long bone. Through ad hoc sequential application of the Retinex method, anisotropic diffusion and thresholding, our new cell detection algorithm (CDA) addresses these challenges on bright-field microscopy images of mouse growth plates. Five parameters, chosen by the user in respect of image characteristics, regulate our CDA. Our results demonstrate effectiveness of the proposed numerical method relative to manual methods. Our CDA confirms previously established results regarding chondrocytes’ number, area, orientation, height and shape of normal growth plates. Our CDA also confirms differences previously found between the genetic mutated mouse Smad1/5CKO and its control mouse on fluorescence images. The CDA aims to aid biomedical research by increasing efficiency and consistency of data collection regarding arrangement and characteristics of chondrocytes. Our results suggest that automated extraction of data from microscopy imaging of growth plates can assist in unlocking information on normal and pathological development, key to the underlying biological mechanisms of bone growth. PMID:25525552
How tough is Brittle Bone? Investigating Osteogenesis Imperfecta in Mouse Bone††
Carriero, A.; Zimmermann, E. A.; Paluszny, A.; Tang, S. Y.; Bale, H.; Busse, B.; Alliston, T.; Kazakia, G.
2015-01-01
The multiscale hierarchical structure of bone is naturally optimized to resist fractures. In osteogenesis imperfecta, or brittle bone disease, genetic mutations affect the quality and/or quantity of collagen, dramatically increasing bone fracture risk. Here we reveal how the collagen defect results in bone fragility in a mouse model of osteogenesis imperfecta (oim), which has homotrimeric α1(I) collagen. At the molecular level we attribute the loss in toughness to a decrease in the stabilizing enzymatic crosslinks and an increase in non-enzymatic crosslinks, which may break prematurely inhibiting plasticity. At the tissue level, high vascular canal density reduces the stable crack growth, and extensive woven bone limits the crack-deflection toughening during crack growth. This demonstrates how modifications at the bone molecular level have ramifications at larger length scales affecting the overall mechanical integrity of the bone; thus, treatment strategies have to address multiscale properties in order to regain bone toughness. In this regard, findings from the heterozygous oim bone, where defective as well as normal collagen are present, suggest that increasing the quantity of healthy collagen in these bones helps to recover toughness at the multiple length scales. PMID:24420672
Bouleftour, Wafa; Juignet, Laura; Bouet, Guenaelle; Granito, Renata Neves; Vanden-Bossche, Arnaud; Laroche, Norbert; Aubin, Jane E; Lafage-Proust, Marie-Hélène; Vico, Laurence; Malaval, Luc
2016-01-01
Bone Sialoprotein (BSP) is a member of the "Small Integrin-Binding Ligand N-linked Glycoproteins" (SIBLING) extracellular matrix protein family of mineralized tissues. BSP has been less studied than other SIBLING proteins such as Osteopontin (OPN), which is coexpressed with it in several skeletal cell types. Here we review the contribution of genetically engineered mice (BSP gene knockout and overexpression) to the understanding of the role of BSP in the bone organ. The studies made so far highlight the role of BSP in skeletal mineralization, as well as its importance for proper osteoblast and osteoclast differentiation and activity, most prominently in primary/repair bone. The absence of BSP also affects the local environment of the bone tissue, in particular hematopoiesis and vascularization. Interestingly, lack of BSP induces an overexpression of OPN, and the cognate protein could be responsible for some aspects of the BSP gene knockout skeletal phenotype, while replacing BSP for some of its functions. Such interplay between the partly overlapping functions of SIBLING proteins, as well as the network of cross-regulations in which they are involved should now be the focus of further work. Copyright © 2016 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.
The STR/ort mouse model of spontaneous osteoarthritis - an update.
Staines, K A; Poulet, B; Wentworth, D N; Pitsillides, A A
2017-06-01
Osteoarthritis is a degenerative joint disease and a world-wide healthcare burden. Characterized by cartilage degradation, subchondral bone thickening and osteophyte formation, osteoarthritis inflicts much pain and suffering, for which there are currently no disease-modifying treatments available. Mouse models of osteoarthritis are proving critical in advancing our understanding of the underpinning molecular mechanisms. The STR/ort mouse is a well-recognized model which develops a natural form of osteoarthritis very similar to the human disease. In this Review we discuss the use of the STR/ort mouse in understanding this multifactorial disease with an emphasis on recent advances in its genetics and its bone, endochondral and immune phenotypes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Verma, Subash Chand; Agarwal, Pooja; Krishnan, Manju Y
2016-03-01
Keeping with their classical role in wound healing, fibroblasts of the lung take part in the resolution of tubercular granulomas. They are totally absent in nascent granulomas, but surround necrotizing granulomas, and are the majority of cells in healed granulomas. Lung fibroblasts may become infected with Mycobacterium tuberculosis (Mtb). Two previous studies suggested an immunomodulatory effect of fibroblasts on infected macrophages. In the present study, we looked at the role of primary mouse lung fibroblasts on naive or activated mouse bone marrow macrophages infected with Mtb and the effect of infection on fibroblast properties. We observed that with fibroblasts in the vicinity, infected naive macrophages restricted the bacterial growth, while activated macrophages turned more bactericidal with concomitant increase in nitrite production. Neutralizing IL-1α in fibroblast supernatant reduced the nitrite production by infected macrophages. Secretion of IL-6 and MCP-1 was down-regulated, while TNF-α was up-regulated in infected naive macrophages. In infected activated macrophages, the secretion of IL-6 was up-regulated, while that of MCP-1 and TNF-α was unaffected. The 'fibroblast effects' were enhanced when the fibroblasts too were infected. Mtb induced IL-1 secretion and pro-fibrotic responses by fibroblasts. Mtb-induced myofibroblast conversion was blocked by rapamycin suggesting cell signalling via mTOR. Copyright © 2015 Elsevier Ltd. All rights reserved.
Vanderkerken, K.; Goes, E.; De Raeve, H.; Radl, J.; Van Camp, B.
1996-01-01
The evolution of bone lesions in transplantable C57BL/KaLwRjj 5T mouse myeloma (MM) has been followed in vivo. Mice were anaesthetised and a radiograph of the pelvis and hind legs was performed by a radiograph dedicated for mammography. This is the first description of an in vivo technique under experimental conditions whereby the development of bone lesions owing to the MM growth was demonstrated. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 6 PMID:8664113
Lozano, D; Fernández-de-Castro, L; Portal-Núñez, S; López-Herradón, A; Dapía, S; Gómez-Barrena, E; Esbrit, P
2011-01-01
BACKGROUND AND PURPOSE Current data suggest that parathyroid hormone (PTH)-related peptide (PTHrP) domains other than the N-terminal PTH-like domain contribute to its role as an endogenous bone anabolic factor. PTHrP-107-139 inhibits bone resorption, a fact which has precluded an unequivocal demonstration of its possible anabolic action in vivo. We thus sought to characterize the osteogenic effects of this peptide using a mouse model of diabetic low-turnover osteopaenia. EXPERIMENTAL APPROACH PTHrP-107-139 was administered to streptozotocin-induced diabetic mice, with or without bone marrow ablation, for 13 days. Osteopaenia was confirmed by dual-energy X-ray absorptiometry and microcomputed tomography analysis. Histological analysis was performed on paraffin-embedded bone tissue sections by haematoxylin/eosin and Masson's staining, and tartrate-resistent acid phosphatase immunohistochemistry. Mouse bone marrow stromal cells and osteoblastic MC3T3-E1 cells were cultured in normal and/or high glucose (HG) medium. Osteogenic and adipogenic markers were assessed by real-time PCR, and PTHrP and the PTH1 receptor protein expression by Western blot analysis. KEY RESULTS PTHrP-107-139 reversed the alterations in bone structure and osteoblast function, and also promoted bone healing after marrow ablation without affecting the number of osteoclast-like cells in diabetic mice. This peptide also reversed the high-glucose-induced changes in osteogenic differentiation in both bone marrow stromal cells and the more differentiated MC3T3-E1 cells. CONCLUSIONS AND IMPLICATIONS These findings demonstrate that PTHrP-107-139 promotes bone formation in diabetic mice. This mouse model and in vitro cell cultures allowed us to identify various anabolic effects of this peptide in this scenario. PMID:21175568
Gallium modulates osteoclastic bone resorption in vitro without affecting osteoblasts
Verron, Elise; Masson, Martial; Khoshniat, Solmaz; Duplomb, Laurence; Wittrant, Yohann; Baud'huin, Marc; Badran, Zahi; Bujoli, Bruno; Janvier, Pascal; Scimeca, Jean-Claude; Bouler, Jean-Michel; Guicheux, Jérôme
2010-01-01
Background and purpose: Gallium (Ga) has been shown to be effective in the treatment of disorders associated with accelerated bone loss, including cancer-related hypercalcemia and Paget's disease. These clinical applications suggest that Ga could reduce bone resorption. However, few studies have studied the effects of Ga on osteoclastic resorption. Here, we have explored the effects of Ga on bone cells in vitro. Experimental approach: In different osteoclastic models [osteoclasts isolated from long bones of neonatal rabbits (RBC), murine RAW 264.7 cells and human CD14-positive cells], we have performed resorption activity tests, staining for tartrate resistant acid phosphatase (TRAP), real-time polymerase chain reaction analysis, viability and apoptotic assays. We also evaluated the effect of Ga on osteoblasts in terms of proliferation, viability and activity by using an osteoblastic cell line (MC3T3-E1) and primary mouse osteoblasts. Key results: Gallium dose-dependently (0–100 µM) inhibited the in vitro resorption activity of RBC and induced a significant decrease in the expression level of transcripts coding for osteoclastic markers in RAW 264.7 cells. Ga also dramatically reduced the formation of TRAP-positive multinucleated cells. Ga down-regulated in a dose-dependant manner the expression of the transcription factor NFATc1. However, Ga did not affect the viability or activity of primary and MC3T3-E1 osteoblasts. Conclusions and implications: Gallium exhibits a dose-dependent anti-osteoclastic effect by reducing in vitro osteoclastic resorption, differentiation and formation without negatively affecting osteoblasts. We provide evidence that this inhibitory mechanism involves down-regulation of NFATc1 expression, a master regulator of RANK-induced osteoclastic differentiation. PMID:20397300
Hosogane, Naobumi; Huang, Zhiping; Rawlins, Bernard A.; Liu, Xia; Boachie-Adjei, Oheneba; Boskey, Adele L.; Zhu, Wei
2010-01-01
Stromal derived factor-1 (SDF-1) is a chemokine signaling molecule that binds to its transmembrane receptor CXC chemokine receptor-4 (CXCR4). While we previously detected that SDF-1 was co-required with bone morphogenetic protein 2 (BMP2) for differentiating mesenchymal C2C12 cells into osteoblastic cells, it is unknown whether SDF-1 is similarly involved in the osteogenic differentiation of mesenchymal stem cells (MSCs). Therefore, here we examined the role of SDF-1 signaling during BMP2-induced osteogenic differentiation of primary MSCs that were derived from human and mouse bone marrow. Our data showed that blocking of the SDF-1/CXCR4 signal axis or adding SDF-1 protein to MSCs significantly affected BMP2-induced alkaline phosphatase (ALP) activity and osteocalcin (OCN) synthesis, markers of preosteoblasts and mature osteoblasts, respectively. Moreover, disrupting the SDF-1 signaling impaired bone nodule mineralization during terminal differentiation of MSCs. Furthermore, we detected that blocking of the SDF-1 signaling inhibited the BMP2-induced early expression of Runt-related factor-2 (Runx2) and osterix (Osx), two “master” regulators of osteogenesis, and the SDF-1 effect was mediated via intracellular Smad and Erk activation. In conclusion, our results demonstrated a regulatory role of SDF-1 in BMP2-induced osteogenic differentiation of MSCs, as perturbing the SDF-1 signaling affected the differentiation of MSCs towards osteoblastic cells in response to BMP2 stimulation. These data provide novel insights into molecular mechanisms underlying MSC osteogenesis, and will contribute to the development of MSC therapies for enhancing bone formation and regeneration in broad orthopaedic situations. PMID:20362069
Valverde, Paloma; Zhang, Jin; Fix, Amanda; Zhu, Ji; Ma, Wenli; Tu, Qisheng; Chen, Jake
2008-01-01
The purpose of this study was to determine the effects of bone sialoprotein (BSP) overexpression in bone metabolism in vivo by using a homozygous transgenic mouse line that constitutively overexpresses mouse BSP cDNA driven by the cytomegalovirus (CMV) promoter. CMV-BSP transgenic (TG) mice and wildtype mice were weighed, and their length, BMD, and trabecular bone volume were measured. Serum levels of RANKL, osteocalcin, osteoprotegerin (OPG), TRACP5b, and PTH were determined. Bone histomorphometry, von Kossa staining, RT-PCR analysis, Western blot, MTS assay, in vitro mineralization assay, and TRACP staining were also performed to delineate phenotypes of this transgenic mouse line. Compared with wildtype mice, adult TG mice exhibit mild dwarfism, lower values of BMD, and lower trabecular bone volume. TG mice serum contained increased calcium levels and decreased PTH levels, whereas the levels of phosphorus and magnesium were within normal limits. TG mice serum also exhibited lower levels of osteoblast differentiation markers and higher levels of markers, indicating osteoclastic activity and bone resorption. H&E staining, TRACP staining, and bone histomorphometry showed that adult TG bones were thinner and the number of giant osteoclasts in TG mice was higher, whereas there were no significant alterations in osteoblast numbers between TG mice and WT mice. Furthermore, the vertical length of the hypertrophic zone in TG mice was slightly enlarged. Moreover, ex vivo experiments indicated that overexpression of BSP decreased osteoblast population and increased osteoclastic activity. Partly because of its effects in enhancing osteoclastic activity and decreasing osteoblast population, BSP overexpression leads to an uncoupling of bone formation and resorption, which in turn results in osteopenia and mild dwarfism in mice. These findings are expected to help the development of therapies to metabolic bone diseases characterized by high serum level of BSP. PMID:18597627
THE INFLUENCE OF HYDROCORTISONE ON THE ACTION OF EXCESS VITAMIN A ON LIMB BONE RUDIMENTS IN CULTURE
Fell, Honor B.; Thomas, Lewis
1961-01-01
The effect of hydrocortisone has been studied in organ cultures of the cartilaginous long bone rudiments from 7-day chick embryos and of the well ossified limb bones from late fetal mice. In the chick rudiments, which grow rapidly in culture, the growth rate was much reduced by hydrocortisone, less intercellular material was formed, and the hypertrophic cells of the shaft were much smaller than in the controls in normal medium. In the late fetal mouse bones, which grow very little in culture, hydrocortisone had no obvious effect on growth but arrested resorption of the cartilage. These effects resemble those described by others in the skeleton of animals treated with cortisone or hydrocortisone. The influence of hydrocortisone on the response of the chick and mouse explants to excess vitamin A was investigated. In the presence of excess vitamin A, cartilage (chick, mouse) and bone (mouse) rapidly disintegrated, but when hydrocortisone also was added to the medium, this dissolution of the intercellular material was much retarded, though not suppressed. The retardative action of hydrocortisone on the changes produced by excess vitamin A in skeletal tissue in culture, contrasts sharply with the strongly additive effect of the two agents on the skeleton in the intact animal (Selye, 1958). It is suggested that this discrepancy between the results obtained in vitro and in vivo is probably due to systemic factors that operate in the body but are eliminated in organ cultures. PMID:13698768
Plumb, Darren; Vo, Phoung; Shah, Mittal; Staines, Katherine; Sampson, Alexandra; Shefelbine, Sandra; Pitsillides, Andrew A.; Bou-Gharios, George
2016-01-01
Bone development and length relies on the growth plate formation, which is dependent on degradative enzymes such as MMPs. Indeed, deletion of specific members of this enzyme family in mice results in important joint and bone abnormalities, suggesting a role in skeletal development. As such, the control of MMP activity is vital in the complex process of bone formation and growth. We generated a transgenic mouse line to overexpress TIMP3 in mouse chondrocytes using the Col2a1-chondrocyte promoter. This overexpression in cartilage resulted in a transient shortening of growth plate in homozygote mice but bone length was restored at eight weeks of age. However, tibial bone structure and mechanical properties remained compromised. Despite no transgene expression in adult osteoblasts from transgenic mice in vitro, their differentiation capacity was decreased. Neonates, however, did show transgene expression in a subset of bone cells. Our data demonstrate for the first time that transgene function persists in the chondro-osseous lineage continuum and exert influence upon bone quantity and quality. PMID:28002442
Parathyroid hormone-related peptide activates and modulates TRPV1 channel in human DRG neurons.
Shepherd, A J; Mickle, A D; McIlvried, L A; Gereau, R W; Mohapatra, D P
2018-05-24
Parathyroid hormone-related peptide (PTHrP) is associated with advanced tumor growth and metastasis, especially in breast, prostate and myeloma cancers that metastasize to bones, resulting in debilitating chronic pain conditions. Our recent studies revealed that the receptor for PTHrP, PTH1R, is expressed in mouse DRG sensory neurons, and its activation leads to flow-activation and modulation of TRPV1 channel function, resulting in peripheral heat and mechanical hypersensitivity. In order to verify the translatability of our findings in rodents to humans, we explored whether this signalling axis operates in primary human DRG sensory neurons. Analysis of gene expression data from recently reported RNA deep sequencing experiments performed on mouse and human DRGs reveals that PTH1R is expressed in DRG and tibial nerve. Furthermore, exposure of cultured human DRG neurons to PTHrP leads to slow-sustained activation of TRPV1 and modulation of capsaicin-induced channel activation. Both activation and modulation of TRPV1 by PTHrP were dependent on PKC activity. Our findings suggest that functional PTHrP/PTH1R-TRPV1 signalling exists in human DRG neurons, which could contribute to local nociceptor excitation in the vicinity of metastatic bone tumor microenvironment. © 2018 European Pain Federation - EFIC®.
Deletion of ameloblastin exon 6 is associated with amelogenesis imperfecta.
Poulter, James A; Murillo, Gina; Brookes, Steven J; Smith, Claire E L; Parry, David A; Silva, Sandra; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J
2014-10-15
Amelogenesis imperfecta (AI) describes a heterogeneous group of inherited dental enamel defects reflecting failure of normal amelogenesis. Ameloblastin (AMBN) is the second most abundant enamel matrix protein expressed during amelogenesis. The pivotal role of AMBN in amelogenesis has been confirmed experimentally using mouse models. However, no AMBN mutations have been associated with human AI. Using autozygosity mapping and exome sequencing, we identified genomic deletion of AMBN exon 6 in a second cousin consanguineous family with three of the six children having hypoplastic AI. The genomic deletion corresponds to an in-frame deletion of 79 amino acids, shortening the protein from 447 to 368 residues. Exfoliated primary teeth (unmatched to genotype) were available from family members. The most severely affected had thin, aprismatic enamel (similar to that reported in mice homozygous for Ambn lacking exons 5 and 6). Other teeth exhibited thicker but largely aprismatic enamel. One tooth had apparently normal enamel. It has been suggested that AMBN may function in bone development. No clinically obvious bone or other co-segregating health problems were identified in the family investigated. This study confirms for the first time that AMBN mutations cause non-syndromic human AI and that mouse models with disrupted Ambn function are valid. © The Author 2014. Published by Oxford University Press.
Knee loading inhibits osteoclast lineage in a mouse model of osteoarthritis
Li, Xinle; Yang, Jing; Liu, Daquan; Li, Jie; Niu, Kaijun; Feng, Shiqing; Yokota, Hiroki; Zhang, Ping
2016-01-01
Osteoarthritis (OA) is a whole joint disorder that involves cartilage degradation and periarticular bone response. Changes of cartilage and subchondral bone are associated with development and activity of osteoclasts from subchondral bone. Knee loading promotes bone formation, but its effects on OA have not been well investigated. Here, we hypothesized that knee loading regulates subchondral bone remodeling by suppressing osteoclast development, and prevents degradation of cartilage through crosstalk of bone-cartilage in osteoarthritic mice. Surgery-induced mouse model of OA was used. Two weeks application of daily dynamic knee loading significantly reduced OARSI scores and CC/TAC (calcified cartilage to total articular cartilage), but increased SBP (subchondral bone plate) and B.Ar/T.Ar (trabecular bone area to total tissue area). Bone resorption of osteoclasts from subchondral bone and the differentiation of osteoclasts from bone marrow-derived cells were completely suppressed by knee loading. The osteoclast activity was positively correlated with OARSI scores and negatively correlated with SBP and B.Ar/T.Ar. Furthermore, knee loading exerted protective effects by suppressing osteoclastogenesis through Wnt signaling. Overall, osteoclast lineage is the hyper responsiveness of knee loading in osteoarthritic mice. Mechanical stimulation prevents OA-induced cartilage degeneration through crosstalk with subchondral bone. Knee loading might be a new potential therapy for osteoarthritis patients. PMID:27087498
Ufimtseva, Elena
2016-01-01
The search for factors that account for the reproduction and survival of mycobacteria, including vaccine strains, in host cells is the priority for studies on tuberculosis. A comparison of BCG-mycobacterial loads in granuloma cells obtained from bone marrow and spleens of mice with latent tuberculous infection and cells from mouse bone marrow and peritoneal macrophage cultures infected with the BCG vaccine in vitro has demonstrated that granuloma macrophages each normally contained a single BCG-Mycobacterium, while those acutely infected in vitro had increased mycobacterial loads and death rates. Mouse granuloma cells were observed to produce the IFNγ, IL-1α, GM-CSF, CD1d, CD25, CD31, СD35, and S100 proteins. None of these activation markers were found in mouse cell cultures infected in vitro or in intact macrophages. Lack of colocalization of lipoarabinomannan-labeled BCG-mycobacteria with the lysosomotropic LysoTracker dye in activated granuloma macrophages suggests that these macrophages were unable to destroy BCG-mycobacteria. However, activated mouse granuloma macrophages could control mycobacterial reproduction in cells both in vivo and in ex vivo culture. By contrast, a considerable increase in the number of BCG-mycobacteria was observed in mouse bone marrow and peritoneal macrophages after BCG infection in vitro, when no expression of the activation-related molecules was detected in these cells. PMID:27066505
Montgomery, Scott R.; Nargizyan, Taya; Meliton, Vicente; Nachtergaele, Sigrid; Rohatgi, Rajat; Stappenbeck, Frank; Jung, Michael E.; Johnson, Jared S.; Aghdasi, Bayan; Tian, Haijun; Weintraub, Gil; Inoue, Hirokazu; Atti, Elisa; Tetradis, Sotirios; Pereira, Renata C; Hokugo, Akishige; Alobaidaan, Raed; Tan, Yanlin; Hahn, Theodor J.; Wang, Jeffrey C; Parhami, Farhad
2015-01-01
Osteogenic factors are often used in orthopedics to promote bone growth, improve fracture healing, and induce spine fusion. Osteogenic oxysterols are naturally occurring molecules that were shown to induce osteogenic differentiation in vitro and promote spine fusion in vivo. The purpose of this study was to identify an osteogenic oxysterol more suitable for clinical development than those previously reported, and evaluate its ability to promote osteogenesis in vitro and spine fusion in rats in vivo. Among more than 100 oxysterol analogues synthesized, Oxy133 induced significant expression of osteogenic markers Runx2, osterix (OSX), alkaline phosphatase (ALP), bone sialoprotein (BSP), and osteocalcin (OCN) in C3H10T1/2 mouse embryonic fibroblasts and in M2-10B4 mouse marrow stromal cells. Oxy133-induced activation of an 8×-Gli luciferase reporter, its direct binding to Smoothened, and the inhibition of Oxy133-induced osteogenic effects by the Hedgehog (Hh) pathway inhibitor, cyclopamine, demonstrated the role of Hh pathway in mediating osteogenic responses to Oxy133. Oxy133 did not stimulate osteogenesis via BMP or Wnt signaling. Oxy133 induced the expression of OSX, BSP, and OCN and stimulated robust mineralization in primary human mesenchymal stem cells. In vivo, bilateral spine fusion occurred through endochondral ossification and was observed in animals treated with Oxy133 at the fusion site on xray after 4 weeks and confirmed with manual assessment, micro CT (μCT), and histology after 8 weeks, with equal efficiency to recombinant human bone morphogenetic protein-2 (rhBMP-2). Unlike rhBMP-2, Oxy133 did not induce adipogenesis in the fusion mass and resulted in denser bone evidenced by greater BV/TV ratio and smaller trabecular separation. Findings here suggest that Oxy133 has significant potential as an osteogenic molecule with greater ease of synthesis and improved time to fusion compared to previously studied oxysterols. Small molecule osteogenic oxysterols may serve as the next generation of bone anabolic agents for therapeutic development. PMID:24591126
NASA Astrophysics Data System (ADS)
Zhang, Xuhui; Xia, Lei; Hao, Shaojun; Chen, Weiliang; Guo, Junyi; Ma, Zhenzhen; Wang, Huamin; Kong, Xuejun; Wang, Hongyu; Zhang, Zhengchen
2018-04-01
To observe the effect of intravenous bone pain Capsule on the ear of mice induced by xylene, swelling of rat models of cervical spondylosis. Weighing 18 ˜ 21g 50 mice, male, were randomly divided into for five groups, which were fed with service for bone pain static capsule suspension, Jingfukang granule suspension 0.5%CMC liquid and the same volume of. Respectively to the mice ear drop of xylene 0.05 ml, 4h after cervical dislocation, the mice were sacrificed and the cut two ear, rapid analytical balance weighing, and calculate the ear swelling degree and the other to take the weight of 200 - 60 250g male SD rats, were randomly divided into for 6 groups, 10 rats in each group, of which 5 groups made cervical spondylosis model. Results: with the blank group than bone pain static capsule group and Jingfukang granule group can significantly reduce mouse auricular dimethylbenzene swelling, significantly reduce ear swelling degree (P < 0.01); the successful establishment of the rat model of cervical spondylosis. With the model group ratio, large, medium and small dose of bone pain static capsule group, Jingfukang granule group (P < 0.01) angle of swash plate of rats increased significantly, the high and middle dose of bone pain static capsule group, Jingfukang granule group can significantly reduce the rat X-ray scores (P < 0.05). Bone pain static capsule can significantly reduce mouse auricular dimethylbenzene swelling. The bone pain capsule has a good effect on the rat model of cervical spondylosis.
Age-related changes in mouse bone permeability.
Rodriguez-Florez, Naiara; Oyen, Michelle L; Shefelbine, Sandra J
2014-03-21
The determination of lacunar-canalicular permeability is essential for understanding local fluid flow in bone, which may indicate how bone senses changes in the mechanical environment to regulate mechano-adaptation. The estimates of lacunar-canalicular permeability found in the literature vary by up to eight orders of magnitude, and age-related permeability changes have not been measured in non-osteonal mouse bone. The objective of this study is to use a poroelastic approach based on nanoindentation data to characterize lacunar-canalicular permeability in murine bone as a function of age. Nine wild type C57BL/6 mice of different ages (2, 7 and 12 months) were used. Three tibiae from each age group were embedded in epoxy resin, cut in half and indented in the longitudinal direction in the mid-cortex using two spherical fluid indenter tips (R=238 μm and 500 μm). Results suggest that the lacunar-canalicular intrinsic permeability of mouse bone decreases from 2 to 7 months, with no significant changes from 7 to 12 months. The large indenter tip imposed larger contact sizes and sampled larger ranges of permeabilities, particularly for the old bone. This age-related difference in the distribution was not seen for indents with the smaller radius tip. We conclude that the small tip effectively measured lacunar-canalicular permeability, while larger tip indents were influenced by vascular permeability. Exploring the age-related changes in permeability of bone measured by nanoindentation will lead to a better understanding of the role of fluid flow in mechano-transduction. This understanding may help indicate alterations in bone adaptation and remodeling. Copyright © 2013 Elsevier Ltd. All rights reserved.
Tye, Coralee E; Boyd, Joseph R; Page, Natalie A; Falcone, Michelle M; Stein, Janet L; Stein, Gary S; Lian, Jane B
2018-12-01
Long noncoding RNAs (lncRNAs) have recently emerged as novel regulators of lineage commitment, differentiation, development, viability, and disease progression. Few studies have examined their role in osteogenesis; however, given their critical and wide-ranging roles in other tissues, lncRNAs are most likely vital regulators of osteogenesis. In this study, we extensively characterized lncRNA expression in mesenchymal cells during commitment and differentiation to the osteoblast lineage using a whole transcriptome sequencing approach (RNA-Seq). Using mouse primary mesenchymal stromal cells (mMSC), we identified 1438 annotated lncRNAs expressed during MSC differentiation, 462 of which are differentially expressed. We performed guilt-by-association analysis using lncRNA and mRNA expression profiles to identify lncRNAs influencing MSC commitment and differentiation. These findings open novel dimensions for exploring lncRNAs in regulating normal bone formation and in skeletal disorders.
Aikou, Susumu; Aida, Junko; Takubo, Kaiyo; Yamagata, Yukinori; Seto, Yasuyuki; Kaminishi, Michio; Nomura, Sachiyo
2013-09-01
The incidence of esophageal adenocarcinoma has increased in the last 25 years. Columnar metaplasia in Barrett's mucosa is assumed to be a precancerous lesion for esophageal adenocarcinoma. However, the induction process of Barrett's mucosa is still unknown. To analyze the induction of esophageal columnar metaplasia, we established a mouse gastro-esophageal reflux disease (GERD) model with associated development of columnar metaplasia in the esophagus. C57BL/6 mice received side-to-side anastomosis of the esophagogastric junction with the jejunum, and mice were killed 10, 20, and 40 weeks after operation. To analyze the contribution of bone marrow-derived cells to columnar metaplasia in this surgical GERD model, some mice were transplanted with GFP-marked bone marrow after the operation. Seventy-three percent of the mice (16/22) showed thickened mucosa in esophagus and 41% of mice (9/22) developed columnar metaplasia 40 weeks after the operation with a mortality rate of 4%. Bone marrow-derived cells were not detected in columnar metaplastic epithelia. However, scattered epithelial cells in the thickened squamous epithelia in regions of esophagitis did show bone marrow derivation. The results demonstrate that reflux induced by esophago-jejunostomy in mice leads to the development of columnar metaplasia in the esophagus. However, bone marrow-derived cells do not contribute directly to columnar metaplasia in this mouse model. © 2013 Japanese Cancer Association.
In vitro and in vivo approaches to study osteocyte biology.
Kalajzic, Ivo; Matthews, Brya G; Torreggiani, Elena; Harris, Marie A; Divieti Pajevic, Paola; Harris, Stephen E
2013-06-01
Osteocytes, the most abundant cell population of the bone lineage, have been a major focus in the bone research field in recent years. This population of cells that resides within mineralized matrix is now thought to be the mechanosensory cell in bone and plays major roles in the regulation of bone formation and resorption. Studies of osteocytes had been impaired by their location, resulting in numerous attempts to isolate primary osteocytes and to generate cell lines representative of the osteocytic phenotype. Progress has been achieved in recent years by utilizing in vivo genetic technology and generation of osteocyte directed transgenic and gene deficiency mouse models. We will provide an overview of the current in vitro and in vivo models utilized to study osteocyte biology. We discuss generation of osteocyte-like cell lines and isolation of primary osteocytes and summarize studies that have utilized these cellular models to understand the functional role of osteocytes. Approaches that attempt to selectively identify and isolate osteocytes using fluorescent protein reporters driven by regulatory elements of genes that are highly expressed in osteocytes will be discussed. In addition, recent in vivo studies utilizing overexpression or conditional deletion of various genes using dentin matrix protein (Dmp1) directed Cre recombinase are outlined. In conclusion, evaluation of the benefits and deficiencies of currently used cell lines/genetic models in understanding osteocyte biology underlines the current progress in this field. The future efforts will be directed towards developing novel in vitro and in vivo models that would additionally facilitate in understanding the multiple roles of osteocytes. Copyright © 2012 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ecarot-Charrier, B.; Bouchard, F.; Delloye, C.
Isolated mouse osteoblasts that retain their osteogenic activity in culture were incubated with (35S) sulfate. Two radiolabeled proteins, in addition to proteoglycans, were extracted from the calcified matrix of osteoblast cultures. All the sulfate label in both proteins was in the form of tyrosine sulfate as assessed by amino acid analysis and thin layer chromatography following alkaline hydrolysis. The elution behavior on DEAE-Sephacel of the major sulfated protein and the apparent Mr on sodium dodecyl sulfate gels were characteristic of bone sialoprotein II extracted from rat. This protein was shown to cross-react with an antiserum raised against bovine bone sialoproteinmore » II, indicating that bone sialoprotein II synthesized by cultured mouse osteoblasts is a tyrosine-sulfated protein. The minor sulfated protein was tentatively identified as bone sialoprotein I or osteopontin based on its elution properties on DEAE-Sephacel and anomalous behavior on sodium dodecyl sulfate gels similar to those reported for rat bone sialoprotein I.« less
Polarization in Raman spectroscopy helps explain bone brittleness in genetic mouse models
NASA Astrophysics Data System (ADS)
Makowski, Alexander J.; Pence, Isaac J.; Uppuganti, Sasidhar; Zein-Sabatto, Ahbid; Huszagh, Meredith C.; Mahadevan-Jansen, Anita; Nyman, Jeffry S.
2014-11-01
Raman spectroscopy (RS) has been extensively used to characterize bone composition. However, the link between bone biomechanics and RS measures is not well established. Here, we leveraged the sensitivity of RS polarization to organization, thereby assessing whether RS can explain differences in bone toughness in genetic mouse models for which traditional RS peak ratios are not informative. In the selected mutant mice-activating transcription factor 4 (ATF4) or matrix metalloproteinase 9 (MMP9) knock-outs-toughness is reduced but differences in bone strength do not exist between knock-out and corresponding wild-type controls. To incorporate differences in the RS of bone occurring at peak shoulders, a multivariate approach was used. Full spectrum principal components analysis of two paired, orthogonal bone orientations (relative to laser polarization) improved genotype classification and correlation to bone toughness when compared to traditional peak ratios. When applied to femurs from wild-type mice at 8 and 20 weeks of age, the principal components of orthogonal bone orientations improved age classification but not the explanation of the maturation-related increase in strength. Overall, increasing polarization information by collecting spectra from two bone orientations improves the ability of multivariate RS to explain variance in bone toughness, likely due to polarization sensitivity to organizational changes in both mineral and collagen.
Oleoyl serine, an endogenous N-acyl amide, modulates bone remodeling and mass
Smoum, Reem; Bar, Arik; Tan, Bo; Milman, Garry; Attar-Namdar, Malka; Ofek, Orr; Stuart, Jordyn M.; Bajayo, Alon; Tam, Joseph; Kram, Vardit; O'Dell, David; Walker, Michael J.; Bradshaw, Heather B.; Bab, Itai; Mechoulam, Raphael
2010-01-01
Bone mass is determined by a continuous remodeling process, whereby the mineralized matrix is being removed by osteoclasts and subsequently replaced with newly formed bone tissue produced by osteoblasts. Here we report the presence of endogenous amides of long-chain fatty acids with amino acids or with ethanolamine (N-acyl amides) in mouse bone. Of these compounds, N-oleoyl-l-serine (OS) had the highest activity in an osteoblast proliferation assay. In these cells, OS triggers a Gi-protein-coupled receptor and Erk1/2. It also mitigates osteoclast number by promoting osteoclast apoptosis through the inhibition of Erk1/2 phosphorylation and receptor activator of nuclear-κB ligand (RANKL) expression in bone marrow stromal cells and osteoblasts. In intact mice, OS moderately increases bone volume density mainly by inhibiting bone resorption. However, in a mouse ovariectomy (OVX) model for osteoporosis, OS effectively rescues bone loss by increasing bone formation and markedly restraining bone resorption. The differential effect of exogenous OS in the OVX vs. intact animals is apparently a result of an OVX-induced decrease in skeletal OS levels. These data show that OS is a previously unexplored lipid regulator of bone remodeling. It represents a lead to antiosteoporotic drug discovery, advantageous to currently available therapies, which are essentially either proformative or antiresorptive. PMID:20876113
Oleoyl serine, an endogenous N-acyl amide, modulates bone remodeling and mass.
Smoum, Reem; Bar, Arik; Tan, Bo; Milman, Garry; Attar-Namdar, Malka; Ofek, Orr; Stuart, Jordyn M; Bajayo, Alon; Tam, Joseph; Kram, Vardit; O'Dell, David; Walker, Michael J; Bradshaw, Heather B; Bab, Itai; Mechoulam, Raphael
2010-10-12
Bone mass is determined by a continuous remodeling process, whereby the mineralized matrix is being removed by osteoclasts and subsequently replaced with newly formed bone tissue produced by osteoblasts. Here we report the presence of endogenous amides of long-chain fatty acids with amino acids or with ethanolamine (N-acyl amides) in mouse bone. Of these compounds, N-oleoyl-l-serine (OS) had the highest activity in an osteoblast proliferation assay. In these cells, OS triggers a Gi-protein-coupled receptor and Erk1/2. It also mitigates osteoclast number by promoting osteoclast apoptosis through the inhibition of Erk1/2 phosphorylation and receptor activator of nuclear-κB ligand (RANKL) expression in bone marrow stromal cells and osteoblasts. In intact mice, OS moderately increases bone volume density mainly by inhibiting bone resorption. However, in a mouse ovariectomy (OVX) model for osteoporosis, OS effectively rescues bone loss by increasing bone formation and markedly restraining bone resorption. The differential effect of exogenous OS in the OVX vs. intact animals is apparently a result of an OVX-induced decrease in skeletal OS levels. These data show that OS is a previously unexplored lipid regulator of bone remodeling. It represents a lead to antiosteoporotic drug discovery, advantageous to currently available therapies, which are essentially either proformative or antiresorptive.
Multiscale characterization of the mineral phase at skeletal sites of breast cancer metastasis.
He, Frank; Chiou, Aaron E; Loh, Hyun Chae; Lynch, Maureen; Seo, Bo Ri; Song, Young Hye; Lee, Min Joon; Hoerth, Rebecca; Bortel, Emely L; Willie, Bettina M; Duda, Georg N; Estroff, Lara A; Masic, Admir; Wagermaier, Wolfgang; Fratzl, Peter; Fischbach, Claudia
2017-10-03
Skeletal metastases, the leading cause of death in advanced breast cancer patients, depend on tumor cell interactions with the mineralized bone extracellular matrix. Bone mineral is largely composed of hydroxyapatite (HA) nanocrystals with physicochemical properties that vary significantly by anatomical location, age, and pathology. However, it remains unclear whether bone regions typically targeted by metastatic breast cancer feature distinct HA materials properties. Here we combined high-resolution X-ray scattering analysis with large-area Raman imaging, backscattered electron microscopy, histopathology, and microcomputed tomography to characterize HA in mouse models of advanced breast cancer in relevant skeletal locations. The proximal tibial metaphysis served as a common metastatic site in our studies; we identified that in disease-free bones this skeletal region contained smaller and less-oriented HA nanocrystals relative to ones that constitute the diaphysis. We further observed that osteolytic bone metastasis led to a decrease in HA nanocrystal size and perfection in remnant metaphyseal trabecular bone. Interestingly, in a model of localized breast cancer, metaphyseal HA nanocrystals were also smaller and less perfect than in corresponding bone in disease-free controls. Collectively, these results suggest that skeletal sites prone to tumor cell dissemination contain less-mature HA (i.e., smaller, less-perfect, and less-oriented crystals) and that primary tumors can further increase HA immaturity even before secondary tumor formation, mimicking alterations present during tibial metastasis. Engineered tumor models recapitulating these spatiotemporal dynamics will permit assessing the functional relevance of the detected changes to the progression and treatment of breast cancer bone metastasis.
Multiscale characterization of the mineral phase at skeletal sites of breast cancer metastasis
Chiou, Aaron E.; Loh, Hyun Chae; Lynch, Maureen; Seo, Bo Ri; Song, Young Hye; Hoerth, Rebecca; Bortel, Emely L.; Willie, Bettina M.; Duda, Georg N.; Masic, Admir; Wagermaier, Wolfgang; Fratzl, Peter; Fischbach, Claudia
2017-01-01
Skeletal metastases, the leading cause of death in advanced breast cancer patients, depend on tumor cell interactions with the mineralized bone extracellular matrix. Bone mineral is largely composed of hydroxyapatite (HA) nanocrystals with physicochemical properties that vary significantly by anatomical location, age, and pathology. However, it remains unclear whether bone regions typically targeted by metastatic breast cancer feature distinct HA materials properties. Here we combined high-resolution X-ray scattering analysis with large-area Raman imaging, backscattered electron microscopy, histopathology, and microcomputed tomography to characterize HA in mouse models of advanced breast cancer in relevant skeletal locations. The proximal tibial metaphysis served as a common metastatic site in our studies; we identified that in disease-free bones this skeletal region contained smaller and less-oriented HA nanocrystals relative to ones that constitute the diaphysis. We further observed that osteolytic bone metastasis led to a decrease in HA nanocrystal size and perfection in remnant metaphyseal trabecular bone. Interestingly, in a model of localized breast cancer, metaphyseal HA nanocrystals were also smaller and less perfect than in corresponding bone in disease-free controls. Collectively, these results suggest that skeletal sites prone to tumor cell dissemination contain less-mature HA (i.e., smaller, less-perfect, and less-oriented crystals) and that primary tumors can further increase HA immaturity even before secondary tumor formation, mimicking alterations present during tibial metastasis. Engineered tumor models recapitulating these spatiotemporal dynamics will permit assessing the functional relevance of the detected changes to the progression and treatment of breast cancer bone metastasis. PMID:28923958
Araujo, John C.; Poblenz, Ann; Corn, Paul G.; Parikh, Nila U.; Starbuck, Michael W.; Thompson, Jerry T.; Lee, Francis; Logothetis, Christopher J.; Darnay, Bryant G.
2013-01-01
Purpose Therapies to target prostate cancer bone metastases have only limited effects. New treatments are focused on the interaction between cancer cells, bone marrow cells and the bone matrix. Osteoclasts play an important role in the development of bone tumors caused by prostate cancer. Since Src kinase has been shown to be necessary for osteoclast function, we hypothesized that dasatinib, a Src family kinase inhibitor, would reduce osteoclast activity and prostate cancer (PC-3) cell-induced osteoclast formation. Results Dasatinib inhibited RANKL-induced osteoclast differentiation of bone marrow-derived monocytes with an EC50 of 7.5 nM. PC-3 cells, a human prostate cancer cell line, were able to differentiate RAW 264.7 cells, a murine monocytic cell line, into osteoclasts and dasatinib inhibited this differentiation. In addition, conditioned medium from PC-3 cell cultures was able to differentiate RAW 264.7 cells into osteoclasts and this too, was inhibited by dasatinib. Even the lowest concentration of dasatinib, 1.25 nmol, inhibited osteoclast differentiation by 29%. Moreover, dasatinib inhibited osteoclast activity by 58% as measured by collagen 1 release. Experimental design We performed in vitro experiments utilizing the Src family kinase inhibitor dasatinib to target osteoclast activation as a means of inhibiting prostate cancer bone metastases. Conclusion Dasatinib inhibits osteoclast differentiation of mouse primary bone marrow-derived monocytes and PC-3 cell-induced osteoclast differentiation. Dasatinib also inhibits osteoclast degradation activity. Inhibiting osteoclast differentiation and activity may be an effective targeted therapy in patients with prostate cancer bone metastases. PMID:19855158
Todeschi, Maria R; El Backly, Rania M; Varghese, Oommen P; Hilborn, Jöns; Cancedda, Ranieri; Mastrogiacomo, Maddalena
2017-07-01
This study aimed to identify host cell recruitment patterns in a mouse model in response to rhBMP-2 releasing hyaluronic acid hydrogels and influence of added nano-hydroxyapatite particles on rhBMP-2 release and pattern of bone formation. Implanted gels were retrieved after implantation and cells were enzymatically dissociated for flow cytometric analysis. Percentages of macrophages, progenitor endothelial cells and putative mesenchymal stem cells were measured. Implants were evaluated for BMP-2 release by ELISA and by histology to monitor tissue formation. Hyaluronic acid+BMP-2 gels influenced the inflammatory response in the bone healing microenvironment. Host-derived putative mesenchymal stem cells were major contributors. Addition of hydroxyapatite nanoparticles modified the release pattern of rhBMP-2, resulting in enhanced bone formation.
Nanoindentation analysis of the micromechanical anisotropy in mouse cortical bone
Balmelli, Anna; Carnelli, Davide; Courty, Diana; Müller, Ralph
2017-01-01
Studies investigating micromechanical properties in mouse cortical bone often solely focus on the mechanical behaviour along the long axis of the bone. Therefore, data on the anisotropy of mouse cortical bone is scarce. The aim of this study is the first-time evaluation of the anisotropy ratio between the longitudinal and transverse directions of reduced modulus and hardness in mouse femurs by using the nanoindentation technique. For this purpose, nine 22-week-old mice (C57BL/6) were sacrificed and all femurs extracted. A total of 648 indentations were performed with a Berkovich tip in the proximal (P), central (C) and distal (D) regions of the femoral shaft in the longitudinal and transverse directions. Higher values for reduced modulus are obtained for indentations in the longitudinal direction, with anisotropy ratios of 1.72 ± 0.40 (P), 1.75 ± 0.69 (C) and 1.34 ± 0.30 (D). Hardness is also higher in the longitudinal direction, with anisotropic ratios of 1.35 ± 0.27 (P), 1.35 ± 0.47 (C) and 1.17 ± 0.19 (D). We observed a significant anisotropy in the micromechanical properties of the mouse femur, but the correlation for reduced modulus and hardness between the two directions is low (r2 < 0.3) and not significant. Therefore, we highly recommend performing independent indentation testing in both the longitudinal and transverse directions when knowledge of the tissue mechanical behaviour along multiple directions is required. PMID:28386450
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kimura, Hiroaki; Akiyama, Haruhiko; Nakamura, Takashi
We identified a cDNA encoding mouse Tenascin-W (TN-W) upregulated by bone morphogenetic protein (Bmp)2 in ATDC5 osteo-chondroprogenitors. In adult mice, TN-W was markedly expressed in bone. In mouse embryos, during endochondral bone formation TN-W was localized in perichondrium/periosteum, but not in trabecular and cortical bones. During bone fracture repair, cells in the newly formed perichondrium/periosteum surrounding the cartilaginous callus expressed TN-W. Furthermore, TN-W was detectable in perichondrium/periosteum of Runx2-null and Osterix-null embryos, indicating that TN-W is expressed in preosteoblasts. In CFU-F and -O cells, TN-W had no effect on initiation of osteogenesis of bone marrow cells, and in MC3T3-E1 osteoblasticmore » cells TN-W inhibited cell proliferation and Col1a1 expression. In addition, TN-W suppressed canonical Wnt signaling which stimulates osteoblastic differentiation. Our results indicate that TN-W is a novel marker of preosteoblasts in early stage of osteogenesis, and that TN-W inhibits cell proliferation and differentiation of preosteoblasts mediated by canonical Wnt signaling.« less
Bi, Xiaohong; Sterling, Julie A.; Merkel, Alyssa R.; Perrien, Daniel S.; Nyman, Jeffry; Mahadevan-Jansen, Anita
2013-01-01
Prostate cancer is the most common primary tumor and the second leading cause of cancer-related deaths in men in the United States. Prostate cancer bone metastases are characterized by abnormal bone remodeling processes and result in a variety of skeletal morbidities. Prevention of skeletal complications is a crucial element in prostate cancer management. This study investigated prostate cancer-induced alterations in the molecular composition and morphological structure of metastasis-bearing bones in a mouse model of prostate cancer using Raman spectroscopy and micro-computed tomography (microCT). LNCaP C4-2B prostate cancer cells were injected into the right tibiae of 5-week old male SCID mice. Upon sacrifice at 8 weeks post tumor inoculation, two out of the ten tumor-bearing tibiae showed only osteoblastic lesions in the radiographs, 4 osteolytic lesions only and 4 mixed with osteoblastic and osteolytic lesions.. Carbonate substitution was significantly increased while there was a marked reduction in the level of collagen mineralization, mineral crystallinity, and carbonate:matrix ratio in the cortex of the intact tumor-bearing tibiae compared to contralateral controls. MicroCT analysis revealed a significant reduction in bone volume/total volume, trabecular number and trabecular thickness, as well as significant increase in bone surface/volume ratio in tibiae with osteolytic lesions, suggesting active bone remodeling and bone loss. None of the changes in bone compositional properties were correlated with lesion area from radiographs or the changes in bone architecture from microCT. This study indicates that LNCaP C4-2B prostate cancer metastases alter bone tissue composition independent of changes in architecture, and altered bone quality may be an important contributor to fracture risk in these patients. Raman spectroscopy may provide a new avenue of investigation into interactions between tumor and bone microenvironment. PMID:23867219
Zuscik, M J; Piascik, M T; Perez, D M
1999-12-01
The functionality of a 3422-base pair promoter fragment from the mouse alpha(1B)-adrenergic receptor (alpha(1B)AR) gene was examined. This fragment, cloned from a mouse genomic library, was found to have significant sequence homology to the known human and rat alpha(1B)AR promoters. However, the consensus motif of several key cis-acting elements is not conserved among the rat, human, and mouse genes, suggesting species specificity. Confirming fidelity of the murine promoter, robust in vitro expression of a chloramphenicol acetyltransferase (CAT) reporter was detected in known alpha(1B)AR-expressing BC(3)H1, NB41A3, and DDT(1)MF-2 cells transiently transfected with a promoter-CAT construct. Conversely, minimal CAT expression was detected in known alpha(1B)AR-negative RAT-1 and R3T3 cells. These findings were extended by transfecting the same promoter-CAT construct into various primary cell types. In support of the hypothesis that alpha(1)ARs are differentially expressed in the smooth muscle of the vasculature, primary cultures of superior mesenteric and renal artery vascular smooth muscle cells showed significantly stronger CAT expression than did vascular smooth muscle cells derived from pulmonary, femoral, and iliac arteries. Primary osteoblastic bone-forming cells, which are known to be alpha(1B)AR negative, showed minimal CAT expression. Indicating regulatory function through cis-acting elements, RAT-1, R3T3, NB41A3, BC(3)H1, and DDT(1)MF2 cells transfected with the promoter-CAT construct all showed increased CAT production when challenged with forskolin or hypoxic conditions. Additionally, tissue-specific regulation of the promoter was observed when cells were simultaneously challenged with both forskolin and hypoxia. These results collectively demonstrate that a 3.4-kb PvuII fragment of the murine alpha(1B)AR gene promoter can: 1) drive tissue-specific production of a CAT reporter in both clonal and primary cell lines; and 2) confer tissue-specific regulation of that CAT reporter when induced by challenge with forskolin and/or hypoxic conditions.
Alpha-1 antitrypsin gene therapy prevented bone loss in ovariectomy induced osteoporosis mouse model
USDA-ARS?s Scientific Manuscript database
Osteoporosis is a major healthcare burden affecting mostly postmenopausal women characterized by compromised bone strength and increased risk of fragility fracture. Although pathogenesis of this disease is complex, elevated proinflammatory cytokine production is clearly involved in bone loss at meno...
Premature primary tooth eruption in cognitive/motor-delayed ADNP-mutated children
Gozes, I; Van Dijck, A; Hacohen-Kleiman, G; Grigg, I; Karmon, G; Giladi, E; Eger, M; Gabet, Y; Pasmanik-Chor, M; Cappuyns, E; Elpeleg, O; Kooy, R F; Bedrosian-Sermone, S
2017-01-01
A major flaw in autism spectrum disorder (ASD) management is late diagnosis. Activity-dependent neuroprotective protein (ADNP) is a most frequent de novo mutated ASD-related gene. Functionally, ADNP protects nerve cells against electrical blockade. In mice, complete Adnp deficiency results in dysregulation of over 400 genes and failure to form a brain. Adnp haploinsufficiency results in cognitive and social deficiencies coupled to sex- and age-dependent deficits in the key microtubule and ion channel pathways. Here, collaborating with parents/caregivers globally, we discovered premature tooth eruption as a potential early diagnostic biomarker for ADNP mutation. The parents of 44/54 ADNP-mutated children reported an almost full erupted dentition by 1 year of age, including molars and only 10 of the children had teeth within the normal developmental time range. Looking at Adnp-deficient mice, by computed tomography, showed significantly smaller dental sacs and tooth buds at 5 days of age in the deficient mice compared to littermate controls. There was only trending at 2 days, implicating age-dependent dysregulation of teething in Adnp-deficient mice. Allen Atlas analysis showed Adnp expression in the jaw area. RNA sequencing (RNAseq) and gene array analysis of human ADNP-mutated lymphoblastoids, whole-mouse embryos and mouse brains identified dysregulation of bone/nervous system-controlling genes resulting from ADNP mutation/deficiency (for example, BMP1 and BMP4). AKAP6, discovered here as a major gene regulated by ADNP, also links cognition and bone maintenance. To the best of our knowledge, this is the first time that early primary (deciduous) teething is related to the ADNP syndrome, providing for early/simple diagnosis and paving the path to early intervention/specialized treatment plan. PMID:28221363
Leptin regulation of bone resorption by the sympathetic nervous system and CART.
Elefteriou, Florent; Ahn, Jong Deok; Takeda, Shu; Starbuck, Michael; Yang, Xiangli; Liu, Xiuyun; Kondo, Hisataka; Richards, William G; Bannon, Tony W; Noda, Masaki; Clement, Karine; Vaisse, Christian; Karsenty, Gerard
2005-03-24
Bone remodelling, the mechanism by which vertebrates regulate bone mass, comprises two phases, namely resorption by osteoclasts and formation by osteoblasts; osteoblasts are multifunctional cells also controlling osteoclast differentiation. Sympathetic signalling via beta2-adrenergic receptors (Adrb2) present on osteoblasts controls bone formation downstream of leptin. Here we show, by analysing Adrb2-deficient mice, that the sympathetic nervous system favours bone resorption by increasing expression in osteoblast progenitor cells of the osteoclast differentiation factor Rankl. This sympathetic function requires phosphorylation (by protein kinase A) of ATF4, a cell-specific CREB-related transcription factor essential for osteoblast differentiation and function. That bone resorption cannot increase in gonadectomized Adrb2-deficient mice highlights the biological importance of this regulation, but also contrasts sharply with the increase in bone resorption characterizing another hypogonadic mouse with low sympathetic tone, the ob/ob mouse. This discrepancy is explained, in part, by the fact that CART ('cocaine amphetamine regulated transcript'), a neuropeptide whose expression is controlled by leptin and nearly abolished in ob/ob mice, inhibits bone resorption by modulating Rankl expression. Our study establishes that leptin-regulated neural pathways control both aspects of bone remodelling, and demonstrates that integrity of sympathetic signalling is necessary for the increase in bone resorption caused by gonadal failure.
Yamaguchi, Masayoshi
2016-10-01
Bone homeostasis is maintained through a balance between osteoblastic bone formation and osteoclastic bone resorption. Bone loss with aging is induced by decreasing in osteoblastic bone formation and increasing in osteoclastic bone resorption, thereby leading to osteoporosis. Osteoporosis with its accompanying decrease in bone mass is widely recognized as a major public heath problem. Pharmacologic and nutritional factors may play a role in the prevention and treatment of bone loss with aging. p-Hydroxycinnamic acid (HCA), which stimulates bone mineralization in mouse bone tissues in vitro, has been found to be present in the leafstalk of wasabi (Wasabi japonica MATSUM) among various food and plants. Other phenolic acids including cinnamic acid, ferulic acid, caffeic acid and 3,4-dimethoxycinnamic acid did not have osteogenic effects. HCA was demonstrated to stimulate osteoblastic bone formation and suppresses osteoclastic bone resorption in vitro by antagonizing activation of the nuclear factor kappa B. Oral administration of HCA was found to exhibit restorative effects on bone loss induced by ovariectomy and diabetic states, supporting a role in the treatment of osteoporosis. Moreover, HCA was demonstrated to prevent the suppressed osteoblastic mineralization and the enhanced osteoclastogenesis in mouse bone marrow cells cocultured with bone metastatic MDA-MB-231 human breast cancer cells in vitro. The botanical molecule HCA, as a new osteogenic agent, is suggested to play a role in the treatment of cancer bone metastases. This review will discuss an advanced recent finding that HCA may be a useful agent to treat bone metabolic disorder.
Variable Bone Fragility Associated With an Amish COL1A2 Variant and a Knock-in Mouse Model
Daley, Ethan; Streeten, Elizabeth A; Sorkin, John D; Kuznetsova, Natalia; Shapses, Sue A; Carleton, Stephanie M; Shuldiner, Alan R; Marini, Joan C; Phillips, Charlotte L; Goldstein, Steven A; Leikin, Sergey; McBride, Daniel J
2010-01-01
Osteogenesis imperfecta (OI) is a heritable form of bone fragility typically associated with a dominant COL1A1 or COL1A2 mutation. Variable phenotype for OI patients with identical collagen mutations is well established, but phenotype variability is described using the qualitative Sillence classification. Patterning a new OI mouse model on a specific collagen mutation therefore has been hindered by the absence of an appropriate kindred with extensive quantitative phenotype data. We benefited from the large sibships of the Old Order Amish (OOA) to define a wide range of OI phenotypes in 64 individuals with the identical COL1A2 mutation. Stratification of carrier spine (L1–4) areal bone mineral density (aBMD) Z-scores demonstrated that 73% had moderate to severe disease (less than −2), 23% had mild disease (−1 to −2), and 4% were in the unaffected range (greater than −1). A line of knock-in mice was patterned on the OOA mutation. Bone phenotype was evaluated in four F1 lines of knock-in mice that each shared approximately 50% of their genetic background. Consistent with the human pedigree, these mice had reduced body mass, aBMD, and bone strength. Whole-bone fracture susceptibility was influenced by individual genomic factors that were reflected in size, shape, and possibly bone metabolic regulation. The results indicate that the G610C OI (Amish) knock-in mouse is a novel translational model to identify modifying genes that influence phenotype and for testing potential therapies for OI. © 2010 American Society for Bone and Mineral Research PMID:19594296
Eap, Sandy; Keller, Laetitia; Schiavi, Jessica; Huck, Olivier; Jacomine, Leandro; Fioretti, Florence; Gauthier, Christian; Sebastian, Victor; Schwinté, Pascale; Benkirane-Jessel, Nadia
2015-01-01
New-generation implants focus on robust, durable, and rapid tissue regeneration to shorten recovery times and decrease risks of postoperative complications for patients. Herein, we describe a new-generation thick nanofibrous implant functionalized with active containers of growth factors and stem cells for regenerative nanomedicine. A thick electrospun poly(ε-caprolactone) nanofibrous implant (from 700 μm to 1 cm thick) was functionalized with chitosan and bone morphogenetic protein BMP-7 as growth factor using layer-by-layer technology, producing fish scale-like chitosan/BMP-7 nanoreservoirs. This extracellular matrix-mimicking scaffold enabled in vitro colonization and bone regeneration by human primary osteoblasts, as shown by expression of osteocalcin, osteopontin, and bone sialoprotein (BSPII), 21 days after seeding. In vivo implantation in mouse calvaria defects showed significantly more newly mineralized extracellular matrix in the functionalized implant compared to a bare scaffold after 30 days' implantation, as shown by histological scanning electron microscopy/energy dispersive X-ray microscopy study and calcein injection. We have as well bifunctionalized our BMP-7 therapeutic implant by adding human mesenchymal stem cells (hMSCs). The activity of this BMP-7-functionalized implant was again further enhanced by the addition of hMSCs to the implant (living materials), in vivo, as demonstrated by the analysis of new bone formation and calcification after 30 days' implantation in mice with calvaria defects. Therefore, implants functionalized with BMP-7 nanocontainers associated with hMSCs can act as an accelerator of in vivo bone mineralization and regeneration.
Jepsen, Karl J; Bigelow, Erin M R; Schlecht, Stephen H
2015-08-01
The twofold greater lifetime risk of fracturing a bone for white women compared with white men and black women has been attributed in part to differences in how the skeletal system accumulates bone mass during growth. On average, women build more slender long bones with less cortical area compared with men. Although slender bones are known to have a naturally lower cortical area compared with wider bones, it remains unclear whether the relatively lower cortical area of women is consistent with their increased slenderness or is reduced beyond that expected for the sex-specific differences in bone size and body size. Whether this sexual dimorphism is consistent with ethnic background and is recapitulated in the widely used mouse model also remains unclear. We asked (1) do black women build bones with reduced cortical area compared with black men; (2) do white women build bones with reduced cortical area compared with white men; and (3) do female mice build bones with reduced cortical area compared with male mice? Bone strength and cross-sectional morphology of adult human and mouse bone were calculated from quantitative CT images of the femoral midshaft. The data were tested for normality and regression analyses were used to test for differences in cortical area between men and women after adjusting for body size and bone size by general linear model (GLM). Linear regression analysis showed that the femurs of black women had 11% lower cortical area compared with those of black men after adjusting for body size and bone size (women: mean=357.7 mm2; 95% confidence interval [CI], 347.9-367.5 mm2; men: mean=400.1 mm2; 95% CI, 391.5-408.7 mm2; effect size=1.2; p<0.001, GLM). Likewise, the femurs of white women had 12% less cortical area compared with those of white men after adjusting for body size and bone size (women: mean=350.1 mm2; 95% CI, 340.4-359.8 mm2; men: mean=394.3 mm2; 95% CI, 386.5-402.1 mm2; effect size=1.3; p<0.001, GLM). In contrast, female and male femora from recombinant inbred mouse strains showed the opposite trend; femurs from female mice had a 4% larger cortical area compared with those of male mice after adjusting for body size and bone size (female: mean=0.73 mm2; 95% CI, 0.71-0.74 mm2; male: mean=0.70 mm2; 95% CI, 0.68-0.71 mm2; effect size=0.74; p=0.04, GLM). Female femurs are not simply a more slender version of male femurs. Women acquire substantially less mass (cortical area) for their body size and bone size compared with men. Our analysis questions whether mouse long bone is a suitable model to study human sexual dimorphism. Identifying differences in the way bones are constructed may be clinically important for developing sex-specific diagnostics and treatment strategies to reduce fragility fractures.
Fast epi-detected broadband multiplex CARS and SHG imaging of mouse skull cells
Capitaine, Erwan; Moussa, Nawel Ould; Louot, Christophe; Bardet, Sylvia M.; Kano, Hideaki; Duponchel, Ludovic; Lévêque, Philippe; Couderc, Vincent; Leproux, Philippe
2017-01-01
We present a bimodal imaging system able to obtain epi-detected mutiplex coherent anti-Stokes Raman scattering (M-CARS) and second harmonic generation (SHG) signals coming from biological samples. We studied a fragment of mouse parietal bone and could detect broadband anti-Stokes and SHG responses originating from bone cells and collagen respectively. In addition we compared two post-processing methods to retrieve the imaginary part of the third-order nonlinear susceptibility related to the spontaneous Raman scattering. PMID:29359100
Liapis, Vasilios; Labrinidis, Agatha; Zinonos, Irene; Hay, Shelley; Ponomarev, Vladimir; Panagopoulos, Vasilios; DeNichilo, Mark; Ingman, Wendy; Atkins, Gerald J.; Findlay, David M.; Zannettino, Andrew CW.; Evdokiou, Andreas
2015-01-01
Tumour hypoxia is a major cause of treatment failure for a variety of malignancies. However, tumour hypoxia also offers treatment opportunities, exemplified by the development compounds that target hypoxic regions within tumours. TH-302 is a pro-drug created by the conjugation of 2-nitroimidazole to bromo-isophosphoramide (Br-IPM). When TH-302 is delivered to regions of hypoxia, Br-IPM, the DNA cross linking toxin, is released. In this study we assessed the cytotoxic activity of TH-302 against osteosarcoma cells in vitro and evaluated its anticancer efficacy as a single agent, and in combination with doxorubicin, in an orthotopic mouse model of human osteosarcoma (OS). In vitro, TH-302 was potently cytotoxic to osteosarcoma cells selectively under hypoxic conditions, whereas primary normal human osteoblasts were protected. Animals transplanted with OS cells directly into their tibiae and left untreated developed mixed osteolytic/osteosclerotic bone lesions and subsequently developed lung metastases. TH-302 reduced tumor burden in bone and cooperated with doxorubicin to protect bone from osteosarcoma induced bone destruction, while it also reduced lung metastases. TH-302 may therefore be an attractive therapeutic agent with strong activity as a single agent and in combination with chemotherapy against OS. PMID:25444931
Liapis, Vasilios; Labrinidis, Agatha; Zinonos, Irene; Hay, Shelley; Ponomarev, Vladimir; Panagopoulos, Vasilios; DeNichilo, Mark; Ingman, Wendy; Atkins, Gerald J; Findlay, David M; Zannettino, Andrew C W; Evdokiou, Andreas
2015-02-01
Tumor hypoxia is a major cause of treatment failure for a variety of malignancies. However, tumor hypoxia also offers treatment opportunities, exemplified by the development compounds that target hypoxic regions within tumors. TH-302 is a pro-drug created by the conjugation of 2-nitroimidazole to bromo-isophosphoramide (Br-IPM). When TH-302 is delivered to regions of hypoxia, Br-IPM, the DNA cross linking toxin, is released. In this study we assessed the cytotoxic activity of TH-302 against osteosarcoma cells in vitro and evaluated its anticancer efficacy as a single agent, and in combination with doxorubicin, in an orthotopic mouse model of human osteosarcoma (OS). In vitro, TH-302 was potently cytotoxic to osteosarcoma cells selectively under hypoxic conditions, whereas primary normal human osteoblasts were protected. Animals transplanted with OS cells directly into their tibiae and left untreated developed mixed osteolytic/osteosclerotic bone lesions and subsequently developed lung metastases. TH-302 reduced tumor burden in bone and cooperated with doxorubicin to protect bone from osteosarcoma induced bone destruction, while it also reduced lung metastases. TH-302 may therefore be an attractive therapeutic agent with strong activity as a single agent and in combination with chemotherapy against OS. Crown Copyright © 2014. Published by Elsevier Ireland Ltd. All rights reserved.
Figeac, Florence; Andersen, Ditte C; Nipper Nielsen, Casper A; Ditzel, Nicholas; Sheikh, Søren P; Skjødt, Karsten; Kassem, Moustapha; Jensen, Charlotte H; Abdallah, Basem M
2018-05-01
Soluble delta-like 1 homolog (DLK1) is a circulating protein that belongs to the Notch/Serrate/delta family, which regulates many differentiation processes including osteogenesis and adipogenesis. We have previously demonstrated an inhibitory effect of DLK1 on bone mass via stimulation of bone resorption and inhibition of bone formation. Further, serum DLK1 levels are elevated and positively correlated to bone turnover markers in estrogen (E)-deficient rodents and women. In this report, we examined whether inhibition of serum DLK1 activity using a neutralizing monoclonal antibody protects from E deficiency-associated bone loss in mice. Thus, we generated mouse monoclonal anti-mouse DLK1 antibodies (MAb DLK1) that enabled us to reduce and also quantitate the levels of bioavailable serum DLK1 in vivo. Ovariectomized (ovx) mice were injected intraperitoneally twice weekly with MAb DLK1 over a period of one month. DEXA-, microCT scanning, and bone histomorphometric analyses were performed. Compared to controls, MAb DLK1 treated ovx mice were protected against ovx-induced bone loss, as revealed by significantly increased total bone mass (BMD) due to increased trabecular bone volume fraction (BV/TV) and inhibition of bone resorption. No significant changes were observed in total fat mass or in the number of bone marrow adipocytes. These results support the potential use of anti-DLK1 antibody therapy as a novel intervention to protect from E deficiency associated bone loss. Copyright © 2018 Elsevier Inc. All rights reserved.
Bone Marrow Failure Secondary to Cytokinesis Failure
2015-12-01
SUPPLEMENTARY NOTES 14. ABSTRACT Fanconi anemia (FA) is a human genetic disease characterized by a progressive bone marrow failure and heightened...Fanconi anemia (FA) is the most commonly inherited bone marrow failure syndrome. FA patients develop bone marrow failure during the first decade of...experiments proposed in specific aims 1- 3 (Tasks 1-3). Task 1: To determine whether HSCs from Fanconi anemia mouse models have increased cytokinesis
Mukherjee, Aditi; Larson, Emily A.; Carlos, Amy S.; Belknap, John K.; Rotwein, Peter; Klein, Robert F.
2016-01-01
Osteoporosis, the most common skeletal disorder, is characterized by low bone mineral density (BMD) and an increased risk of fragility fractures. BMD is the best clinical predictor of future osteoporotic fracture risk, but is a complex trait controlled by multiple environmental and genetic determinants with individually modest effects. Quantitative trait locus (QTL) mapping is a powerful method for identifying chromosomal regions encompassing genes involved in shaping complex phenotypes, such as BMD. Here we have applied QTL analysis to male and female genetically-heterogeneous F2 mice derived from a cross between C57BL/6 and DBA/2 strains, and have identified 11 loci contributing to femoral BMD. Further analysis of a QTL on mouse chromosome 7 following the generation of reciprocal congenic strains has allowed us to determine that the high BMD trait, which tracks with the DBA/2 chromosome and exerts equivalent effects on male and female mice, is manifested by enhanced osteogenic differentiation of mesenchymal stem cells (MSCs) in vitro and by increased growth of metatarsal bones in short-term primary culture. An insertion/deletion DNA polymorphism in Ltbp4 exon 12 that causes the in-frame removal of 12 codons in the DBA/2-derived gene maps within 0.6 Mb of the marker most tightly linked to the QTL. LTBP4, one of four paralogous mouse proteins that modify the bioavailability of the TGF-b family of growth factors, is expressed in differentiating MSC-derived osteoblasts and in long bones, and reduced responsiveness to TGF-b1 is observed in MSCs of mice homozygous for the DBA/2 chromosome 7. Taken together, our results identify a potential genetic and biochemical relationship between decreased TGF-b1-mediated signaling and enhanced femoral BMD that may be regulated by a variant LTBP4 molecule. PMID:22407846
Sun, Li; Zhu, Ling-Ling; Lu, Ping; Yuen, Tony; Li, Jianhua; Ma, Risheng; Baliram, Ramkumarie; Moonga, Surinder S.; Liu, Peng; Zallone, Alberta; New, Maria I.; Davies, Terry F.; Zaidi, Mone
2013-01-01
Clinical data showing correlations between low thyroid-stimulating hormone (TSH) levels and high bone turnover markers, low bone mineral density, and an increased risk of osteoporosis-related fractures are buttressed by mouse genetic and pharmacological studies identifying a direct action of TSH on the skeleton. Here we show that the skeletal actions of TSH deficiency are mediated, in part, through TNFα. Compound mouse mutants generated by genetically deleting the Tnfα gene on a Tshr−/− (homozygote) or Tshr+/− (heterozygote) background resulted in full rescue of the osteoporosis, low bone formation, and hyperresorption that accompany TSH deficiency. Studies using ex vivo bone marrow cell cultures showed that TSH inhibits and stimulates TNFα production from macrophages and osteoblasts, respectively. TNFα, in turn, stimulates osteoclastogenesis but also enhances the production in bone marrow of a variant TSHβ. This locally produced TSH suppresses osteoclast formation in a negative feedback loop. We speculate that TNFα elevations due to low TSH signaling in human hyperthyroidism contribute to the bone loss that has traditionally been attributed solely to high thyroid hormone levels. PMID:23716650
Measurement of Strain Distributions in Mouse Femora with 3D-Digital Speckle Pattern Interferometry
Yang, Lianxiang; Zhang, Ping; Liu, Sheng; Samala, Praveen R; Su, Min; Yokota, Hiroki
2007-01-01
Bone is a mechanosensitive tissue that adapts its mass, architecture and mechanical properties to external loading. Appropriate mechanical loads offer an effective means to stimulate bone remodeling and prevent bone loss. A role of in situ strain in bone is considered essential in enhancement of bone formation, and establishing a quantitative relationship between 3D strain distributions and a rate of local bone formation is important. Digital speckle pattern interferometry (DSPI) can achieve whole-field, non-contacting measurements of microscopic deformation for high-resolution determination of 3D strain distributions. However, the current system does not allow us to derive accurate strain distributions because of complex surface contours inherent to biological samples. Through development of a custom-made piezoelectric loading device as well as a new DSPI-based force calibration system, we built an advanced DSPI system and integrated local contour information to deformation data. Using a mouse femur in response to a knee loading modality as a model system, we determined 3D strain distributions and discussed effectiveness and limitations of the described system. PMID:18670581
Effects of alkylphenols on bone metabolism in vivo and in vitro.
Hagiwara, Hiromi; Sugizaki, Toshinori; Tsukamoto, Yu; Senoh, Emi; Goto, Tadashi; Ishihara, Yoko
2008-09-01
Alkylphenols are endocrine disruptors that show estrogen-like effects in various wildlife species. However, little information is available about the action of these chemicals on bone metabolism. We investigated the effects of alkylphenols, such as nonylphenol (NP) and octylphenol (OP), on the formation of bone using several culture systems for osteoclasts and osteoblasts, as well as in vivo experiments. NP and OP dose-dependently inhibited the formation of tartrate-resistant acid phosphatase-positive multinucleated cells (osteoclasts) in cocultures of mouse spleen cells or mouse bone marrow cells with ST2 cells. However, beta-estradiol at 10(-9)M to 10(-6)M did not affect this process. In contrast, neither compound affected the proliferation and differentiation of rat calvarial osteoblast-like cells (ROB cells). When NP or OP (0.1mg/kg body weight) was administered subcutaneously to pregnant mice at 10 days, 12 days and 14 days post-coitus, fetuses at 17.5 days post-coitus showed stimulation of sternebrae bone calcification. Our findings suggest that alkylphenols have critical effects on the formation of bone by non-estrogenic effects.
Effect of oral calcium and calcium + fluoride treatments on mouse bone properties during suspension
NASA Technical Reports Server (NTRS)
Simske, S. J.; Luttges, M. W.; Allen, K. A.; Spooner, B. S. (Principal Investigator)
1992-01-01
The bone effects of oral dosages of calcium chloride with or without supplementary sodium fluoride were assessed in antiorthostatically suspended mice. Two calcium dosages were used to replace half (3.1 mM) or all(6.3 mM) of the dietary calcium lost due to reduced food intake by the suspended mice. Two groups of 6.3 mM CaCl2-treated mice were additionally treated with 0.25 or 2.5 mM NaF. The results indicate that supplementation of the mouse drinking water with calcium salts prevents bone changes induced by short-term suspension, while calcium salts in combination with fluoride are less effective as fluoride dosage increases. However, the calcium supplements change the relationship between the femur mechanical properties and the mineral composition of the bone. Because of this, it appears that oral calcium supplements are effective through a mechanism other than simple dietary supplementation and may indicate a dependence of bone consistency on systemic and local fluid conditions.
Effect of sclerostin antibody treatment in a mouse model of severe osteogenesis imperfecta.
Roschger, Andreas; Roschger, Paul; Keplingter, Petra; Klaushofer, Klaus; Abdullah, Sami; Kneissel, Michaela; Rauch, Frank
2014-09-01
Osteogenesis imperfecta (OI) is a heritable bone fragility disorder that is usually caused by mutations affecting collagen type I production in osteoblasts. Stimulation of bone formation through sclerostin antibody treatment (Sost-ab) has shown promising results in mouse models of relatively mild OI. We assessed the effect of once-weekly intravenous Sost-ab injections for 4weeks in male Col1a1(Jrt)/+mice, a model of severe dominant OI, starting either at 4weeks (growing mice) or at 20weeks (adult mice) of age. Sost-ab had no effect on weight or femur length. In OI mice, no significant treatment-associated differences in serum markers of bone formation (alkaline phosphatase activity, procollagen type I N-propeptide) or resorption (C-telopeptide of collagen type I) were found. Micro-CT analyses at the femur showed that Sost-ab treatment was associated with higher trabecular bone volume and higher cortical thickness in wild type mice at both ages and in growing OI mice, but not in adult OI mice. Three-point bending tests of the femur showed that in wild type but not in OI mice, Sost-ab was associated with higher ultimate load and work to failure. Quantitative backscattered electron imaging of the femur did not show any effect of Sost-ab on CaPeak (the most frequently occurring calcium concentration in the bone mineral density distribution), regardless of genotype, age or measurement location. Thus, Sost-ab had a larger effect in wild type than in Col1a1(Jrt)/+mice. Previous studies had found marked improvements of Sost-ab on bone mass and strength in an OI mouse model with a milder phenotype. Our data therefore suggest that Sost-ab is less effective in a more severely affected OI mouse model. Copyright © 2014 Elsevier Inc. All rights reserved.
Franzius, Christiane; Hotfilder, Marc; Poremba, Christopher; Hermann, Sven; Schäfers, Klaus; Gabbert, Helmut Erich; Jürgens, Heribert; Schober, Otmar; Schäfers, Michael; Vormoor, Josef
2006-12-01
As primary osseous metastasis is the main adverse prognostic factor in patients with Ewing tumours, a NOD/scid mouse model for human Ewing tumour metastases has been established to examine the mechanisms of metastasis. The aim of this study was to evaluate the feasibility of diagnostic molecular imaging by small animal PET in this mouse model. Human Ewing tumour cells were transplanted into immune-deficient NOD/scid mice via s.c injection (n=17) or i.v. injection (n=17). The animals (mean weight 23.2 g) were studied 2-7 weeks after transplantation using a submillimetre resolution animal PET scanner. To assess glucose utilisation and bone metabolism, mice were scanned after intravenous injection of 9.6 MBq (mean) 2-[(18)F]fluoro-2-deoxy-D: -glucose (FDG) or 9.4 MBq (mean) [(18)F]fluoride. Whole-body PET images were analysed visually and semi-quantitatively [%ID/g, tumour to non-tumour ratio (T/NT)]. Foci of pathological uptake were identified with respect to the physiological organ uptake in corresponding regions. Subcutaneously transplanted Ewing tumours demonstrated a moderately increased glucose uptake (median %ID/g 2.5; median T/NT 2.2). After i.v. transplantation, the pattern of metastasis was similar to that in patients with metastases in lung, bone and soft tissue. These metastases showed an increased FDG uptake (median %ID/g 3.6; median T/NT 2.7). Osseous metastases were additionally visible on [(18)F]fluoride PET by virtue of decreased [(18)F]fluoride uptake (osteolysis; median %ID/g 8.4; median T/NT 0.59). Metastases were confirmed immunohistologically. Diagnostic molecular imaging of Ewing tumours and their small metastases in an in vivo NOD/scid mouse model is feasible using a submillimetre resolution PET scanner.
Yong, Kylie Su Mei; Ng, Justin Han Jia; Her, Zhisheng; Hey, Ying Ying; Tan, Sue Yee; Tan, Wilson Wei Sheng; Irac, Sergio Erdal; Liu, Min; Chan, Xue Ying; Gunawan, Merry; Foo, Randy Jee Hiang; Low, Dolyce Hong Wen; Mendenhall, Ian Hewitt; Chionh, Yok Teng; Dutertre, Charles-Antoine; Chen, Qingfeng; Wang, Lin-Fa
2018-03-16
Bats are an important animal model with long lifespans, low incidences of tumorigenesis and an ability to asymptomatically harbour pathogens. Currently, in vivo studies of bats are hampered due to their low reproduction rates. To overcome this, we transplanted bat cells from bone marrow (BM) and spleen into an immunodeficient mouse strain NOD-scid IL-2R -/- (NSG), and have successfully established stable, long-term reconstitution of bat immune cells in mice (bat-mice). Immune functionality of our bat-mouse model was demonstrated through generation of antigen-specific antibody response by bat cells following immunization. Post-engraftment of total bat BM cells and splenocytes, bat immune cells survived, expanded and repopulated the mouse without any observable clinical abnormalities. Utilizing bat's remarkable immunological functions, this novel model has a potential to be transformed into a powerful platform for basic and translational research.
Karagül, Meryem İlkay; Aktaş, Savaş; Coşkun Yılmaz, Banu; Yılmaz, Mustafa; Orekici Temel, Gülhan
2018-01-20
Polycystic ovary syndrome is the most frequently seen endocrine disorder in women of reproductive age with a prevalence of about 10%. To investigate the efficiency of growth differentiation factor 9 and bone morphogenetic protein 15 during folliculogenesis in a dehydroepiandrosterone-induced mouse Polycystic ovary syndrome model. Animal experimentation. Mice were divided into 3 groups: control, vehicle and Polycystic ovary syndrome. Polycystic ovary syndrome model mice were developed by the injection of dehydroepiandrosterone dissolved in 0.1 mL of sesame oil. Ovarian tissues were examined for growth differentiation factor 9 and bone morphogenetic protein 15 using immunofluorescent labelling and electron microscopic examinations. The immunoreactivity of growth differentiation factor 9 and bone morphogenetic protein 15 proteins decreased (p<0.05) in the Polycystic ovary syndrome group (27.73±8.43 and 24.85±7.03, respectively) compared with the control group (33.72±11.22 and 31.12±11.05, respectively) and vehicle group (33.95±10.75 and 29.99±10.72, respectively). Apoptotic changes were observed in granulosa cells, lipid vacuoles increased in Theca cells and thickening and irregularities were noted in the basal lamina of granulosa cells. An increased electron density in the zona pellucida in some of the multilaminar primary and secondary follicles in the Polycystic ovary syndrome model was also observed at the ultrastructural level. These results suggest that the decrease in the growth differentiation factor 9 and bone morphogenetic protein 15 expression initiated at the primary follicle stage effect the follicle development and zona pellucida structure and may cause subfertility or infertility in Polycystic ovary syndrome.
R-Spondin 1 promotes vibration-induced bone formation in mouse models of osteoporosis
Wang, Haitao; Brennan, Tracy A.; Russell, Elizabeth; Kim, Jung-Hoon; Egan, Kevin P.; Chen, Qijun; Israelite, Craig; Schultz, David C.; Johnson, Frederick B.; Pignolo, Robert J.
2013-01-01
Bone tissue adapts to its functional environment by optimizing its morphology for mechanical demand. Among the mechanosensitive cells that recognize and respond to forces in the skeleton are osteocytes, osteoblasts, and mesenchymal progenitor cells (MPCs). Therefore, the ability to use mechanical signals to improve bone health through exercise and devices that deliver mechanical signals is an attractive approach to age-related bone loss; however, the extracellular or circulating mediators of such signals are largely unknown. Using SDS-PAGE separation of proteins secreted by MPCs in response to low magnitude mechanical signals and in-gel trypsin digestion followed by HPLC and mass spectroscopy, we identified secreted proteins up-regulated by vibratory stimulation. We exploited a cell senescence-associated secretory phenotype screen, and reasoned that a subset of vibration-induced proteins with diminished secretion by senescent MPCs will have the capacity to promote bone formation in vivo. We identified one such vibration-induced bone-enhancing (vibe) gene as R-Spondin 1, a Wnt pathway modulator, and demonstrated that it has the capacity to promote bone formation in three mouse models of age-related bone loss. By virtue of their secretory status, some vibe proteins may be candidates for pre-clinical development as anabolic agents for the treatment of osteoporosis. PMID:23974989
Leptin differentially regulates chondrogenesis in mouse vertebral and tibial growth plates.
Yu, Bo; Jiang, Kaibiao; Chen, Bin; Wang, Hantao; Li, Xinfeng; Liu, Zude
2017-05-31
Leptin plays an important role in mediating chondrogenesis of limb growth plate. Previous studies suggest that bone structures and development of spine and limb are different. The expression of Ob-Rb, the gene that encodes leptin receptors, is vertebral and appendicular region-specific, suggesting the regulation of leptin on VGP and TGP chondrogenesis may be very different. The aim of the present study was to investigate the differential regulation of leptin on the chondrogenesis of vertebral growth plate (VGP) and tibial growth plate (TGP). We compared the VGP and TGP from wild type (C57BL/6) and leptin-deficient (ob/ob) mice. We then generated primary cultures of TGP and VGP chondrocytes. By treating the primary cells with different concentrations of leptin in vitro, we analyzed proliferation and apoptosis of the primary chondrocytes from TGP and VGP. We further measured expression of chondrogenic-related genes in these cells that had been incubated with different doses of leptin. Leptin-deficient mice of 8-week-old had shorter tibial and longer vertebral lengths than the wide type mice. Disturbed columnar structure was observed for TGP but not for VGP. In primary chondrocyte cultures, leptin inhibited VGP chondrocyte proliferation but promoted their apoptosis. Collagen IIA and aggrecan mRNA, and the protein levels of proliferation- and chondrogenesis-related markers, including PCNA, Sox9, and Smad4, were downregulated by leptin in a dose-dependent manner. In contrast, leptin stimulated the proliferation and chondrogenic differentiation of TGP chondrocytes at physiological levels (i.e., 10 and 50 ng/mL) but not at high levels (i.e., 100 and 1000 ng/mL). Leptin exerts a stimulatory effect on the proliferation and chondrogenic differentiation of the long bone growth plate but an inhibitory effect on the spine growth plate. The ongoing study will shed light on the regulatory mechanisms of leptin in bone development and metabolism.
NSG Mice Provide a Better Spontaneous Model of Breast Cancer Metastasis than Athymic (Nude) Mice
Puchalapalli, Madhavi; Zeng, Xianke; Mu, Liang; Anderson, Aubree; Hix Glickman, Laura; Zhang, Ming; Sayyad, Megan R.; Mosticone Wangensteen, Sierra; Clevenger, Charles V.; Koblinski, Jennifer E.
2016-01-01
Metastasis is the most common cause of mortality in breast cancer patients worldwide. To identify improved mouse models for breast cancer growth and spontaneous metastasis, we examined growth and metastasis of both estrogen receptor positive (T47D) and negative (MDA-MB-231, SUM1315, and CN34BrM) human breast cancer cells in nude and NSG mice. Both primary tumor growth and spontaneous metastases were increased in NSG mice compared to nude mice. In addition, a pattern of metastasis similar to that observed in human breast cancer patients (metastases to the lungs, liver, bones, brain, and lymph nodes) was found in NSG mice. Furthermore, there was an increase in the metastatic burden in NSG compared to nude mice that were injected with MDA-MB-231 breast cancer cells in an intracardiac experimental metastasis model. This data demonstrates that NSG mice provide a better model for studying human breast cancer metastasis compared to the current nude mouse model. PMID:27662655
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wezeman, F.H.; Dungan, D.D.
1986-08-01
Newborn mouse calvaria prelabeled with /sup 45/Ca and cryopreserved at -196 degrees C in serum-free medium containing dimethylsulfoxide were compared to unpreserved explants for response to parathyroid hormone during subsequent culture. After short-term cryopreservation followed by rapid thawing, the viable explants continued to release /sup 45/Ca to the culture medium but additions of parathyroid hormone to the medium did not cause increased bone resorption. The data suggest that cryopreservation and thawing impairs mechanisms responsible for parathyroid hormone action on bone cells.
Jing, Da; Baik, Andrew D.; Lu, X. Lucas; Zhou, Bin; Lai, Xiaohan; Wang, Liyun; Luo, Erping; Guo, X. Edward
2014-01-01
Osteocytes have been hypothesized to be the major mechanosensors in bone. How in situ osteocytes respond to mechanical stimuli is still unclear because of technical difficulties. In vitro studies have shown that osteocytes exhibited unique calcium (Ca2+) oscillations to fluid shear. However, whether this mechanotransduction phenomenon holds for in situ osteocytes embedded within a mineralized bone matrix under dynamic loading remains unknown. Using a novel synchronized loading/imaging technique, we successfully visualized in real time and quantified Ca2+ responses in osteocytes and bone surface cells in situ under controlled dynamic loading on intact mouse tibia. The resultant fluid-induced shear stress on the osteocyte in the lacunocanalicular system (LCS) was also quantified. Osteocytes, but not surface cells, displayed repetitive Ca2+ spikes in response to dynamic loading, with spike frequency and magnitude dependent on load magnitude, tissue strain, and shear stress in the LCS. The Ca2+ oscillations were significantly reduced by endoplasmic reticulum (ER) depletion and P2 purinergic receptor (P2R)/phospholipase C (PLC) inhibition. This study provides direct evidence that osteocytes respond to in situ mechanical loading by Ca2+ oscillations, which are dependent on the P2R/PLC/inositol trisphosphate/ER pathway. This study develops a novel approach in skeletal mechanobiology and also advances our fundamental knowledge of bone mechanotransduction.—Jing, D., Baik, A. D., Lu, X. L., Zhou, B., Lai, X., Wang, L., Luo, E., Guo, X. E. In situ intracellular calcium oscillations in osteocytes in intact mouse long bones under dynamic mechanical loading. PMID:24347610
An Acvr1 R206H knock-in mouse has fibrodysplasia ossificans progressiva
Chakkalakal, Salin A.; Zhang, Deyu; Culbert, Andria L.; Convente, Michael R.; Caron, Robert J.; Wright, Alexander C.; Maidment, Andrew D.A.; Kaplan, Frederick S.; Shore, Eileen M.
2013-01-01
Fibrodysplasia ossificans progressiva (FOP; MIM #135100) is a debilitating genetic disorder of dysregulated cellular differentiation characterized by malformation of the great toes during embryonic skeletal development and by progressive heterotopic endochondral ossification post-natally. Patients with these classic clinical features of FOP have the identical heterozygous single nucleotide substitution (c.617G>A; R206H) in the gene encoding ACVR1/ALK2, a bone morphogenetic protein (BMP) type I receptor. Gene targeting was used to develop a knock-in mouse model for FOP (Acvr1R206H/+). Radiographic analysis of Acvr1R206H/+ chimeric mice revealed that this mutation induced malformed first digits in the hind limbs and post-natal extra-skeletal bone formation, recapitulating the human disease. Histological analysis of murine lesions showed inflammatory infiltration and apoptosis of skeletal muscle followed by robust formation of heterotopic bone through an endochondral pathway, identical to that seen in patients. Progenitor cells of a Tie2+ lineage participated in each stage of endochondral osteogenesis. We further determined that both wild-type and mutant cells are present within the ectopic bone tissue, an unexpected finding that indicates that although the mutation is necessary to induce the bone formation process, the mutation is not required for progenitor cell contribution to bone and cartilage. This unique knock-in mouse model provides novel insight into the genetic regulation of heterotopic ossification and establishes the first direct in vivo evidence that the R206H mutation in ACVR1 causes FOP. PMID:22508565
Shibata, Shunichi; Fukada, Kenji; Suzuki, Shoichi; Ogawa, Takuya; Yamashita, Yasuo
2002-01-01
Mandibular condylar cartilage is often classified as a secondary cartilage, differing from the primary cartilaginous skeleton in its rapid progress from progenitor cells to hypertrophic chondrocytes. In this study we used in situ hybridization and immunohistochemistry to investigate whether the formation of primary (tibial) and secondary (condylar) cartilage also differs with respect to the expression of two major non-collagenous glycoproteins of bone matrix, bone sialoprotein (BSP) and secreted phosphoprotein 1 (Spp1, osteopontin). The mRNAs for both molecules were never expressed until hypertrophic chondrocytes appeared. In the tibial cartilage, hypertrophic chondrocytes first appeared at E14 and the expression of BSP and Spp1 mRNAs was detected in the lower hypertrophic cell zone, but the expression of BSP mRNA was very weak. In the condylar cartilage, hypertrophic chondrocytes appeared at E15 as soon as cartilage tissue appeared. The mRNAs for both molecules were expressed in the newly formed condylar cartilage, although the proteins were not detected by immunostaining; BSP mRNA in the condylar cartilage was more extensively expressed than that in the tibial cartilage at the corresponding stage (first appearance of hypertrophic cell zone). Endochondral bone formation started at E15 in the tibial cartilage and at E16 in the condylar cartilage. At this stage (first appearance of endochondral bone formation), BSP mRNA was also more extensively expressed in the condylar cartilage than in the tibial cartilage. The hypertrophic cell zone in the condylar cartilage rapidly extended during E15–16. These results indicate that the formation process of the mandibular condylar cartilage differs from that of limb bud cartilage with respect to the extensive expression of BSP mRNA and the rapid extension of the hypertrophic cell zone at early stages of cartilage formation. Furthermore, these results support the hypothesis that, in vivo, BSP promotes the initiation of mineralization. PMID:12033735
Toneri, Makoto; Miwa, Shinji; Zhang, Yong; Hu, Cameron; Yano, Shuya; Matsumoto, Yasunori; Bouvet, Michael; Nakanishi, Hayao; Hoffman, Robert M; Zhao, Ming
2015-10-13
Bone metastasis is a frequent occurrence in prostate cancer patients and often is lethal. Zoledronic acid (ZOL) is often used for bone metastasis with limited efficacy. More effective models and treatment methods are required to improve the outcome of prostate cancer patients. In the present study, the effects of tumor-targeting Salmonella typhimurium A1-R were analyzed in vitro and in vivo on prostate cancer cells and experimental bone metastasis. Both ZOL and S. typhimurium A1-R inhibited the growth of PC-3 cells expressing red fluorescent protien in vitro. To investigate the efficacy of S. typhimurium A1-R on prostate cancer experimental bone metastasis, we established models of both early and advanced stage bone metastasis. The mice were treated with ZOL, S. typhimurium A1-R, and combination therapy of both ZOL and S. typhimurium A1-R. ZOL and S. typhimurium A1-R inhibited the growth of solitary bone metastases. S. typhimurium A1-R treatment significantly decreased bone metastasis and delayed the appearance of PC-3 bone metastases of multiple mouse models. Additionally, S. typhimurium A1-R treatment significantly improved the overall survival of the mice with multiple bone metastases. The results of the present study indicate that S. typhimurium A1-R is useful to prevent and inhibit prostate cancer bone metastasis and has potential for future clinical use in the adjuvant setting.
Campbell, Dean O; Noda, Akihiro; Verlinsky, Alla; Snyder, Josh; Fujita, Yuji; Murakami, Yoshihiro; Fushiki, Hiroshi; Miyoshi, Sosuke; Lacayo, Sergio; Cabral, Edward; Yang, Peng; Stover, David R; Joseph, Ingrid B J K
2016-10-01
Nectin-4 is selectively overexpressed in a variety of cancers and is currently under clinical investigation as a therapeutic target. A monoclonal antibody against nectin-4 (AGS-22M6) was evaluated as an Immuno-positron emission tomography (ImmunoPET) reagent. Its ability to assay nectin-4 expression as well as detect nectin-4 positive tumors in the liver and bone was evaluated using mouse models. The biodistribution of [(89)Zr]AGS-22M6 was evaluated in mice bearing tumors with varying levels of nectin-4 expression. An isogenic breast cancer tumor line was used to model metastatic liver and bone disease in mice. The biodistribution of [(18)F]AGS-22M6 in cynomolgus monkeys was evaluated. A positive correlation was demonstrated between tumor nectin-4 expression and [(89)Zr]AGS-22M6 uptake. Tumors in the liver and bone were detected and differentiated based on nectin-4 expression. [(18)F]AGS-22M6 showed limited uptake in cynomolgus monkey tissues. [(89)Zr]AGS-22M6 is a promising ImmunoPET reagent that can assay nectin-4 expression in both primary and metastatic lesions.
NASA Astrophysics Data System (ADS)
Ross, Michael H.
Breast cancer is the most common cancer for women worldwide, representing approximately 25% of all new cancer cases in this population. While early detection and removal of breast cancer still confined to the primary site results in a good prognosis, approximately one- third of patients will develop distant metastases. In these patients, overall survival is markedly reduced. Of the common sites for breast cancer metastasis, the skeletal system is the most frequent. Treating breast cancer bone metastases has proven particularly difficult for several reasons, such as dissemination of metastases throughout the skeleton, poor drug localization to sites of interest, a lack of tumor-specific targets expressed across breast cancer subtypes, and the chemo-protective nature of the bone microenvironment. This dissertation is focused on investigating a potential tumor-target expressed on breast cancer bone metastases, and to improve drug treatment efficacy against tumor cells in the bone microenvironment. Integrins are heterodimeric cell surface receptors, composed of an alpha and beta subunit from a large family of selectively-compatible integrin subunits. As a heterodimeric complex, integrins can bind to components of the extracellular matrix or to other cells. One particular integrin complex, integrin alphavbeta3, is composed of the tightly regulated integrin subunit beta3 and the more widely expressed alphav subunit. I examined the expression of integrin beta3 on primary breast cancer as compared to metastases in murine cancer models, and observed that integrin expression is significantly elevated on bone metastases as compared to the primary tumors or visceral metastases. In addition, I evaluated tumor-associated integrin beta3 expression on a tissue microarray (TMA) composed of primary breast cancer and patient-matched bone metastatic tissue from 42 patients. Across nearly all patients, tumor-associated integrin beta3 expression was significantly elevated on bone metastases as compared to the primary tumor. For the first time, I demonstrate that tumor-associated integrin beta3 is elevated on bone metastases across all breast cancer subtypes, supporting the translational potential of targeting integrin beta3 in breast cancer patients with bone metastases. Integrin beta3 was weakly expressed on tumor cells in vitro and on tumor cells in the primary mammary fat pad (MFP). Additional analysis demonstrated that integrin beta3 on circulating tumor cells is dispensable for strong expression of integrin beta3 on subsequent bone metastases, suggested that integrin beta3 may be induced within the bone microenvironment. I identified transforming growth factor beta (TGF-beta) to be a potent inducer of integrin beta3 in vitro, and further demonstrate canonical TGF-beta signaling through the SMAD2 and SMAD3 (SMAD2/3) pathway is responsible for breast cancer upregulation of integrin beta3 induction on bone metastases, both in vitro and in vivo. Utilizing this information, I sought to evaluate the targeting potential of nanotherapy coated with a targeting ligand specific for integrin alphavbeta3. Nanotherapy has the potential to increase therapeutic efficacy and reduce toxicity versus traditional chemotherapies by enhancing drug delivery to specific targets of interest. I explored the localization potential of two nanoparticles with significantly different sizes: polysorbate (tween) 80 micelle nanoparticles (MPs, 12.5 nm) or perfluorocarbon (PFC) nanoparticles ( 250 nm). The smaller integrin alphavbeta3- targeted micelle nanoparticle (alphavbeta3-MP) could more effectively penetrate breast cancer bone metastases than larger integrin alphavbeta3-targeted PFC nanoparticles (alphavbeta3-PFCs). With these observations, I evaluated whether alphavbeta3-MP-mediated drug delivery could more effectively attenuate bone metastatic tumor burden and bone destruction than free drug delivery. Using the chemotherapeutic agent docetaxel (DTX), a potent microtubule inhibitor that is a first-line therapy for metastatic breast cancer, I observe that DTX is only weakly tumor- suppressive in our mouse model of breast cancer metastases. However, treating mice bearing breast cancer metastases with alphavbeta3-MP-delivery of a docetaxel-prodrug (DTX-PD) significantly reduced bone tumor burden and bone destruction, and with less hepatotoxicity. I observed a significant decrease in bone-residing tumor cell proliferation in mice treated with alphavbeta3-MP- delivery of DTX-PD, without overt osteoclast killing or inhibition of osteoclast formation. Together, these results provide support that nanotherapy-mediated attenuation of bone metastases and bone destruction occurs through enhanced drug efficacy against breast cancer cells within the bone. In this Dissertation, Chapter 1 will provide an overview of breast cancer, bone metastases, integrins, and the therapeutic potential of nanotherapy. In Chapter 2, my work on the expression and physiologic regulation of integrin beta3 on breast cancer during metastases will be explored. In Chapter 3, the role of the cytokine TGF-beta in regulating tumoral expression of integrin beta3 will be discussed. And in Chapter 4, I discuss the use of integrin alphavbeta3-targeted nanotherapy directed against breast cancer metastases. Collectively, I provide evidence that chemotherapeutic efficacy against breast cancer cells within bone can be enhanced by exploiting the expression of tumoral integrin beta3 at that metastatic site.
Ophoff, J; Venken, K; Callewaert, F; Boonen, S; Bouillon, R; Vanderschueren, D
2009-10-01
In this study, the role of disturbed bone mineral acquisition during puberty in the pathogenesis of osteoporosis was studied. To this end, a mouse model for senile and hypogonadal osteoporosis was used. Longitudinal follow-up showed that bone fragility in both models results from deficient bone build-up during early puberty. Male osteoporosis may result from impaired bone growth. This study characterizes the mechanisms of deficient peak bone mass acquisition in models for senile (SAMP6) and hypogonadal (orchidectomized SAMR1) osteoporosis. Bone mineral acquisition was investigated longitudinally in SAMP6 and orchidectomized SAMR1 mice (eight to ten animals per group) using peripheral quantitative computed tomography and histomorphometry. Additionally, the effects of long-term 5alpha-dihydrotestosterone (DHT) and 17beta-estradiol (E2) replacement were studied. Statistical analysis was performed using ANOVA and Student's t test. SAMP6 mice showed an early (4 weeks) medullary expansion of the cortex due to impaired endocortical bone formation (-43%). Despite compensatory periosteal bone formation (+47%), cortical thickness was severely reduced in 20-week-old SAMP6 versus SAMR1. Orchidectomy reduced periosteal apposition between 4 and 8 weeks of age and resulted in high bone turnover and less trabecular bone gain in SAMP6 and SAMR1. DHT and E2 stimulated periosteal expansion and trabecular bone in orchidectomized SAMP6 and SAMR1. E2 stimulated endocortical apposition in SAMP6. Moreover, sex steroid action occurred between 4 and 8 weeks of age. Bone fragility in both models resulted from deficient bone build-up during early puberty. DHT and E2 improved bone mass acquisition in orchidectomized animals, suggesting a role for AR and ER in male skeletal development.
Li, Feng; Wang, Xujun; Niyibizi, Christopher
2010-01-01
Currently, there are conflicting data in literature regarding contribution of bone marrow stromal cells (BMSCs) to bone formation when the cells are systemically delivered in recipient animals. To understand if BMSCs contribute to bone cell phenotype and bone formation in osteogenesis imperfecta bones (OI), MSCs marked with GFP were directly infused into the femurs of a mouse model of OI (oim). The contribution of the cells to the cell phenotype and bone formation was assessed by histology, immunohistochemistry and biomechanical loading of recipient bones. Two weeks following infusion of BMSCs, histological examination of the recipient femurs demonstrated presence of new bone when compared to femurs injected with saline which showed little or no bone formation. The new bone contained few donor cells as demonstrated by GFP fluorescence. At six weeks following cell injection, new bone was still detectable in the recipient femurs but was enhanced by injection of the cells suspended in pepsin solublized type I collagen. Immunofluorescence and immunohistochemical staining showed that donor GFP positive cells in the new bone were localized with osteocalcin expressing cells suggesting that the cells differentiated into osteoblasts in vivo. Biomechanical loading to failure in thee point bending, revealed that, femurs infused with BMSCs in PBS or in soluble type I collagen were biomechanically stronger than those injected with PBS or type I collagen alone. Taken together, the results indicate that transplanted cells differentiated into osteoblasts in vivo and contributed to bone formation in vivo; we also speculate that donor cells induced differentiation or recruitment of endogenous cells to initiate reparative process at early stages following transplantation. PMID:20570757
Jeffery, Justin J; Lux, Katie; Vogel, John S; Herrera, Wynetta D; Greco, Stephen; Woo, Ho-Hyung; AbuShahin, Nisreen; Pagel, Mark D; Chambers, Setsuko K
2014-04-01
Breast cancer cells preferentially home to the bone microenvironment, which provides a unique niche with a network of multiple bidirectional communications between host and tumor, promoting survival and growth of bone metastases. In the bone microenvironment, the c-fms proto-oncogene that encodes for the CSF-1 receptor, along with CSF-1, serves as one critical cytokine/receptor pair, functioning in paracrine and autocrine fashion. Previous studies concentrated on the effect of inhibition of host (mouse) c-fms on bone metastasis, with resulting decrease in osteolysis and bone metastases as a paracrine effect. In this report, we assessed the role of c-fms inhibition within the tumor cells (autocrine effect) in the early establishment of breast cancer cells in bone and the effects of this early c-fms inhibition on subsequent bone metastases and destruction. This study exploited a multidisciplinary approach by employing two non-invasive, in vivo imaging methods to assess the progression of bone metastases and bone destruction, in addition to ex vivo analyses using RT-PCR and histopathology. Using a mouse model of bone homing human breast cancer cells, we showed that an early one-time application of anti-human c-fms antibody delayed growth of bone metastases and bone destruction for at least 31 days as quantitatively measured by bioluminescence imaging and computed tomography, compared to controls. Thus, neutralizing human c-fms in the breast cancer cell alone decreases extent of subsequent bone metastasis formation and osteolysis. Furthermore, we are the first to show that anti-c-fms antibodies can impact early establishment of breast cancer cells in bone.
The First Scube3 Mutant Mouse Line with Pleiotropic Phenotypic Alterations
Fuchs, Helmut; Sabrautzki, Sibylle; Przemeck, Gerhard K. H.; Leuchtenberger, Stefanie; Lorenz-Depiereux, Bettina; Becker, Lore; Rathkolb, Birgit; Horsch, Marion; Garrett, Lillian; Östereicher, Manuela A.; Hans, Wolfgang; Abe, Koichiro; Sagawa, Nobuho; Rozman, Jan; Vargas-Panesso, Ingrid L.; Sandholzer, Michael; Lisse, Thomas S.; Adler, Thure; Aguilar-Pimentel, Juan Antonio; Calzada-Wack, Julia; Ehrhard, Nicole; Elvert, Ralf; Gau, Christine; Hölter, Sabine M.; Micklich, Katja; Moreth, Kristin; Prehn, Cornelia; Puk, Oliver; Racz, Ildiko; Stoeger, Claudia; Vernaleken, Alexandra; Michel, Dian; Diener, Susanne; Wieland, Thomas; Adamski, Jerzy; Bekeredjian, Raffi; Busch, Dirk H.; Favor, John; Graw, Jochen; Klingenspor, Martin; Lengger, Christoph; Maier, Holger; Neff, Frauke; Ollert, Markus; Stoeger, Tobias; Yildirim, Ali Önder; Strom, Tim M.; Zimmer, Andreas; Wolf, Eckhard; Wurst, Wolfgang; Klopstock, Thomas; Beckers, Johannes; Gailus-Durner, Valerie; Hrabé de Angelis, Martin
2016-01-01
The vertebrate Scube (Signal peptide, CUB, and EGF-like domain-containing protein) family consists of three independent members, Scube1–3, which encode secreted cell surface-associated membrane glycoproteins. Limited information about the general function of this gene family is available, and their roles during adulthood. Here, we present the first Scube3 mutant mouse line (Scube3N294K/N294K), which clearly shows phenotypic alterations by carrying a missense mutation in exon 8, and thus contributes to our understanding of SCUBE3 functions. We performed a detailed phenotypic characterization in the German Mouse Clinic (GMC). Scube3N294K/N294K mutants showed morphological abnormalities of the skeleton, alterations of parameters relevant for bone metabolism, changes in renal function, and hearing impairments. These findings correlate with characteristics of the rare metabolic bone disorder Paget disease of bone (PDB), associated with the chromosomal region of human SCUBE3. In addition, alterations in energy metabolism, behavior, and neurological functions were detected in Scube3N294K/N294K mice. The Scube3N294K/N294K mutant mouse line may serve as a new model for further studying the effect of impaired SCUBE3 gene function. PMID:27815347
Eap, Sandy; Keller, Laetitia; Schiavi, Jessica; Huck, Olivier; Jacomine, Leandro; Fioretti, Florence; Gauthier, Christian; Sebastian, Victor; Schwinté, Pascale; Benkirane-Jessel, Nadia
2015-01-01
New-generation implants focus on robust, durable, and rapid tissue regeneration to shorten recovery times and decrease risks of postoperative complications for patients. Herein, we describe a new-generation thick nanofibrous implant functionalized with active containers of growth factors and stem cells for regenerative nanomedicine. A thick electrospun poly(ε-caprolactone) nanofibrous implant (from 700 μm to 1 cm thick) was functionalized with chitosan and bone morphogenetic protein BMP-7 as growth factor using layer-by-layer technology, producing fish scale-like chitosan/BMP-7 nanoreservoirs. This extracellular matrix-mimicking scaffold enabled in vitro colonization and bone regeneration by human primary osteoblasts, as shown by expression of osteocalcin, osteopontin, and bone sialoprotein (BSPII), 21 days after seeding. In vivo implantation in mouse calvaria defects showed significantly more newly mineralized extracellular matrix in the functionalized implant compared to a bare scaffold after 30 days’ implantation, as shown by histological scanning electron microscopy/energy dispersive X-ray microscopy study and calcein injection. We have as well bifunctionalized our BMP-7 therapeutic implant by adding human mesenchymal stem cells (hMSCs). The activity of this BMP-7-functionalized implant was again further enhanced by the addition of hMSCs to the implant (living materials), in vivo, as demonstrated by the analysis of new bone formation and calcification after 30 days’ implantation in mice with calvaria defects. Therefore, implants functionalized with BMP-7 nanocontainers associated with hMSCs can act as an accelerator of in vivo bone mineralization and regeneration. PMID:25709432
Junankar, Simon; Shay, Gemma; Jurczyluk, Julie; Ali, Naveid; Down, Jenny; Pocock, Nicholas; Parker, Andrew; Nguyen, Akira; Sun, Shuting; Kashemirov, Boris; McKenna, Charles E.; Croucher, Peter I.; Swarbrick, Alexander; Weilbaecher, Katherine; Phan, Tri Giang; Rogers, Michael J.
2014-01-01
Recent clinical trials have shown that bisphosphonate drugs improve breast cancer patient survival independent of their anti-resorptive effects on the skeleton. However, since bisphosphonates bind rapidly to bone mineral, the exact mechanisms of their anti-tumour action, particularly on cells outside of bone, remain unknown. Here we used real-time intravital two-photon microscopy to show extensive leakage of fluorescent bisphosphonate from the vasculature in 4T1 mouse mammary tumours, where it initially binds to areas of small, granular microcalcifications that are engulfed by tumour-associated macrophages (TAMs), but not tumour cells. Importantly, we also observed uptake of radiolabeled bisphosphonate in the primary breast tumour of a patient and showed the resected tumour to be infiltrated with TAMs and to contain similar granular microcalcifications. These data represent the first compelling in vivo evidence that bisphosphonates can target cells in tumours outside the skeleton and that their anti-tumour activity is likely to be mediated via TAMs. PMID:25312016
Wolfe, Tobie D.; Somanathan Pillai, Smitha Pankajavally; Hildreth, Blake Eason; Lanigan, Lisa G.; Martin, Chelsea K.; Werbeck, Jillian L.
2014-01-01
Osteosarcoma (OSA) is an aggressive, highly metastatic and lytic primary bone neoplasm commonly affecting the appendicular skeleton of dogs and children. Current treatment options include amputation of the afflicted limb, limb-sparing procedures, or palliative radiation with or without adjunct chemotherapy. Therapies that inhibit bone resorption, such as the bisphosphonates, may be an effective palliative therapy by limiting the local progression of OSA in those patients that are not viable candidates for amputation. We have developed a mouse model of canine skeletal OSA following intratibial inoculation of OSCA40 cells that spontaneously metastasized to the lungs. We demonstrated that therapy with a nitrogen-containing bisphosphonate, zoledronic acid (Zol), reduced OSA-induced bone lysis; however, Zol monotherapy or in combination with amputation was not effective at inhibiting pulmonary metastasis. While not reaching statistical significance, amputation of the tumor-bearing limb reduced the average incidence of lung metastases; however, this effect was nullified when Zol was added to the treatment protocol. In untreated mice, the magnitude of proximal tibial lysis was significantly correlated with the incidence of metastasis. The data support amputation alone for the management of appendicular OSA rather than combining amputation with Zol. However, in patients that are not viable candidates for amputation, Zol may be a useful palliative therapy for OSA by reducing the magnitude of lysis and therefore bone pain, despite the risk of increased pulmonary metastasis. PMID:21374084
Tominari, Tsukasa; Hirata, Michiko; Matsumoto, Chiho; Inada, Masaki; Miyaura, Chisato
2012-01-01
Nobiletin, a polymethoxy flavonoid (PMF), inhibits systemic bone resorption and maintains bone mass in estrogen-deficient ovariectomized mice. This study examined the anti-inflammatory effects of PMFs, nobiletin, and tangeretin on lipopolysaccharide (LPS)-induced bone resorption. Nobiletin and tangeretin suppressed LPS-induced osteoclast formation and bone resorption and suppressed the receptor activator of NFκB ligand-induced osteoclastogenesis in RAW264.7 macrophages. Nobiletin clearly restored the alveolar bone mass in a mouse experimental model for periodontitis by inhibiting LPS-induced bone resorption. PMFs may therefore provide a new therapeutic approach for periodontal bone loss.
Early Changes of Articular Cartilage and Subchondral Bone in The DMM Mouse Model of Osteoarthritis.
Fang, Hang; Huang, Lisi; Welch, Ian; Norley, Chris; Holdsworth, David W; Beier, Frank; Cai, Daozhang
2018-02-12
To examine the early changes of articular cartilage and subchondral bone in the DMM mouse model of osteoarthritis, mice were subjected to DMM or SHAM surgery and sacrificed at 2-, 5- and 10-week post-surgery. Catwalk gait analyses, Micro-Computed Tomography, Toluidine Blue, Picrosirius Red and Tartrate-Resistant Acid Phosphatase (TRAP) staining were used to investigate gait patterns, joint morphology, subchondral bone, cartilage, collagen organization and osteoclasts activity, respectively. Results showed OA progressed over 10-week time-course. Gait disparity occurred only at 10-week post-surgery. Osteophyte formed at 2-week post-surgery. BMDs of DMM showed no statistical differences comparing to SHAM at 2 weeks, but BV/TV is much higher in DMM mice. Increased BMD was clearly found at 5- and 10-week post-surgery in DMM mice. TRAP staining showed increased osteoclast activity at the site of osteophyte formation of DMM joints at 5- and 10-week time points. These results showed that subchondral bone turnover might occurred earlier than 2 weeks in this mouse DMM model. Gait disparity only occurred at later stage of OA in DMM mice. Notably, patella dislocation could occur in some of the DMM mice and cause a different pattern of OA in affected knee.
Xu, Wenan; Jiang, Shan; Chen, Qiuyue; Ye, Yanyan; Chen, Jiajing; Heng, Boon Chin; Jiang, Qianli; Wu, Buling; Ding, Zihai; Zhang, Chengfei
2016-02-01
Migratory cells via blood circulation or cells adjacent to the root apex may potentially participate in dental pulp tissue regeneration or renewal. This study investigated whether systemically transplanted bone marrow cells can contribute to pulp regeneration in a chimeric mouse model. A chimeric mouse model was created through the injection of bone marrow cells from green fluorescent protein (GFP) transgenic C57BL/6 mice into the tail veins of recipient wild-type C57BL/6 mice that had been irradiated with a lethal dose of 8.5 Gy from a high-frequency linear accelerator. These mice were subjected to pulpectomy and pulp revascularization. At 1, 4, and 8 weeks after surgery, in vivo animal imaging and histologic analyses were conducted. In vivo animal imaging showed that the green biofluorescence signal from the transplanted GFP+ cells increased significantly and was maintained at a high level during the first 4 weeks after surgery. Immunofluorescence analyses of tooth specimens collected at 8 weeks postsurgery showed the presence of nestin+/GFP+, α smooth muscle actin (α-SMA)/GFP+, and NeuN/GFP+ cells within the regenerated pulplike tissue. These data confirm that transplanted bone marrow-derived cells can contribute to dental pulp regeneration. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Adeno Associated Viral-mediated intraosseus labeling of bone marrow derived cells for CNS tracking
Selenica, Maj-Linda B.; Reid, Patrick; Pena, Gabriela; Alvarez, Jennifer; Hunt, Jerry B.; Nash, Kevin R.; Morgan, Dave; Gordon, Marcia N.; Lee, Daniel C.
2016-01-01
Inflammation, including microglial activation in the CNS, is an important hallmark in many neurodegenerative diseases. Microglial stimuli not only impact the brain microenvironment by production and release of cytokines and chemokines, but also influence the activity of bone marrow derived cells and blood born macrophage populations. In many diseases including brain disorders and spinal cord injury, researchers have tried to harbor the neuroprotective and repair properties of these subpopulations. Hematopoietic bone marrow derived cells (BMDCs) are of great interest, especially during gene therapy because certain hematopoietic cell subpopulations traffic to the sites of injury and inflammation. The aim of this study was to develop a method of labeling endogenous bone marrow derived cells through intraosseus impregnation of recombinant adeno-associated virus (rAAV) or lentivirus. We utilized rAAV serotype 9 (rAAV-9) or lentivirus for gene delivery of green florescence protein (GFP) to the mouse bone marrow cells. Flow cytometry showed that both viruses were able to efficiently transduce mouse bone marrow cells in vivo. However, the rAAV9–GFP viral construct transduced BMDCs more efficiently than the lentivirus (11.2% vs. 6.8%), as indicated by cellular GFP expression. We also demonstrate that GFP labeled cells correspond to bone marrow cells of myeloid origin using CD11b as a marker. Additionally, we characterized the ability of bone marrow derived, GFP labeled cells to extravasate into the brain parenchyma upon acute and subchronic neuroinflammatory stimuli in the mouse CNS. Viral mediated over expression of chemokine (C-C motif) ligand 2 (CCL2) or intracranial injection of lipopolysaccharide (LPS) recruited GFP labeled BMDCs from the periphery into the brain parenchyma compared to vehicle treated mice. Altogether our findings demonstrate a useful method of labeling endogenous BMDCs via viral transduction and the ability to track subpopulations throughout the body following insult or injury. Alternatively, this method might find utility in delivering therapeutic genes for neuroinflammatory conditions. PMID:26784524
CUI, X.; CHEN, J.; ZACHAREK, A.; ROBERTS, C.; SAVANT-BHONSALE, S.; CHOPP, M.
2008-01-01
Neovascularization may contribute to functional recovery after neural injury. Combination treatment of stroke with a nitric oxide donor, DETA-NONOate and bone marrow stromal cells promote functional recovery. However, the mechanisms underlying functional improvement have not been elucidated. In this study, we tested the hypothesis that combination treatment upregulates Angiopoietin1 and its receptor Tie2 in the ischemic brain and bone marrow stromal cells, thereby enhances cerebral neovascularization after stroke. Adult wild type male C57BL/6 mice were intravenously administered PBS, bone marrow stromal cells 5×105, DETA-NONOate 0.4 mg/kg or combination DETA-NONOate with bone marrow stromal cells (n=12/group) after middle cerebral artery occlusion. Combination treatment significantly upregulated Angiopoietin-1/Tie2 and tight junction protein (occludin) expression, and increased the number, diameter and perimeter of blood vessels in the ischemic brain compared with vehicle control (mean ± SE, p<0.05). In vitro, DETA-NONOate significantly increased Angiopoietin-1/Tie2 protein (n=6/group) and Tie2 mRNA (n=3/group) expression in bone marrow stromal cells. DETA-NONOate also significantly increased Angiopoietin-1 protein (n=6/group) and mRNA (n=3/group) expression in mouse brain endothelial cells (p<0.05). Angiopoietin-1 mRNA (n=3/group) was significantly increased in mouse brain endothelial cells treated with DETA-NONOate in combination with bone marrow stromal cells conditioned medium compared with cells treated with bone marrow stromal cells conditioned medium or DETA-NONOate alone. Mouse brain endothelial cell capillary tube-like formation assays (n=6/group) showed that Angiopoietin-1 peptide, the supernatant of bone marrow stromal cells and DETA-NONOate significantly increased capillary tube formation compared to vehicle control. Combination treatment significantly increased capillary tube formation compared with DETA-NONOate treatment alone. Inhibition of Angiopoietin-1 significantly attenuated combination treatment-induced tube formation. Our data indicated that combination treatment of stroke with DETA-NONOate and bone marrow stromal cells promotes neovascularization, which is at least partially mediated by upregulation of the Angiopoietin-1/Tie2 axis. PMID:18691637
Raman spectroscopy of bone metastasis
NASA Astrophysics Data System (ADS)
Esmonde-White, Karen A.; Sottnik, Joseph; Morris, Michael; Keller, Evan
2012-02-01
Raman spectroscopy of bone has been used to characterize chemical changes occurring in diseases such as osteoporosis, osteoarthritis and osteomyelitis. Metastasis of cancer into bone causes changes to bone quality that are similar to those observed in osteoporosis, such as decreased bone strength, but with an accelerated timeframe. In particular, osteolytic (bone degrading) lesions in bone metastasis have a marked effect on patient quality of life because of increased risk of fractures, pain, and hypercalcemia. We use Raman spectroscopy to examine bone from two different mouse models of osteolytic bone metastasis. Raman spectroscopy measures physicochemical information which cannot be obtained through standard biochemical and histological measurements. This study was reviewed and approved by the University of Michigan University Committee on the Care and Use of Animals. Two mouse models of prostate cancer bone metastasis, RM1 (n=3) and PC3-luc (n=4) were examined. Tibiae were injected with RM1 or PC3-luc cancer cells, while the contralateral tibiae received a placebo injection for use as controls. After 2 weeks of incubation, the mice were sacrificed and the tibiae were examined by Raman microspectroscopy (λ=785 nm). Spectroscopic markers corresponding to mineral stoichiometry, bone mineralization, and mineral crystallinity were compared in spectra from the cancerous and control tibiae. X-ray imaging of the tibia confirmed extensive osteolysis in the RM1 mice, with tumor invasion into adjoining soft tissue and moderate osteolysis in the PC3-luc mice. Raman spectroscopic markers indicate that osteolytic lesions are less mineralized than normal bone tissue, with an altered mineral stoichiometry and crystallinity.
Sex Steroid Actions in Male Bone
Laurent, Michaël R.; Claessens, Frank; Gielen, Evelien; Lagerquist, Marie K.; Vandenput, Liesbeth; Börjesson, Anna E.; Ohlsson, Claes
2014-01-01
Sex steroids are chief regulators of gender differences in the skeleton, and male gender is one of the strongest protective factors against osteoporotic fractures. This advantage in bone strength relies mainly on greater cortical bone expansion during pubertal peak bone mass acquisition and superior skeletal maintenance during aging. During both these phases, estrogens acting via estrogen receptor-α in osteoblast lineage cells are crucial for male cortical and trabecular bone, as evident from conditional genetic mouse models, epidemiological studies, rare genetic conditions, genome-wide meta-analyses, and recent interventional trials. Genetic mouse models have also demonstrated a direct role for androgens independent of aromatization on trabecular bone via the androgen receptor in osteoblasts and osteocytes, although the target cell for their key effects on periosteal bone formation remains elusive. Low serum estradiol predicts incident fractures, but the highest risk occurs in men with additionally low T and high SHBG. Still, the possible clinical utility of serum sex steroids for fracture prediction is unknown. It is likely that sex steroid actions on male bone metabolism rely also on extraskeletal mechanisms and cross talk with other signaling pathways. We propose that estrogens influence fracture risk in aging men via direct effects on bone, whereas androgens exert an additional antifracture effect mainly via extraskeletal parameters such as muscle mass and propensity to fall. Given the demographic trends of increased longevity and consequent rise of osteoporosis, an increased understanding of how sex steroids influence male bone health remains a high research priority. PMID:25202834
Hajdu Cheney Mouse Mutants Exhibit Osteopenia, Increased Osteoclastogenesis, and Bone Resorption.
Canalis, Ernesto; Schilling, Lauren; Yee, Siu-Pok; Lee, Sun-Kyeong; Zanotti, Stefano
2016-01-22
Notch receptors are determinants of cell fate and function and play a central role in skeletal development and bone remodeling. Hajdu Cheney syndrome, a disease characterized by osteoporosis and fractures, is associated with NOTCH2 mutations resulting in a truncated stable protein and gain-of-function. We created a mouse model reproducing the Hajdu Cheney syndrome by introducing a 6955C→T mutation in the Notch2 locus leading to a Q2319X change at the amino acid level. Notch2(Q2319X) heterozygous mutants were smaller and had shorter femurs than controls; and at 1 month of age they exhibited cancellous and cortical bone osteopenia. As the mice matured, cancellous bone volume was restored partially in male but not female mice, whereas cortical osteopenia persisted in both sexes. Cancellous bone histomorphometry revealed an increased number of osteoclasts and bone resorption, without a decrease in osteoblast number or bone formation. Osteoblast differentiation and function were not affected in Notch2(Q2319X) cells. The pre-osteoclast cell pool, osteoclast differentiation, and bone resorption in response to receptor activator of nuclear factor κB ligand in vitro were increased in Notch2(Q2319X) mutants. These effects were suppressed by the γ-secretase inhibitor LY450139. In conclusion, Notch2(Q2319X) mice exhibit cancellous and cortical bone osteopenia, enhanced osteoclastogenesis, and increased bone resorption. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
The bone diagnostic instrument III: Testing mouse femora
NASA Astrophysics Data System (ADS)
Randall, Connor; Mathews, Phillip; Yurtsev, Eugene; Sahar, Nadder; Kohn, David; Hansma, Paul
2009-06-01
Here we describe modifications that allow the bone diagnostic instrument (BDI) [P. Hansma et al., Rev. Sci. Instrum. 79, 064303 (2008); Rev. Sci. Instrum. 77, 075105 (2006)], developed to test human bone, to test the femora of mice. These modifications include reducing the effective weight of the instrument on the bone, designing and fabricating new probe assemblies to minimize damage to the small bone, developing new testing protocols that involve smaller testing forces, and fabricating a jig for securing the smaller bones for testing. With these modifications, the BDI was used to test the hypothesis that short-term running has greater benefit on the mechanical properties of the femur for young growing mice compared to older, skeletally mature mice. We measured elastic modulus, hardness, and indentation distance increase (IDI), which had previously been shown to be the best discriminators in model systems known to exhibit differences in mechanical properties at the whole bone level. In the young exercised murine femora, the IDI was significantly lower than in young control femora. Since IDI has a relation to postyield properties, these results suggest that exercise during bone development increases post yield mechanical competence. We were also able to measure effects of aging on bone properties with the BDI. There was a significant increase in the IDI, and a significant decrease in the elastic modulus and hardness between the young and old groups. Thus, with the modifications described here, the BDI can take measurements on mouse bones and obtain statistically significant results.
Excess TGF-β mediates muscle weakness associated with bone metastases in mice
Reiken, Steven; Xie, Wenjun; Andersson, Daniel C.; John, Sutha; Chiechi, Antonella; Wright, Laura E.; Umanskaya, Alisa; Niewolna, Maria; Trivedi, Trupti; Charkhzarrin, Sahba; Khatiwada, Pooja; Wronska, Anetta; Haynes, Ashley; Benassi, Maria Serena; Witzmann, Frank A.; Zhen, Gehua; Wang, Xiao; Cao, Xu; Roodman, G. David; Marks, Andrew R.; Guise, Theresa A.
2015-01-01
Cancer-associated muscle weakness is poorly understood and there is no effective treatment. Here, we find that seven different mouse models of human osteolytic bone metastases, representing breast, lung and prostate cancers, as well as multiple myeloma exhibited impaired muscle function, implicating a role for the tumor-bone microenvironment in cancer-associated muscle weakness. We found that TGF-β, released from the bone surface as a result of metastasis-induced bone destruction upregulated NADPH oxidase 4 (Nox4), resulting in elevated oxidization of skeletal muscle proteins, including the ryanodine receptor/calcium (Ca2+) release channel (RyR1). The oxidized RyR1 channels leaked Ca2+, resulting in lower intracellular signaling required for proper muscle contraction. We found that inhibiting RyR1 leak, TGF-β signaling, TGF-β release from bone or Nox4 all improved muscle function in mice with MDA-MB-231 bone metastases. Humans with breast cancer- or lung cancer-associated bone metastases also had oxidized skeletal muscle RyR1 that is not seen in normal muscle. Similarly, skeletal muscle weakness, higher levels of Nox4 protein and Nox4 binding to RyR1, and oxidation of RyR1 were present in a mouse model of Camurati-Engelmann disease, a non-malignant metabolic bone disorder associated with increased TGF-β activity. Thus, metastasis-induced TGF-β release from bone contributes to muscle weakness by decreasing Ca2+-induced muscle force production. PMID:26457758
DOE Office of Scientific and Technical Information (OSTI.GOV)
Du, L.; Desbarats, M.; Viel, J.
1996-08-15
The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less
Models of tibial fracture healing in normal and Nf1-deficient mice.
Schindeler, Aaron; Morse, Alyson; Harry, Lorraine; Godfrey, Craig; Mikulec, Kathy; McDonald, Michelle; Gasser, Jürg A; Little, David G
2008-08-01
Delayed union and nonunion are common complications associated with tibial fractures, particularly in the distal tibia. Existing mouse tibial fracture models are typically closed and middiaphyseal, and thus poorly recapitulate the prevailing conditions following surgery on a human open distal tibial fracture. This report describes our development of two open tibial fracture models in the mouse, where the bone is broken either in the tibial midshaft (mid-diaphysis) or in the distal tibia. Fractures in the distal tibial model showed delayed repair compared to fractures in the tibial midshaft. These tibial fracture models were applied to both wild-type and Nf1-deficient (Nf1+/-) mice. Bone repair has been reported to be exceptionally problematic in human NF1 patients, and these patients can also spontaneously develop tibial nonunions (known as congenital pseudarthrosis of the tibia), which are recalcitrant to even vigorous intervention. pQCT analysis confirmed no fundamental differences in cortical or cancellous bone in Nf1-deficient mouse tibiae compared to wild-type mice. Although no difference in bone healing was seen in the tibial midshaft fracture model, the healing of distal tibial fractures was found to be impaired in Nf1+/- mice. The histological features associated with nonunited Nf1+/- fractures were variable, but included delayed cartilage removal, disproportionate fibrous invasion, insufficient new bone anabolism, and excessive catabolism. These findings imply that the pathology of tibial pseudarthrosis in human NF1 is complex and likely to be multifactorial.
2014-01-01
Background While microRNA (miRNA) expression is known to be altered in a variety of human malignancies contributing to cancer development and progression, the potential role of miRNA dysregulation in malignant mast cell disease has not been previously explored. The purpose of this study was to investigate the potential contribution of miRNA dysregulation to the biology of canine mast cell tumors (MCTs), a well-established spontaneous model of malignant mast cell disease. Methods We evaluated the miRNA expression profiles from biologically low-grade and biologically high-grade primary canine MCTs using real-time PCR-based TaqMan Low Density miRNA Arrays and performed real-time PCR to evaluate miR-9 expression in primary canine MCTs, malignant mast cell lines, and normal bone marrow-derived mast cells (BMMCs). Mouse mast cell lines and BMMCs were transduced with empty or pre-miR-9 expressing lentiviral constructs and cell proliferation, caspase 3/7 activity, and invasion were assessed. Transcriptional profiling of cells overexpressing miR-9 was performed using Affymetrix GeneChip Mouse Gene 2.0 ST arrays and real-time PCR was performed to validate changes in mRNA expression. Results Our data demonstrate that unique miRNA expression profiles correlate with the biological behavior of primary canine MCTs and that miR-9 expression is increased in biologically high grade canine MCTs and malignant cell lines compared to biologically low grade tumors and normal canine BMMCs. In transformed mouse malignant mast cell lines expressing either wild-type (C57) or activating (P815) KIT mutations and mouse BMMCs, miR-9 overexpression significantly enhanced invasion but had no effect on cell proliferation or apoptosis. Transcriptional profiling of normal mouse BMMCs and P815 cells possessing enforced miR-9 expression demonstrated dysregulation of several genes, including upregulation of CMA1, a protease involved in activation of matrix metalloproteases and extracellular matrix remodeling. Conclusions Our findings demonstrate that unique miRNA expression profiles correlate with the biological behavior of canine MCTs. Furthermore, dysregulation of miR-9 is associated with MCT metastasis potentially through the induction of an invasive phenotype, identifying a potentially novel pathway for therapeutic intervention. PMID:24517413
Shi, Changgui; Hu, Bo; Guo, Lei; Cao, Peng; Tian, Ye; Ma, Jun; Chen, Yuanyuan; Wu, Huiqiao; Hu, Jinquan; Deng, Lianfu; Zhang, Ying; Yuan, Wen
2016-05-01
Osteogenesis imperfecta (OI) is a genetic bone dysplasia characterized by brittle bones with increased fracture risk. Although current treatment options to improve bone strength in OI focus on antiresorptive bisphosphonates, controlled clinical trials suggest they have an equivocal effect on reducing fracture risk. Strontium ranelate (SrR) is a promising therapy with a dual mode of action that is capable of simultaneously maintaining bone formation and reducing bone resorption, and may be beneficial for the treatment of OI. In this study, SrR therapy was investigated to assess its effects on fracture frequency and bone mass and strength in an animal model of OI, the oim/oim mouse. Three-week-old oim/oim and wt/wt mice were treated with either SrR or vehicle (Veh) for 11 weeks. After treatment, the average number of fractures sustained by SrR-treated oim/oim mice was significantly reduced compared to Veh-treated oim/oim mice. Micro-computed tomographic (μCT) analyses of femurs showed that both trabecular and cortical bone mass were significantly improved with SrR treatment in both genotypes. SrR significantly inhibited bone resorption, whereas bone formation indices were maintained. Biomechanical testing revealed improved bone structural properties in both oim/oim and wild-type (wt/wt) mice under the treatment, whereas no significant effects on bone brittleness and material quality were observed. In conclusion, SrR was able to effectively reduce fractures in oim/oim mice by improving bone mass and strength and thus represents a potential therapy for the treatment of pediatric OI. © 2015 American Society for Bone and Mineral Research. © 2015 American Society for Bone and Mineral Research.
Moriyama, Kenji; Hanai, Atsuko; Mekada, Kazuyuki; Yoshiki, Atsushi; Ogiwara, Katsueki; Kimura, Atsushi; Takahashi, Takayuki
2011-08-20
The endopeptidase encoded by Phex (phosphate-regulating gene with homologies to endopeptidases linked to the X chromosome) is critical for regulation of bone matrix mineralization and phosphate homeostasis. PHEX has been identified from analyses of human X-linked hypophosphatemic rickets and Hyp mutant mouse models. We here demonstrated a newly established dwarfism-like Kbus/Idr mouse line to be a novel Hyp model. Histopathological and X-ray examination with cross experiments were performed to characterize Kbus/Idr. RT-PCR-based and exon-directed PCR screening performed to identify the presence of genetic alteration. Biochemical assays were also performed to evaluate activity of alkaline phosphatase. Kbus/Idr, characterized by bone mineralization defects, was found to be inherited in an X chromosome-linked dominant manner. RT-PCR experiments showed that a novel mutation spanning exon 16 and 18 causing hypophosphatemic rickets. Alkaline phosphatase activity, as an osteoblast marker, demonstrated raised levels in the bone marrow of Kbus/Idr independent of the age. Kbus mice should serve as a useful research tool exploring molecular mechanisms underlying aberrant Phex-associated pathophysiological phenomena.
Bropirimine inhibits osteoclast differentiation through production of interferon-β
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suzuki, Hiroaki; Mochizuki, Ayako; Yoshimura, Kentaro
Bropirimine is a synthetic agonist for toll-like receptor 7 (TLR7). In this study, we investigated the effects of bropirimine on differentiation and bone-resorbing activity of osteoclasts in vitro. Bropirimine inhibited osteoclast differentiation of mouse bone marrow-derived macrophages (BMMs) induced by receptor activator of nuclear factor κB ligand (RANKL) in a concentration-dependent manner. Furthermore, it suppressed the mRNA expression of nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATc1), a master transcription factor for osteoclast differentiation, without affecting BMM viability. Bropirimine also inhibited osteoclast differentiation induced in co-cultures of mouse bone marrow cells (BMCs) and mouse osteoblastic UAMS-32 cells in the presencemore » of activated vitamin D{sub 3}. Bropirimine partially suppressed the expression of RANKL mRNA in UAMS-32 cells induced by activated vitamin D{sub 3}. Finally, the anti-interferon-β (IFN-β) antibody restored RANKL-dependent differentiation of BMMs into osteoclasts suppressed by bropirimine. These results suggest that bropirimine inhibits differentiation of osteoclast precursor cells into osteoclasts via TLR7-mediated production of IFN-β.« less
Zhuk, A S; Stepchenkova, E I; Dukel'skaia, A V; Daev, E V; Inge-Vechtomov, S G
2011-10-01
The hypothesis on a relationship between the high frequency of mitotic disturbances in bone marrow cells and the change in the activity of the S9 liver fraction containing promutagen-activating enzymes under olfactory stress in the house mouse Mus musculus has been tested. For this purpose, the effect of the pheromone 2,5-dimethylpyrazine on the frequency of mitotic disturbances in mouse bone marrow cells has been measured by the anaphase-telophase assay. The Ames test using Salmonella typhimurium has been employed to compare the capacities of the S9 liver fractions from stressed and intact mice for activating the promutagen 2-aminofluorene. It has been demonstrated that the increased frequency of mitotic disturbances in bone marrow cells induced by the pheromonal stressor in male house mice is accompanied by an increased promutagen-activating capacity of the S9 liver fraction. The model system used in the study allowed the genetic consequences of the exposure to the olfactory stressor to be estimated and the possible mechanisms of genome destabilization to be assumed.
Pan, Xuan; Jones, Morgan; Jiang, Jie; Zaprazna, Kristina; Yu, Duonan; Pear, Warren; Maillard, Ivan; Atchison, Michael L.
2012-01-01
Ying Yang 1 (YY1) is a multifunctional Polycomb Group (PcG) transcription factor that binds to multiple enhancer binding sites in the immunoglobulin (Ig) loci and plays vital roles in early B cell development. PcG proteins have important functions in hematopoietic stem cell renewal and YY1 is the only mammalian PcG protein with DNA binding specificity. Conditional knock-out of YY1 in the mouse B cell lineage results in arrest at the pro-B cell stage, and dosage effects have been observed at various YY1 expression levels. To investigate the impact of elevated YY1 expression on hematopoetic development, we utilized a mouse in vivo bone marrow reconstitution system. We found that mouse bone marrow cells expressing elevated levels of YY1 exhibited a selective disadvantage as they progressed from hematopoietic stem/progenitor cells to pro-B, pre-B, immature B and re-circulating B cell stages, but no disadvantage of YY1 over-expression was observed in myeloid lineage cells. Furthermore, mouse bone marrow cells expressing elevated levels of YY1 displayed enrichment for cells with surface markers characteristic of long-term hematopoietic stem cells (HSC). YY1 expression induced apoptosis in mouse B cell lines in vitro, and resulted in down-regulated expression of anti-apoptotic genes Bcl-xl and NFκB2, while no impact was observed in a mouse myeloid line. B cell apoptosis and LT-HSC enrichment induced by YY1 suggest that novel strategies to induce YY1 expression could have beneficial effects in the treatment of B lineage malignancies while preserving normal HSCs. PMID:22292011
Daev, E V; Vyborova, A M; Kazarova, V É; Dukel'skaia, A V
2012-01-01
Evolutionary conservative chemosignal 2,5-dimethylpyrazin that is pheromone in female mice has been shown to increase frequency of mitotic aberrations analyzed with aid of metaphasic and ana-telophasic analysis in bone marrow cells. Replacement of one of methyl radicals in the pheromone molecule by the carboxyl radical reveals specificity of action of the used derivative: the frequency of disturbances revealed only by the ana-telophasic analysis increases, whereas by the metaphasic analysis, no induction of disturbance is detected. In the sperm head abnormality test there is shown a rise of the anomalies by both compounds. Possible mechanisms of specific action of the tested substances on stability of genetic apparatus of the bone marrow dividing cells in the house mouse are discussed.
Aguila, Hector L.; Mun, Se Hwan; Kalinowski, Judith; Adams, Douglas J.; Lorenzo, Joseph A.; Lee, Sun-Kyeong
2012-01-01
Interleukin-7 is a critical cytokine for lymphoid development and a direct inhibitor of in vitro osteoclastogenesis in murine bone marrow cultures. To explore the role of IL-7 in bone, we generated transgenic mouse lines bearing the 2.3 Kb rat collagen 1A1 promoter driving the expression of human IL-7 specifically in osteoblasts. In addition we crossed these mice with IL-7 deficient mice to determine if the alterations in lymphopoiesis, bone mass and osteoclast formation observed in the IL-7 KO mice could be rescued by osteoblast-specific overexpression of IL-7. Here we show that mice overexpressing human IL-7 in the osteoblast lineage demonstrated increased trabecular bone volume in vivo by µCT and decreased osteoclast formation in vitro. Furthermore, targeted overexpression of IL-7 in osteoblasts rescued the osteopenic bone phenotype and B cell development of IL-7 KO mice but did not have an effect on T lymphopoiesis, which occurs in the periphery. The bone phenotypes in IL-7 KO mice and targeted IL-7 overexpressing mouse models were observed only in females. These results likely reflect both a direct inhibitory effects of IL-7 on osteoclastogenesis in vivo and gender specific differences in responses to IL-7. PMID:22258693
Hermenean, Anca; Codreanu, Ada; Herman, Hildegard; Balta, Cornel; Rosu, Marcel; Mihali, Ciprian Valentin; Ivan, Alexandra; Dinescu, Sorina; Ionita, Mariana; Costache, Marieta
2017-11-30
Limited self-regenerating capacity of human skeleton makes the reconstruction of critical size bone defect a significant challenge for clinical practice. Aimed for regenerating bone tissues, this study was designed to investigate osteogenic differentiation, along with bone repair capacity of 3D chitosan (CHT) scaffolds enriched with graphene oxide (GO) in critical-sized mouse calvarial defect. Histopathological/histomorphometry and scanning electron microscopy(SEM) analysis of the implants revealed larger amount of new bone in the CHT/GO-filled defects compared with CHT alone (p < 0.001). When combined with GO, CHT scaffolds synergistically promoted the increase of alkaline phosphatase activity both in vitro and in vivo experiments. This enhanced osteogenesis was corroborated with increased expression of bone morphogenetic protein (BMP) and Runx-2 up to week 4 post-implantation, which showed that GO facilitates the differentiation of osteoprogenitor cells. Meanwhile, osteogenesis was promoted by GO at the late stage as well, as indicated by the up-regulation of osteopontin and osteocalcin at week 8 and overexpressed at week 18, for both markers. Our data suggest that CHT/GO biomaterial could represent a promising tool for the reconstruction of large bone defects, without using exogenous living cells or growth factors.
Nakashima, Tomoki
Recent studies of mouse genetics and human gene mutations has greatly contributed to clarifying the molecular mechanism of bone metabolism. Bone is constantly renewed by the balanced action of osteoblastic bone formation and osteoclastic bone resorption both of which mainly occur at the bone surface. This restructuring process called "bone remodeling" is important not only for normal bone mass and strength, but also for mineral homeostasis. Bone remodeling is stringently regulated by communication among bone component cells such as osteoclasts, osteoblasts, osteocytes and endothelial cells. An imbalance of this process is often linked to various bone diseases. Thus, the elucidation of the molecular mechanisms involved in bone remodeling is critical for a deeper understanding of the maintenance of healthy skeleton and bone disease.
Keeney, Michael; Chung, Michael T; Zielins, Elizabeth R; Paik, Kevin J; McArdle, Adrian; Morrison, Shane D; Ransom, Ryan C; Barbhaiya, Namrata; Atashroo, David; Jacobson, Gunilla; Zare, Richard N; Longaker, Michael T; Wan, Derrick C; Yang, Fan
2016-08-01
Scaffold-mediated gene delivery holds great promise for tissue regeneration. However, previous attempts to induce bone regeneration using scaffold-mediated non-viral gene delivery rarely resulted in satisfactory healing. We report a novel platform with sustained release of minicircle DNA (MC) from PLGA scaffolds to accelerate bone repair. MC was encapsulated inside PLGA scaffolds using supercritical CO2 , which showed prolonged release of MC. Skull-derived osteoblasts transfected with BMP-2 MC in vitro result in higher osteocalcin gene expression and mineralized bone formation. When implanted in a critical-size mouse calvarial defect, scaffolds containing luciferase MC lead to robust in situ protein production up to at least 60 days. Scaffold-mediated BMP-2 MC delivery leads to substantially accelerated bone repair as early as two weeks, which continues to progress over 12 weeks. This platform represents an efficient, long-term nonviral gene delivery system, and may be applicable for enhancing repair of a broad range of tissues types. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2099-2107, 2016. © 2016 Wiley Periodicals, Inc.
DiGirolamo, Douglas J.; Singhal, Vandana; Chang, Xiaoli; Lee, Se-Jin; Germain-Lee, Emily L.
2015-01-01
Osteogenesis imperfecta (OI) comprises a group of heritable connective tissue disorders generally defined by recurrent fractures, low bone mass, short stature and skeletal fragility. Beyond the skeletal complications of OI, many patients also report intolerance to physical activity, fatigue and muscle weakness. Indeed, recent studies have demonstrated that skeletal muscle is also negatively affected by OI, both directly and indirectly. Given the well-established interdependence of bone and skeletal muscle in both physiology and pathophysiology and the observations of skeletal muscle pathology in patients with OI, we investigated the therapeutic potential of simultaneous anabolic targeting of both bone and skeletal muscle using a soluble activin receptor 2B (ACVR2B) in a mouse model of type III OI (oim). Treatment of 12-week-old oim mice with ACVR2B for 4 weeks resulted in significant increases in both bone and muscle that were similar to those observed in healthy, wild-type littermates. This proof of concept study provides encouraging evidence for a holistic approach to treating the deleterious consequences of OI in the musculoskeletal system. PMID:26161291
Chatterjee, Sumanta; Basak, Pratima; Das, Prosun; Das, Madhurima; Pereira, Jacintha Archana; Dutta, Ranjan Kumar; Chaklader, Malay; Chaudhuri, Samaresh; Law, Sujata
2010-01-01
Self-renewing Hematopoietic Stem Cells (HSCs) are responsible for reconstitution of all blood cell lineages. Sca-1 is the “stem cell antigen” marker used to identify the primitive murine HSC population, the expression of which decreases upon differentiation to other mature cell types. Sca-1+ HSCs maintain the bone marrow stem cell pool throughout the life. Aplastic anemia is a disease considered to involve primary stem cell deficiency and is characterized by severe pancytopenia and a decline in healthy blood cell generation system. Studies conducted in our laboratory revealed that the primitive Sca-1+ BM-HSCs (bone marrow hematopoietic stem cell) are significantly affected in experimental Aplastic animals pretreated with chemotherapeutic drugs (Busulfan and Cyclophosphamide) and there is increased Caspase-3 activity with consecutive high Annexin-V positivity leading to premature apoptosis in the bone marrow hematopoietic stem cell population in Aplastic condition. The Sca-1bright, that is, “more primitive” BM-HSC population was more affected than the “less primitive” BM-HSC Sca-1dim population. The decreased cell population and the receptor expression were directly associated with an empty and deranged marrow microenvironment, which is evident from scanning electron microscopy (SEM). The above experimental evidences hint toward the manipulation of receptor expression for the benefit of cytotherapy by primitive stem cell population in Aplastic anemia cases. PMID:21048851
2015-09-01
results in increased activity/expression of key pain-sensing receptor channels, such as TRPV1 , such that the channels are constitutively activated...Keywords: Prostate Cancer Bone Metastasis, Bone Cancer Pain, Heterotrimeric G protein betagamma subunits, G protein coupled receptors (GPCRs), TRPV1 ...vitro, as well as mediating GPCR-regulated TRPV1 channel function in cultured mouse sensory neurons (Aim 1) Major Goal/Objective 1: Determine the
2013-07-01
results in increased activity/expression of key pain-sensing receptor channels, such as TRPV1 , such that the channels are constitutively activated...Keywords: Prostate Cancer Bone Metastasis, Bone Cancer Pain, Heterotrimeric G protein betagamma subunits, G protein coupled receptors (GPCRs), TRPV1 ...cell growth, migration and invasion in vitro, as well as mediating GPCR-regulated TRPV1 channel function in cultured mouse sensory neurons (Aim 1
Meier, Raphael P. H.; Seebach, Jörg D.; Morel, Philippe; Mahou, Redouan; Borot, Sophie; Giovannoni, Laurianne; Parnaud, Geraldine; Montanari, Elisa; Bosco, Domenico; Wandrey, Christine; Berney, Thierry; Bühler, Leo H.; Muller, Yannick D.
2014-01-01
Bone marrow was recently proposed as an alternative and potentially immune-privileged site for pancreatic islet transplantation. The aim of the present study was to assess the survival and rejection mechanisms of free and encapsulated xenogeneic islets transplanted into the medullary cavity of the femur, or under the kidney capsule of streptozotocin-induced diabetic C57BL/6 mice. The median survival of free rat islets transplanted into the bone marrow or under the kidney capsule was 9 and 14 days, respectively, whereas that of free human islets was shorter, 7 days (bone marrow) and 10 days (kidney capsule). Infiltrating CD8+ T cells and redistributed CD4+ T cells, and macrophages were detected around the transplanted islets in bone sections. Recipient mouse splenocytes proliferated in response to donor rat stimulator cells. One month after transplantation under both kidney capsule or into bone marrow, encapsulated rat islets had induced a similar degree of fibrotic reaction and still contained insulin positive cells. In conclusion, we successfully established a small animal model for xenogeneic islet transplantation into the bone marrow. The rejection of xenogeneic islets was associated with local and systemic T cell responses and macrophage recruitment. Although there was no evidence for immune-privilege, the bone marrow may represent a feasible site for encapsulated xenogeneic islet transplantation. PMID:24625569
Kumar, Sanjay; Ponnazhagan, Selvarangan
2012-04-01
Although the number of mesenchymal stem cells (MSC) in the bone marrow is sufficient to maintain skeletal homeostasis, in osteopenic pathology, aggravated osteoclast activity or insufficient osteoblast numbers ensue, affecting normal bone remodeling. Most of the currently available therapies are anti-resorptive with limited osteogenic potential. Since mobilization of stem/progenitors from the BM is a prerequisite for their participation in tissue repair, amplification of endogenous stem cells may provide an alternative approach in these conditions. The present study determined the potential of MSC mobilization in vivo, using combinations of different growth factors with the CXCR4 antagonist, AMD3100, in a mouse model of segmental bone defect. Results indicated that among several factors tested IGF1 had maximum proliferative ability of MSC in vitro. Results of the in vivo studies indicated that the combination of IGF1 and AMD3100 provided significant augmentation of bone growth as determined by DXA, micro-CT and histomorphometry in mice bearing segmental fractures. Further, characterization of MSC isolated from mice treated with IGF1 and AMD3100 indicated Akt/PI3K, MEK1/2-Erk1/2 and smad2/3 as key signaling pathways mediating this effect. These data indicate the potential of in vivo stem cell mobilization as a novel alternative for bone healing. Copyright © 2012 Elsevier Inc. All rights reserved.
Tomco, Marek; Petrovova, Eva; Giretova, Maria; Almasiova, Viera; Holovska, Katarina; Cigankova, Viera; Jenca, Andrej; Jencova, Janka; Jenca, Andrej; Boldizar, Martin; Balazs, Kosa; Medvecky, Lubomir
2017-09-01
Bone tissue engineering combines biomaterials with biologically active factors and cells to hold promise for reconstructing craniofacial defects. In this study the biological activity of biphasic hydroxyapatite ceramics (HA; a bone substitute that is a mixture of hydroxyapatite and β-tricalcium phosphate in fixed ratios) was characterized (1) in vitro by assessing the growth of MC3T3 mouse osteoblast lineage cells, (2) in ovo by using the chick chorioallantoic membrane (CAM) assay and (3) in an in vivo pig animal model. Biocompatibility, bioactivity, bone formation and biomaterial degradation were detected microscopically and by radiology and histology. HA ceramics alone demonstrated great biocompatibility on the CAM as well as bioactivity by increased proliferation and alkaline phosphatase secretion of mouse osteoblasts. The in vivo implantation of HA ceramics with bone marrow mesenchymal stem cells (MMSCs) showed de novo intramembranous bone healing of critical-size bone defects in the right lateral side of pig mandibular bodies after 3 and 9 weeks post-implantation. Compared with the HA ceramics without MMSCs, the progress of bone formation was slower with less-developed features. This article highlights the clinical use of microporous biphasic HA ceramics despite the unusually shaped elongated micropores with a high length/width aspect ratio (up to 20) and absence of preferable macropores (>100 µm) in bone regenerative medicine.
Frick, Kevin K; Krieger, Nancy S; Nehrke, Keith; Bushinsky, David A
2009-01-01
Metabolic acidosis increases urine Ca without increasing intestinal absorption, leading to bone Ca loss. It is unclear how bone cells detect the increase in proton concentration. To determine which G protein-coupled proton sensing receptors are expressed in bone, PCR was performed, and products were detected for OGR1, TDAG8, G2A, and GPR4. We tested the hypothesis that the G protein-coupled proton sensor, OGR1, is an H+-sensing receptor in bone. To determine whether acid-induced bone resorption involves OGR1, we incubated mouse calvariae in neutral pH (NTL) or acidic (MET) medium ± the OGR1 inhibitor CuCl2. CuCl2 decreased MET-induced Ca efflux. We used fluorescent imaging of perfused bone cells to determine whether MET increases Cai. Perfusion with MET induced a rapid, flow-independent, increase in Cai in individual bone cells. To determine whether transfection of OGR1 into a heterologous cell type would increase Cai in response to H+, we perfused Chinese hamster ovary (CHO) cells transfected with mouse OGR1 cDNA. Perfusion with MET induced a rapid increase in Cai in OGR1-transfected CHO cells. These data indicate that OGR1 induces an increase in Cai in response to MET and is a prime candidate for an osteoblast proton sensor. PMID:18847331
Frick, Kevin K; Krieger, Nancy S; Nehrke, Keith; Bushinsky, David A
2009-02-01
Metabolic acidosis increases urine Ca without increasing intestinal absorption, leading to bone Ca loss. It is unclear how bone cells detect the increase in proton concentration. To determine which G protein-coupled proton sensing receptors are expressed in bone, PCR was performed, and products were detected for OGR1, TDAG8, G2A, and GPR4. We tested the hypothesis that the G protein-coupled proton sensor, OGR1, is an H(+)-sensing receptor in bone. To determine whether acid-induced bone resorption involves OGR1, we incubated mouse calvariae in neutral pH (NTL) or acidic (MET) medium +/- the OGR1 inhibitor CuCl(2). CuCl(2) decreased MET-induced Ca efflux. We used fluorescent imaging of perfused bone cells to determine whether MET increases Ca(i). Perfusion with MET induced a rapid, flow-independent, increase in Ca(i) in individual bone cells. To determine whether transfection of OGR1 into a heterologous cell type would increase Ca(i) in response to H(+), we perfused Chinese hamster ovary (CHO) cells transfected with mouse OGR1 cDNA. Perfusion with MET induced a rapid increase in Ca(i) in OGR1-transfected CHO cells. These data indicate that OGR1 induces an increase in Ca(i) in response to MET and is a prime candidate for an osteoblast proton sensor.
Flexibility in the mouse middle ear: A finite element study of the frequency response
NASA Astrophysics Data System (ADS)
Gottlieb, Peter; Puria, Sunil
2018-05-01
The mammalian middle ear is comprised of three distinct ossicles, connected by joints, and suspended in an air-filled cavity. In most mammals, the ossicular joints are mobile synovial joints, which introduce flexibility into the ossicular chain. In some smaller rodents, however, these joints are less mobile, and in the mouse in particular, the malleus is additionally characterized by a large, thin plate known as the transversal lamina, which connects the manubrium to the incus-malleus joint (IMJ). We hypothesize that this feature acts as a functional joint, maintaining the benefits of a flexible ossicular chain despite a less-mobile IMJ, and tested this hypothesis with a finite element model of the mouse middle ear. The results showed that while fusing the ossicular joints had a negligible effect on sound transmission, stiffening the ossicular bone significantly reduced sound transmission, implying that bone flexibility plays a critical role in the normal function of the mouse middle ear.
A Progressive Translational Mouse Model of Human VCP Disease: The VCP R155H/+ Mouse
Nalbandian, Angèle; Llewellyn, Katrina J.; Badadani, Mallikarjun; Yin, Hong Z.; Nguyen, Christopher; Katheria, Veeral; Watts, Giles; Mukherjee, Jogeshwar; Vesa, Jouni; Caiozzo, Vincent; Mozaffar, Tahseen; Weiss, John H.; Kimonis, Virginia E.
2012-01-01
Introduction Mutations in the valosin containing protein (VCP) gene cause hereditary Inclusion Body Myopathy (hIBM) associated with Paget disease of bone (PDB), and frontotemporal dementia (FTD). More recently they have been linked to 2% of familial ALS cases. A knock-in mouse model offers the opportunity to study VCP-associated pathogenesis. Methods The VCPR155H/+ knock-in mouse model was assessed for muscle strength, immunohistochemical, Western, apoptosis, autophagy and MicroPET/CT imaging analyses. Results VCPR155H/+ mice developed significant progressive muscle weakness, and the quadriceps and brain developed progressive cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-II staining. MicroCT analyses revealed Paget-like lesions at the ends of long bones. Spinal cord demonstrated neurodegenerative changes, ubiquitin, and TDP-43 pathology of motor neurons. Discussion VCPR155H/+ knock-in mice represent an excellent pre-clinical model for understanding VCP-associated disease mechanisms and future treatments. PMID:23169451
Shanmugarajan, Srinivasan; Swoboda, Kathryn J.; Iannaccone, Susan T.; Ries, William L.; Maria, Bernard L.; Reddy, Sakamuri V.
2009-01-01
Spinal muscular atrophy is the second most common fatal childhood disorder. Core clinical features include muscle weakness caused by degenerating lower motor neurons and a high incidence of bone fractures and hypercalcemia. Fractures further compromise quality of life by progression of joint contractures or additional loss of motor function. Recent observations suggest that bone disease in spinal muscular atrophy may not be attributed entirely to lower motor neuron degeneration. The presence of the spinal muscular atrophy disease-determining survival motor neuron gene (SMN), SMN expression, and differential splicing in bone-resorbing osteoclasts was recently discovered. Its ubiquitous expression and the differential expression of splice variants suggest that SMN has specific roles in bone cell function. SMN protein also interacts with osteoclast stimulatory factor. Mouse models of human spinal muscular atrophy disease suggest a potential role of SMN protein in skeletal development. Dual energy x-ray absorptiometry analysis demonstrated a substantial decrease in total bone area and poorly developed caudal vertebra in the mouse model. These mice also had pelvic bone fractures. Studies delineating SMN signaling mechanisms and gene transcription in a cell-specific manner will provide important molecular insights into the pathogenesis of bone disease in children with spinal muscular atrophy. Moreover, understanding bone remodeling in spinal muscular atrophy may lead to novel therapeutic approaches to enhance skeletal health and quality of life. This article reviews the skeletal complications associated with spinal muscular atrophy and describes a functional role for SMN protein in osteoclast development and bone resorption activity. PMID:17761651
Li, Nianhu; Xu, Zhanwang; Wooley, Paul H; Zhang, Jianxin; Yang, Shang-You
2014-01-01
Wear debris associated periprosthetic osteolysis represents a major pathological process associated with the aseptic loosening of joint prostheses. Naringin is a major flavonoid identified in grapefruit. Studies have shown that naringin possesses many pharmacological properties including effects on bone metabolism. The current study evaluated the influence of naringin on wear debris induced osteoclastic bone resorption both in vitro and in vivo. The osteoclast precursor cell line RAW 264.7 was cultured and stimulated with polymethylmethacrylate (PMMA) particles followed by treatment with naringin at several doses. Tartrate resistant acid phosphatase (TRAP), calcium release, and gene expression profiles of TRAP, cathepsin K, and receptor activator of nuclear factor-kappa B were sequentially evaluated. PMMA challenged murine air pouch and the load bearing tibia titanium pin-implantation mouse models were used to evaluate the effects of naringin in controlling PMMA induced bone resorption. Histological analyses and biomechanical pullout tests were performed following the animal experimentation. The in vitro data clearly demonstrated the inhibitory effects of naringin in PMMA induced osteoclastogenesis. The naringin dose of 10 μg/mL exhibited the most significant influence on the suppression of TRAP activities. Naringin treatment also markedly decreased calcium release in the stimulated cell culture medium. The short-term air pouch mouse study revealed that local injection of naringin ameliorated the PMMA induced inflammatory tissue response and subsequent bone resorption. The long-term tibia pin-implantation mouse model study suggested that daily oral gavage of naringin at 300 mg/kg dosage for 30 days significantly alleviated the periprosthetic bone resorption. A significant increase of periprosthetic bone volume and regaining of the pin stability were found in naringin treated mice. Overall, this study suggests that naringin may serve as a potential therapeutic agent to treat wear debris associated osteolysis. PMID:24376342
A novel Phex mutation in a new mouse model of hypophosphatemic rickets.
Owen, Celeste; Chen, Frieda; Flenniken, Ann M; Osborne, Lucy R; Ichikawa, Shoji; Adamson, S Lee; Rossant, Janet; Aubin, Jane E
2012-07-01
X-linked hypophosphatemic rickets (XLH) is a dominantly inherited disease characterized by renal phosphate wasting, aberrant vitamin D metabolism, and defective bone mineralization. It is known that XLH in humans and in certain mouse models is caused by inactivating mutations in PHEX/Phex (phosphate-regulating gene with homologies to endopeptidases on the X chromosome). By a genome-wide N-ethyl-N-nitrosourea (ENU)-induced mutagenesis screen in mice, we identified a dominant mouse mutation that exhibits the classic clinical manifestations of XLH, including growth retardation, skeletal abnormalities (rickets/osteomalacia), hypophosphatemia, and increased serum alkaline phosphatase (ALP) levels. Mapping and sequencing revealed that these mice carry a point mutation in exon 14 of the Phex gene that introduces a stop codon at amino acid 496 of the coding sequence (Phex(Jrt) also published as Phex(K496X) [Ichikawa et al., 2012]). Fgf23 mRNA expression as well as that of osteocalcin, bone sialoprotein, and matrix extracellular phosphoglycoprotein was upregulated in male mutant long bone, but that of sclerostin was unaffected. Although Phex mRNA is expressed in bone from mutant hemizygous male mice (Phex(Jrt)/Y mice), no Phex protein was detected in immunoblots of femoral bone protein. Stromal cultures from mutant bone marrow were indistinguishable from those of wild-type mice with respect to differentiation and mineralization. The ability of Phex(Jrt)/Y osteoblasts to mineralize and the altered expression levels of matrix proteins compared with the well-studied Hyp mice makes it a unique model with which to further explore the clinical manifestations of XLH and its link to FGF23 as well as to evaluate potential new therapeutic strategies. Copyright © 2012 Wiley Periodicals, Inc.
Comparison of three methods of calculating strain in the mouse ulna in exogenous loading studies.
Norman, Stephanie C; Wagner, David W; Beaupre, Gary S; Castillo, Alesha B
2015-01-02
Axial compression of mouse limbs is commonly used to induce bone formation in a controlled, non-invasive manner. Determination of peak strains caused by loading is central to interpreting results. Load-strain calibration is typically performed using uniaxial strain gauges attached to the diaphyseal, periosteal surface of a small number of sacrificed animals. Strain is measured as the limb is loaded to a range of physiological loads known to be anabolic to bone. The load-strain relationship determined by this subgroup is then extrapolated to a larger group of experimental mice. This method of strain calculation requires the challenging process of strain gauging very small bones which is subject to variability in placement of the strain gauge. We previously developed a method to estimate animal-specific periosteal strain during axial ulnar loading using an image-based computational approach that does not require strain gauges. The purpose of this study was to compare the relationship between load-induced bone formation rates and periosteal strain at ulnar midshaft using three different methods to estimate strain: (A) Nominal strain values based solely on load-strain calibration; (B) Strains calculated from load-strain calibration, but scaled for differences in mid-shaft cross-sectional geometry among animals; and (C) An alternative image-based computational method for calculating strains based on beam theory and animal-specific bone geometry. Our results show that the alternative method (C) provides comparable correlation between strain and bone formation rates in the mouse ulna relative to the strain gauge-dependent methods (A and B), while avoiding the need to use strain gauges. Published by Elsevier Ltd.
Rapid ex vivo imaging of PAIII prostate to bone tumor with SWIFT-MRI.
Luhach, Ihor; Idiyatullin, Djaudat; Lynch, Conor C; Corum, Curt; Martinez, Gary V; Garwood, Michael; Gillies, Robert J
2014-09-01
The limiting factor for MRI of skeletal/mineralized tissue is fast transverse relaxation. A recent advancement in MRI technology, SWIFT (Sweep Imaging with Fourier Transform), is emerging as a new approach to overcome this difficulty. Among other techniques like UTE, ZTE, and WASPI, the application of SWIFT technology has the strong potential to impact preclinical and clinical imaging, particularly in the context of primary or metastatic bone cancers because it has the added advantage of imaging water in mineralized tissues of bone allowing MRI images to be obtained of tissues previously visible only with modalities such as computed tomography (CT). The goal of the current study is to examine the feasibility of SWIFT for the assessment of the prostate cancer induced changes in bone formation (osteogenesis) and destruction (osteolysis) in ex vivo specimens. A luciferase expressing prostate cancer cell line (PAIII) or saline control was inoculated directly into the tibia of 6-week-old immunocompromised male mice. Tumor growth was assessed weekly for 3 weeks before euthanasia and dissection of the tumor bearing and sham tibias. The ex vivo mouse tibia specimens were imaged with a 9.4 Tesla (T) and 7T MRI systems. SWIFT images are compared with traditional gradient-echo and spin-echo MRI images as well as CT and histological sections. SWIFT images with nominal resolution of 78 μm are obtained with the tumor and different bone structures identified. Prostate cancer induced changes in the bone microstructure are visible in SWIFT images, which is supported by spin-echo, high resolution CT and histological analysis. SWIFT MRI is capable of high-quality high-resolution ex vivo imaging of bone tumor and surrounding bone and soft tissues. Furthermore, SWIFT MRI shows promise for in vivo bone tumor imaging, with the added benefits of nonexposure to ionizing radiation, quietness, and speed. Copyright © 2013 Wiley Periodicals, Inc.
Luo, Ke-Wang; Yue, Grace Gar-Lee; Ko, Chun-Hay; Lee, Julia Kin-Ming; Gao, Si; Li, Long-Fei; Li, Gang; Fung, Kwok-Pui; Leung, Ping-Chung; Lau, Clara Bik-San
2014-01-01
Coriolus versicolor (CV), a medicinal mushroom widely consumed in Asian countries, has been demonstrated to be effective in stimulation of immune system and inhibition of tumor growth. The present study aimed to investigate the anti-tumor and anti-metastasis effects of CV aqueous extract in mouse mammary carcinoma 4T1 cells and in 4T1-tumor bearing mouse model. Our results showed that CV aqueous extract (0.125-2 mg/ml) did not inhibit 4T1 cell proliferation while the non-cytotoxic dose of CV extract (1-2 mg/ml) significantly inhibited cell migration and invasion (p<0.05). Besides, the enzyme activities and protein levels of MMP-9 were suppressed by CV extract significantly. Animal studies showed that CV aqueous extract (1 g/kg, orally-fed daily for 4 weeks) was effective in decreasing the tumor weight by 36%, and decreased the lung metastasis by 70.8% against untreated control. Besides, micro-CT analysis of the tumor-bearing mice tibias indicated that CV extract was effective in bone protection against breast cancer-induced bone destruction as the bone volume was significantly increased. On the other hand, CV aqueous extract treatments resulted in remarkable immunomodulatory effects, which was reflected by the augmentation of IL-2, 6, 12, TNF-α and IFN-γ productions from the spleen lymphocytes of CV-treated tumor-bearing mice. In conclusion, our results demonstrated for the first time that the CV aqueous extract exhibited anti-tumor, anti-metastasis and immunomodulation effects in metastatic breast cancer mouse model, and could protect the bone from breast cancer-induced bone destruction. These findings provided scientific evidences for the clinical application of CV aqueous extract in breast cancer patients. Copyright © 2014 Elsevier GmbH. All rights reserved.
Panaroni, Cristina; Gioia, Roberta; Lupi, Anna; Besio, Roberta; Goldstein, Steven A.; Kreider, Jaclynn; Leikin, Sergey; Vera, Juan Carlos; Mertz, Edward L.; Perilli, Egon; Baruffaldi, Fabio; Villa, Isabella; Farina, Aurora; Casasco, Marco; Cetta, Giuseppe; Rossi, Antonio; Frattini, Annalisa; Marini, Joan C.; Vezzoni, Paolo
2009-01-01
Autosomal dominant osteogenesis imperfecta (OI) caused by glycine substitutions in type I collagen is a paradigmatic disorder for stem cell therapy. Bone marrow transplantation in OI children has produced a low engraftment rate, but surprisingly encouraging symptomatic improvements. In utero transplantation (IUT) may hold even more promise. However, systematic studies of both methods have so far been limited to a recessive mouse model. In this study, we evaluated intrauterine transplantation of adult bone marrow into heterozygous BrtlIV mice. Brtl is a knockin mouse with a classical glycine substitution in type I collagen [α1(I)-Gly349Cys], dominant trait transmission, and a phenotype resembling moderately severe and lethal OI. Adult bone marrow donor cells from enhanced green fluorescent protein (eGFP) transgenic mice engrafted in hematopoietic and nonhematopoietic tissues differentiated to trabecular and cortical bone cells and synthesized up to 20% of all type I collagen in the host bone. The transplantation eliminated the perinatal lethality of heterozygous BrtlIV mice. At 2 months of age, femora of treated Brtl mice had significant improvement in geometric parameters (P < .05) versus untreated Brtl mice, and their mechanical properties attained wild-type values. Our results suggest that the engrafted cells form bone with higher efficiency than the endogenous cells, supporting IUT as a promising approach for the treatment of genetic bone diseases. PMID:19414862
Uchimura, Tomoya; Hollander, Judith M; Nakamura, Daisy S; Liu, Zhiyi; Rosen, Clifford J; Georgakoudi, Irene; Zeng, Li
2017-10-01
Postnatal bone growth involves a dramatic increase in length and girth. Intriguingly, this period of growth is independent of growth hormone and the underlying mechanism is poorly understood. Recently, an IGF2 mutation was identified in humans with early postnatal growth restriction. Here, we show that IGF2 is essential for longitudinal and appositional murine postnatal bone development, which involves proper timing of chondrocyte maturation and perichondrial cell differentiation and survival. Importantly, the Igf2 null mouse model does not represent a simple delay of growth but instead uncoordinated growth plate development. Furthermore, biochemical and two-photon imaging analyses identified elevated and imbalanced glucose metabolism in the Igf2 null mouse. Attenuation of glycolysis rescued the mutant phenotype of premature cartilage maturation, thereby indicating that IGF2 controls bone growth by regulating glucose metabolism in chondrocytes. This work links glucose metabolism with cartilage development and provides insight into the fundamental understanding of human growth abnormalities. © 2017. Published by The Company of Biologists Ltd.
Tommasini, Steven M; Hu, Bin; Nadeau, Joseph H; Jepsen, Karl J
2009-04-01
Conventional approaches to identifying quantitative trait loci (QTLs) regulating bone mass and fragility are limited because they examine cortical and trabecular traits independently. Prior work examining long bones from young adult mice and humans indicated that skeletal traits are functionally related and that compensatory interactions among morphological and compositional traits are critical for establishing mechanical function. However, it is not known whether trait covariation (i.e., phenotypic integration) also is important for establishing mechanical function in more complex, corticocancellous structures. Covariation among trabecular, cortical, and compositional bone traits was examined in the context of mechanical functionality for L(4) vertebral bodies across a panel of 16-wk-old female AXB/BXA recombinant inbred (RI) mouse strains. The unique pattern of randomization of the A/J and C57BL/6J (B6) genome among the RI panel provides a powerful tool that can be used to measure the tendency for different traits to covary and to study the biology of complex traits. We tested the hypothesis that genetic variants affecting vertebral size and mass are buffered by changes in the relative amounts of cortical and trabecular bone and overall mineralization. Despite inheriting random sets of A/J and B6 genomes, the RI strains inherited nonrandom sets of cortical and trabecular bone traits. Path analysis, which is a multivariate analysis that shows how multiple traits covary simultaneously when confounding variables like body size are taken into consideration, showed that RI strains that tended to have smaller vertebrae relative to body size achieved mechanical functionality by increasing mineralization and the relative amounts of cortical and trabecular bone. The interdependence among corticocancellous traits in the vertebral body indicated that variation in trabecular bone traits among inbred mouse strains, which is often thought to arise from genetic factors, is also determined in part by the adaptive response to variation in traits describing the cortical shell. The covariation among corticocancellous traits has important implications for genetic analyses and for interpreting the response of bone to genetic and environmental perturbations.
Kühnisch, Jirko; Seto, Jong; Lange, Claudia; Schrof, Susanne; Stumpp, Sabine; Kobus, Karolina; Grohmann, Julia; Kossler, Nadine; Varga, Peter; Osswald, Monika; Emmerich, Denise; Tinschert, Sigrid; Thielemann, Falk; Duda, Georg; Seifert, Wenke; el Khassawna, Thaqif; Stevenson, David A.; Elefteriou, Florent; Kornak, Uwe; Raum, Kay; Fratzl, Peter; Mundlos, Stefan; Kolanczyk, Mateusz
2014-01-01
Bone fragility due to osteopenia, osteoporosis or debilitating focal skeletal dysplasias is a frequent observation in the Mendelian disease Neurofibromatosis type 1 (NF1). To determine the mechanisms underlying bone fragility in NF1 we analyzed two conditional mouse models, Nf1Prx1 (limb knock-out) and Nf1Col1 (osteoblast specific knock-out), as well as cortical bone samples from individuals with NF1. We examined mouse bone tissue with micro-computed tomography, qualitative and quantitative histology, mechanical tensile analysis, small-angle X-ray scattering (SAXS), energy dispersive X-ray spectroscopy (EDX), and scanning acoustic microscopy (SAM). In cortical bone of Nf1Prx1 mice we detected ectopic blood vessels that were associated with diaphyseal mineralization defects. Defective mineral binding in the proximity of blood vessels was most likely due to impaired bone collagen formation, as these areas were completely devoid of acidic matrix proteins and contained thin collagen fibers. Additionally, we found significantly reduced mechanical strength of the bone material, which was partially caused by increased osteocyte volume. Consistent with these observations, bone samples from individuals with NF1 and tibial dysplasia showed increased osteocyte lacuna volume. Reduced mechanical properties were associated with diminished matrix stiffness, as determined by SAM. In line with these observations, bone tissue from individuals with NF1 and tibial dysplasia showed heterogeneous mineralization and reduced collagen fiber thickness and packaging. Collectively, the data indicate that bone fragility in NF1 tibial dysplasia is partly due to an increased osteocyte-related micro-porosity, hypomineralization, a generalized defect of organic matrix formation, exacerbated in the regions of tensional and bending force integration, and finally persistence of ectopic blood vessels associated with localized macro-porotic bone lesions. PMID:24465906
Depleting dietary valine permits nonmyeloablative mouse hematopoietic stem cell transplantation.
Taya, Yuki; Ota, Yasunori; Wilkinson, Adam C; Kanazawa, Ayano; Watarai, Hiroshi; Kasai, Masataka; Nakauchi, Hiromitsu; Yamazaki, Satoshi
2016-12-02
A specialized bone marrow microenvironment (niche) regulates hematopoietic stem cell (HSC) self-renewal and commitment. For successful donor-HSC engraftment, the niche must be emptied via myeloablative irradiation or chemotherapy. However, myeloablation can cause severe complications and even mortality. Here we report that the essential amino acid valine is indispensable for the proliferation and maintenance of HSCs. Both mouse and human HSCs failed to proliferate when cultured in valine-depleted conditions. In mice fed a valine-restricted diet, HSC frequency fell dramatically within 1 week. Furthermore, dietary valine restriction emptied the mouse bone marrow niche and afforded donor-HSC engraftment without chemoirradiative myeloablation. These findings indicate a critical role for valine in HSC maintenance and suggest that dietary valine restriction may reduce iatrogenic complications in HSC transplantation. Copyright © 2016, American Association for the Advancement of Science.
The Role of Peripheral Nerve Function in Age-Related Bone Loss and Changes in Bone Adaptation
2013-10-01
mechanical loading (months 6-18): 2a. Strain gage analysis of bone strain during tibial compression (months 6-7) 2b. Capsaicin or vehicle treatment...of neonatal mice (months 6-8) 2c. Tibial compression of capsaicin- and vehicle-injected mice (months 8-10) 2d. Micro-computed tomography of mouse...the endosteal and periosteal surfaces. Capsaicin treatment altered bone formation rate parameters in the tibias of treated mice (Table 2). There
Nishikawa, Keizo; Iwamoto, Yoriko; Ishii, Masaru
2014-05-01
The development of methods for differentiation of embryonic stem cells (ESCs) and induced pluripotent stem cell (iPSCs) into functional cells have helped to analyze the mechanism regulating cellular processes and to explore cell-based assays for drug discovery. Although several reports have demonstrated methods for differentiation of mouse ESCs into osteoclast-like cells, it remains unclear whether these methods are applicable for differentiation of iPSCs to osteoclasts. In this study, we developed a simple method for stepwise differentiation of mouse ESCs and iPSCs into bone-resorbing osteoclasts based upon a monoculture approach consisting of three steps. First, based on conventional hanging-drop methods, embryoid bodies (EBs) were produced from mouse ESCs or iPSCs. Second, EBs were cultured in medium supplemented with macrophage colony-stimulating factor (M-CSF), and differentiated to osteoclast precursors, which expressed CD11b. Finally, ESC- or iPSC-derived osteoclast precursors stimulated with receptor activator of nuclear factor-B ligand (RANKL) and M-CSF formed large multinucleated osteoclast-like cells that expressed tartrate-resistant acid phosphatase and were capable of bone resorption. Molecular analysis showed that the expression of osteoclast marker genes such as Nfatc1, Ctsk, and Acp5 are increased in a RANKL-dependent manner. Thus, our procedure is simple and easy and would be helpful for stem cell-based bone research.
Ip, Victoria; Toth, Zacharie; Chibnall, John; McBride-Gagyi, Sarah
2016-01-01
Introduction Mouse models are used frequently to study effects of bone diseases and genetic determinates of bone strength. Murine bones have an intracortical band of woven bone that is not present in human bones. This band is not obvious under brightfield imaging and not typically analyzed. Due to the band’s morphology and location it has been theorized to be remnant bone from early in life. Furthermore, lamellar and woven bone are well known to have differing mechanical strengths. The purpose of this study was to determine (i) if the band is from early life and (ii) if the woven bone or calcified cartilage contained within the band affect whole bone strength. Woven Bone Origin Studies In twelve to fourteen week old mice, doxycycline was used to label bone formed prior to 3 weeks old. Doxycycline labeling and woven bone patterns on contralateral femora matched well and encompassed an almost identical cross-sectional area. Also, we highlight for the first time in mice the presence of calcified cartilage exclusively within the band. However, calcified cartilage could not be identified on high resolution cone-beam microCT scans when examined visually or by thresholding methods. Mechanical Strength Studies Subsequently, three-point bending was used to analyze the effects of woven bone and calcified cartilage on whole bone mechanics in a cohort of male and female six and 13 week old Balb/C mice. Three-point bending outcomes were correlated with structural and compositional measures using multivariate linear regression. Woven bone composed a higher percent of young bones than older bones. However, calcified cartilage in older bones was twice that of younger bones, which was similar when normalized by area. Area and/or tissue mineral density accounted for >75% of variation for most strength outcomes. Percent calcified cartilage added significant predictive power to maximal force and bending stress. Calcified cartilage and woven bone could have more influence in genetic models where calcified cartilage percent is double our highest value. PMID:27829059
Kong, Fanxuan; Shi, Xuefeng; Xiao, Fengjun; Yang, Yuefeng; Zhang, Xiaoyan; Wang, Li-Sheng; Wu, Chu-Tse; Wang, Hua
2018-02-01
Investigations based on mesenchymal stem cells (MSCs) for osteoporosis have attracted attention recently. MSCs can be derived from various tissues, such as bone marrow, adipose, umbilical cord, placenta, and dental pulp. Among these, dental pulp-derived MSCs (DPSCs) and hepatocyte growth factor (HGF)-modified DPSCs (DPSCs-HGF) highly express osteogenic-related genes and have stronger osteogenic differentiation capacities. DPSCs have more benefits in treating osteoporosis. The purpose of this study was to investigate the roles of HGF gene-modified DPSCs in bone regeneration using a mouse model of ovariectomy (OVX)-induced bone loss. The HGF and luciferase genes were transferred into human DPSCs using recombinant adenovirus. These transduced cells were assayed for distribution or bone regeneration assay by transplantation into an OVX-induced osteoporosis model. By using bioluminogenic imaging, it was determined that some DPSCs could survive for >1 month in vivo. The DPSCs were mainly distributed to the lung in the early stage and to the liver in the late stage of OVX osteoporosis after administration, but they were scarcely distributed to the bone. The homing efficiency of DPSCs is higher when administrated in the early stage of a mouse OVX model. Micro-computed tomography indicated that DPSCs-Null or DPSCs-HGF transplantation significantly reduces OVX-induced bone loss in the trabecular bone of the distal femur metaphysis, and DPSCs-HGF show a stronger capacity to reduce bone loss. The data suggest that systemic infusion of DPSCs-HGF is a potential therapeutic approach for OVX-induced bone loss, which might be mediated by paracrine mechanisms.
Lambert, Laura J; Challa, Anil K; Niu, Aidi; Zhou, Lihua; Tucholski, Janusz; Johnson, Maria S; Nagy, Tim R; Eberhardt, Alan W; Estep, Patrick N; Kesterson, Robert A; Grams, Jayleen M
2016-10-01
Osteocalcin, also known as bone γ-carboxyglutamate protein (Bglap), is expressed by osteoblasts and is commonly used as a clinical marker of bone turnover. A mouse model of osteocalcin deficiency has implicated osteocalcin as a mediator of changes to the skeleton, endocrine system, reproductive organs and central nervous system. However, differences between mouse and human osteocalcin at both the genome and protein levels have challenged the validity of extrapolating findings from the osteocalcin-deficient mouse model to human disease. The rat osteocalcin (Bglap) gene locus shares greater synteny with that of humans. To further examine the role of osteocalcin in disease, we created a rat model with complete loss of osteocalcin using the CRISPR/Cas9 system. Rat osteocalcin was modified by injection of CRISPR/Cas9 mRNA into the pronuclei of fertilized single cell Sprague-Dawley embryos, and animals were bred to homozygosity and compound heterozygosity for the mutant alleles. Dual-energy X-ray absorptiometry (DXA), glucose tolerance testing (GTT), insulin tolerance testing (ITT), microcomputed tomography (µCT), and a three-point break biomechanical assay were performed on the excised femurs at 5 months of age. Complete loss of osteocalcin resulted in bones with significantly increased trabecular thickness, density and volume. Cortical bone volume and density were not increased in null animals. The bones had improved functional quality as evidenced by an increase in failure load during the biomechanical stress assay. Differences in glucose homeostasis were observed between groups, but there were no differences in body weight or composition. This rat model of complete loss of osteocalcin provides a platform for further understanding the role of osteocalcin in disease, and it is a novel model of increased bone formation with potential utility in osteoporosis and osteoarthritis research. © 2016. Published by The Company of Biologists Ltd.
Pang, Jian; Ye, Meina; Gu, Xinfeng; Cao, Yuelong; Zheng, Yuxin; Guo, Hailing; Zhao, Yongfang; Zhan, Hongsheng; Shi, Yinyu
2015-08-01
It is known that bone healing is delayed in the presence of osteoporosis in humans. However, due to the complexities of the healing of osteoporotic fractures, animal models may be more appropriate for studying the effects of osteoporosis in more detail and for testing drugs on the fracture repair process. The purpose of this study was to investigate the influence of ovariectomy-induced osteopenia in bone healing in an open femoral osteotomy model, and to test the feasibility of this model for evaluating the healing process under osteopenic conditions. Ovariectomized (OVX) mouse models were employed to assess the effects of osteopenia on fracture healing, A mid-shaft femur osteotomy model was also established 3 weeks after ovariectomy as an osteopenic fracture group (OVX group). Femurs were then harvested at 2 weeks and 6 weeks after fracture for X-ray radiography, micro-computed tomography (micro-CT), histology, and biomechanical analysis. A sham-operated group (sham group) was used for comparison. The OVX mice had significantly lower bone volume density (BVF), volumetric bone mineral density (vBMD), and tissue mineral density (TMD) in the fracture calluses at 6 weeks (p<0.05), and similar trend was observed in 2 weeks. Additionally, larger calluses in OVX animals were observed via micro-CT and X-ray, but these did not result in better healing outcomes, as determined by biomechanical test at 6 weeks. Histological images of the healing fractures in the OVX mice found hastening of broken end resorption and delay of hard callus remodeling. The impaired biomechanical measurements in the OVX group (p<0.05) were consistent with micro-CT measurements and radiographic scoring, which also indicated delay in fracture healing of the OVX group. This study provided evidence that ovariectomy-induced osteopenia impair the middle and late bone healing process. These data also supported the validity of the mouse femoral osteotomy model in evaluating the process of bone healing under osteopenic conditions.
Javanmard, F; Azadbakht, M; Pourmoradi, M
2016-01-01
In this study, the role of hydrostatic pressure on staurosporine-induced neural differentiation in mouse bone marrow mesenchymal stem cells were investigated. The cells were cultured in treatment medium containing 100 nM of staurosporine for 4 hours; then the cells were affected by hydrostatic pressure (0, 25,50, 100 mmHg). The percentage of cell viability by trypan blue staining and the percentage of cell death by Hoechst/PI differential staining were assessed. We obtained the total neurite length. Expression of β-tubulin III and GFAP (Glial fibrillary acidic protein) proteins were also analyzed by immunocytochemistry. The percentage of cell viability in treatments decreased relative to the increase in hydrostatic pressure and time (p Keywords: bone marrow mesenchymal stem cell, hydrostatic pressure, immunocytochemistry, neural differentiation, neurite length, cell differentiation.
Bone Morphogenetic Protein (BMP) signaling in development and human diseases
Wang, Richard N.; Green, Jordan; Wang, Zhongliang; Deng, Youlin; Qiao, Min; Peabody, Michael; Zhang, Qian; Ye, Jixing; Yan, Zhengjian; Denduluri, Sahitya; Idowu, Olumuyiwa; Li, Melissa; Shen, Christine; Hu, Alan; Haydon, Rex C.; Kang, Richard; Mok, James; Lee, Michael J.; Luu, Hue L.; Shi, Lewis L.
2014-01-01
Bone Morphogenetic Proteins (BMPs) are a group of signaling molecules that belongs to the Transforming Growth Factor-β (TGF-β) superfamily of proteins. Initially discovered for their ability to induce bone formation, BMPs are now known to play crucial roles in all organ systems. BMPs are important in embryogenesis and development, and also in maintenance of adult tissue homeostasis. Mouse knockout models of various components of the BMP signaling pathway result in embryonic lethality or marked defects, highlighting the essential functions of BMPs. In this review, we first outline the basic aspects of BMP signaling and then focus on genetically manipulated mouse knockout models that have helped elucidate the role of BMPs in development. A significant portion of this review is devoted to the prominent human pathologies associated with dysregulated BMP signaling. PMID:25401122
Bone as an endocrine organ relevant to diabetes
USDA-ARS?s Scientific Manuscript database
There are well-established associations between diabetes and fracture risk and yet the mechanism underlying these associations are controversial. Guided by a series of mouse studies, a specific form of the bone protein, osteocalcin, was proposed to be the mechanistic link between these two chronic d...
Local administration of a hedgehog agonist accelerates fracture healing in a mouse model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kashiwagi, Miki; Division of Clinical Biotechnology, The University of Tokyo Graduate School of Medicine, Bunkyo-ku, Tokyo, 113-0033; Hojo, Hironori
Bone fracture healing is processed through multiple biological stages including the transition from cartilaginous callus to bony callus formation. Because of its specific, temporal and indispensable functions demonstrated by mouse genetic studies, Hedgehog (Hh) signaling is one of the most potent signaling pathways involved in these processes, but the effect of Hh-signaling activation by small compounds on the repair process had not yet been addressed. Here we examined therapeutic effects of local and one shot-administration of the Hh agonist known as smoothened agonist (SAG) on bone fracture healing in a mouse model. A quantitative analysis with three-dimensional micro-computed tomography showedmore » that SAG administration increased the size of both the cartilaginous callus and bony callus at 14 days after the surgery. A histological analysis showed that SAG administration increased the number of cells expressing a proliferation marker and a chondrocyte marker in cartilaginous callus as well as the cells expressing an osteoblast marker in bony callus. These results indicate that the SAG administration resulted in an enhancement of callus formation during bone fracture healing, which is at least in part mediated by an increase in chondrocyte proliferation in cartilaginous callus and the promotion of bone formation in bony callus. Therapeutic strategies with a SAG-mediated protocol may thus be useful for the treatment of bone fractures. - Highlights: • Local administration of a Hh agonist accelerates callus formation. • The Hh agonist administration promotes chondrocyte proliferation in the soft callus. • The Hh agonist administration increases osteoblast formation in the hard callus.« less
Matsui, Hiroyuki; Fukuno, Naoto; Kanda, Yoshiaki; Kantoh, Yusuke; Chida, Toko; Nagaura, Yuko; Suzuki, Osamu; Nishitoh, Hideki; Takeda, Kohsuke; Ichijo, Hidenori; Sawada, Yasuhiro; Sasaki, Keiichi; Kobayashi, Takayasu; Tamura, Shinri
2014-01-01
Bone mass is maintained by the balance between the activities of bone-forming osteoblasts and bone-resorbing osteoclasts. It is well known that adequate mechanical stress is essential for the maintenance of bone mass, whereas excess mechanical stress induces bone resorption. However, it has not been clarified how osteoblasts respond to different magnitudes of mechanical stress. Here we report that large-magnitude (12%) cyclic stretch induced Ca2+ influx, which activated reactive oxygen species generation in MC3T3-E1 osteoblasts. Reactive oxygen species then activated the ASK1-JNK/p38 pathways. The activated JNK led to transiently enhanced expression of FGF-inducible 14 (Fn14, a member of the TNF receptor superfamily) gene. Cells with enhanced expression of Fn14 subsequently acquired sensitivity to the ligand of Fn14, TNF-related weak inducer of apoptosis, and underwent apoptosis. On the other hand, the ASK1-p38 pathway induced expression of the monocyte chemoattractant protein 3 (MCP-3) gene, which promoted chemotaxis of preosteoclasts. In contrast, the ERK pathway was activated by small-magnitude stretching (1%) and induced expression of two osteogenic genes, collagen Ia (Col1a) and osteopontin (OPN). Moreover, activated JNK suppressed Col1a and OPN induction in large-magnitude mechanical stretch-loaded cells. The enhanced expression of Fn14 and MCP-3 by 12% stretch and the enhanced expression of Col1a and OPN by 1% stretch were also observed in mouse primary osteoblasts. These results suggest that differences in the response of osteoblasts to varying magnitudes of mechanical stress play a key role in switching the mode of bone metabolism between formation and resorption. PMID:24446436
Arad, Shiri; Le, Phuong T.; Bustin, Michael; Rosen, Clifford J.; Gabet, Yankel
2015-01-01
Heterochromatin protein 1 binding protein 3 (HP1BP3) is a recently described histone H1-related protein with roles in chromatin structure and transcriptional regulation. To explore the potential physiological role of HP1BP3, we have previously described an Hp1bp3−/− mouse model with reduced postnatal viability and growth. We now find that these mice are proportionate dwarfs, with reduction in body weight, body length, and organ weight. In addition to their small size, microcomputed tomography analysis showed that Hp1bp3−/− mice present a dramatic impairment of their bone development and structure. By 3 weeks of age, mice of both sexes have severely impaired cortical and trabecular bone, and these defects persist into adulthood and beyond. Primary cultures of both osteoblasts and osteoclasts from Hp1bp3−/− bone marrow and splenocytes, respectively, showed normal differentiation and function, strongly suggesting that the impaired bone accrual is due to noncell autonomous systemic cues in vivo. One major endocrine pathway regulating both body growth and bone acquisition is the IGF regulatory system, composed of IGF-1, the IGF receptors, and the IGF-binding proteins (IGFBPs). At 3 weeks of age, Hp1bp3−/− mice exhibited a 60% reduction in circulating IGF-1 and a 4-fold increase in the levels of IGFBP-1 and IGFBP-2. These alterations were reflected in similar changes in the hepatic transcripts of the Igf1, Igfbp1, and Igfbp2 genes. Collectively, these results suggest that HP1BP3 plays a key role in normal growth and bone development by regulating transcription of endocrine IGF-1 components. PMID:26402843
Garfinkel, Benjamin P; Arad, Shiri; Le, Phuong T; Bustin, Michael; Rosen, Clifford J; Gabet, Yankel; Orly, Joseph
2015-12-01
Heterochromatin protein 1 binding protein 3 (HP1BP3) is a recently described histone H1-related protein with roles in chromatin structure and transcriptional regulation. To explore the potential physiological role of HP1BP3, we have previously described an Hp1bp3(-/-) mouse model with reduced postnatal viability and growth. We now find that these mice are proportionate dwarfs, with reduction in body weight, body length, and organ weight. In addition to their small size, microcomputed tomography analysis showed that Hp1bp3(-/-) mice present a dramatic impairment of their bone development and structure. By 3 weeks of age, mice of both sexes have severely impaired cortical and trabecular bone, and these defects persist into adulthood and beyond. Primary cultures of both osteoblasts and osteoclasts from Hp1bp3(-/-) bone marrow and splenocytes, respectively, showed normal differentiation and function, strongly suggesting that the impaired bone accrual is due to noncell autonomous systemic cues in vivo. One major endocrine pathway regulating both body growth and bone acquisition is the IGF regulatory system, composed of IGF-1, the IGF receptors, and the IGF-binding proteins (IGFBPs). At 3 weeks of age, Hp1bp3(-/-) mice exhibited a 60% reduction in circulating IGF-1 and a 4-fold increase in the levels of IGFBP-1 and IGFBP-2. These alterations were reflected in similar changes in the hepatic transcripts of the Igf1, Igfbp1, and Igfbp2 genes. Collectively, these results suggest that HP1BP3 plays a key role in normal growth and bone development by regulating transcription of endocrine IGF-1 components.
Tominari, Tsukasa; Matsumoto, Chiho; Watanabe, Kenta; Hirata, Michiko; Grundler, Florian M W; Miyaura, Chisato; Inada, Masaki
2015-01-01
Epigallocatechin gallate (EGCG), a major polyphenol in green tea, possesses antioxidant properties and regulates various cell functions. Here, we examined the function of EGCG in inflammatory bone resorption. In calvarial organ cultures, lipopolysaccharide (LPS)-induced bone resorption was clearly suppressed by EGCG. In osteoblasts, EGCG suppressed the LPS-induced expression of COX-2 and mPGES-1 mRNAs, as well as prostaglandin E2 production, and also suppressed RANKL expression, which is essential for osteoclast differentiation. LPS-induced bone resorption of mandibular alveolar bones was attenuated by EGCG in vitro, and the loss of mouse alveolar bone mass was inhibited by the catechin in vivo.
Zhang, Yan; Yin, Chong; Hu, Lifang; Chen, Zhihao; Zhao, Fan; Li, Dijie; Ma, Jianhua; Ma, Xiaoli; Su, Peihong; Qiu, Wuxia; Yang, Chaofei; Wang, Pai; Li, Siyu; Zhang, Ge; Wang, Liping; Qian, Airong; Xian, Cory J
2018-02-01
Microtubule actin crosslinking factor 1 (MACF1) is a large spectraplakin protein known to have crucial roles in regulating cytoskeletal dynamics, cell migration, growth, and differentiation. However, its role and action mechanism in bone remain unclear. The present study investigated optimal conditions for effective transfection of the large plasmid PEGFP-C1A-ACF7 (∼21 kbp) containing full-length human MACF1 cDNA, as well as the potential role of MACF1 in bone formation. To enhance MACF1 expression, the plasmid was transfected into osteogenic cells by electroporation in vitro and into mouse calvaria with nanoparticles. Then, transfection efficiency, osteogenic marker expression, calvarial thickness, and bone formation were analyzed. Notably, MACF1 overexpression triggered a drastic increase in osteogenic gene expression, alkaline phosphatase activity, and matrix mineralization in vitro. Mouse calvarial thickness, mineral apposition rate, and osteogenic marker protein expression were significantly enhanced by local transfection. In addition, MACF1 overexpression promoted β-catenin expression and signaling. In conclusion, MACF1 overexpression by transfecting the large plasmid containing full-length MACF1 cDNA promotes osteoblast differentiation and bone formation via β-catenin signaling. Current data will provide useful experimental parameters for the transfection of large plasmids and a novel strategy based on promoting bone formation for prevention and therapy of bone disorders.
RANKL, Osteopontin, and Osteoclast Homeostasis in a Hyper-Occlusion Mouse Model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walker, Cameron G.; Ito, Yoshihiro; Dangaria, Smit
2010-11-15
The biological mechanisms that maintain the position of teeth in their sockets establish a dynamic equilibrium between bone resorption and apposition. In order to reveal some of the dynamics involved in the tissue responses towards occlusal forces on periodontal ligament (PDL) and alveolar bone homeostasis, we developed the first mouse model of hyperocclusion. Swiss-Webster mice were kept in hyperocclusion for 0, 3, 6, and 9 d. Morphological and histological changes in the periodontium were assessed using micro-computed tomography (micro-CT) and ground sections with fluorescent detection of vital dye labels. Sections were stained for tartrate-resistant acid phosphatase, and the expression ofmore » receptor activator of nuclear factor-{kappa}B ligand (RANKL) and osteopontin (OPN) was analyzed by immunohistochemistry and real-time polymerase chain reaction (PCR). Traumatic occlusion resulted in enamel surface abrasion, inhibition of alveolar bone apposition, significant formation of osteoclasts at 3, 6 and 9 d, and upregulation of OPN and RANKL. Data from this study suggest that both OPN and RANKL contribute to the stimulation of bone resorption in the hyperocclusive state. In addition, we propose that the inhibition of alveolar bone apposition by occlusal forces is an important mechanism for the control of occlusal height that might work in synergy with RANKL-induced bone resorption to maintain normal occlusion.« less
RANKL, osteopontin, and osteoclast homeostasis in a hyperocclusion mouse model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walker, Cameron G.; Ito, Yoshihiro; Dangaria, Smit
2009-10-21
The biological mechanisms that maintain the position of teeth in their sockets establish a dynamic equilibrium between bone resorption and apposition. In order to reveal some of the dynamics involved in the tissue responses towards occlusal forces on periodontal ligament (PDL) and alveolar bone homeostasis, we developed the first mouse model of hyperocclusion. Swiss-Webster mice were kept in hyperocclusion for 0, 3, 6, and 9 d. Morphological and histological changes in the periodontium were assessed using micro-computed tomography (micro-CT) and ground sections with fluorescent detection of vital dye labels. Sections were stained for tartrate-resistant acid phosphatase, and the expression ofmore » receptor activator of nuclear factor-{kappa}B ligand (RANKL) and osteopontin (OPN) was analyzed by immunohistochemistry and real-time polymerase chain reaction (PCR). Traumatic occlusion resulted in enamel surface abrasion, inhibition of alveolar bone apposition, significant formation of osteoclasts at 3, 6 and 9 d, and upregulation of OPN and RANKL. Data from this study suggest that both OPN and RANKL contribute to the stimulation of bone resorption in the hyperocclusive state. In addition, we propose that the inhibition of alveolar bone apposition by occlusal forces is an important mechanism for the control of occlusal height that might work in synergy with RANKL-induced bone resorption to maintain normal occlusion.« less
Niziolek, Paul J; Bullock, Whitney; Warman, Matthew L; Robling, Alexander G
2015-01-01
The low density lipoprotein receptor-related protein-5 (LRP5), a co-receptor in the Wnt signaling pathway, modulates bone mass in humans and in mice. Lrp5 knock-out mice have severely impaired responsiveness to mechanical stimulation whereas Lrp5 gain-of-function knock-in and transgenic mice have enhanced responsiveness to mechanical stimulation. Those observations highlight the importance of Lrp5 protein in bone cell mechanotransduction. It is unclear if and how high bone mass-causing (HBM) point mutations in Lrp5 alter the bone-wasting effects of mechanical disuse. To address this issue we explored the skeletal effects of mechanical disuse using two models, tail suspension and Botulinum toxin-induced muscle paralysis, in two different Lrp5 HBM knock-in mouse models. A separate experiment employing estrogen withdrawal-induced bone loss by ovariectomy was also conducted as a control. Both disuse stimuli induced significant bone loss in WT mice, but Lrp5 A214V and G171V were partially or fully protected from the bone loss that normally results from disuse. Trabecular bone parameters among HBM mice were significantly affected by disuse in both models, but these data are consistent with DEXA data showing a failure to continue growing in HBM mice, rather than a loss of pre-existing bone. Ovariectomy in Lrp5 HBM mice resulted in similar protection from catabolism as was observed for the disuse experiments. In conclusion, the Lrp5 HBM alleles offer significant protection from the resorptive effects of disuse and from estrogen withdrawal, and consequently, present a potential mechanism to mimic with pharmaceutical intervention to protect against various bone-wasting stimuli.
Falk, Sarah; Bannister, Kirsty
2014-01-01
Mechanisms of inflammatory and neuropathic pains have been elucidated and translated to patient care by the use of animal models of these pain states. Cancer pain has lagged behind since early animal models of cancer-induced bone pain were based on the systemic injection of carcinoma cells. This precluded systematic investigation of specific neuronal and pharmacological alterations that occur in cancer-induced bone pain. In 1999, Schwei et al. described a murine model of cancer-induced bone pain that paralleled the clinical condition in terms of pain development and bone destruction, confined to the mouse femur. This model prompted related approaches, and we can now state that cancer pain may include elements of inflammatory and neuropathic pains but also unique changes in sensory processing. Cancer-induced bone pain results in progressive bone destruction, elevated osteoclast activity and distinctive nocifensive behaviours (indicating the triad of ongoing, spontaneous and movement-induced hyperalgesia). In addition, cancer cells induce an inflammatory infiltrate and release growth factors, cytokines, interleukins, chemokines, prostanoids and endothelins, resulting in a reduction of pH to below 5 and direct deformation of primary afferents within bone. These peripheral changes, in turn, drive hypersensitivity of spinal cord sensory neurons, many of which project to the parts of the brain involved in the emotional response to pain. Within the spinal cord, a unique neuronal function reorganization within segments of the dorsal horn of the spinal cord receiving nociceptive input from the bone are discussed. Changes in certain neurotransmitters implicated in brain modulation of spinal function are also altered with implications for the affective components of cancer pain. Treatments are described in terms of mechanistic insights and in the case of opioids, which modulate pain transmission at spinal and supraspinal sites, their use can be compromised by opioid-induced hyperalgesia. We discuss evidence for how this comes about and how it may be treated. PMID:26516549
Gu, Xiaoping; Zheng, Yaguo; Ren, Bingxu; Zhang, Rui; Mei, Fengmei; Zhang, Juan; Ma, Zhengliang
2010-10-05
Tumor necrosis factor α (TNF-α) may have a pivotal role in the genesis of mechanical allodynia and thermal hyperalgesia during inflammatory and neuropathic pain. Thalidomide has been shown to selectively inhibit TNF-α production. Previous studies have suggested that thalidomide exerts anti-nociceptive effects in various pain models, but its effects on bone cancer pain have not previously been studied. Therefore, in the present study, we investigated the effect of thalidomide on bone cancer-induced hyperalgesia and up-regulated expression of spinal TNF-α in a mouse model. Osteosarcoma NCTC 2472 cells were implanted into the intramedullary space of the right femurs of C3H/HeJ mice to induce ongoing bone cancer related pain behaviors. At day 5, 7, 10 and 14 after operation, the expression of TNF-α in the spinal cord was higher in tumor-bearing mice compared to the sham mice. Intraperitoneal injection of thalidomide (50 mg/kg), started at day 1 after surgery and once daily thereafter until day 7, attenuated bone cancer-evoked mechanical allodynia and thermal hyperalgesia as well as the up-regulation of TNF-α in the spinal cord. These results suggest that thalidomide can efficiently alleviate bone cancer pain and it may be a useful alternative or adjunct therapy for bone cancer pain. Our data also suggest a role of spinal TNF-α in the development of bone cancer pain.
2010-01-01
Background Tumor necrosis factor α (TNF-α) may have a pivotal role in the genesis of mechanical allodynia and thermal hyperalgesia during inflammatory and neuropathic pain. Thalidomide has been shown to selectively inhibit TNF-α production. Previous studies have suggested that thalidomide exerts anti-nociceptive effects in various pain models, but its effects on bone cancer pain have not previously been studied. Therefore, in the present study, we investigated the effect of thalidomide on bone cancer-induced hyperalgesia and up-regulated expression of spinal TNF-α in a mouse model. Results Osteosarcoma NCTC 2472 cells were implanted into the intramedullary space of the right femurs of C3H/HeJ mice to induce ongoing bone cancer related pain behaviors. At day 5, 7, 10 and 14 after operation, the expression of TNF-α in the spinal cord was higher in tumor-bearing mice compared to the sham mice. Intraperitoneal injection of thalidomide (50 mg/kg), started at day 1 after surgery and once daily thereafter until day 7, attenuated bone cancer-evoked mechanical allodynia and thermal hyperalgesia as well as the up-regulation of TNF-α in the spinal cord. Conclusions These results suggest that thalidomide can efficiently alleviate bone cancer pain and it may be a useful alternative or adjunct therapy for bone cancer pain. Our data also suggest a role of spinal TNF-α in the development of bone cancer pain. PMID:20923560
Cui, X; Chen, J; Zacharek, A; Roberts, C; Savant-Bhonsale, S; Chopp, M
2008-09-22
Neovascularization may contribute to functional recovery after neural injury. Combination treatment of stroke with a nitric oxide donor, (Z)-1-[N-(2-aminoethyl)-N-(2-ammonioethyl) amino] diazen-1-ium-1, 2-diolate (DETA-NONOate) and bone marrow stromal cells promotes functional recovery. However, the mechanisms underlying functional improvement have not been elucidated. In this study, we tested the hypothesis that combination treatment upregulates angiopoietin-1 and its receptor Tie2 in the ischemic brain and bone marrow stromal cells, thereby enhancing cerebral neovascularization after stroke. Adult wild type male C57BL/6 mice were i.v. administered PBS, bone marrow stromal cells 5x10(5), DETA-NONOate 0.4 mg/kg or combination DETA-NONOate with bone marrow stromal cells (n=12/group) after middle cerebral artery occlusion. Combination treatment significantly upregulated angiopoietin-1/Tie2 and tight junction protein (occludin) expression, and increased the number, diameter and perimeter of blood vessels in the ischemic brain compared with vehicle control (mean+ or -S.E., P<0.05). In vitro, DETA-NONOate significantly increased angiopoietin-1/Tie2 protein (n=6/group) and Tie2 mRNA (n=3/group) expression in bone marrow stromal cells. DETA-NONOate also significantly increased angiopoietin-1 protein (n=6/group) and mRNA (n=3/group) expression in mouse brain endothelial cells (P<0.05). Angiopoietin-1 mRNA (n=3/group) was significantly increased in mouse brain endothelial cells treated with DETA-NONOate in combination with bone marrow stromal cell-conditioned medium compared with cells treated with bone marrow stromal cell-conditioned medium or DETA-NONOate alone. Mouse brain endothelial cell capillary tube-like formation assays (n=6/group) showed that angiopoietin-1 peptide, the supernatant of bone marrow stromal cells and DETA-NONOate significantly increased capillary tube formation compared with vehicle control. Combination treatment significantly increased capillary tube formation compared with DETA-NONOate treatment alone. Inhibition of angiopoietin-1 significantly attenuated combination treatment-induced tube formation. Our data indicated that combination treatment of stroke with DETA-NONOate and bone marrow stromal cells promotes neovascularization, which is at least partially mediated by upregulation of the angiopoietin-1/Tie2 axis.
Yamanaka, Nobuko; Wong, Christine J.; Gertsenstein, Marina; Casper, Robert F.; Nagy, Andras; Rogers, Ian M.
2009-01-01
Background Mouse models of human disease are invaluable for determining the differentiation ability and functional capacity of stem cells. The best example is bone marrow transplants for studies of hematopoietic stem cells. For organ studies, the interpretation of the data can be difficult as transdifferentiation, cell fusion or surface antigen transfer (trogocytosis) can be misinterpreted as differentiation. These events have not been investigated in hematopoietic stem cell transplant models. Methodology/Principal Findings In this study we investigated fusion and trogocytosis involving blood cells during bone marrow transplantation using a xenograft model. We report that using a standard SCID repopulating assay almost 100% of the human donor cells appear as hybrid blood cells containing both mouse and human surface antigens. Conclusion/Significance Hybrid cells are not the result of cell-cell fusion events but appear to be due to efficient surface antigen transfer, a process referred to as trogocytosis. Antigen transfer appears to be non-random and includes all donor cells regardless of sub-type. We also demonstrate that irradiation preconditioning enhances the frequency of hybrid cells and that trogocytosis is evident in non-blood cells in chimera mice. PMID:20046883
Hogan, Mary Beth; Piktel, Debra; Hubbs, Ann F; McPherson, Leslie E; Landreth, Kenneth S
2008-12-01
Patient factors that cause long-term airway remodeling are largely unidentified. This suggests that genetic differences may determine which asthmatic patients develop airway remodeling. A murine model with repeated allergen exposure leading to peribronchial fibrosis in complement factor 5 (C5)-deficient A/J mice has been used to study asthma progression. No studies have addressed the systemic effects of allergen sensitization or chronic allergen exposure on bone marrow eosinophilopoiesis in this mouse strain. To investigate bone marrow eosinophil responses during acute sensitization and chronic allergen exposure using genetically distinct mouse strains differing in persistent airway reactivity and remodeling. The C5-sufficient BALB/c and C5-deficient A/J mice were repetitively exposed to intranasal ovalbumin for 12 weeks. Subsequently, the mice were evaluated for airway eosinophilia, mucus-containing goblet cells, and peribronchial fibrosis. Both strains of mice were also acutely sensitized to ovalbumin. Bone marrow eosinophil progenitor cells and mature eosinophils were enumerated. BALB/c and A/J mice have similar bone marrow responses after acute allergen exposure, with elevations in bone marrow eosinophil progenitor cell and eosinophil numbers. After chronic allergen exposure, only C5-deficient A/J mice that developed peribronchial fibrosis exhibited bone marrow eosinophilia. BALB/c mice lacked peribronchial fibrosis and extinguished accelerated eosinophil production after long-term allergen challenge. Chronic airway remodeling after repeated allergen exposure in genetically different mice correlated with differences in long-term bone marrow eosinophilopoiesis. Preventing asthma from progressing to chronic airway remodeling with fibrosis may involve identifying genetically determined influences on bone marrow responses to chronic allergen exposure.
Fejer, György; Wegner, Mareike Dorothee; Györy, Ildiko; Cohen, Idan; Engelhard, Peggy; Voronov, Elena; Manke, Thomas; Ruzsics, Zsolt; Dölken, Lars; Prazeres da Costa, Olivia; Branzk, Nora; Huber, Michael; Prasse, Antje; Schneider, Robert; Apte, Ron N; Galanos, Chris; Freudenberg, Marina A
2013-06-11
Macrophages are diverse cell types in the first line of antimicrobial defense. Only a limited number of primary mouse models exist to study their function. Bone marrow-derived, macrophage-CSF-induced cells with a limited life span are the most common source. We report here a simple method yielding self-renewing, nontransformed, GM-CSF/signal transducer and activator of transcription 5-dependent macrophages (Max Planck Institute cells) from mouse fetal liver, which reflect the innate immune characteristics of alveolar macrophages. Max Planck Institute cells are exquisitely sensitive to selected microbial agents, including bacterial LPS, lipopeptide, Mycobacterium tuberculosis, cord factor, and adenovirus and mount highly proinflammatory but no anti-inflammatory IL-10 responses. They show a unique pattern of innate responses not yet observed in other mononuclear phagocytes. This includes differential LPS sensing and an unprecedented regulation of IL-1α production upon LPS exposure, which likely plays a key role in lung inflammation in vivo. In conclusion, Max Planck Institute cells offer an useful tool to study macrophage biology and for biomedical science.
MMP-8, A Breast Cancer Bone Metastasis Suppressor Gene
2006-08-01
new protein synthesis. This event is particularly important in situations such as tissue repair following injury . PTH and TGF-b1 stimulated LTBP-1...osteoclastogenesis inhi- bitory factor in the stimulation of osteoclast formation by parathyroid hormone in mouse bone cells. Eur J Endo - crinol 142:661–664...done to determine cross-sectional area, bone volume, and perios - teal perimeter (Ps.Pm). The endocortical sur- face was outlined, and the analysis
What is the impact of immunosuppressive treatment on the post-transplant renal osteopathy?
Blaslov, Kristina; Katalinic, Lea; Kes, Petar; Spasovski, Goce; Smalcelj, Ruzica; Basic-Jukic, Nikolina
2014-05-01
Although glucocorticoid therapy is considered to be the main pathogenic factor, a consistent body of evidence suggests that other immunosuppressants might also play an important role in the development of the post-transplant renal osteopathy (PRO) through their pleiotropic pharmacological effects. Glucocorticoids seem to induce osteoclasts' activity suppressing the osteoblasts while data regarding other immunosuppressive drugs are still controversial. Mycophenolate mofetil and azathioprine appear to be neutral regarding the bone metabolism. However, the study analyzing any independent effect of antimetabolites on bone turnover has not been conducted yet. Calcineurin inhibitors (CNIs) induce trabecular bone loss in rodent, with contradictory results in renal transplant recipients. Suppression of vitamin D receptor is probably the underlying mechanism of renal calcium wasting in renal transplant recipients receiving CNI. In spite of an increased 1,25(OH)2 vitamin D level, the kidney is not able to reserve calcium, suggesting a role of vitamin D resistance that may be related to bone loss. More efforts should be invested to determine the role of CNI in PRO. In particular, data regarding the role of mammalian target of rapamycin inhibitors (mTORi), such as sirolimus and everolimus, in the PRO development are still controversial. Rapamycin markedly decreases bone longitudinal growth as well as callus formation in experimental models, but also lowers the rate of bone resorption markers and glomerular filtration in clinical studies. Everolimus potently inhibits primary mouse and human osteoclast activity as well as the osteoclast differentiation. It also prevents the ovariectomy-induced loss of cancellous bone by 60 %, an effect predominantly associated with a decreased osteoclast-mediated bone resorption, resulting in a partial preservation of the cancellous bone. At present, there is no clinical study analyzing the effect of everolimus on bone turnover in renal transplant recipients or comparing sirolimus versus everolimus impact on bone, so only general conclusions could be drawn. Hence, the use of mTORi might be useful in patients with PRO due to their possible potential to inhibit osteoclast activity which might lead to a decreased rate of bone resorption. In addition, it should be also emphasized that they might inhibit osteoblast activity which may lead to a decreased bone formation and adynamic bone disease. Further studies are urgently needed to solve these important clinical dilemmas.
Wan, Xinhai; Li, Zhi-Gang; Yingling, Jonathan M; Yang, Jun; Starbuck, Michael W; Ravoori, Murali K; Kundra, Vikas; Vazquez, Elba; Navone, Nora M
2012-03-01
Transforming growth factor beta 1 (TGF-β1) has been implicated in the pathogenesis of prostate cancer (PCa) bone metastasis. In this study, we tested the antitumor efficacy of a selective TGF-β receptor I kinase inhibitor, LY2109761, in preclinical models. The effect of LY2109761 on the growth of MDA PCa 2b and PC-3 human PCa cells and primary mouse osteoblasts (PMOs) was assessed in vitro by measuring radiolabeled thymidine incorporation into DNA. In vivo, the right femurs of male SCID mice were injected with PCa cells. We monitored the tumor burden in control- and LY2109761-treated mice with MRI analysis and the PCa-induced bone response with X-ray and micro-CT analyses. Histologic changes in bone were studied by performing bone histomorphometric evaluations. PCa cells and PMOs expressed TGF-β receptor I. TGF-β1 induced pathway activation (as assessed by induced expression of p-Smad2) and inhibited cell growth in PC-3 cells and PMOs but not in MDA PCa 2b cells. LY2109761 had no effect on PCa cells but induced PMO proliferation in vitro. As expected, LY2109761 reversed the TGF-β1-induced pathway activation and growth inhibition in PC-3 cells and PMOs. In vivo, LY2109761 treatment for 6weeks resulted in increased volume in normal bone and increased osteoblast and osteoclast parameters. In addition, LY2109761 treatment significantly inhibited the growth of MDA PCa 2b and PC-3 in the bone of SCID mice (p<0.05); moreover, it resulted in significantly less bone loss and change in osteoclast-associated parameters in the PC-3 tumor-bearing bones than in the untreated mice. In summary, we report for the first time that targeting TGF-β receptors with LY2109761 can control PCa bone growth while increasing the mass of normal bone. This increased bone mass in nontumorous bone may be a desirable side effect of LY2109761 treatment for men with osteopenia or osteoporosis secondary to androgen-ablation therapy, reinforcing the benefit of effectively controlling PCa growth in bone. Thus, targeting TGF-β receptor I is a valuable intervention in men with advanced PCa. Copyright © 2011 Elsevier Inc. All rights reserved.
Wan, Xinhai; Li, Zhi-Gang; Yingling, Jonathan M.; Yang, Jun; Starbuck, Michael W.; Ravoori, Murali K.; Kundra, Vikas; Vazquez, Elba; Navone, Nora M.
2012-01-01
Transforming growth factor beta 1 (TGF-β1) has been implicated in the pathogenesis of prostate cancer (PCa) bone metastasis. In this study, we tested the antitumor efficacy of a selective TGF-β receptor I kinase inhibitor, LY2109761, in preclinical models. The effect of LY2109761 on the growth of MDA PCa 2b and PC-3 human PCa cells and primary mouse osteoblasts (PMOs) was assessed in vitro by measuring radiolabeled thymidine incorporation into DNA. In vivo, the right femurs of male SCID mice were injected with PCa cells. We monitored the tumor burden in control- and LY2109761-treated mice with MRI analysis and the PCa-induced bone response with x-ray and micro-CT analyses. Histologic changes in bone were studied by performing bone histomorphometric evaluations. PCa cells and PMOs expressed TGF-β receptor I. TGF-β1 induced pathway activation (as assessed by induced expression of p-Smad2) and inhibited cell growth in PC-3 cells and PMOs but not in MDA PCa 2b cells. LY2109761 had no effect on PCa cells but induced PMO proliferation in vitro. As expected, LY2109761 reversed the TGF-β1–induced pathway activation and growth inhibition in PC-3 cells and PMOs. In vivo, LY2109761 treatment for 6 weeks resulted in increased volume in normal bone and increased osteoblast and osteoclast parameters. In addition, LY2109761 treatment significantly inhibited the growth of MDA PCa 2b and PC-3 in the bone of SCID mice (p < 0.05); moreover, it resulted in significantly less bone loss and change in osteoclast-associated parameters in the PC-3 tumor–bearing bones than in the untreated mice. In summary, we report for the first time that targeting TGF-β receptors with LY2109761 can control PCa bone growth while increasing the mass of normal bone. This increased bone mass in nontumorous bone may be a desirable side effect of LY2109761 treatment for men with osteopenia or osteoporosis secondary to androgen-ablation therapy, reinforcing the benefit of effectively controlling PCa growth in bone. Thus, targeting TGF-β receptor I is a valuable intervention in men with advanced PCa. PMID:22173053
Ablation of the Sam68 RNA Binding Protein Protects Mice from Age-Related Bone Loss
Richard, Stéphane; Torabi, Nazi; Franco, Gladys Valverde; Tremblay, Guy A; Chen, Taiping; Vogel, Gillian; Morel, Mélanie; Cléroux, Patrick; Forget-Richard, Alexandre; Komarova, Svetlana; Tremblay, Michel L; Li, Wei; Li, Ailian; Gao, Yun Jing; Henderson, Janet E
2005-01-01
The Src substrate associated in mitosis of 68 kDa (Sam68) is a KH-type RNA binding protein that has been shown to regulate several aspects of RNA metabolism; however, its physiologic role has remained elusive. Herein we report the generation of Sam68-null mice by homologous recombination. Aged Sam68−/− mice preserved their bone mass, in sharp contrast with 12-month-old wild-type littermates in which bone mass was decreased up to approximately 75%. In fact, the bone volume of the 12-month-old Sam68−/− mice was virtually indistinguishable from that of 4-month-old wild-type or Sam68−/− mice. Sam68−/− bone marrow stromal cells had a differentiation advantage for the osteogenic pathway. Moreover, the knockdown of Sam68 using short hairpin RNA in the embryonic mesenchymal multipotential progenitor C3H10T1/2 cells resulted in more pronounced expression of the mature osteoblast marker osteocalcin when differentiation was induced with bone morphogenetic protein-2. Cultures of mouse embryo fibroblasts generated from Sam68+/+ and Sam68−/− littermates were induced to differentiate into adipocytes with culture medium containing pioglitazone and the Sam68−/− mouse embryo fibroblasts shown to have impaired adipocyte differentiation. Furthermore, in vivo it was shown that sections of bone from 12-month-old Sam68−/− mice had few marrow adipocytes compared with their age-matched wild-type littermate controls, which exhibited fatty bone marrow. Our findings identify endogenous Sam68 as a positive regulator of adipocyte differentiation and a negative regulator of osteoblast differentiation, which is consistent with Sam68 being a modulator of bone marrow mesenchymal cell differentiation, and hence bone metabolism, in aged mice. PMID:16362077
Courtland, Hayden-William; Nasser, Philip; Goldstone, Andrew B.; Spevak, Lyudmila; Boskey, Adele L.; Jepsen, Karl J.
2009-01-01
Fracture susceptibility is heritable and dependent upon bone morphology and quality. However, studies of bone quality are typically overshadowed by emphasis on bone geometry and bone mineral density. Given that differences in mineral and matrix composition exist in a variety of species, we hypothesized that genetic variation in bone quality and tissue-level mechanical properties would also exist within species. Sixteen-week-old female A/J, C57BL/6J (B6), and C3H/HeJ (C3H) inbred mouse femora were analyzed using Fourier transform infrared imaging and tissue-level mechanical testing for variation in mineral composition, mineral maturity, collagen cross-link ratio, and tissue-level mechanical properties. A/J femora had an increased mineral-to-matrix ratio compared to B6. The C3H mineral-to-matrix ratio was intermediate of A/J and B6. C3H femora had reduced acid phosphate and carbonate levels and an increased collagen cross-link ratio compared to A/J and B6. Modulus values paralleled mineral-to-matrix values, with A/J femora being the most stiff, B6 being the least stiff, and C3H having intermediate stiffness. In addition, work-to-failure varied among the strains, with the highly mineralized and brittle A/J femora performing the least amount of work-to-failure. Inbred mice are therefore able to differentially modulate the composition of their bone mineral and the maturity of their bone matrix in conjunction with tissue-level mechanical properties. These results suggest that specific combinations of bone quality and morphological traits are genetically regulated such that mechanically functional bones can be constructed in different ways. PMID:18855037
Courtland, Hayden-William; Nasser, Philip; Goldstone, Andrew B; Spevak, Lyudmila; Boskey, Adele L; Jepsen, Karl J
2008-11-01
Fracture susceptibility is heritable and dependent upon bone morphology and quality. However, studies of bone quality are typically overshadowed by emphasis on bone geometry and bone mineral density. Given that differences in mineral and matrix composition exist in a variety of species, we hypothesized that genetic variation in bone quality and tissue-level mechanical properties would also exist within species. Sixteen-week-old female A/J, C57BL/6J (B6), and C3H/HeJ (C3H) inbred mouse femora were analyzed using Fourier transform infrared imaging and tissue-level mechanical testing for variation in mineral composition, mineral maturity, collagen cross-link ratio, and tissue-level mechanical properties. A/J femora had an increased mineral-to-matrix ratio compared to B6. The C3H mineral-to-matrix ratio was intermediate of A/J and B6. C3H femora had reduced acid phosphate and carbonate levels and an increased collagen cross-link ratio compared to A/J and B6. Modulus values paralleled mineral-to-matrix values, with A/J femora being the most stiff, B6 being the least stiff, and C3H having intermediate stiffness. In addition, work-to-failure varied among the strains, with the highly mineralized and brittle A/J femora performing the least amount of work-to-failure. Inbred mice are therefore able to differentially modulate the composition of their bone mineral and the maturity of their bone matrix in conjunction with tissue-level mechanical properties. These results suggest that specific combinations of bone quality and morphological traits are genetically regulated such that mechanically functional bones can be constructed in different ways.
Di Stefano, Danilo Alessio; Perrotti, Vittoria; Greco, Gian Battista; Cappucci, Claudia; Arosio, Paolo; Piattelli, Adriano; Iezzi, Giovanna
2018-06-01
Implant site preparation may be adjusted to achieve the maximum possible primary stability. The aim of this investigation was to study the relation among bone-to-implant contact at insertion, bone density, and implant primary stability intra-operatively measured by a torque-measuring implant motor, when implant sites were undersized or tapped. Undersized (n=14), standard (n=13), and tapped (n=13) implant sites were prepared on 9 segments of bovine ribs. After measuring bone density using the implant motor, 40 implants were placed, and their primary stability assessed by measuring the integral of the torque-depth insertion curve. Bovine ribs were then processed histologically, the bone-to-implant contact measured and statistically correlated to bone density and the integral. Bone-to-implant contact and the integral of the torque-depth curve were significantly greater for undersized sites than tapped sites. Moreover, a correlation between bone to implant contact, the integral and bone density was found under all preparation conditions. The slope of the bone-to-implant/density and integral/density lines was significantly greater for undersized sites, while those corresponding to standard prepared and tapped sites did not differ significantly. The integral of the torque-depth curve provided reliable information about bone-to-implant contact and primary implant stability even in tapped or undersized sites. The linear relations found among the parameters suggests a connection between extent and modality of undersizing and the corresponding increase of the integral and, consequently, of primary stability. These results might help the physician determine the extent of undersizing needed to achieve the proper implant primary stability, according to the planned loading protocol.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prieto, A.M.; Santos, A.G.; Csipak, A.R.
Ethanolic extract of Casearia sylvestris is thought to be antimutagenic. In this study, we attempted to determine whether this extract and casearin X (a clerodane diterpene from C. sylvestris) are protective against the harmful effects of airborne pollutants from sugarcane burning. To that end, we used the Tradescantia micronucleus test in meiotic pollen cells of Tradescantia pallida, the micronucleus test in mouse bone marrow cells, and the comet assay in mouse blood cells. The mutagenic compound was total suspended particulate (TSP) from air. For the Tradescantia micronucleus test, T. pallida cuttings were treated with the extract at 0.13, 0.25, ormore » 0.50 mg/ml. Subsequently, TSP was added at 0.3 mg/ml, and tetrads from the inflorescences were examined for micronuclei. For the micronucleus test in mouse bone marrow cells and the comet assay in mouse blood cells, Balb/c mice were treated for 15 days with the extract—3.9, 7.5, or 15.0 mg/kg body weight (BW)—or with casearin X—0.3, 0.25, or 1.2 mg/kg BW—after which they received TSP (3.75 mg/kg BW). In T. pallida and mouse bone marrow cells, the extract was antimutagenic at all concentrations tested. In mouse blood cells, the extract was antigenotoxic at all concentrations, whereas casearin X was not antimutagenic but was antigenotoxic at all concentrations. We conclude that C. sylvestris ethanolic extract and casearin X protect DNA from damage induced by airborne pollutants from sugarcane burning. -- Highlights: ► We assessed DNA protection of C. sylvestris ethanolic extract. ► We assessed DNA protection of casearin X. ► We used Tradescantia pallida micronucleus test as screening. ► We used comet assay and micronucleus test in mice. ► The compounds protected DNA against sugar cane burning pollutants.« less
Bone-targeted cabazitaxel nanoparticles for metastatic prostate cancer skeletal lesions and pain.
Gdowski, Andrew S; Ranjan, Amalendu; Sarker, Marjana R; Vishwanatha, Jamboor K
2017-09-01
The aim of this study was to develop a novel cabazitaxel bone targeted nanoparticle (NP) system for improved drug delivery to the bone microenvironment. Nanoparticles were developed using poly(D,L-lactic-co-glycolic acid) and cabazitaxel as the core with amino-bisphosphonate surface conjugation. Optimization of nanoparticle physiochemical properties, in vitro evaluation in prostate cancer cell lines and in vivo testing in an intraosseous model of metastatic prostate cancer was performed. This bone targeted cabazitaxel nanocarrier system showed significant reduction in tumor burden, while at the same time maintaining bone structure integrity and reducing pain in the mouse tumor limb. This bone microenvironment targeted nanoparticle system and clinically relevant approach of evaluation represents a promising advancement for treating bone metastatic cancer.
Nyman, Jeffry S.; Even, Jesse L.; Jo, Chan-Hee; Herbert, Erik G.; Murry, Matthew R.; Cockrell, Gael E.; Wahl, Elizabeth C.; Bunn, R. Clay; Lumpkin, Charles K.; Fowlkes, John L.; Thrailkill, Kathryn M.
2011-01-01
Type 1 diabetes (T1DM) increases the likelihood of a fracture. Despite serious complications in the healing of fractures among those with diabetes, the underlying causes are not delineated for the effect of diabetes on the fracture resistance of bone. Therefore, in a mouse model of T1DM, we have investigated the possibility that a prolonged state of diabetes perturbs the relationship between bone strength and structure (i.e., affects tissue properties). At 10, 15, and 18 weeks following injection of streptozotocin to induce diabetes, diabetic male mice and age-matched controls were examined for measures of skeletal integrity. We assessed 1) the moment of inertia (IMIN) of the cortical bone within diaphysis, trabecular bone architecture of the metaphysis, and mineralization density of the tissue (TMD) for each compartment of the femur by microcomputed tomography and 2) biomechanical properties by three point bending test (femur) and nanoindentation (tibia). In the metaphysis, a significant decrease in trabecular bone volume fraction and trabecular TMD was apparent after 10 weeks of diabetes. For cortical bone, type 1 diabetes was associated with decreased cortical TMD, IMIN, rigidity, and peak moment as well as a lack of normal age-related increases in the biomechanical properties. However, there were only modest differences in material properties between diabetic and normal mice at both whole bone and tissue-levels. As the duration of diabetes increased, bone toughness decreased relative to control. If the sole effect of diabetes on bone strength was due to a reduction in bone size, then IMIN would be the only significant variable explaining the variance in the maximum moment. However, general linear modeling found that the relationship between peak moment and IMIN depended on whether the bone was from a diabetic mouse and the duration of diabetes. Thus, these findings suggest that the elevated fracture risk among diabetics is impacted by complex changes in tissue properties that ultimately reduce the fracture resistance of bone. PMID:21185416
Lymphatic Endothelial Cells Produce M-CSF, Causing Massive Bone Loss in Mice.
Wang, Wensheng; Wang, Hua; Zhou, Xichao; Li, Xing; Sun, Wen; Dellinger, Michael; Boyce, Brendan F; Xing, Lianping
2017-05-01
Gorham-Stout disease (GSD) is a rare bone disorder characterized by aggressive osteolysis associated with lymphatic vessel invasion within bone marrow cavities. The etiology of GSD is not known, and there is no effective therapy or animal model for the disease. Here, we investigated if lymphatic endothelial cells (LECs) affect osteoclasts (OCs) to cause a GSD osteolytic phenotype in mice. We examined the effect of a mouse LEC line on osteoclastogenesis in co-cultures. LECs significantly increased receptor activator of NF-κB ligand (RANKL)-mediated OC formation and bone resorption. LECs expressed high levels of macrophage colony-stimulating factor (M-CSF), but not RANKL, interleukin-6 (IL-6), and tumor necrosis factor (TNF). LEC-mediated OC formation and bone resorption were blocked by an M-CSF neutralizing antibody or Ki20227, an inhibitor of the M-CSF receptor, c-Fms. We injected LECs into the tibias of wild-type (WT) mice and observed massive osteolysis on X-ray and micro-CT scans. Histology showed that LEC-injected tibias had significant trabecular and cortical bone loss and increased OC numbers. M-CSF protein levels were significantly higher in serum and bone marrow plasma of mice given intra-tibial LEC injections. Immunofluorescence staining showed extensive replacement of bone and marrow by podoplanin+ LECs. Treatment of LEC-injected mice with Ki20227 significantly decreased tibial bone destruction. In addition, lymphatic vessels in a GSD bone sample were stained positively for M-CSF. Thus, LECs cause bone destruction in vivo in mice by secreting M-CSF, which promotes OC formation and activation. Blocking M-CSF signaling may represent a new therapeutic approach for treatment of patients with GSD. Furthermore, tibial injection of LECs is a useful mouse model to study GSD. © 2017 American Society for Bone and Mineral Research. © 2017 American Society for Bone and Mineral Research.
Role of estrogen receptor signaling in skeletal response to leptin in female ob/ob mice.
Turner, Russell T; Philbrick, Kenneth A; Kuah, Amida F; Branscum, Adam J; Iwaniec, Urszula T
2017-06-01
Leptin, critical in regulation of energy metabolism, is also important for normal bone growth, maturation and turnover. Compared to wild type (WT) mice, bone mass is lower in leptin-deficient ob/ob mice. Osteopenia in growing ob/ob mice is due to decreased bone accrual, and is associated with reduced longitudinal bone growth, impaired cancellous bone maturation and increased marrow adipose tissue (MAT). However, leptin deficiency also results in gonadal dysfunction, disrupting production of gonadal hormones which regulate bone growth and turnover. The present study evaluated the role of increased estrogen in mediating the effects of leptin on bone in ob/ob mice. Three-month-old female ob/ob mice were randomized into one of the 3 groups: (1) ob/ob + vehicle (veh), (2) ob/ob + leptin (leptin) or (3) ob/ob + leptin and the potent estrogen receptor antagonist ICI 182,780 (leptin + ICI). Age-matched WT mice received vehicle. Leptin (40 µg/mouse, daily) and ICI (10 µg/mouse, 2×/week) were administered by subcutaneous injection for 1 month and bone analyzed by X-ray absorptiometry, microcomputed tomography and static and dynamic histomorphometry. Uterine weight did not differ between ob/ob mice and ob/ob mice receiving leptin + ICI, indicating that ICI successfully blocked the uterine response to leptin-induced increases in estrogen levels. Compared to leptin-treated ob/ob mice, ob/ob mice receiving leptin + ICI had lower uterine weight; did not differ in weight loss, MAT or bone formation rate; and had higher longitudinal bone growth rate and cancellous bone volume fraction. We conclude that increased estrogen signaling following leptin treatment is dispensable for the positive actions of leptin on bone and may attenuate leptin-induced bone growth. © 2017 Society for Endocrinology.
Zach, Frank; Mueller, Alexandra; Gessner, André
2015-01-01
In vitro differentiation into functional osteoclasts is routinely achieved by incubation of embryonic stem cells, induced pluripotent stem cells, or primary as well as cryopreserved spleen and bone marrow-derived cells with soluble receptor activator of nuclear factor kappa-B ligand and macrophage colony-stimulating factor. Additionally, osteoclasts can be derived from co-cultures with osteoblasts or by direct administration of soluble receptor activator of nuclear factor kappa-B ligand to RAW 264.7 macrophage lineage cells. However, despite their benefits for osteoclast-associated research, these different methods have several drawbacks with respect to differentiation yields, time and animal consumption, storage life of progenitor cells or the limited potential for genetic manipulation of osteoclast precursors. In the present study, we therefore established a novel protocol for the differentiation of osteoclasts from murine ER-Hoxb8-immortalized myeloid stem cells. We isolated and immortalized bone marrow cells from wild type and genetically manipulated mouse lines, optimized protocols for osteoclast differentiation and compared these cells to osteoclasts derived from conventional sources. In vitro generated ER-Hoxb8 osteoclasts displayed typical osteoclast characteristics such as multi-nucleation, tartrate-resistant acid phosphatase staining of supernatants and cells, F-actin ring formation and bone resorption activity. Furthermore, the osteoclast differentiation time course was traced on a gene expression level. Increased expression of osteoclast-specific genes and decreased expression of stem cell marker genes during differentiation of osteoclasts from ER-Hoxb8-immortalized myeloid progenitor cells were detected by gene array and confirmed by semi-quantitative and quantitative RT-PCR approaches. In summary, we established a novel method for the quantitative production of murine bona fide osteoclasts from ER-Hoxb8 stem cells generated from wild type or genetically manipulated mouse lines. These cells represent a standardized and theoretically unlimited source for osteoclast-associated research projects.
A Surgical Procedure for Resecting the Mouse Rib: A Model for Large-Scale Long Bone Repair
Funnell, John W.; Thein, Thu Zan Tun; Mariani, Francesca V.
2015-01-01
This protocol introduces researchers to a new model for large-scale bone repair utilizing the mouse rib. The procedure details the following: preparation of the animal for surgery, opening the thoracic body wall, exposing the desired rib from the surrounding intercostal muscles, excising the desired section of rib without inducing a pneumothorax, and closing the incisions. Compared to the bones of the appendicular skeleton, the ribs are highly accessible. In addition, no internal or external fixator is necessary since the adjacent ribs provide a natural fixation. The surgery uses commercially available supplies, is straightforward to learn, and well-tolerated by the animal. The procedure can be carried out with or without removing the surrounding periosteum, and therefore the contribution of the periosteum to repair can be assessed. Results indicate that if the periosteum is retained, robust repair occurs in 1 - 2 months. We expect that use of this protocol will stimulate research into rib repair and that the findings will facilitate the development of new ways to stimulate bone repair in other locations around the body. PMID:25651082
Martínez-Vargas, Jessica; Muñoz-Muñoz, Francesc; López-Fuster, María José; Cubo, Jorge; Ventura, Jacint
2018-04-18
The western European house mouse (Mus musculus domesticus) shows high karyotypic diversity owing to Robertsonian translocations. Morphometric studies conducted with adult mice suggest that karyotype evolution due to these chromosomal reorganizations entails variation in the form and the patterns of morphological covariation of the mandible. However, information is much scarcer regarding the effect of these rearrangements on the growth pattern of the mouse mandible over early postnatal ontogeny. Here we compare mandible growth from the second to the eighth week of postnatal life between two ontogenetic series of mice from wild populations, with the standard karyotype and with Robertsonian translocations respectively, reared under the same conditions. A multi-method approach is used, including bone histology analyses of mandible surfaces and cross-sections, as well as geometric morphometric analyses of mandible form. The mandibles of both standard and Robertsonian mice display growth acceleration around weaning, anteroposterior direction of bone maturation, a predominance of bone deposition fields over ontogeny, and relatively greater expansion of the posterior mandible region correlated with the ontogenetic increase in mandible size. Nevertheless, differences exist between the two mouse groups regarding the timing of histological maturation of the mandible, the localization of certain bone remodeling fields, the temporospatial patterns of morphological variation, and the organization into two main modules. The dissimilarities in the process of mandible growth between the two groups of mice become more evident around sexual maturity, and could arise from alterations that Robertsonian translocations may exert on genes involved in the bone remodeling mechanism. Anat Rec, 2018. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.
Levi, Benjamin; Nelson, Emily R.; Li, Shuli; James, Aaron W.; Hyun, Jeong S.; Montoro, Daniel T.; Lee, Min; Glotzbach, Jason P.; Commons, George W.; Longaker, Michael T.
2015-01-01
Human adipose-derived stromal cells (hASCs) have a proven capacity to aid in osseous repair of calvarial defects. However, the bone defect microenvironment necessary for osseous healing is not fully understood. In this study, we postulated that the cell-cell interaction between engrafted ASCs and host dura mater (DM) cells is critical for the healing of calvarial defects. hASCs were engrafted into critical sized calvarial mouse defects. The DM-hASC interaction was manipulated surgically by DM removal or by insertion of a semipermeable or nonpermeable membrane between DM and hASCs. Radiographic, histologic, and gene expression analyses were performed. Next, the hASC-DM interaction is assessed by conditioned media (CM) and coculture assays. Finally, bone morphogenetic protein (BMP) signaling from DM was investigated in vivo using novel BMP-2 and anti-BMP-2/4 slow releasing scaffolds. With intact DM, osseous healing occurs both from host DM and engrafted hASCs. Interference with the DM-hASC interaction dramatically reduced calvarial healing with abrogated BMP-2–Smad-1/5 signaling. Using CM and coculture assays, mouse DM cells stimulated hASC osteogenesis via BMP signaling. Through in vivo manipulation of the BMP-2 pathway, we found that BMP-2 plays an important role in DM stimulation of hASC osteogenesis in the context of calvarial bone healing. BMP-2 supplementation to a defect with disrupted DM allowed for bone formation in a nonhealing defect. DM is an osteogenic cell type that both participates in and stimulates osseous healing in a hASC-engrafted calvarial defect. Furthermore, DM-derived BMP-2 paracrine stimulation appears to play a key role for hASC mediated repair. PMID:21656608
Wang, Jianyong; Chen, Tao
2010-03-01
In our previous study (Wang et al., 2004, Toxicol. Sci. 82: 124-128), we observed that the cII gene mutant frequency (MF) in the bone marrow of Big Blue mice showed significant increase as early as day 1, reached the maximum at day 3 and then decreased to a plateau by day 15 after a single dose of carcinogen N-ethyl-N-nitrosourea (ENU) treatment, which is different from the longer mutation manifestation time and the constancy of MFs after reaching their maximum in some other tissues. To determine the mechanism underlying the quick increase in MF and the peak formation in the mutant manifestation, we examined the mutation frequencies and spectra of the ENU-induced mutants collected from different sampling times in this study. The cII mutants from days 1, 3 and 120 after ENU treatment were randomly selected from different animals. The mutation frequencies were 33, 217, 305 and 144 x 10(-6) for control, days 1, 3, and 120, respectively. The mutation spectra at days 1 and 3 were significantly different from that at day 120. Considering that stem cells are responsible for the ultimate MF plateau (day 120) and transit cells are accountable for the earlier MF induction (days 1 or 3) in mouse bone marrow, we conclude that transit cells are much more sensitive to mutation induction than stem cells in mouse bone marrow, which resulted in the specific mutation manifestation induced by ENU.
Flamant, Stéphane; Lebastard, Maï; Pescher, Pascale; Besmond, Claude; Milon, Geneviève; Marchal, Gilles
2003-10-01
Mononuclear phagocytes are located in every tissue of metazoan organisms. In this extravascular space, they are designated as macrophages and are known to sense and process many signals including the local oxygen tension (PO2), which ranges from 150 mmHg at the lung apices to around 40 mmHg in mixed venous blood and most organs, and to less than 10 mmHg in tissues where long-term and dynamic remodeling processes occur. Most tissue macrophages survive and maintain their differentiated status within an environment bathed by colony-stimulating factor (CSF)-1 through the CSF-1 receptor, encoded by the Csf1r gene. In order to investigate the mRNA expression profile of macrophages as a function of PO2, we developed an in vitro model in which monocyte-derived macrophages were generated from mouse bone marrow progenitor cells grown and maintained under low (36 mmHg) or atmospheric (142 mmHg) PO2, in the presence of L929-conditioned medium (L-CM) as a source of CSF-1. We show that CSF-1-reactive C57BL/6 bone marrow cells displayed an increased cloning efficiency under a PO2 of 36, compared with 142 mmHg. Furthermore, we provide evidence of the overexpression of both CSF-1 receptor protein and mRNA by mouse monocyte-derived macrophages generated from bone marrow under low PO2.
THE EFFECT OF ANTISERUM, ALONE AND WITH HYDROCORTISONE, ON FOETAL MOUSE BONES IN CULTURE
Fell, Honor B.; Weiss, L.
1965-01-01
1. The effects of normal rabbit serum and of rabbit antiserum to whole foetal mouse tissues, on the isolated limb bones of late foetal mice were studied in organ culture, and the influence of hydrocortisone on these effects was investigated. 2. Unheated normal serum caused slight loss of metachromatic material from the cartilage matrix, and some resorption of both cartilage and bone. 3. In unheated antiserum to foetal mouse tissues, the terminal cartilage was smaller and less metachromatic than in paired controls in normal serum, while osteoclasis was so intense that in many explants the bone had almost disappeared. The amount of necrosis varied with different batches of antiserum. 4. The changes produced by normal serum and antiserum could be largely prevented by heating the sera to 57°C for 45 minutes. 5. The effects could also be inhibited by the addition of hydrocortisone to the unheated sera; as little as 0.1 µg hydrocortisone per ml of medium had a well marked protective action. 6. It is suggested that (a) unheated antiserum causes a release of lysosomal enzymes with consequent breakdown of intercellular material, (b) this release is due to an indirect action on the lysosome via an increased permeability of the cell membrane, (c) hydrocortisone does not affect the antigen-antibody reaction, but inhibits the autolytic changes that normally follow this reaction, possibly by stabilising both the lysosomal and cell membranes. PMID:14276776
Chattopadhyay, Sukalpa; Chatterjee, Ritam; Law, Sujata
2016-10-01
According to case-control studies, long-term pesticide exposure can cause bone marrow aplasia like hematopoietic degenerative disease leading to impaired hematopoiesis and increased risk of aplastic anemia in human subjects. However, the exact mechanism of pesticide mediated hematotoxicity still remains elusive. In this study, we investigated the role of noncanonical Wnt signaling pathway, a crucial regulator of adult hematopoiesis, in pesticide induced bone marrow aplasia mouse model. Aplasia mouse model was developed following inhalation and dermal exposure of 5% aqueous mixture of common agriculturally used pesticides for 6 h/day for 5 days a week up to 90 days. After that, blood hemogram, marrow smear, cellularity, scanning electron microscopy, extramedullary hematopoiesis and flowcytometric expression analysis of noncanonical Wnt signaling components, such as Wnt 5a, fzd5, NFAT, IFN-γ, intracellular Ca(2+) level were evaluated in the bone marrow hematopoietic stem/progenitor compartment of the control and pesticide induced aplasia groups of animals. Results showed that pesticide exposed mice were anemic with peripheral blood pancytopenia, hypocellular degenerative marrow, and extramedullary hematopoiesis in the spleen. Upon pesticide exposure, Wnt 5a expression was severely downregulated with a decline in intracellular Ca(2+) level. Moreover, downstream of Wnt5a, we observed sharp downregulation of NFATc2 transcription factor expression, the major target of pesticide toxicity and its target molecule IFN-γ. Taken together, our result suggests that deregulation of Wnt5a-Ca(2+) -NFAT signaling axis in the hematopoietic stem/progenitor compartment plays a crucial role behind the pathogenesis of pesticide mediated bone marrow aplasia by limiting primitive hematopoietic stem cells' ability to maintain hematopoietic homeostasis and reconstitution mechanism in vivo during xenobiotic stress leading to ineffective hematopoiesis and evolution of bone marrow aplasia. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 1163-1175, 2016. © 2015 Wiley Periodicals, Inc.
Zhang, Qiu Hua; Wu, Chun Fu; Duan, Lian; Yang, Jing Yu
2008-01-01
Cyclophosphamide (CP), commonly used anti-cancer, induces oxidative stress and is cytotoxic to normal cells. It is very important to choice the protective agent combined CP to reduce the side effects in cancer treatment. Ginsenosides are biological active constituents of Panax ginseng C.A. Meyer that acts as the tonic agent for the cancer patients to reduce the side effects in the clinic application. Because CP is a pro-oxidant agent and induces oxidative stress by the generation of free radicals to decrease the activities of anti-oxidant enzymes, the protective effects of the total saponins from stem and leaf of P. ginseng C.A. Meyer (TSPG) act as an anti-oxidant agent against the decreased anti-oxidant enzymes, the genotoxicity and apoptosis induced by CP was carried out. The alkaline single cell gel electrophoresis was employed to detect DNA damage; flow cytometry assay and AO/EB staining assay were employed to measure cell apoptosis; the enzymatic anti-oxidants (T-SOD, CAT and GPx) and non-enzymatic anti-oxidant (GSH) were measured by the various colorimetric methods. CP induced the significant DNA damage in mouse peripheral lymphocytes in time- and dose-dependent manners, inhibited the activities of T-SOD, GPx and CAT, and decreased the contents of GSH in mouse blood, triggered bone marrow cell apoptosis at 6 and 12h. TSPG significantly reduced CP-induced DNA damages in bone marrow cells and peripheral lymphocyte cells, antagonized CP-induced reduction of T-SOD, GPx, CAT activities and the GSH contents, decreased the bone marrow cell apoptosis induced by CP. TSPG, significantly reduced the genotoxicity of CP in bone marrow cells and peripheral lymphocyte cells, and decreased the apoptotic cell number induced by CP in bone marrow cells. The effects of TSPG on T-SOD, GPx, CAT activities and GSH contents might partially contribute to its protective effects on CP-induced cell toxicities.
Liu, Huihui; Guo, Shanyu
2018-01-01
It is abundantly clear that tumor-derived parathyroid hormone-related protein (PTHrP), receptor activator of nuclear factor-κB ligand (RANKL) and osteoprotegerin (OPG) are central contributors in promoting osteolytic process of breast carcinoma bone metastasis. Forcusing on this molecular basis, the study was undertaken to explore the inhibition effects of total flavonoids from Scutellaria barbata D. Don (TF-SB) on human breast carcinoma bone metastasis. MDA-MB-231 cells and nude mouse models of breast cancer bone metastasis were given TF-SB in different concentrations. The proliferation, migration and invasion potentials of MDA-MB-231 cells were respectively tested. The effects of TF-SB on tumor weights and bone destruction were investigated. The mRNA and protein expression of PTHrP, OPG and RANKL were assessed by qPCR and western blot analysis. In vitro, TF-SB inhibited the proliferation, migration and invasion of MDA-MB-231 cells in a dose-dependent manner. In vivo, TF-SB prevented bone metastasis of breast cancer by decreasing the number of osteoclast cells per field in a dose-dependent manner, but not affecting tumor growth or mouse survival. Molecular analysis revealed that TF-SB controled the secretion of osteolysis-related factors PTHrP and its downstream RANKL/OPG. Together, by controlling the expression of PTHrP and its downstream OPG/RANKL, TF-SB has significant inhibition effects on breast cancer bone metastasis, which indicates a new therapeutic method. PMID:29512770
The Changing Sensory and Sympathetic Innervation of the Young, Adult and Aging Mouse Femur.
Chartier, Stephane R; Mitchell, Stefanie A T; Majuta, Lisa A; Mantyh, Patrick W
2018-02-10
Although bone is continually being remodeled and ultimately declines with aging, little is known whether similar changes occur in the sensory and sympathetic nerve fibers that innervate bone. Here, immunohistochemistry and confocal microscopy were used to examine changes in the sensory and sympathetic nerve fibers that innervate the young (10 days post-partum), adult (3 months) and aging (24 months) C57Bl/6 mouse femur. In all three ages examined, the periosteum was the most densely innervated bone compartment. With aging, the total number of sensory and sympathetic nerve fibers clearly declines as the cambium layer of the periosteum dramatically thins. Yet even in the aging femur, there remains a dense sensory and sympathetic innervation of the periosteum. In cortical bone, sensory and sympathetic nerve fibers are largely confined to vascularized Haversian canals and while there is no significant decline in the density of sensory fibers, there was a 75% reduction in sympathetic nerve fibers in the aging vs. adult cortical bone. In contrast, in the bone marrow the overall density/unit area of both sensory and sympathetic nerve fibers appeared to remain largely unchanged across the lifespan. The preferential preservation of sensory nerve fibers suggests that even as bone itself undergoes a marked decline with age, the nociceptors that detect injury and signal skeletal pain remain relatively intact. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Meng, Xiangqi; Vander Ark, Alexandra; Daft, Paul; Woodford, Erica; Wang, Jie; Madaj, Zachary; Li, Xiaohong
2018-04-01
TGF-β plays a central role in prostate cancer (PCa) bone metastasis, and it is crucial to understand the bone cell-specific role of TGF-β signaling in this process. Thus, we used knockout (KO) mouse models having deletion of the Tgfbr2 gene specifically in osteoblasts (Tgfbr2 Col1CreERT KO) or in osteoclasts (Tgfbr2 LysMCre KO). We found that PCa-induced bone lesion development was promoted in the Tgfbr2 Col1CreERT KO mice, but was inhibited in the Tgfbr2 LysMCre KO mice, relative to their respective control Tgfbr2 FloxE2 littermates. Since metastatic PCa cells attach to osteoblasts when colonized in the bone microenvironment, we focused on the mechanistic studies using the Tgfbr2 Col1CreERT KO mouse model. We found that bFGF was upregulated in osteoblasts from PC3-injected tibiae of Tgfbr2 Col1CreERT KO mice and correlated with increased tumor cell proliferation, angiogenesis, amounts of cancer-associated fibroblasts and osteoclasts. In vitro studies showed that osteoblastogenesis was inhibited, osteoclastogenesis was stimulated, but PC3 viability was not affected, by bFGF treatments. Lastly, the increased PC3-induced bone lesions in Tgfbr2 Col1CreERT KO mice were significantly attenuated by blocking bFGF using neutralizing antibody, suggesting bFGF is a promising target inhibiting bone metastasis. Copyright © 2018 Elsevier B.V. All rights reserved.
The Mice Drawer System Tissue Sharing Program (MDS-TSP): osteobiology in microgravity
NASA Astrophysics Data System (ADS)
Ruggiu, Alessandra; Cancedda, Ranieri; Biticchi, Roberta; Cilli, Michele; Cotronei, Vittorio; Costa, Delfina; Liu, Yi; Piccardi, Federica; Pignataro, Salvatore; Tasso, Roberta; Tavella, Sara
The capacity of bone tissue to alter its mass and architecture in response to mechanical request has long been known. Bone not only develops as a structure designed specifically for mechanical demands, but it can adapt during life toward more efficient mechanical performance. In partic-ular, the skeletal effects of microgravity result in the development of an osteoporotic phenotype with several bone defects including a bone mass decrease resembling the bone modifications occurring in elder people and in bed rest conditions. This is particularly true for weight bearing bones such as spine, femur and tibiae. In contrast non-weight bearing bones like calvaria etc didn't show bone mineral density decrease in weightlessness. Given the interest of our labora-tory in the microgravity induced skeleton alterations, we focused our attention on a transgenic mouse overexpressing pleiotrophin (PTN) under the control of the bone specific human os-teocalcin promoter. This protein is a heparin-binding cytokine with different functions. In particular PTN-transgenic mice (PTN-Tg) show an increase in the bone mass and mineral-ization, with a calcium content/mg bone of 10We used this mouse model in the MDS flight experiment to study the PTN potential role in counteracting bone loss in microgravity. Three PTN-transgenic mice (Tg) and three wild type (Wt) mice were housed in the MDS (Mouse Drawer System) at the ISS for three months. During these three months two wt and one tg mice died and therefore could be only frozen for subsequent skeletal analysis. The other three mice, daily checked for their health status, were viable and in good condition throughout the all three months at the ISS. At the end of November 2009 the three mice came back to Earth and after blood collection were immediately sacrificed and the different bones isolated. From blood cell analysis no major hematological alterations were noticed in the blood cell count except a slight increase in the number of erythrocytes. The serum collected from these mice is being used in a Luminex panel assay for several cytokine and bone metabolism markers. A ground replica of the flight experiment ("ground control") was performed at the University of Genova from November 2009 to the second week of February 2010 during which we collected the bone samples. To study the microgravity effects on both wt and PTN-Tg mice we are performing morphological analysis by classical histological technique. A finer microarchitectural study by synchrotron and bench microCT has been initiated both at the Grenoble and the Trieste facil-ities. With this last technique we are analyzing both weight and non-weight bearing bones and we are evaluating bone mineral density, mineralization amount, trabecular architecture. We are also in the process of obtaining a holotomographic reconstruction of the trabecular and cortical bone from both the flight and the ground control mice. In addition we extracted RNA from long bones and bone marrow of the same mice and we are performing Real-time PCR analysis to determine the expression of bone marker such as osteocalcin, runx2, bone sialoprotein and of markers of bone turnover such as RankL, TRAP, cathepsin K, IL6 in the different animals.
Labelle, Philippe; Hahn, Nina E; Fraser, Jenelle K; Kendall, Lonnie V; Ziman, Melanie; James, Edward; Shastri, Nilabh; Griffey, Stephen M
2009-04-01
An outbreak of mousepox in a research institution was caused by Ectromelia-contaminated mouse serum that had been used for bone marrow cell culture and the cells subsequently injected into the footpads of mice. The disease initially was diagnosed by identification of gross and microscopic lesions typical for Ectromelia infection, including foci of necrosis in the liver and spleen and eosinophilic intracytoplasmic inclusion bodies in the skin. The source of infection was determined by PCR analysis to be serum obtained from a commercial vendor. To determine whether viral growth in tissue culture was required to induce viral infection, 36 mice (BALB/cJ, C57BL/6J) were experimentally exposed intraperitoneally, intradermally (footpad), or intranasally to contaminated serum or bone marrow cell cultures using the contaminated serum in the culture medium. Mice were euthanized when clinical signs developed or after 12 wk. Necropsy, PCR of spleen, and serum ELISA were performed on all mice. Mice injected with cell cultures and their cage contacts developed mousepox, antibodies to Ectromelia, and lesions, whereas mice injected with serum without cells did not. Mouse antibody production, a tool commonly used to screen biologic materials for viral contamination, failed to detect active Ectromelia contamination in mouse serum.
Ye, Jin-Hai; Xu, Yuan-Jin; Gao, Jun; Yan, Shi-Guo; Zhao, Jun; Tu, Qisheng; Zhang, Jin; Duan, Xue-Jing; Sommer, Cesar A.; Mostoslavsky, Gustavo; Kaplan, David; Wu, Yu-Nong; Zhang, Chen-Ping; Wang, Lin; Chen, Jake
2011-01-01
Induced pluripotent stem cells (iPSCs) can differentiate into mineralizing cells and thus have a great potential in application in engineered bone substitutes with bioactive scaffolds in regeneration medicine. In the current study we characterized and demonstrated the pluripotency and osteogenic differentiation of mouse iPSCs. To enhance the osteogenic differentiation of iPSCs, we then transduced the iPSCs with the potent transcription factor, nuclear matrix protein SATB2. We observed that in SATB2-overexpressing iPSCs there were increased mineral nodule formation and elevated mRNA levels of key osteogenic genes, osterix (OSX), Runx2, bone sialoprotein (BSP) and osteocalcin (OCN). Moreover, the mRNA levels of HoxA2 was reduced after SATB2 overexpression in iPSCs. The SATB2-overexpressing iPSCs were then combined with silk scaffolds and transplanted into critical-size calvarial bone defects created in nude mice. Five weeks post-surgery, radiological and micro-CT analysis revealed enhanced new bone formation in calvarial defects in SATB2 group. Histological analysis also showed increased new bone formation and mineralization in the SATB2 group. In conclusion, the results demonstrate that SATB2 facilitates the differentiation of iPSCs towards osteoblast-lineage cells by repressing HoxA2 and augmenting the functions of the osteoblast determinants Runx2, BSP and OCN. PMID:21492931
Keeney, Michael; van den Beucken, Jeroen J J P; van der Kraan, Peter M; Jansen, John A; Pandit, Abhay
2010-04-01
Collagen/calcium phosphate scaffolds have been used for bone reconstruction due to their inherent similarities to the bone extracellular matrix. Calcium phosphate alone has also been used as a non-viral vector for gene delivery. The aim of this study was to determine the capability of a collagen/calcium phosphate scaffold to deliver naked plasmid DNA and mediate transfection in vivo. The second goal of the study was to deliver a plasmid encoding vascular endothelial growth factor(165) (pVEGF(165)) to promote angiogenesis, and hence bone formation, in a mouse intra-femoral model. The delivery of naked plasmid DNA resulted in a 7.6-fold increase in mRNA levels of beta-Galactosidase compared to the delivery of plasmid DNA complexed with a partially degraded PAMAM dendrimer (dPAMAM) in a subcutaneous murine model. When implanted in a muirne intra-femoral model, the delivery of pVEGF(165) resulted in a 2-fold increase in bone volume at the defect site relative to control scaffolds without pVEGF(165). It was concluded that a collagen/calcium phosphate scaffold can mediate transfection without the use of additional transfection vectors and can promote bone formation in a mouse model via the delivery of pVEGF(165). 2009 Elsevier Ltd. All rights reserved.
Predicting the bending properties of long bones: Insights from an experimental mouse model.
Peacock, Sarah J; Coats, Brittney R; Kirkland, J Kyle; Tanner, Courtney A; Garland, Theodore; Middleton, Kevin M
2018-03-01
Analyses of bone cross-sectional geometry are frequently used by anthropologists and paleontologists to infer the loading histories of past populations. To address some underlying assumptions, we investigated the relative roles of genetics and exercise on bone cross-sectional geometry and bending mechanics in three mouse strains: high bone density (C3H/He), low bone density (C57BL/6), and a high-runner strain homozygous for the Myh4 Minimsc allele (MM). Weanlings of each strain were divided into exercise (wheel) or control (sedentary) treatment groups for a 7-week experimental period. Morphometrics of the femoral mid-diaphysis and mechanical testing were used to assess both theoretical and ex vivo bending mechanics. Across all measured morphological and bending traits, we found relatively small effects of exercise treatment compared to larger and more frequent interstrain differences. In the exercised group, total distance run over the experimental period was not a predictor of any morphological or bending traits. Cross-sectional geometry did not accurately predict bone response to loading. Results from this experimental model do not support hypothesized associations among extreme exercise, cross-sectional geometry, and bending mechanics. Our results suggest that analysis of cross-sectional geometry alone is insufficient to predict loading response, and questions the common assumption that cross-sectional geometry differences are indicative of differential loading history. © 2017 Wiley Periodicals, Inc.
Bär, Christian; Povedano, Juan Manuel; Serrano, Rosa; Benitez-Buelga, Carlos; Popkes, Miriam; Formentini, Ivan; Bobadilla, Maria; Bosch, Fatima; Blasco, Maria A
2016-04-07
Aplastic anemia is a fatal bone marrow disorder characterized by peripheral pancytopenia and marrow hypoplasia. The disease can be hereditary or acquired and develops at any stage of life. A subgroup of the inherited form is caused by replicative impairment of hematopoietic stem and progenitor cells due to very short telomeres as a result of mutations in telomerase and other telomere components. Abnormal telomere shortening is also described in cases of acquired aplastic anemia, most likely secondary to increased turnover of bone marrow stem and progenitor cells. Here, we test the therapeutic efficacy of telomerase activation by using adeno-associated virus (AAV)9 gene therapy vectors carrying the telomerase Tert gene in 2 independent mouse models of aplastic anemia due to short telomeres (Trf1- and Tert-deficient mice). We find that a high dose of AAV9-Tert targets the bone marrow compartment, including hematopoietic stem cells. AAV9-Tert treatment after telomere attrition in bone marrow cells rescues aplastic anemia and mouse survival compared with mice treated with the empty vector. Improved survival is associated with a significant increase in telomere length in peripheral blood and bone marrow cells, as well as improved blood counts. These findings indicate that telomerase gene therapy represents a novel therapeutic strategy to treat aplastic anemia provoked or associated with short telomeres. © 2016 by The American Society of Hematology.
Garimella, Rama; Eskew, Jeff; Bhamidi, Priyanka; Vielhauer, George; Hong, Yan; Anderson, H. Clarke; Tawfik, Ossama; Rowe, Peter
2013-01-01
Osteosarcoma (OS) is a bone malignancy that affects children and adolescents. It is a highly aggressive tumor and typically metastasizes to lungs. Despite aggressive chemotherapy and surgical treatments, the current 5 year survival rate is 60–70%. Clinically relevant models are needed to understand OS pathobiology, metastatic progression from bones to lungs, and ultimately, to develop more efficacious treatment strategies and improve survival rates in OS patients with metastasis. The main goal of this study was to develop and characterize an in vivo OS model that will allow non-invasive tracking of tumor progression in real time, and aid in studying OS pathobiology, and screening of potential therapeutic agents against OS. In this study, we have used a multi-modality approach using bioluminescent imaging, electron microscopy, micro-computed tomography, and histopathology to develop and characterize a preclinical Bioluminescent Osteosarcoma Orthotopic Mouse (BOOM) model, using 143B human OS cell line. The results of this study clearly demonstrate that the BOOM model represents the clinical disease as evidenced by a spectrum of changes associated with tumor establishment, progression and metastasis, and detection of known OS biomarkers in the primary and metastatic tumor tissue. Key novel findings of this study include: (a) multimodality approach for extensive characterization of the BOOM model using 143B human OS cell line; (b) evidence of renal metastasis in OS orthotopic model using 143B cells; (c) evidence of Runx2 expression in the metastatic lung tissue; and (d) evidence of the presence of extracellular membrane vesicles and myofibroblasts in the BOOM model. PMID:25688332
Bone morphogenetic protein signaling is impaired in an Hfe knockout mouse model of hemochromatosis
Corradini, Elena; Garuti, Cinzia; Montosi, Giuliana; Ventura, Paolo; Andriopoulos, Billy; Lin, Herbert Y.; Pietrangelo, Antonello; Babitt, Jodie L.
2009-01-01
Background and Aims Mutations in HFE are the most common cause of the iron-overload disorder hereditary hemochromatosis (HH). Levels of the main iron regulatory hormone, hepcidin, are inappropriately low in HH mouse models and patients with HFE mutations, indicating that HFE regulates hepcidin. The bone morphogenetic protein 6 (BMP6)-SMAD signaling pathway is an important endogenous regulator of hepcidin expression. We investigated whether HFE is involved in BMP6-SMAD regulation of hepcidin expression. Methods The BMP6-SMAD pathway was examined in Hfe knockout (KO) mice and in wild-type (WT) mice as controls. Mice were placed on diets of varying iron content. Hepcidin induction by BMP6 was examined in primary hepatocytes from Hfe KO mice; data were compared with those of WT mice. Results Liver levels of Bmp6 mRNA were higher in Hfe KO mice; these were appropriate for the increased hepatic levels of iron in these mice, compared with WT mice. However, levels of hepatic phosphorylated Smad 1/5/8 protein (an intracellular mediator of Bmp6 signaling) and Id1 mRNA (a target gene of Bmp6) were inappropriately low for the body iron burden and Bmp6 mRNA levels in Hfe KO, compared with WT mice. BMP6 induction of hepcidin expression was reduced in Hfe KO hepatocytes compared with WT hepatocytes. Conclusions HFE is not involved in regulation of BMP6 by iron, but does regulate the downstream signals of BMP6 that are triggered by iron. PMID:19591830
NASA Astrophysics Data System (ADS)
Bushinsky, David A.
2008-09-01
Chronic metabolic acidosis increases urine calcium (Ca) excretion in the absence of a concomitant increase in intestinal Ca absorption resulting in a net loss of total body. The source of this additional urine Ca is almost certainly the skeleton, the primary reservoir of body Ca. In vitro metabolic acidosis, modeled as a primary reduction in medium bicarbonate concentration, acutely (<24 h) stimulates Ca efflux primarily through physicochemical mineral dissolution while at later time periods (>24 h) cell-mediated mechanisms predominate. In cultured neonatal mouse calvariae, acidosis-induced, cell-mediated Ca efflux is mediated by effects on both osteoblasts and osteoclasts. Metabolic acidosis inhibits extracellular matrix production by osteoblasts, as determined by measurement of collagen levels and levels for the non-collagenous matrix proteins osteopontin and matrix gla protein. Metabolic acidosis upregulates osteoblastic expression of RANKL (Receptor Activator of NFκB Ligand), an important osteoclastogenic and osteoclast-activating factor. Acidosis also increases osteoclastic activity as measured by release of β-glucuronidase, an enzyme whose secretion correlates with osteoclast-mediated bone resorption.
2012-10-01
ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1
Bone metastases of unknown origin: epidemiology and principles of management.
Piccioli, Andrea; Maccauro, Giulio; Spinelli, Maria Silvia; Biagini, Roberto; Rossi, Barbara
2015-06-01
Metastases are the most common malignancies involving bone; breast, prostate, lung and thyroid are the main sites of primary cancer. However, up to 30 % of patients present with bone metastases of unknown origin, where the site of the primary neoplasm cannot be identified at the time of diagnosis despite a thorough history, physical examination, appropriate laboratory testing and modern imaging technology (CT, MRI, PET). Sometimes only extensive histopathological investigations on bone specimens from biopsy can suggest the primary malignancy. At other times, a bone lesion can have such a highly undifferentiated histological appearance that a precise pathological classification on routine hematoxylin-eosin-stained section is not possible. The authors reviewed the relevant literature in an attempt to investigate the epidemiology of the histological primaries finally identified in patients with bone metastases from occult cancer, and a strategy of management and treatment of bone metastases from occult carcinomas is suggested. Lung, liver, pancreas and gastrointestinal tract are common sites for primary occult tumors. Adenocarcinoma is the main histological type, accounting for 70 % of all cases, while undifferentiated cancer accounts for 20 %. Over the past 30 years, lung cancer is the main causative occult primary for bone metastases and has a poor prognosis with an average survival of 4-8 months. Most relevant literature focuses on the need for standardized diagnostic workup, as surgery for bone lesions should be aggressive only when they are solitary and/or the occult primaries have a good prognosis; in these cases, identification of the primary tumor may be important and warrants special diagnostic efforts. However, in most cases, the primary site remains unknown, even after autopsy. Thus, orthopedic surgery has a mainly palliative role in preventing or stabilizing pathological fractures, relieving pain and facilitating the care of the patient in an attempt to provide the most appropriate therapy for the primary tumor as soon as possible. 5.
Bi, Xiaohong; Grafe, Ingo; Ding, Hao; Flores, Rene; Munivez, Elda; Jiang, Ming Ming; Dawson, Brian; Lee, Brendan; Ambrose, Catherine G
2017-02-01
Osteogenesis imperfecta (OI) is a group of genetic disorders characterized by brittle bones that are prone to fracture. Although previous studies in animal models investigated the mechanical properties and material composition of OI bone, little work has been conducted to statistically correlate these parameters to identify key compositional contributors to the impaired bone mechanical behaviors in OI. Further, although increased TGF-β signaling has been demonstrated as a contributing mechanism to the bone pathology in OI models, the relationship between mechanical properties and bone composition after anti-TGF-β treatment in OI has not been studied. Here, we performed follow-up analyses of femurs collected in an earlier study from OI mice with and without anti-TGF-β treatment from both recessive (Crtap -/- ) and dominant (Col1a2 +/P.G610C ) OI mouse models and WT mice. Mechanical properties were determined using three-point bending tests and evaluated for statistical correlation with molecular composition in bone tissue assessed by Raman spectroscopy. Statistical regression analysis was conducted to determine significant compositional determinants of mechanical integrity. Interestingly, we found differences in the relationships between bone composition and mechanical properties and in the response to anti-TGF-β treatment. Femurs of both OI models exhibited increased brittleness, which was associated with reduced collagen content and carbonate substitution. In the Col1a2 +/P.G610C femurs, reduced hydroxyapatite crystallinity was also found to be associated with increased brittleness, and increased mineral-to-collagen ratio was correlated with increased ultimate strength, elastic modulus, and bone brittleness. In both models of OI, regression analysis demonstrated that collagen content was an important predictor of the increased brittleness. In summary, this work provides new insights into the relationships between bone composition and material properties in models of OI, identifies key bone compositional parameters that correlate with the impaired mechanical integrity of OI bone, and explores the effects of anti-TGF-β treatment on bone-quality parameters in these models. © 2016 American Society for Bone and Mineral Research. © 2016 American Society for Bone and Mineral Research.
Kam, Winnie Wai-Ying; Meikle, Steven R.; Dunstan, Colin R.; Banati, Richard B.
2012-01-01
The presence of the translocator protein (TSPO), previously named as the mitochondrial or peripheral benzodiazepine receptor, in bone cells was studied in vitro and in situ using RT-qPCR, and receptor autoradiography using the selective TSPO ligand PK11195. In vitro, the TSPO is highly expressed in osteoblastic and osteoclastic cells. In situ, constitutive expression of TSPO is found in bone marrow and trabecular bone, e.g., spongiosa. Mice with a reduction of bone turnover induced by a 4-day treatment of osteoprotegerin reduces [3H]PK11195 binding in the spongiosa (320±128 Bq.mg−1, 499±106 Bq.mg−1 in saline-treated controls). In contrast, mice with an increase in bone turnover caused by a 4-day low calcium diet increases [3H]PK11195 binding in the spongiosa (615±90 Bq.mg−1). Further, our study includes technical feasibility data on [18F]fluoride microPET imaging of rodent bone with altered turnover. Despite [18F]fluoride having high uptake, the in vivo signal differences were small. Using a phantom model, we describe the spillover effect and partial volume loss that affect the quantitative microPET imaging of the small bone structures in experimental mouse models. In summary, we demonstrate the expression of TSPO in small rodent bone tissues, including osteoblasts and osteoclasts. A trend increase in TSPO expression was observed in the spongiosa from low to high bone turnover conditions. However, despite the potential utility of TSPO expression as an in vivo biomarker of bone turnover in experimental rodent models, our small animal PET imaging data using [18F]fluoride show that even under the condition of a good biological signal-to-noise ratio and high tracer uptake, the currently achievable instrument sensitivity and spatial resolution is unlikely to be sufficient to detect subtle differences in small structures, such as mouse bone. PMID:22295097
[Study of migration and distribution of bone marrow cells transplanted animals with B16 melanoma ].
Poveshchenko, A F; Solovieva, A O; Zubareva, K E; Strunkin, D N; Gricyk, O B; Poveshchenko, O V; Shurlygina, A V; Konenkov, V I
2017-01-01
Purpose. Reveal features migration and distribution of syngeneic bone marrow cells (BMC) and subpopulations (MSC) after transplantation into the recipient carrier B16 melanoma bodies. Methods. We used mouse male and female C57BL/6 mice. Induction of Tumor Growth: B16 melanoma cells implanted subcutaneously into right hind paw of female C57BL/6 mice at a dose of 2.5 x 105 cells / mouse. migration study in vivo distribution and BMC and MSC was performed using genetic markers - Y-chromosome specific sequence line male C57Bl/6 syngeneic intravenous transplantation in females using the polymerase chain reaction (PCR) in real time on Authorized Termal Cycler - Light Cycler 480 II / 96 (Roche). Introduction suspension of unseparated bone marrow cells, mesenchymal stem cells from donor to recipient male mice (syngeneic recipient female C57BL/6), followed by isolation of recipients of organs was performed at regular intervals, then of organ recipients isolated DNA. Results. It was shown that bone marrow cells positive for Y-chromosome in migrate lymphoid (lymph nodes, spleen, bone marrow) or in non-lymphoid organs (liver, heart, brain, skin) syngeneic recipients. In addition to the migration of cells from the bone marrow to other organs, there is a way back migration of cells from the circulation to the bone marrow. B16 melanoma stimulates the migration of transplanted MSCs and BMC in bone marrow. It is found that tumor growth enhanced migration of transplanted bone marrow cells, including populations of MSCs in the bone marrow. In the early stages of tumor formation MSC migration activity higher than the BMC. In the later stages of tumor formation undivided population of bone marrow cells migrate to the intense swelling compared with a population of MSCs. Conclusion. The possibility of using bone marrow MSCs for targeted therapy of tumor diseases, because migration of MSCs in tumor tissue can be used to effectively deliver anticancer drugs.
The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes
Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek
2017-01-01
Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014
Zhang, Yanshuai; McNerny, Erin Gatenby; Terajima, Masahiko; Raghavan, Mekhala; Romanowicz, Genevieve; Zhang, Zhanpeng; Zhang, Honghao; Kamiya, Nobuhiro; Tantillo, Margaret; Zhu, Peizhi; Scott, Gregory J.; Ray, Manas K.; Lynch, Michelle; Ma, Peter X.; Morris, Michael D.; Yamauchi, Mitsuo; Kohn, David H.; Mishina, Yuji
2016-01-01
Bone morphogenetic protein (BMP) signaling pathways play critical roles in skeletal development and new bone formation. Our previous study, however, showed a negative impact of BMP signaling on bone mass because of the osteoblast-specific loss of a BMP receptor (i.e. BMPR1A) showing increased trabecular bone volume and mineral density in mice. Here, we investigated the bone quality and biomechanical properties of the higher bone mass associated with BMPR1A deficiency using the osteoblast-specific Bmpr1a conditional knockout (cKO) mouse model. Collagen biochemical analysis revealed greater levels of the mature cross-link pyridinoline in the cKO bones, in parallel with upregulation of collagen modifying enzymes. Raman spectroscopy distinguished increases in the mature to immature cross-link ratio and mineral to matrix ratio in the trabecular compartments of cKO femora, but not in the cortical compartments. The mineral crystallinity was unchanged in the cKO in either the trabecular or cortical compartments. Further, we tested the intrinsic material properties by nanoindentation and found significantly higher hardness and elastic modulus in the cKO trabecular compartments, but not in the cortical compartments. Four point bending tests of cortical compartments showed lower structural biomechanical properties (i.e. strength and stiffness) in the cKO bones due to the smaller cortical areas. However, there were no significant differences in biomechanical performance at the material level, which was consistent with the nanoindentation test results on the cortical compartment. These studies emphasize the pivotal role of BMPR1A in the determination of bone quality and mechanical integrity under physiological conditions, with different impact on femoral cortical and trabecular compartments. PMID:27113526
The terminator mouse: salvation for primary cell culture.
Kabgani, Nazanin; Moeller, Marcus J
2013-11-01
The Terminator had to come back from the future already several times in an effort to bring salvation to mankind. In the present issue of Kidney International, Guo et al. brought us a novel transgenic mouse model: the terminator mouse. This highly elegant mouse may facilitate significantly the derivation of primary cultures of a specific cell type from a tissue containing multiple cell populations.
Jun, Sang Ho; Park, Chang-Joo; Hwang, Suk-Hyun; Lee, Youn Ki; Zhou, Cong; Jang, Hyon-Seok; Ryu, Jae-Jun
2018-12-01
This study was to evaluate the effect of bone graft procedure on the primary stability of implants installed in fresh sockets and assess the vertical alteration of peri-implant bone radiographically. Twenty-three implants were inserted in 18 patients immediately after tooth extraction. The horizontal gap between the implant and bony walls of the extraction socket was grafted with xenografts. The implant stability before and after graft procedure was measured by Osstell Mentor as implant stability quotient before bone graft (ISQ bbg) and implant stability quotient after bone graft (ISQ abg). Peri-apical radiographs were taken to measure peri-implant bone change immediately after implant surgery and 12 months after implant placement. Data were analyzed by independent t test; the relationships between stability parameters (insertion torque value (ITV), ISQ abg, and ISQ bbg) and peri-implant bone changes were analyzed according to Pearson correlation coefficients. The increase of ISQ in low primary stability group (LPSG) was 6.87 ± 3.62, which was significantly higher than the increase in high primary stability group (HPSG). A significant correlation between ITV and ISQ bbg ( R = 0.606, P = 0.002) was found; however, age and peri-implant bone change were not found significantly related to implant stability parameters. It was presented that there were no significant peri-implant bone changes at 1 year after bone graft surgery. Bone graft procedure is beneficial for increasing the primary stability of immediately placed implants, especially when the ISQ of implants is below 65 and that bone grafts have some effects on peri-implant bone maintenance.
Effects of epidermal growth factor on bone formation and resorption in vivo
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marie, P.J.; Hott, M.; Perheentupa, J.
1990-02-01
The effects of mouse epidermal growth factor (EGF) on bone formation and resorption were examined in male mice. EGF administration (2-200 ng.g-1.day-1 ip for 7 days) induced a dose-dependent rise in plasma EGF levels that remained within physiological range. Histomorphometric analysis of caudal vertebrae showed that EGF (20 and 200 ng.g-1.day-1) reduced the endosteal matrix and mineral appositional rates after 5 days of treatment as measured by double (3H)proline labeling and double tetracycline labeling, respectively. This effect was transitory and was not observed after 7 days of EGF administration. EGF administered for 7 days induced a dose-dependent increase in themore » periosteal osteoblastic and tetracycline double-labeled surfaces. At high dosage (200 ng.g-1.day-1) EGF administration increased the osteoclastic surface and the number of acid phosphatase-stained osteoclasts, although plasma calcium remained normal. The results show that EGF administration at physiological doses induces distinct effects on endosteal and periosteal bone formation and that the effects are dependent on EGF dosage and duration of treatment. This study indicates that EGF at physiological dosage stimulates periosteal bone formation and increases endosteal bone resorption in the growing mouse.« less
Cagáňová, Veronika; Borský, Jiří; Smahel, Zbyněk; Velemínská, Jana
2014-01-01
To describe the effect of secondary alveolar bone grafting in patients with unilateral cleft lip and palate by comparison with a sample of patients who have undergone primary periosteoplasty. Cephalometric analysis of lateral x-ray films in a retrospective semilongitudinal study. Lateral x-ray films of 18 secondary alveolar bone grafting patients and 48 primary periosteoplasty patients at 10 years of age and again at 15 years of age. The treatment of secondary alveolar bone grafting patients included lip repair according to Tennison, palatoplasty including retropositioning, pharyngeal flap surgery, and secondary alveolar bone grafting. The lips of primary periosteoplasty patient were repaired using the methods of Tennison and Veau, followed by primary periosteoplasty, palatoplasty including retropositioning, and pharyngeal flap surgery. Lateral radiographs were assessed using classical morphometry. There were few significant differences at 10 years of age between the secondary alveolar bone grafting and primary periosteoplasty patients. At 15 years of age, there were several significant differences. Compared with primary periosteoplasty patients, subsequent development in patients who had undergone secondary alveolar bone grafting was characterized by a significantly better position of the upper and lower dentoalveolar components in relation to the facial plane, a higher increase in the global convexity of the soft profile, a significantly better maxillary inclination, and a more favorable development of vertical intermaxillary relationships. Craniofacial development in secondary alveolar bone grafting patients was better than that in primary periosteoplasty patients due to the more marked facial convexity, the increased prominence of the nose, and better vertical intermaxillary relationships.
Vick, Binje; Rothenberg, Maja; Sandhöfer, Nadine; Carlet, Michela; Finkenzeller, Cornelia; Krupka, Christina; Grunert, Michaela; Trumpp, Andreas; Corbacioglu, Selim; Ebinger, Martin; André, Maya C.; Hiddemann, Wolfgang; Schneider, Stephanie; Subklewe, Marion; Metzeler, Klaus H.; Spiekermann, Karsten; Jeremias, Irmela
2015-01-01
Acute myeloid leukemia (AML) is a clinically and molecularly heterogeneous disease with poor outcome. Adequate model systems are required for preclinical studies to improve understanding of AML biology and to develop novel, rational treatment approaches. Xenografts in immunodeficient mice allow performing functional studies on patient-derived AML cells. We have established an improved model system that integrates serial retransplantation of patient-derived xenograft (PDX) cells in mice, genetic manipulation by lentiviral transduction, and essential quality controls by immunophenotyping and targeted resequencing of driver genes. 17/29 samples showed primary engraftment, 10/17 samples could be retransplanted and some of them allowed virtually indefinite serial transplantation. 5/6 samples were successfully transduced using lentiviruses. Neither serial transplantation nor genetic engineering markedly altered sample characteristics analyzed. Transgene expression was stable in PDX AML cells. Example given, recombinant luciferase enabled bioluminescence in vivo imaging and highly sensitive and reliable disease monitoring; imaging visualized minimal disease at 1 PDX cell in 10000 mouse bone marrow cells and facilitated quantifying leukemia initiating cells. We conclude that serial expansion, genetic engineering and imaging represent valuable tools to improve the individualized xenograft mouse model of AML. Prospectively, these advancements enable repetitive, clinically relevant studies on AML biology and preclinical treatment trials on genetically defined and heterogeneous subgroups. PMID:25793878
USDA-ARS?s Scientific Manuscript database
Osteocalcin (OC) is a vitamin K-dependent bone protein used as a marker of bone formation. Mouse models have demonstrated a role for the uncarboxylated form of OC (ucOC) in energy metabolism, including energy expenditure and adiposity, but human data are equivocal. To determine the associations betw...
USDA-ARS?s Scientific Manuscript database
Osteocalcin (OC) is a vitamin K dependent bone protein used as a marker of bone formation. Mouse models have demonstrated a role for the uncarboxylated form of OC (ucOC) in energy metabolism, including energy expenditure and adiposity, but human data are equivocal. To determine the associations betw...
1995-10-01
continually releases a synthetic progestin, levonorgestrel , for five years. In order to assess the impact of levonorgestrel on bone cells, murine calvarial...cell cultures were harvested, grown to confluence and treated with levonorgestrel , progesterone and estrogen. The majority of the cells grown in these
2014-09-01
mouse. Clear evidence for intra- articular fractures, existence of substantial subchondral bone erosion at the surface of articular plate, and formation...of bone spurs (small growths called osteophytes ) on the edges is seen in the PTOA joint but not on the intact contralateral knee joint. This
Recombinant mouse periostin ameliorates coronal sutures fusion in Twist1+/- mice.
Bai, Shanshan; Li, Dong; Xu, Liang; Duan, Huichuan; Yuan, Jie; Wei, Min
2018-04-17
Saethre-Chotzen syndrome is an autosomal dominantly inherited disorder caused by mutations in the twist family basic helix-loop-helix transcription factor 1 (TWIST1) gene. Surgical procedures are frequently required to reduce morphological and functional defects in patients with Saethre-Chotzen syndrome. Therefore, the development of noninvasive procedures to treat Saethre-Chotzen syndrome is critical. We identified that periostin, which is an extracellular matrix protein that plays an important role in both bone and connective tissues, is downregulated in craniosynostosis patients. We aimed to verify the effects of different concentrations (0, 50, 100, and 200 μg/l) of recombinant mouse periostin in Twist1 +/- mice (a mouse model of Saethre-Chotzen syndrome) coronal suture cells in vitro and in vivo. Cell proliferation, migration, and osteogenic differentiation were observed and detected. Twist1 +/- mice were also injected with recombinant mouse periostin to verify the treatment effects. Cell Counting Kit-8 results showed that recombinant mouse periostin inhibited the proliferation of suture-derived cells in a time- and concentration-dependent manner. Cell migration was also suppressed when treated with recombinant mouse periostin. Real-time quantitative PCR and Western blotting results suggested that messenger ribonucleic acid and protein expression of alkaline phosphatase, bone sialoprotein, collagen type I, and osteocalcin were all downregulated after treatment with recombinant mouse periostin. However, the expression of Wnt-3a, Wnt-1, and β-catenin were upregulated. The in vivo results demonstrated that periostin-treated Twist1 +/- mice showed patent coronal sutures in comparison with non-treated Twist1 +/- mice which have coronal craniosynostosis. Our results suggest that recombinant mouse periostin can inhibit coronal suture cell proliferation and migration and suppress osteogenic differentiation of suture-derived cells via Wnt canonical signaling, as well as ameliorate coronal suture fusion in Twist1 +/- mice.
Hosseinimehr, Seyed Jalal; Azadbakht, Mohammad; Abadi, Atefeh Jahan
2008-01-01
The preventive effect of hawthorn (Crataegus microphylla) fruit extract was investigated in mouse bone marrow cells against genotoxicity induced by cyclophosphamide. Mice were orally (gavages) pretreated with solutions of hawthorn extract which was prepared at five different doses (25, 50, 100, 200 and 400mg/kg b.w.) for seven consecutive days. Mice were injected intraperitoneally on the seventh day with cyclophosphamide (50mg/kg b.w.) and killed after 24h for the evaluation of micronucleated polychromatic erythrocytes (MnPCEs) and the ratio of PCE/(PCE+NCE) (polychromatic erythrocyte/polychromatic erythrocyte+normochromatic erythrocyte). All of five doses of extract significantly reduced MnPCEs induced by cyclophosphamide (P<0.0001). Hawthorn extract at dose 100mg/kg b.w. reduced MnPCEs 2.5 time and also completely normalized PCE/(PCE+NCE) ratio. Hawthorn extract exhibited concentration-dependent antioxidant activity on 1,1-diphenyl-2-picryl hydrazyl free radical. Hawthorn contains high amounts of phenolic compounds; the HPLC analysis showed that it contained chlorogenic acid, epicatechin and hyperoside. It is obvious that hawthorn, particularly flavonoids constituents with antioxidative activity, reduced the oxidative stress and genotoxicity induced by cyclophosphamide in mouse bone marrow cells. Copyright © 2007 Elsevier B.V. All rights reserved.
Mechanism Underlying Linezolid-induced Thrombocytopenia in a Chronic Kidney Failure Mouse Model
Nishijo, Nao; Tsuji, Yasuhiro; Matsunaga, Kazuhisa; Kutsukake, Masahiko; Okazaki, Fumiyasu; Fukumori, Shiro; Kasai, Hidefumi; Hiraki, Yoichi; Sakamaki, Ippei; Yamamoto, Yoshihiro; Karube, Yoshiharu; To, Hideto
2017-01-01
Objective: To investigate the relationship between renal function and linezolid (LZD)-induced thrombocytopenia and elucidate the underlying mechanism using a chronic renal disease (CRD) mouse model. Materials and Methods: CRD was induced in 5-week-old male Institute of Cancer Research (ICR) mice by 5/6 nephrectomy. After this procedure, LZD (25 and 100 mg/kg) was administered intraperitoneally once every day for 28 days. Platelet counts, white blood cell (WBC) counts, and hematocrit (HCT) levels were measured every 7 days. 2-14C-thymidine (0.185 MBq) was administrated intravenously to LZD-administered mice to evaluate the thymidine uptake ability of bone marrow. Results: Platelet counts were significantly lower in the LZD-administered CRD group than in the LZD-nonadministered groups at 14, 21, and 28 days (P < 0.05); however, these changes were not observed in LZD-administered mice with normal renal function, regardless of the duration of LZD administration. No significant changes were observed in WBC counts or HCT levels in any LZD-administered CRD mouse. Moreover, radioactive levels in bone marrow were not significantly different in each group. Conclusions: These results indicate that LZD-induced decreases in platelet counts were enhanced by renal impairment in vivo, suggesting that LZD-induced thrombocytopenia is not caused by nonimmune-mediated bone marrow suppression. PMID:28405130
Infrared imaging microscopy of bone: Illustrations from a mouse model of Fabry disease
Boskey, Adele L.; Goldberg, Michel; Kulkarni, Ashok; Gomez, Santiago
2006-01-01
Bone is a complex tissue whose composition and properties vary with age, sex, diet, tissue type, health and disease. In this review, we demonstrate how infrared spectroscopy and infrared spectroscopic imaging can be applied to the study of these variations. A specific example of mice with Fabry disease (a lipid storage disease) is presented in which it is demonstrated that the bones of these young animals, while showing typical spatial variation in mineral content, mineral crystal size, and collagen maturity, do not differ from the bones of age- and sex-matched wild type animals. PMID:16697974
Infrared imaging microscopy of bone: illustrations from a mouse model of Fabry disease.
Boskey, Adele L; Goldberg, Michel; Kulkarni, Ashok; Gomez, Santiago
2006-07-01
Bone is a complex tissue whose composition and properties vary with age, sex, diet, tissue type, health and disease. In this review, we demonstrate how infrared spectroscopy and infrared spectroscopic imaging can be applied to the study of these variations. A specific example of mice with Fabry disease (a lipid storage disease) is presented in which it is demonstrated that the bones of these young animals, while showing typical spatial variation in mineral content, mineral crystal size, and collagen maturity, do not differ from the bones of age- and sex-matched wild type animals.
Zhen, Ruixin; Yang, Jianing; Wang, Yu; Li, Yubo; Chen, Bin; Song, Youxin; Ma, Guiyun; Yang, Bo
2018-04-01
Bone regeneration is an important process associated with the treatment of osteonecrosis, which is caused by various factors. Hepatocyte growth factor (HGF) is an active biological factor that has multifunctional roles in cell biology, life sciences and clinical medicine. It has previously been suggested that bone morphogenetic protein (BMP)‑2 exerts beneficial roles in bone formation, repair and angiogenesis in the femoral head. The present study aimed to investigate the benefits and molecular mechanisms of HGF in bone regeneration. The viability of osteoblasts and osteoclasts were studied in vitro. In addition, the expression levels of tumor necrosis factor (TNF)‑α, monocyte chemotactic protein (MCP)‑1, interleukin (IL)‑1 and IL‑6 were detected in a mouse fracture model following treatment with HGF. The expression and activity of nuclear factor (NF)‑κB were also analyzed in osteocytes post‑treatment with HGF. Histological analysis was used to determine the therapeutic effects of HGF on mice with fractures. The migration and differentiation of osteoblasts and osteoclasts were investigated in HGF‑incubated cells. Furthermore, angiogenesis and BMP‑2 expression were analyzed in the mouse fracture model post‑treatment with HGF. The results indicated that HGF regulates the cell viability of osteoblasts and osteoclasts, and also balanced the ratio between osteoblasts and osteoclasts. In addition, HGF decreased the serum expression levels of TNF‑α, MCP‑1, IL‑1 and IL‑6 in experimental mice. The results of a mechanistic analysis demonstrated that HGF upregulated p65, IκB kinase‑β and IκBα expression in osteoblasts from experimental mice. In addition, the expression levels of vascular endothelial growth factor, BMP‑2 receptor, receptor activator of NF‑κB ligand and macrophage colony‑stimulating factor were upregulated by HGF, which may effectively promote blood vessel regeneration, and contribute to the formation and revascularization of tissue‑engineered bone. Furthermore, HGF promoted BMP‑2 expression and enhanced angiogenesis at the fracture location. These results suggested that HGF treatment may significantly promote bone regeneration in a mouse fracture model. In conclusion, these results indicated that HGF is involved in bone regeneration, angiogenesis and the balance between osteoblasts and osteoclasts, thus suggesting that HGF may be considered a potential agent for the treatment of fractures via the promotion of bone regeneration through regulation of the BMP‑2‑mediated NF‑κB signaling pathway.
Applications of transgenics in studies of bone sialoprotein.
Zhang, Jin; Tu, Qisheng; Chen, Jake
2009-07-01
Bone sialoprotein (BSP) is a major non-collagenous protein in mineralizing connective tissues such as dentin, cementum and calcified cartilage tissues. As a member of the Small Integrin-Binding Ligand, N-linked Glycoprotein (SIBLING) gene family of glycoproteins, BSP is involved in regulating hydroxyapatite crystal formation in bones and teeth, and has long been used as a marker gene for osteogenic differentiation. In the most recent decade, new discoveries in BSP gene expression and regulation, bone remodeling, bone metastasis, and bone tissue engineering have been achieved with the help of transgenic mice. In this review, we discuss these new discoveries obtained from the literatures and from our own laboratory, which were derived from the use of transgenic mouse mutants related to BSP gene or its promoter activity.
SONG, NINGXIA; GAO, LEI; QIU, HUIYING; HUANG, CHONGMEI; CHENG, HUI; ZHOU, HONG; LV, SHUQING; CHEN, LI; WANG, JIANMIN
2015-01-01
The allogeneic hematopoietic stem cell (HSC) transplantation of mesenchymal stem cells (MSCs) contributes to the reconstitution of hematopoiesis by ameliorating acute graft-versus-host disease (aGVHD). However, the role of MSCs in graft-versus-leukemia remains to be determined. In the present study, we co-cultured C57BL/6 mouse bone marrow (BM)-derived MSCs with A20 murine B lymphoma, FBL3 murine erythroleukemia and P388 murine acute lymphocytic leukemia cells. Cell proliferation, apoptosis, cell cycle progression and the amount of cytokine secretion were then measured using a Cell Counting kit-8, Annexin V/propidium iodide staining, flow cytometry and ELISA, respectively. We also established a model of allogeneic bone marrow transplantation (BMT) using BALB/c mice. Following the administration of A20 cells and MSCs, we recorded the symptoms and the survival of the mice for 4 weeks, assessed the T cell subsets present in peripheral blood, and, after the mice were sacrifice, we determined the infiltration of MSCs into the organs by histological staining. Our results revealed that the MSCs inhibited the proliferation of the mouse lymphoma and leukemia cells in vitro, leading to cell cycle arrest and reducing the secretion of interleukin (IL)-10. In our model of allogeneic BMT, the intravenous injection of MSCs into the mice injected wth A20 cells decreased the incidence of lymphoma, improved survival, increased the fraction of CD3+CD8+ T cells, decreased the fraction of CD3+CD4+ T cells and CD4+CD25+ T cells in peripheral blood, and ameliorated the manifestation of aGVHD. The results from the present study indicate that MSCs may be safe and effective when used in allogeneic BMT for the treatment of hemotological malignancies. PMID:25901937
Song, Ningxia; Gao, Lei; Qiu, Huiying; Huang, Chongmei; Cheng, Hui; Zhou, Hong; Lv, Shuqing; Chen, Li; Wang, Jianmin
2015-07-01
The allogeneic hematopoietic stem cell (HSC) transplantation of mesenchymal stem cells (MSCs) contributes to the reconstitution of hematopoiesis by ameliorating acute graft‑versus‑host disease (aGVHD). However, the role of MSCs in graft‑versus‑leukemia remains to be determined. In the present study, we co‑cultured C57BL/6 mouse bone marrow (BM)‑derived MSCs with A20 murine B lymphoma, FBL3 murine erythroleukemia and P388 murine acute lymphocytic leukemia cells. Cell proliferation, apoptosis, cell cycle progression and the amount of cytokine secretion were then measured using a Cell Counting kit‑8, Annexin V/propidium iodide staining, flow cytometry and ELISA, respectively. We also established a model of allogeneic bone marrow transplantation (BMT) using BALB/c mice. Following the administration of A20 cells and MSCs, we recorded the symptoms and the survival of the mice for 4 weeks, assessed the T cell subsets present in peripheral blood, and, after the mice were sacrifice, we determined the infiltration of MSCs into the organs by histological staining. Our results revealed that the MSCs inhibited the proliferation of the mouse lymphoma and leukemia cells in vitro, leading to cell cycle arrest and reducing the secretion of interleukin (IL)‑10. In our model of allogeneic BMT, the intravenous injection of MSCs into the mice injected wth A20 cells decreased the incidence of lymphoma, improved survival, increased the fraction of CD3+CD8+ T cells, decreased the fraction of CD3+CD4+ T cells and CD4+CD25+ T cells in peripheral blood, and ameliorated the manifestation of aGVHD. The results from the present study indicate that MSCs may be safe and effective when used in allogeneic BMT for the treatment of hemotological malignancies.
Masia, Ricard; Krause, Daniela S; Yellen, Gary
2015-02-01
Neutrophils are phagocytic cells that play a critical role in innate immunity by destroying bacterial pathogens. Channels belonging to the inward rectifier potassium channel subfamily 2 (Kir2 channels) have been described in other phagocytes (monocytes/macrophages and eosinophils) and in hematopoietic precursors of phagocytes. Their physiological function in these cells remains unclear, but some evidence suggests a role in growth factor-dependent proliferation and development. Expression of functional Kir2 channels has not been definitively demonstrated in mammalian neutrophils. Here, we show by RT-PCR that neutrophils from mouse bone marrow and liver express mRNA for the Kir2 subunit Kir2.1 but not for other subunits (Kir2.2, Kir2.3, and Kir2.4). In electrophysiological experiments, resting (unstimulated) neutrophils from mouse bone marrow and liver exhibit a constitutively active, external K(+)-dependent, strong inwardly rectifying current that constitutes the dominant current. The reversal potential is dependent on the external K(+) concentration in a Nernstian fashion, as expected for a K(+)-selective current. The current is not altered by changes in external or internal pH, and it is blocked by Ba(2+), Cs(+), and the Kir2-selective inhibitor ML133. The single-channel conductance is in agreement with previously reported values for Kir2.1 channels. These properties are characteristic of homomeric Kir2.1 channels. Current density in short-term cultures of bone marrow neutrophils is decreased in the absence of growth factors that are important for neutrophil proliferation [granulocyte colony-stimulating factor (G-CSF) and stem cell factor (SCF)]. These results demonstrate that mouse neutrophils express functional Kir2.1 channels and suggest that these channels may be important for neutrophil function, possibly in a growth factor-dependent manner. Copyright © 2015 the American Physiological Society.
Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone
2014-10-01
DRIP205) and VDR interacting with the histone acetyltransferases (SRC1, CBBP etc) that control entry and activity of RNA polymerase II for TAF12...bone volume fraction (BV/TV, %), trabecular number (Tb.N, N /mm2), trabecular thickness (Tb.Th, mm), and trabecular bone spacing (Tb.Sp, mm). Cortical...mean SD ( n ¼ 4); p< 0.01, significantly different from OCLs formed with the same treatment in WT mouse cultures. (B) OCL formation by treatment of
Primary Mouse Myoblast Purification using Magnetic Cell Separation.
Sincennes, Marie Claude; Wang, Yu Xin; Rudnicki, Michael A
2017-01-01
Primary myoblasts can be isolated from mouse muscle cell extracts and cultured in vitro. Muscle cells are usually dissociated manually by mincing with razor blades or scissors in a collagenase/dispase solution. Primary myoblasts are then gradually enriched by pre-plating on collagen-coated plates, based on the observation that mouse fibroblasts attach quickly to collagen-coated plates, and are less adherent. Here, we describe an automated muscle dissociation protocol. We also propose an alternative to pre-plating using magnetic bead separation of primary myoblasts, which improve myoblast purity by minimizing fibroblast contamination.
An investigation of the mineral in ductile and brittle cortical mouse bone.
Rodriguez-Florez, Naiara; Garcia-Tunon, Esther; Mukadam, Quresh; Saiz, Eduardo; Oldknow, Karla J; Farquharson, Colin; Millán, José Luis; Boyde, Alan; Shefelbine, Sandra J
2015-05-01
Bone is a strong and tough material composed of apatite mineral, organic matter, and water. Changes in composition and organization of these building blocks affect bone's mechanical integrity. Skeletal disorders often affect bone's mineral phase, either by variations in the collagen or directly altering mineralization. The aim of the current study was to explore the differences in the mineral of brittle and ductile cortical bone at the mineral (nm) and tissue (µm) levels using two mouse phenotypes. Osteogenesis imperfecta model, oim(-/-) , mice have a defect in the collagen, which leads to brittle bone; PHOSPHO1 mutants, Phospho1(-/-) , have ductile bone resulting from altered mineralization. Oim(-/-) and Phospho1(-/-) were compared with their respective wild-type controls. Femora were defatted and ground to powder to measure average mineral crystal size using X-ray diffraction (XRD) and to monitor the bulk mineral to matrix ratio via thermogravimetric analysis (TGA). XRD scans were run after TGA for phase identification to assess the fractions of hydroxyapatite and β-tricalcium phosphate. Tibiae were embedded to measure elastic properties with nanoindentation and the extent of mineralization with backscattered electron microscopy (BSE SEM). Results revealed that although both pathology models had extremely different whole-bone mechanics, they both had smaller apatite crystals, lower bulk mineral to matrix ratio, and showed more thermal conversion to β-tricalcium phosphate than their wild types, indicating deviations from stoichiometric hydroxyapatite in the original mineral. In contrast, the degree of mineralization of bone matrix was different for each strain: brittle oim(-/-) were hypermineralized, whereas ductile Phospho1(-/-) were hypomineralized. Despite differences in the mineralization, nanoscale alterations in the mineral were associated with reduced tissue elastic moduli in both pathologies. Results indicated that alterations from normal crystal size, composition, and structure are correlated with reduced mechanical integrity of bone. © 2014 American Society for Bone and Mineral Research.
Zheng, Ming-Jie; Wang, Jue; Xu, Lu; Zha, Xiao-Ming; Zhao, Yi; Ling, Li-Jun; Wang, Shui
2015-02-01
During the past decades, many efforts have been made in mimicking the clinical progress of human cancer in mouse models. Previously, we developed a human breast tissue-derived (HB) mouse model. Theoretically, it may mimic the interactions between "species-specific" mammary microenvironment of human origin and human breast cancer cells. However, detailed evidences are absent. The present study (in vivo, cellular, and molecular experiments) was designed to explore the regulatory role of human mammary microenvironment in the progress of human breast cancer cells. Subcutaneous (SUB), mammary fat pad (MFP), and HB mouse models were developed for in vivo comparisons. Then, the orthotopic tumor masses from three different mouse models were collected for primary culture. Finally, the biology of primary cultured human breast cancer cells was compared by cellular and molecular experiments. Results of in vivo mouse models indicated that human breast cancer cells grew better in human mammary microenvironment. Cellular and molecular experiments confirmed that primary cultured human breast cancer cells from HB mouse model showed a better proliferative and anti-apoptotic biology than those from SUB to MFP mouse models. Meanwhile, primary cultured human breast cancer cells from HB mouse model also obtained the migratory and invasive biology for "species-specific" tissue metastasis to human tissues. Comprehensive analyses suggest that "species-specific" mammary microenvironment of human origin better regulates the biology of human breast cancer cells in our humanized mouse model of breast cancer, which is more consistent with the clinical progress of human breast cancer.
Hatoum, Georges; Meshkin, Cyrus; Alkhunaizi, Sufana; Levene, Richard; Formoso-Onofrio, Julie
2015-01-01
Chronic lymphocytic leukemia (CLL) is a common malignancy which may coexist with other primary cancers. CLL is rarely the cause of solitary bone lesions; such lesions in the context of CLL are believed to result from either Richter’s transformation or metastasis from another primary malignancy. Renal cell carcinoma (RCC), on the other hand, is a malignancy which frequently metastasizes to bone and may cause an osteolytic solitary bone lesion. The origin of a solitary bone lesion in a patient with multiple potential primary malignancies has prognostic implications and affects treatment protocol, and as such must be diagnosed accurately. We describe a patient with CLL and a history of RCC who is found to have an incidental solitary bone lesion of the T11 vertebra. After two separate CT-guided biopsies revealed various lymphoid cell predominance and no evidence of RCC, treatment with low dose external beam radiation therapy (EBRT) was employed. Post-therapy MRI showed further propagation of the lesion. Surgical corpectomy was subsequently performed and postoperative pathology of the lesion was consistent with RCC. The patient was treated with bisphosphonates and a higher dose of EBRT. Our case illustrates the importance of surgical excisional biopsy for accurately diagnosing the primary source metastatic to the bone in a patient with CLL and another potential primary cancer. PMID:29147427
Tumor - bone; Bone cancer; Primary bone tumor; Secondary bone tumor; Bone tumor - benign ... The cause of bone tumors is unknown. They often occur in areas of the bone that grow rapidly. Possible causes include: Genetic defects ...
2013-03-01
tissue have been optimized • Optimization of flow cytometry-based analyses to characterize co- incident expression of multiple MSC-related markers on a...CA). Mouse anti-human vimentin (clone LN-6) was purchased from Sigma-Aldrich (St. Louis, MO). Goat anti-mouse Alexa Fluor 488, Roswell Park
Puolakkainen, Tero; Ma, Hongqian; Kainulainen, Heikki; Pasternack, Arja; Rantalainen, Timo; Ritvos, Olli; Heikinheimo, Kristiina; Hulmi, Juha J; Kiviranta, Riku
2017-01-19
Inhibition of activin/myostatin pathway has emerged as a novel approach to increase muscle mass and bone strength. Duchenne muscular dystrophy (DMD) is a neuromuscular disorder that leads to progressive muscle degeneration and also high incidence of fractures. The aim of our study was to test whether inhibition of activin receptor IIB ligands with or without exercise could improve bone strength in the mdx mouse model for DMD. Thirty-two mdx mice were divided to running and non-running groups and to receive either PBS control or soluble activin type IIB-receptor (ActRIIB-Fc) once weekly for 7 weeks. Treatment of mdx mice with ActRIIB-Fc resulted in significantly increased body and muscle weights in both sedentary and exercising mice. Femoral μCT analysis showed increased bone volume and trabecular number (BV/TV +80%, Tb.N +70%, P < 0.05) in both ActRIIB-Fc treated groups. Running also resulted in increased bone volume and trabecular number in PBS-treated mice. However, there was no significant difference in trabecular bone structure or volumetric bone mineral density between the ActRIIB-Fc and ActRIIB-Fc-R indicating that running did not further improve bone structure in ActRIIB-Fc-treated mice. ActRIIB-Fc increased bone mass also in vertebrae (BV/TV +20%, Tb.N +30%, P < 0.05) but the effects were more modest. The number of osteoclasts was decreased in histological analysis and the expression of several osteoblast marker genes was increased in ActRIIB-Fc treated mice suggesting decreased bone resorption and increased bone formation in these mice. Increased bone mass in femurs translated into enhanced bone strength in biomechanical testing as the maximum force and stiffness were significantly elevated in ActRIIB-Fc-treated mice. Our results indicate that treatment of mdx mice with the soluble ActRIIB-Fc results in a robust increase in bone mass, without any additive effect by voluntary running. Thus ActRIIB-Fc could be an attractive option in the treatment of musculoskeletal disorders.
Sost deficiency does not alter bone's lacunar or vascular porosity in mice
NASA Astrophysics Data System (ADS)
Mosey, Henry; Núñez, Juan A.; Goring, Alice; Clarkin, Claire E.; Staines, Katherine A.; Lee, Peter D.; Pitsillides, Andrew A.; Javaheri, Behzad
2017-09-01
SCLEROSTIN (Sost) is expressed predominantly in osteocytes acting as a negative regulator of bone formation. In humans, mutations in the SOST gene lead to skeletal overgrowth and increased bone mineral density, suggesting that SCLEROSTIN is a key regulator of bone mass. The function of SCLEROSTIN as an inhibitor of bone formation is further supported by Sost knockout (KO) mice which display a high bone mass with elevated bone formation. Previous studies have indicated that Sost exerts its effect on bone formation through Wnt-mediated regulation of osteoblast differentiation, proliferation and activity. Recent in vitro studies have also suggested that SCLEROSTIN regulates angiogenesis and osteoblast-to-osteocyte transition. Despite this wealth of knowledge of the mechanisms responsible for SCLEROSTIN action, no previous studies have examined whether SCLEROSTIN regulates osteocyte and vascular configuration in cortices of mouse tibia. Herein, we image tibiae from Sost KO mice and their wild-type (WT) counterparts with high resolution CT to examine whether lack of SCLEROSTIN influences the morphometric properties of lacunae and vascular canal porosity relating to osteocytes and vessels within cortical bone. Male Sost KO and WT mice (n = 6 /group) were sacrificed at 12 weeks of age. Fixed tibiae were analysed using microCT to examine cortical bone mass and architecture. Then, samples were imaged by using benchtop and synchrotron nanoCT at the tibiofibular junction. Our data, consistent with previous studies show that, Sost deficiency leads to significant enhancement of bone mass by cortical thickening and bigger cross-sectional area and we find that this occurs without modifications of tibial ellipticity, a measure of bone shape. In addition, our data show that there are no significant differences in any lacunar or vascular morphometric or geometric parameters between Sost KO mouse tibia and WT counterparts. We therefore conclude that the significant increases in bone mass induced by Sost deficiency are not accompanied by any significant modification in the density, organisation or shape of osteocyte lacunae or vascular content within the cortical bone. These data may imply that SCLEROSTIN does not modify the frequency of osteocytogenic recruitment of osteoblasts to initiate terminal osteocytic differentiation in mice.
Mineralization defects in cementum and craniofacial bone from loss of bone sialoprotein
Foster, B.L.; Ao, M.; Willoughby, C.; Soenjaya, Y.; Holm, E.; Lukashova, L.; Tran, A. B.; Wimer, H.F.; Zerfas, P.M.; Nociti, F.H.; Kantovitz, K.R.; Quan, B.D.; Sone, E.D.; Goldberg, H.A.; Somerman, M.J.
2015-01-01
Bone sialoprotein (BSP) is a multifunctional extracellular matrix protein found in mineralized tissues, including bone, cartilage, tooth root cementum (both acellular and cellular types), and dentin. In order to define the role BSP plays in the process of biomineralization of these tissues, we analyzed cementogenesis, dentinogenesis, and osteogenesis (intramembranous and endochondral) in craniofacial bone in Bsp null mice and wild-type (WT) controls over a developmental period (1-60 days post natal; dpn) by histology, immunohistochemistry, undecalcified histochemistry, microcomputed tomography (microCT), scanning electron microscopy (SEM), transmission electron microscopy (TEM), and quantitative PCR (qPCR). Regions of intramembranous ossification in the alveolus, mandible, and calvaria presented delayed mineralization and osteoid accumulation, assessed by von Kossa and Goldner's trichrome stains at 1 and 14 dpn. Moreover, Bsp−/− mice featured increased cranial suture size at the early time point, 1 dpn. Immunostaining and PCR demonstrated that osteoblast markers, osterix, alkaline phosphatase, and osteopontin were unchanged in Bsp null mandibles compared to WT. Bsp−/− mouse molars featured a lack of functional acellular cementum formation by histology, SEM, and TEM, and subsequent loss of Sharpey's collagen fiber insertion into the tooth root structure. Bsp−/− mouse alveolar and mandibular bone featured equivalent or fewer osteoclasts at early ages (1 and 14 dpn), however, increased RANKL immunostaining and mRNA, and significantly increased number of osteoclast-like cells (2-5 fold) were found at later ages (26 and 60 dpn), corresponding to periodontal breakdown and severe alveolar bone resorption observed following molar teeth entering occlusion. Dentin formation was unperturbed in Bsp−/− mouse molars, with no delay in mineralization, no alteration in dentin dimensions, and no differences in odontoblast markers analyzed. No defects were identified in endochondral ossification in the cranial base, and craniofacial morphology was unaffected in Bsp−/− mice. These analyses confirm a critical role for BSP in processes of cementogenesis and intramembranous ossification of craniofacial bone, whereas endochondral ossification in the cranial base was minimally affected and dentinogenesis was normal in Bsp−/− molar teeth. Dissimilar effects of loss of BSP on mineralization of dental and craniofacial tissues suggest local differences in the role of BSP and/or yet to be defined interactions with site-specific factors. PMID:25963390
Burgio, Gaétan; Baylac, Michel; Heyer, Evelyne; Montagutelli, Xavier
2012-01-01
Background Genetic determinism of cranial morphology in the mouse is still largely unknown, despite the localization of putative QTLs and the identification of genes associated with Mendelian skull malformations. To approach the dissection of this multigenic control, we have used a set of interspecific recombinant congenic strains (IRCS) produced between C57BL/6 and mice of the distant species Mus spretus (SEG/Pas). Each strain has inherited 1.3% of its genome from SEG/Pas under the form of few, small-sized, chromosomal segments. Results The shape of the nasal bone was studied using outline analysis combined with Fourier descriptors, and differential features were identified between IRCS BcG-66H and C57BL/6. An F2 cross between BcG-66H and C57BL/6 revealed that, out of the three SEG/Pas-derived chromosomal regions present in BcG-66H, two were involved. Segments on chromosomes 1 (∼32 Mb) and 18 (∼13 Mb) showed additive effect on nasal bone shape. The three chromosomal regions present in BcG-66H were isolated in congenic strains to study their individual effect. Epistatic interactions were assessed in bicongenic strains. Conclusions Our results show that, besides a strong individual effect, the QTL on chromosome 1 interacts with genes on chromosomes 13 and 18. This study demonstrates that nasal bone shape is under complex genetic control but can be efficiently dissected in the mouse using appropriate genetic tools and shape descriptors. PMID:22662199
Ghaneialvar, Hori; Soltani, Leila; Rahmani, Hamid Reza; Lotfi, Abbas Sahebghadam; Soleimani, Masoud
2018-01-01
Mesenchymal stem cells are multipotent cells capable of replicating as undifferentiated cells, and have the potential of differentiating into mesenchymal tissue lineages such as osteocytes, adipocytes and chondrocytes. Such lineages can then be used in cell therapy. The aim of present study was to characterize bone marrow derived mesenchymal stem cells in four different species, including: sheep, goat, human and mouse. Human bone-marrow mesenchymal stem cells were purchased, those of sheep and goat were isolated from fetal bone marrow, and those of mouse were collected by washing bone cavity of femur and tibia with DMEM/F12. Using flow-cytometry, they were characterized by CD surface antigens. Furthermore, cells of third passage were examined for their osteogenic and adipogenic differentiation potential by oil red and alizarin red staining respectively. According to the results, CD markers studied in the four groups of mesenchymal stem cells showed a different expression. Goat and sheep expressed CD44 and CD166, and weakly expressed CD34, CD45, CD105 and CD90. Similarly, human and mouse mesenchymal cells expressed CD44, CD166, CD105 and CD90 whereas the expression of CD34 and CD45 was negative. In conclusion, although all mesenchymal stem cells display plastic adherence and tri-lineage differentiation, not all express the same panel of surface antigens described for human mesenchymal stem cells. Additional panel of CD markers are necessary to characterize regenerative potential and possible application of these stem cells in regenerative medicine and implantology.
Primary pericranial Ewing's sarcoma on the temporal bone: A case report.
Kawano, Hiroto; Nitta, Naoki; Ishida, Mitsuaki; Fukami, Tadateru; Nozaki, Kazuhiko
2016-01-01
Primary Ewing's sarcoma originating in the pericranium is an extremely rare disease entity. A 9-year-old female patient was admitted to our department due to a left temporal subcutaneous mass. The mass was localized under the left temporal muscle and attached to the surface of the temporal bone. Head computed tomography revealed a mass with bony spicule formation on the temporal bone, however, it did not show bone destruction or intracranial invasion. F-18 fluorodeoxyglucose positron emission tomography showed no lesions other than the mass on the temporal bone. Magnetic resonance imaging showed that the mass was located between the temporal bone and the pericranium. The mass was completely resected with the underlying temporal bone and the overlying deep layer of temporal muscle, and was diagnosed as primary Ewing's sarcoma. Because the tumor was located in the subpericranium, we created a new classification, "pericranial Ewing's sarcoma," and diagnosed the present tumor as pericranial Ewing's sarcoma. We herein present an extremely rare case of primary pericranial Ewing's sarcoma that developed on the temporal bone.
Postradiation atrophy of mature bone
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ergun, H.; Howland, W.J.
1980-01-01
The primary event of radiation damage to bone is atrophy and true necrosis of bone is uncommon. The postradiation atrophic changes of bone are the result of combined cellular and vascular damage, the former being more important. The damage to the osteoblast resulting in decreased matrix production is apparently the primary histopathologic event. Radiation damaged bone is susceptible to superimposed complications of fracture, infection, necrosis, and sarcoma. The primary radiographic evidence of atrophy, localized osteopenia, is late in appearing. Contrary to former views, the mature bone is quite radiosensitive and reacts quickly to even small doses of radiation. The differentiationmore » of postirradiation atrophy and metastasis may be difficult. Biopsy should be the last resort because of the possibility of causing true necrosis in atrophic bone by trauma and infection.« less
Macrophage-selective toxicity as a mechanism of hydroquinone-induced myelotoxicity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thomas, D.J.
1989-01-01
This research has focused upon the role of the bone marrow stroma in the etiology of benzene hematotoxicity. Treatment with the metabolite hydroquinone results in a reduced capacity of the stroma to support myelopoiesis. The goal of this research was to examine stromal cell selective toxicity following hydroquinone treatment. Populations of macrophages and a fibroblastoid cell line (LTF) or primary fibroblasts were developed from mouse bone marrow. Following treatment of with hydroquinone, treated or control fibroblastoid cells were reconstituted with control or treated macrophages, respectively, and the cultures were assayed for their ability to support myelopoiesis. To examine mechanisms ofmore » selective toxicity, macrophage and LTF cultures were incubated with 14C-hydroquinone and bioactivation was examined. After 24 hours, macrophages had 16-fold higher levels of bound {sup 14}C than LTF cells. Peroxide-dependent bioactivation in cell homogenates revealed that peroxide could support formation of covalent-binding species in macrophage homogenates but not in LTF homogenates. It was determined that macrophages, but not LTF cells, contained detectable levels of peroxidase activity which was consistent with the postulate that increased binding was due to peroxidase-mediated bioactivation of hydroquinone. Accordingly, purified myeloperoxidase incubated with {sup 14}C-hydroquinone, resulted in bioactivation to a covalent-binding species. This study provided evidence supporting selective bioactivation as a mechanism of selective toxicity of hydroquinone to bone marrow stromal macrophages.« less
Gupte, Ankita; Baker, Emma K.; Wan, Soo-San; Stewart, Elizabeth; Loh, Amos; Shelat, Anang A.; Gould, Cathryn M.; Chalk, Alistair M.; Taylor, Scott; Lackovic, Kurt; Karlström, Åsa; Mutsaers, Anthony J.; Desai, Jayesh; Madhamshettiwar, Piyush B.; Zannettino, Andrew CW.; Burns, Chris; Huang, David CS.; Dyer, Michael A.; Simpson, Kaylene J.; Walkley, Carl R.
2015-01-01
Purpose Osteosarcoma (OS) is the most common cancer of bone occurring mostly in teenagers. Despite rapid advances in our knowledge of the genetics and cell biology of OS, significant improvements in patient survival have not been observed. The identification of effective therapeutics has been largely empirically based. The identification of new therapies and therapeutic targets are urgently needed to enable improved outcomes for OS patients. Experimental Design We have used genetically engineered murine models of human OS in a systematic, genome wide screen to identify new candidate therapeutic targets. We performed a genome wide siRNA screen, with or without doxorubicin. In parallel a screen of therapeutically relevant small molecules was conducted on primary murine and primary human OS derived cell cultures. All results were validated across independent cell cultures and across human and mouse OS. Results The results from the genetic and chemical screens significantly overlapped, with a profound enrichment of pathways regulated by PI3K and mTOR pathways. Drugs that concurrently target both PI3K and mTOR were effective at inducing apoptosis in primary OS cell cultures in vitro in both human and mouse OS, while specific PI3K or mTOR inhibitors were not effective. The results were confirmed with siRNA and small molecule approaches. Rationale combinations of specific PI3K and mTOR inhibitors could recapitulate the effect on OS cell cultures. Conclusions The approaches described here have identified dual inhibition of the PI3K/mTOR pathway as a sensitive, druggable target in OS and provide rationale for translational studies with these agents. PMID:25862761
Hyperlipidemia affects multiscale structure and strength of murine femur.
Ascenzi, Maria-Grazia; Lutz, Andre; Du, Xia; Klimecky, Laureen; Kawas, Neal; Hourany, Talia; Jahng, Joelle; Chin, Jesse; Tintut, Yin; Nackenhors, Udo; Keyak, Joyce
2014-07-18
To improve bone strength prediction beyond limitations of assessment founded solely on the bone mineral component, we investigated the effect of hyperlipidemia, present in more than 40% of osteoporotic patients, on multiscale structure of murine bone. Our overarching purpose is to estimate bone strength accurately, to facilitate mitigating fracture morbidity and mortality in patients. Because (i) orientation of collagen type I affects, independently of degree of mineralization, cortical bone׳s micro-structural strength; and, (ii) hyperlipidemia affects collagen orientation and μCT volumetric tissue mineral density (vTMD) in murine cortical bone, we have constructed the first multiscale finite element (mFE), mouse-specific femoral model to study the effect of collagen orientation and vTMD on strength in Ldlr(-/-), a mouse model of hyperlipidemia, and its control wild type, on either high fat diet or normal diet. Each µCT scan-based mFE model included either element-specific elastic orthotropic properties calculated from collagen orientation and vTMD (collagen-density model) by experimentally validated formulation, or usual element-specific elastic isotropic material properties dependent on vTMD-only (density-only model). We found that collagen orientation, assessed by circularly polarized light and confocal microscopies, and vTMD, differed among groups and that microindentation results strongly correlate with elastic modulus of collagen-density models (r(2)=0.85, p=10(-5)). Collagen-density models yielded (1) larger strains, and therefore lower strength, in simulations of 3-point bending and physiological loading; and (2) higher correlation between mFE-predicted strength and 3-point bending experimental strength, than density-only models. This novel method supports ongoing translational research to achieve the as yet elusive goal of accurate bone strength prediction. Copyright © 2014 Elsevier Ltd. All rights reserved.
Hu, Bin; Tommasini, Steven M.; Courtland, Hayden-William; Price, Christopher; Terranova, Carl J.; Nadeau, Joseph H.
2007-01-01
We examined femora from adult AXB/BXA recombinant inbred (RI) mouse strains to identify skeletal traits that are functionally related and to determine how functional interactions among these traits contribute to genetic variability in whole-bone stiffness, strength, and toughness. Randomization of A/J and C57BL/6J genomic regions resulted in each adult male and female RI strain building mechanically functional femora by assembling unique sets of morphologic and tissue-quality traits. A correlation analysis was conducted using the mean trait values for each RI strain. A third of the 66 correlations examined were significant, indicating that many bone traits covaried or were functionally related. Path analysis revealed important functional interactions among bone slenderness, cortical thickness, and tissue mineral density. The path coefficients describing these functional relations were similar for both sexes. The causal relationship among these three traits suggested that cellular processes during growth simultaneously regulate bone slenderness, cortical thickness, and tissue mineral density so that the combination of traits is sufficiently stiff and strong to satisfy daily loading demands. A disadvantage of these functional interactions was that increases in tissue mineral density also deleteriously affected tissue ductility. Consequently, slender bones with high mineral density may be stiff and strong but they are also brittle. Thus, genetically randomized mouse strains revealed a basic biological paradigm that allows for flexibility in building bones that are functional for daily activities but that creates preferred sets of traits under extreme loading conditions. Genetic or environmental perturbations that alter these functional interactions during growth would be expected to lead to loss of function and suboptimal adult bone quality. PMID:17557179
NASA Astrophysics Data System (ADS)
Cheng, Lijia; Duan, Xin; Xiang, Zhou; Shi, Yujun; Lu, Xiaofeng; Ye, Feng; Bu, Hong
2012-12-01
Many studies have shown that calcium phosphate ceramics (CP) have osteoconductive and osteoinductive properties; however, the exact mechanism of bone induction has not yet been reported. This study was performed to investigate if destroying immunological function will influence osteogenesis, to explain the mechanism which is unclear. In this study, twenty C57BL/6 mice were divided into two groups (n = 10), in group 1, a hydroxyapatite/β-tricalcium phosphate (HA/β-TCP) ceramic was implanted into both the left and right leg muscles of each mouse; in group 2, ten mice experienced lethal irradiation, then were injected bone marrow (BM) cells from green fluorescent protein (GFP) transgenic mice by tail veil, after bone marrow transplantation (BMT), heart, liver, spleen, lung, kidney, and muscle were harvested for biological analysis, after the GFP chimera model was established successfully, the same HA/β-TCP ceramic was implanted into both leg muscles of each mouse immediately after irradiation. 45 and 90 days after implantation, the ceramics of the two groups were harvested to perform with hematoxylin and eosin (HE) and immunohistochemistry (IHC) staining; the results showed that there was no bone formation in group 2, while new bone tissues were detected in group 1. Our findings suggest that the BM cell from GFP transgenic mice is a good biomarker and it could set a good platform for chimera model; it also shows that BM cell is one of cell resources of bone induction, and destruction of immune function will impede osteoinduction by CP. Overall, our results may shed light on clear mechanism study of bone induction in the future.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsuji, Takehito; Kondo, Eri; Yasoda, Akihiro
2008-11-07
Long bone abnormality (lbab/lbab) is a spontaneous mutant mouse characterized by dwarfism with shorter long bones. A missense mutation was reported in the Nppc gene, which encodes C-type natriuretic peptide (CNP), but it has not been confirmed whether this mutation is responsible for the dwarf phenotype. To verify that the mutation causes the dwarfism of lbab/lbab mice, we first investigated the effect of CNP in lbab/lbab mice. By transgenic rescue with chondrocyte-specific expression of CNP, the dwarf phenotype in lbab/lbab mice was completely compensated. Next, we revealed that CNP derived from the lbab allele retained only slight activity to inducemore » cGMP production through its receptor. Histological analysis showed that both proliferative and hypertrophic zones of chondrocytes in the growth plate of lbab/lbab mice were markedly reduced. Our results demonstrate that lbab/lbab mice have a hypomorphic mutation in the Nppc gene that is responsible for dwarfism caused by impaired endochondral ossification.« less
Walker, Marquis T.; Montell, Craig
2016-01-01
Mucolipidosis IV (MLIV) is a severe lysosomal storage disorder, which results from loss of the TRPML1 channel. MLIV causes multiple impairments in young children, including severe motor deficits. Currently, there is no effective treatment. Using a Drosophila MLIV model, we showed previously that introduction of trpml+ in phagocytic glia rescued the locomotor deficit by removing early dying neurons, thereby preventing amplification of neuronal death from cytotoxicity. Because microglia, which are phagocytic cells in the mammalian brain, are bone marrow derived, and cross the blood–brain barrier, we used a mouse MLIV model to test the efficacy of bone marrow transplantation (BMT). We found that BMT suppressed the reduced myelination and the increased caspase-3 activity due to loss of TRPML1. Using a rotarod test, we demonstrated that early BMT greatly delayed the motor impairment in the mutant mice. These data offer the possibility that BMT might provide the first therapy for MLIV. PMID:27270598
Inflammatory arthritis increases mouse osteoclast precursors with myeloid suppressor function
Charles, Julia F.; Hsu, Lih-Yun; Niemi, Erene C.; Weiss, Arthur; Aliprantis, Antonios O.; Nakamura, Mary C.
2012-01-01
Increased osteoclastic bone resorption leads to periarticular erosions and systemic osteoporosis in RA patients. Although a great deal is known about how osteoclasts differentiate from precursors and resorb bone, the identity of an osteoclast precursor (OCP) population in vivo and its regulatory role in RA remains elusive. Here, we report the identification of a CD11b–/loLy6Chi BM population with OCP activity in vitro and in vivo. These cells, which can be distinguished from previously characterized precursors in the myeloid lineage, display features of both M1 and M2 monocytes and expand in inflammatory arthritis models. Surprisingly, in one mouse model of RA (adoptive transfer of SKG arthritis), cotransfer of OCP with SKG CD4+ T cells diminished inflammatory arthritis. Similar to monocytic myeloid-derived suppressor cells (M-MDSCs), OCPs suppressed CD4+ and CD8+ T cell proliferation in vitro through the production of NO. This study identifies a BM myeloid precursor population with osteoclastic and T cell–suppressive activity that is expanded in inflammatory arthritis. Therapeutic strategies that prevent the development of OCPs into mature bone-resorbing cells could simultaneously prevent bone resorption and generate an antiinflammatory milieu in the RA joint. PMID:23114597
Bone marrow adipocytes as negative regulators of the hematopoietic microenvironment
Naveiras, Olaia; Nardi, Valentina; Wenzel, Pamela L.; Fahey, Frederic; Daley, George Q.
2009-01-01
Osteoblasts and endothelium constitute functional niches that support hematopoietic stem cells (HSC) in mammalian bone marrow (BM) 1,2,3 . Adult BM also contains adipocytes, whose numbers correlate inversely with the hematopoietic activity of the marrow. Fatty infiltration of hematopoietic red marrow follows irradiation or chemotherapy and is a diagnostic feature in biopsies from patients with marrow aplasia 4. To explore whether adipocytes influence hematopoiesis or simply fill marrow space, we compared the hematopoietic activity of distinct regions of the mouse skeleton that differ in adiposity. By flow cytometry, colony forming activity, and competitive repopulation assay, HSCs and short-term progenitors are reduced in frequency in the adipocyte-rich vertebrae of the mouse tail relative to the adipocyte-free vertebrae of the thorax. In lipoatrophic A-ZIP/F1 “fatless” mice, which are genetically incapable of forming adipocytes8, and in mice treated with the PPARγ inhibitor Bisphenol-A-DiGlycidyl-Ether (BADGE), which inhibits adipogenesis9, post-irradiation marrow engraftment is accelerated relative to wild type or untreated mice. These data implicate adipocytes as predominantly negative regulators of the bone marrow microenvironment, and suggest that antagonizingmarrow adipogenesis may enhance hematopoietic recovery in clinical bone marrow transplantation. PMID:19516257
Vos, Maarten; Tökési, Károly; Benkö, Ilona
2013-06-01
Electron Rutherford backscattering (ERBS) is a new technique that could be developed into a tool for materials analysis. Here we try to establish a methodology for the use of ERBS for materials analysis of more complex samples using bone minerals as a test case. For this purpose, we also studied several reference samples containing Ca: calcium carbonate (CaCO(3)) and hydroxyapatite and mouse bone powder. A very good understanding of the spectra of CaCO(3) and hydroxyapatite was obtained. Quantitative interpretation of the bone spectrum is more challenging. A good fit of these spectra is only obtained with the same peak widths as used for the hydroxyapatite sample, if one allows for the presence of impurity atoms with a mass close to that of Na and Mg. Our conclusion is that a meaningful interpretation of spectra of more complex samples in terms of composition is indeed possible, but only if widths of the peaks contributing to the spectra are known. Knowledge of the peak widths can either be developed by the study of reference samples (as was done here) or potentially be derived from theory.
Pre-existing periodontitis exacerbates experimental arthritis in a mouse model.
Cantley, Melissa D; Haynes, David R; Marino, Victor; Bartold, P Mark
2011-06-01
Previous studies have shown a higher incidence of alveolar bone loss in patients with rheumatoid arthritis (RA) and that patients with periodontitis are at a greater risk of developing RA. The aim of this study was to develop an animal model to assess the relationship between pre-existing periodontitis and experimental arthritis (EA). Periodontitis was first induced in mice by oral gavage with Porphyromonas gingivalis followed by EA using the collagen antibody-induced arthritis model. These animals were compared with animals with periodontitis alone, EA alone and no disease (controls). Visual changes in paw swelling were assessed to determine clinical development of EA. Alveolar bone and joint changes were assessed using micro-CT, histological analyses and immunohistochemistry. Serum levels of C-reactive protein were used to monitor systemic inflammation. Mice with pre-existing periodontitis developed more severe arthritis, which developed at a faster rate. Mice with periodontitis only also showed evidence of loss of bone within the radiocarpal joint. There was also evidence of alveolar bone loss in mice with EA alone. The results of this study indicate that pre-existing periodontitis exacerbated experimental arthritis in a mouse model. © 2011 John Wiley & Sons A/S.
Mendonça, Maira L.; Batista, Sérgio L.; Nogueira-Barbosa, Marcello H.; Salmon, Carlos E.G.; de Paula, Francisco J.A.
2016-01-01
OBJECTIVES: Bone marrow adipose tissue has been associated with low bone mineral density. However, no data exist regarding marrow adipose tissue in primary hyperparathyroidism, a disorder associated with bone loss in conditions of high bone turnover. The objective of the present study was to investigate the relationship between marrow adipose tissue, bone mass and parathyroid hormone. The influence of osteocalcin on the homeostasis model assessment of insulin resistance was also evaluated. METHODS: This was a cross-sectional study conducted at a university hospital, involving 18 patients with primary hyperparathyroidism (PHPT) and 21 controls (CG). Bone mass was assessed by dual-energy x-ray absorptiometry and marrow adipose tissue was assessed by 1H magnetic resonance spectroscopy. The biochemical evaluation included the determination of parathyroid hormone, osteocalcin, glucose and insulin levels. RESULTS: A negative association was found between the bone mass at the 1/3 radius and parathyroid hormone levels (r = -0.69; p<0.01). Marrow adipose tissue was not significantly increased in patients (CG = 32.8±11.2% vs PHPT = 38.6±12%). The serum levels of osteocalcin were higher in patients (CG = 8.6±3.6 ng/mL vs PHPT = 36.5±38.4 ng/mL; p<0.005), but no associations were observed between osteocalcin and insulin or between insulin and both marrow adipose tissue and bone mass. CONCLUSION: These results suggest that the increment of adipogenesis in the bone marrow microenvironment under conditions of high bone turnover due to primary hyperparathyroidism is limited. Despite the increased serum levels of osteocalcin due to primary hyperparathyroidism, these patients tend to have impaired insulin sensitivity. PMID:27626477
Primary telangiectatic osteosarcoma of occipital bone: a case report and review of literature.
Patibandla, Mohana Rao; Uppin, Shantveer G; Thotakura, Amit Kumar; Panigrahi, Manas K; Challa, Sundaram
2011-01-01
Telangiectatic osteosarcoma (TOS), an uncommon variant of osteosarcoma, involving skull bones is extremely rare. We present clinico-pathological, imageological and treatment outcome of a primary TOS of occipital bone in a 30-year-old woman and review the previously reported skull bone TOS. We suggest that TOS should be included in the differential diagnosis of destructive lytic lesions involving the skull bones. As radical surgical procedures are not applicable to skull bones, the outcome is poor even with adjuvant chemotherapy.
ZIP4 silencing improves bone loss in pancreatic cancer
Yang, Jingxuan; Ding, Hao; LeBrun, Drake; Ding, Kai; Houchen, Courtney W.; Postier, Russell G.; Ambrose, Catherine G.; Li, Zhaoshen; Bi, Xiaohong; Li, Min
2015-01-01
Metabolic bone disorders are associated with several types of human cancers. Pancreatic cancer patients usually suffer from severe nutrition deficiency, muscle wasting, and loss of bone mass. We have previously found that silencing of a zinc transporter ZIP4 prolongs the survival and reduces the severity of the cachexia in vivo. However, the role of ZIP4 in the pancreatic cancer related bone loss remains unknown. In this study we investigated the effect of ZIP4 knockdown on the bone structure, composition and mechanical properties of femurs in an orthotopic xenograft mouse model. Our data showed that silencing of ZIP4 resulted in increased bone tissue mineral density, decreased bone crystallinity and restoration of bone strength through the RANK/RANKL pathway. The results further support the impact of ZIP4 on the progression of pancreatic cancer, and suggest its potential significance as a therapeutic target for treating patients with such devastating disease and cancer related disorders. PMID:26305676
A rare case of primary bone lymphoma mimicking a pelvic abscess
Al Wattar, BH; Mohanty, K
2011-01-01
Primary bone lymphoma (PBL) is a rare, malignant, neoplastic disorder of the skeleton that accounts for less than 5% of all primary bone tumours. We present an extremely rare case of PBL mimicking a pelvic abscess around the sacroiliac joint, which has never been reported in the medical literature, and discuss learning points highlighted from this case. PMID:22004625
Gronowicz, Gloria; Jacobs, Emily; Peng, Tao; Zhu, Li; Hurley, Marja; Kuhn, Liisa T
2017-12-01
A drug delivery coating for synthetic bone grafts has been developed to provide sequential delivery of multiple osteoinductive factors to better mimic aspects of the natural regenerative process. The coating is composed of a biomimetic calcium phosphate (bCaP) layer that is applied to a synthetic bone graft and then covered with a poly-l-Lysine/poly-l-Glutamic acid polyelectrolyte multilayer (PEM) film. Bone morphogenetic protein-2 (BMP-2) was applied before the coating process directly on the synthetic bone graft and then, bCaP-PEM was deposited followed by adsorption of fibroblast growth factor-2 (FGF-2) into the PEM layer. Cells access the FGF-2 immediately, while the bCaP-PEM temporally delays the cell access to BMP-2. In vitro studies with cells derived from mouse calvarial bones demonstrated that Sca-1 and CD-166 positive osteoblast progenitor cells proliferated in response to media dosing with FGF-2. Coated scaffolds with BMP-2 and FGF-2 were implanted in mouse calvarial bone defects and harvested at 1 and 3 weeks. After 1 week in vivo, proliferation of cells, including Sca-1+ progenitors, was observed with low dose FGF-2 and BMP-2 compared to BMP-2 alone, indicating that in vivo delivery of FGF-2 activated a similar population of cells as shown by in vitro testing. At 3 weeks, FGF-2 and BMP-2 delivery increased bone formation more than BMP-2 alone, particularly in the center of the defect, confirming that the proliferation of the Sca-1 positive osteoprogenitors by FGF-2 was associated with increased bone healing. Areas of bone mineralization were positive for double fluorochrome labeling of calcium and alkaline phosphatase staining of osteoblasts, along with increased TRAP+ osteoclasts, demonstrating active bone formation distinct from the bone-like collagen/hydroxyapatite scaffold. In conclusion, the addition of a bCaP layer to PEM delayed access to BMP-2 and allowed the FGF-2 stimulated progenitors to populate the scaffold before differentiating in response to BMP-2, leading to improved bone defect healing.
Igarashi, Kentaro; Kawaguchi, Kei; Kiyuna, Tasuku; Murakami, Takashi; Yamamoto, Norio; Hayashi, Katsuhiro; Kimura, Hiroaki; Miwa, Shinji; Tsuchiya, Hiroyuki; Hoffman, Robert M
2017-03-01
We have previously reported that caffeine can enhance chemotherapy efficacy of bone and soft tissue sarcoma via cell-cycle perturbation. Valproic acid has histone deacetylase (HDAC) inhibitory activity. We have also reported the anti-tumor efficacy of combination treatment with caffeine and valproic acid against osteosarcoma primary tumors in a cell-line orthotopic mouse model. In this study, we performed combination treatment of caffeine and valproic acid on osteosarcoma cell lines in vitro and in spontaneous and experimental lung metastasis mouse models of osteosarcoma. Survival of 143B-RFP human osteosarcoma cells after exposure to caffeine and valproic acid for 72 hours was determined using the WST-8 assay. IC 50 values and combination indices were calculated. Mouse models of primary osteosarcoma and spontaneous lung metastasis were obtained by orthotopic intra-tibial injection of 143B-RFP cells. Valproic acid, caffeine, and combination of both drugs were administered from day 7, five times a week, for four weeks. Six weeks after orthotopic injection, lung samples were excised and observed with a fluorescence imaging system. A mouse model of experimental lung metastasis was obtained by tail vein injection of 143B-RFP cells. The mice were treated with these agents from day 0, five times a week for four weeks. Both caffeine and valproic acid caused concentration-dependent cell kill in vitro. Synergistic efficacy of the combination treatment was observed. In the spontaneous lung-metastasis model, the number of lung metastasis was 9.0±2.6 in the untreated group (G1); 10.8±2.9 in the caffeine group (G2); 10.0±3.1 in the valproic-acid group (G3); and 3.0±1.1 in the combination group (G4); (p=6.78E-5 control vs. combination; p=0.006 valproic acid vs. combination; p=0.003 caffeine vs. combination). In the experimental lung-metastasis model, the combination group significantly reduced lung metastases and improved overall survival (p=0.0005). Efficacy of the combination of caffeine and valproic acid was observed in vitro and in spontaneous and experimental lung-metastasis mouse models of osteosarcoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Primary bone tumors of adulthood
Teo, Harvey E L; Peh, Wilfred C G
2004-01-01
Imaging plays a crucial role in the evaluation of primary bone tumors in adults. Initial radiographic evaluation is indicated in all cases with suspected primary bone tumors. Radiographs are useful for providing the diagnosis, a short list of differential diagnosis or at least indicating the degree of aggressiveness of the lesion. More detailed information about the lesion, such as cortical destruction or local spread, can be obtained using cross-sectional imaging techniques such as computed tomography and magnetic resonance imaging. This article discusses the characteristic features of the more common primary bone tumors of adulthood, and also the pre-treatment evaluation and staging of these lesions using imaging techniques. PMID:18250012
Taiani, J T; Buie, H R; Campbell, G M; Manske, S L; Krawetz, R J; Rancourt, D E; Boyd, S K; Matyas, J R
2014-07-01
In the current study, we used an estrogen-deficient mouse model of osteoporosis to test the efficacy of a cell-generated bone tissue construct for bone augmentation of an impaired healing fracture. A reduction in new bone formation at the defect site was observed in ovariectomized fractures compared to the control group using repeated measures in vivo micro-computed tomography (μCT) imaging over 4 weeks. A significant increase in the bone mineral density (BMD), trabecular bone volume ratio, and trabecular number, thickness and connectivity were associated with fracture repair in the control group, whereas the fractured bones of the ovariectomized mice exhibited a loss in all of these parameters (p<0.001). In a separate group, ovariectomized fractures were treated with murine embryonic stem (ES) cell-derived osteoblasts loaded in a three-dimensional collagen I gel and recovery of the bone at the defect site was observed. A significant increase in the trabecular bone volume ratio (p<0.001) and trabecular number (p<0.01) was observed by 4 weeks in the fractures treated with cell-loaded collagen matrix compared to those treated with collagen I alone. The stem cell-derived osteoblasts were identified at the fracture site at 4 weeks post-implantation through in situ hybridization histochemistry. Although this cell tracking method was effective, the formation of an ectopic cellular nodule adjacent to the knee joints of two mice suggested that alternative in vivo cell tracking methods should be employed in order to definitively assess migration of the implanted cells. To our knowledge, this study is the first of its kind to examine the efficacy of stem cell therapy for fracture repair in an osteoporosis-related fracture model in vivo. The findings presented provide novel insight into the use of stem cell therapies for bone injuries. Copyright © 2014 Elsevier Inc. All rights reserved.
Hsu, Jui-Ting; Fuh, Lih-Jyh; Tu, Ming-Gene; Li, Yu-Fen; Chen, Kuan-Ting; Huang, Heng-Li
2013-04-01
This study investigated how the primary stability of a dental implant as measured by the insertion torque value (ITV), Periotest value (PTV), and implant stability quotient (ISQ) is affected by varying thicknesses of cortical bone and strengths of trabecular bone using synthetic bone models. Four synthetic cortical shells (with thicknesses of 0, 1, 2, and 3 mm) were attached to four cellular rigid polyurethane foams (with elastic moduli of 137, 47.5, 23, and 12.4 MPa) and one open-cell rigid polyurethane foam which mimic the osteoporotic bone (with an elastic modulus 6.5 MPa), to represent the jawbones with various cortical bone thicknesses and strengths of trabecular bone. A total of 60 bone specimens accompanied with implants was examined by a torque meter, Osstell resonance frequency analyzer, and Periotest electronic device. All data were statistically analyzed by two-way analysis of variance. In addition, second-order nonlinear regression was utilized to assess the correlations of the primary implant stability with the four cortex thicknesses and five strengths of trabecular bone. ITV, ISQ, and PTV differed significantly (p < .05) and were strongly correlated with the thickness of cortical bone (R(2) > 0.9) and the elastic modulus of trabecular bone (R(2) = 0.74-0.99). The initial stability at the time of implant placement is influenced by both the cortical bone thickness and the strength of trabecular bone; however, these factors are mostly nonlinearly correlated with ITV, PTV, and ISQ. Using ITV and PTV seems more suitable for identifying the primary implant stability in osteoporotic bone with a thin cortex. © 2011 Wiley Periodicals, Inc.
Applications of Transgenics in Studies of Bone Sialoprotein
Zhang, Jin; Tu, Qisheng; Chen, Jake
2010-01-01
Bone sialoprotein (BSP) is a major non-collagenous protein in mineralizing connective tissues such as dentin, cementum and calcified cartilage tissues. As a member of the SIBLING (Small Integrin-Binding Ligand, N-linked Glycoprotein) gene family of glycoproteins, BSP is involved in regulating hydroxyapatite crystal formation in bones and teeth, and has long been used as a marker gene for osteogenic differentiation. In the most recent decade, new discoveries in BSP gene expression and regulation, bone remodeling, bone metastasis, and bone tissue engineering have been achieved with the help of transgenic mice. In this review, we discuss these new discoveries obtained from the literatures and from our own laboratory, which were derived from the use of transgenic mouse mutants related to BSP gene or its promoter activity. PMID:19326395
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hashimoto, Ryota, E-mail: hryota@juntendo.ac.jp; Katoh, Youichi, E-mail: katoyo@juntendo-urayasu.jp; Nakamura, Kyoko
2012-07-13
Highlights: Black-Right-Pointing-Pointer High [Ca{sup 2+}]{sub o} enhances adipocyte accumulation in the presence of adipogenic inducers. Black-Right-Pointing-Pointer High [Ca{sup 2+}]{sub o} enhances both proliferation and adipocyte differentiation in BMSCs. Black-Right-Pointing-Pointer High [Ca{sup 2+}]{sub o} induces an increase in [Ca{sup 2+}]{sub o} in BMSCs. Black-Right-Pointing-Pointer An intracellular Ca{sup 2+} chelator suppresses the enhancement in adipocyte accumulation. Black-Right-Pointing-Pointer Controlling [Ca{sup 2+}]{sub o} may govern the balance of adipocyte and osteoblast development. -- Abstract: The bone marrow stroma contains osteoblasts and adipocytes that have a common precursor: the pluripotent mesenchymal stem cell found in bone marrow stromal cells (BMSCs). Local bone marrow Ca{sup 2+}more » levels can reach high concentrations due to bone resorption, which is one of the notable features of the bone marrow stroma. Here, we describe the effects of high [Ca{sup 2+}]{sub o} on the accumulation of adipocytes in the bone marrow stroma. Using primary mouse BMSCs, we evaluated the level of adipocyte accumulation by measuring Oil Red O staining and glycerol-3-phosphate dehydrogenase (GPDH) activity. High [Ca{sup 2+}]{sub o} enhanced the accumulation of adipocytes following treatment with both insulin and dexamethasone together but not in the absence of this treatment. This enhanced accumulation was the result of both the accelerated proliferation of BMSCs and their differentiation into adipocytes. Using the fura-2 method, we also showed that high [Ca{sup 2+}]{sub o} induces an increase in [Ca{sup 2+}]{sub i}. An intracellular Ca{sup 2+} chelator suppressed the enhancement in adipocyte accumulation due to increased [Ca{sup 2+}]{sub o} in BMSCs. These data suggest a new role for extracellular Ca{sup 2+} in the bone marrow stroma: increased [Ca{sup 2+}]{sub o} induces an increase in [Ca{sup 2+}]{sub i} levels, which in turn enhances the accumulation of adipocytes under certain conditions.« less
2011-10-01
GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007
Abbott, Christina; Huang, Guo; Ellison, Aaron R; Chen, Ching; Arora, Taruna; Szilvassy, Stephen J; Wei, Ping
2010-04-01
Mouse monoclonal antibodies (MAbs) against human c-Mpl, the cognate receptor for thrombopoietin (TPO), were generated using hybridoma technology and characterized by various assays to demonstrate their specificity and affinity. Two such MAbs, 1.6 and 1.75, were determined to be superior for flow cytometry studies and exhibited double-digit picomolar (pM) affinities to soluble human c-Mpl protein. Both MAbs specifically bound to cells engineered to overexpress human c-Mpl protein, immortalized human hematopoietic cell lines that express endogenous c-Mpl, primary human bone marrow and peripheral blood-derived CD34(+) cells, and purified human platelets. No binding was detected on cell lines that did not express c-Mpl. Receptor competition and siRNA knock-down studies further confirmed the specificity of antibodies 1.6 and 1.75 for human c-Mpl. In contrast to these newly generated MAbs, none of eight commercially available anti-c-Mpl antibodies tested were found to bind specifically to human c-Mpl and were thus shown to be unsuitable for flow cytometry studies. Monoclonal antibodies 1.6 and 1.75 will therefore be useful flow cytometry reagents to detect cell surface c-Mpl expression.
Folate-targeted nanoparticles show efficacy in the treatment of inflammatory arthritis
Thomas, Thommey P.; Goonewardena, Sascha N.; Majoros, Istvan; Kotlyar, Alina; Cao, Zhengyi; Leroueil, Pascale R.; Baker, James R.
2011-01-01
Objective To investigate the uptake of a poly(amidoamine) dendrimer (generation 5 (G5)) nanoparticle covalently conjugated to polyvalent folic acid (FA) as the targeting ligand into macrophages, and the activity of a FA- and methotrexate-conjugated dendrimer (G5-FA-MTX) as a therapeutic for the inflammatory disease of arthritis. Methods In vitro studies were performed in macrophage cell lines and in isolated mouse macrophages to check the cellular uptake of fluorescently tagged G5-FA nanoparticles, using flow cytometry and confocal microscopy. In vivo studies were conducted in a rat model of collagen-induced arthritis to evaluate the therapeutic potential of G5-FA-MTX. Results Folate targeted dendrimer bound and internalized in a receptor-specific manner into both folate receptor β-expressing macrophage cell lines and primary mouse macrophages. The G5-FA-MTX acts as a potent anti-inflammatory agent and reduces arthritis-induced inflammatory parameters such as ankle swelling, paw volume, cartilage damage, bone resorption and body weight decrease. Conclusion The use of folate-targeted nanoparticles to specifically target MTX into macrophages may provide an effective clinical approach for anti-inflammatory therapy in rheumatoid arthritis. PMID:21618461
Cancer-associated bone disease.
Rizzoli, R; Body, J-J; Brandi, M-L; Cannata-Andia, J; Chappard, D; El Maghraoui, A; Glüer, C C; Kendler, D; Napoli, N; Papaioannou, A; Pierroz, D D; Rahme, M; Van Poznak, C H; de Villiers, T J; El Hajj Fuleihan, G
2013-12-01
Bone is commonly affected in cancer. Cancer-induced bone disease results from the primary disease, or from therapies against the primary condition, causing bone fragility. Bone-modifying agents, such as bisphosphonates and denosumab, are efficacious in preventing and delaying cancer-related bone disease. With evidence-based care pathways, guidelines assist physicians in clinical decision-making. Of the 57 million deaths in 2008 worldwide, almost two thirds were due to non-communicable diseases, led by cardiovascular diseases and cancers. Bone is a commonly affected organ in cancer, and although the incidence of metastatic bone disease is not well defined, it is estimated that around half of patients who die from cancer in the USA each year have bone involvement. Furthermore, cancer-induced bone disease can result from the primary disease itself, either due to circulating bone resorbing substances or metastatic bone disease, such as commonly occurs with breast, lung and prostate cancer, or from therapies administered to treat the primary condition thus causing bone loss and fractures. Treatment-induced osteoporosis may occur in the setting of glucocorticoid therapy or oestrogen deprivation therapy, chemotherapy-induced ovarian failure and androgen deprivation therapy. Tumour skeletal-related events include pathologic fractures, spinal cord compression, surgery and radiotherapy to bone and may or may not include hypercalcaemia of malignancy while skeletal complication refers to pain and other symptoms. Some evidence demonstrates the efficacy of various interventions including bone-modifying agents, such as bisphosphonates and denosumab, in preventing or delaying cancer-related bone disease. The latter includes treatment of patients with metastatic skeletal lesions in general, adjuvant treatment of breast and prostate cancer in particular, and the prevention of cancer-associated bone disease. This has led to the development of guidelines by several societies and working groups to assist physicians in clinical decision making, providing them with evidence-based care pathways to prevent skeletal-related events and bone loss. The goal of this paper is to put forth an IOF position paper addressing bone diseases and cancer and summarizing the position papers of other organizations.
Postradiation atrophy of mature bone
DOE Office of Scientific and Technical Information (OSTI.GOV)
Erguen, H.; Howland, W.J.
1980-01-01
The growing number of oncological patients subjected to radiotherapy require the diagnostic radiologist to be aware of expected bone changes following irradiation and the differentiation of this entity from metastasis. The primary event of radiation damage to bone is atrophy and true necrosis of bone is uncommon. The postradiation atrophic changes of bone are the result of combined cellular and vascular damage, the former being more important. The damage to the osteoblast resulting in decreased matrix production is apparently the primary histopathologic event. Radiation damaged bone is susceptible to superimposed complications of fracture, infection, necrosis, and sarcoma. The primary radiographicmore » evidence of atrophy, localized osteopenia, is late in appearing, mainly because of the relative insensitivity of radiographs in detecting demineralization. Contrary to former views, the mature bone is quite radiosensitive and reacts quickly to even small doses of radiation. In vivo midrodensitometric analysis and radionuclide bone and bone marrow scans can reveal early changes following irradiation. The differentiation of postirradiation atrophy and metastasis may be difficult. Biopsy should be the last resort because of the possibility of causing true necrosis in atrophic bone by trauma and infection.« less
Postradiation atrophy of mature bone
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ergun, H.; Howland, W.J.
1980-01-01
The growing number of oncological patients subjected to radiotherapy require the diagnostic radiologist to be aware of expected bone changes following irradiation and the differentiation of this entity from metastasis. The primary event of radiation damage to bone is atrophy and true necrosis of bone is uncommon. The postradiation atrophic changes of bone are the result of combined cellular and vascular damage, the former being more important. The damage to the osteoblast resulting in decreased matrix production is apparently the primary histopathologic event. Radiation damaged bone is susceptible to superimposed complications of fracture, infection, necrosis, and sarcoma. The primary radiographicmore » evidence of atrophy, localized osteopenia, is late in appearing, mainly because of the relative insensitivity of radiographs in detecing demineralization. Contrary to former views, the mature bone is quite radiosensitive and reacts quickly to even small doses of radiation. In vivo midrodensitometric analysis and radionuclide bone and bone marrow scans can reveal early changes following irradiation. The differentiation of postirradiation atrophy and metastasis may be difficult. Biopsy should be the last resort because of the possibility of causing true necrosis in atrophic bone by trauma and infection.« less
Targeting mast cells in gastric cancer with special reference to bone metastases
Leporini, Christian; Ammendola, Michele; Marech, Ilaria; Sammarco, Giuseppe; Sacco, Rosario; Gadaleta, Cosmo Damiano; Oakley, Caroline; Russo, Emilio; De Sarro, Giovambattista; Ranieri, Girolamo
2015-01-01
Bone metastases from gastric cancer (GC) are considered a relatively uncommon finding; however, they are related to poorer prognosis. Both primary GC and its metastatic progression rely on angiogenesis. Several lines of evidence from GC patients strongly support the involvement of mast cells (MCs) positive to tryptase (MCPT) in primary gastric tumor angiogenesis. Recently, we analyzed infiltrating MCs and neovascularization in bone tissue metastases from primary GC patients, and observed a significant correlation between infiltrating MCPT and angiogenesis. Such a finding suggested the involvement of peritumoral MCPT by infiltrating surrounding tumor cells, and in bone metastasis angiogenesis from primary GC. Thus, an MCPT-stimulated angiogenic process could support the development of metastases in bone tissue. From this perspective, we aim to review the hypothetical involvement of tumor-infiltrating, peritumoral MCPT in angiogenesis-mediated GC cell growth in the bone microenvironment and in tumor-induced osteoclastic bone resorption. We also focus on the potential use of MCPT targeting agents, such as MCs tryptase inhibitors (gabexate mesylate, nafamostat mesylate) or c-KitR tyrosine kinase inhibitors (imatinib, masitinib), as possible new anti-angiogenic and anti-resorptive strategies for the treatment of GC patients affected by bone metastases. PMID:26457010
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.
Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan
2007-04-17
The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, HongBin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan
2007-01-01
Background The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia. PMID:17439653
Takeshita, S; Kikuno, R; Tezuka, K; Amann, E
1993-01-01
A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580
Does the GH/IGF-1 axis contribute to skeletal sexual dimorphism? Evidence from mouse studies.
Liu, Zhongbo; Mohan, Subburaman; Yakar, Shoshana
2016-04-01
The contribution of the gonadotropic axis to skeletal sexual dimorphism (SSD) was clarified in recent years. Studies with animal models of estrogen receptor (ER) or androgen receptor (AR) null mice, as well as mice with bone cell-specific ablation of ER or AR, revealed that both hormones play major roles in skeletal acquisition, and that estrogen regulates skeletal accrual in both sexes. The growth hormone (GH) and its downstream effector, the insulin-like growth factor-1 (IGF-1) are also major determinants of peak bone mass during puberty and young adulthood, and play important roles in maintaining bone integrity during aging. A few studies in both humans and animal models suggest that in addition to the differences in sex steroid actions on bone, sex-specific effects of GH and IGF-1 play essential roles in SSD. However, the contributions of the somatotropic (GH/IGF-1) axis to SSD are controversial and data is difficult to interpret. GH/IGF-1 are pleotropic hormones that act in an endocrine and autocrine/paracrine fashion on multiple tissues, affecting body composition as well as metabolism. Thus, understanding the contribution of the somatotropic axis to SSD requires the use of mouse models that will differentiate between these two modes of action. Elucidation of the relative contribution of GH/IGF-1 axis to SSD is significant because GH is approved for the treatment of normal children with short stature and children with congenital growth disorders. Thus, if the GH/IGF-1 axis determines SSD, treatment with GH may be tailored according to sex. In the following review, we give an overview of the roles of sex steroids in determining SSD and how they may interact with the GH/IGF-1 axis in bone. We summarize several mouse models with impaired somatotropic axis and speculate on the possible contribution of that axis to SSD. Copyright © 2015 Elsevier Ltd. All rights reserved.
Periodontal Defects in the A116T Knock-in Murine Model of Odontohypophosphatasia.
Foster, B L; Sheen, C R; Hatch, N E; Liu, J; Cory, E; Narisawa, S; Kiffer-Moreira, T; Sah, R L; Whyte, M P; Somerman, M J; Millán, J L
2015-05-01
Mutations in ALPL result in hypophosphatasia (HPP), a disease causing defective skeletal mineralization. ALPL encodes tissue nonspecific alkaline phosphatase (ALP), an enzyme that promotes mineralization by reducing inorganic pyrophosphate, a mineralization inhibitor. In addition to skeletal defects, HPP causes dental defects, and a mild clinical form of HPP, odontohypophosphatasia, features only a dental phenotype. The Alpl knockout (Alpl (-/-)) mouse phenocopies severe infantile HPP, including profound skeletal and dental defects. However, the severity of disease in Alpl (-/-) mice prevents analysis at advanced ages, including studies to target rescue of dental tissues. We aimed to generate a knock-in mouse model of odontohypophosphatasia with a primarily dental phenotype, based on a mutation (c.346G>A) identified in a human kindred with autosomal dominant odontohypophosphatasia. Biochemical, skeletal, and dental analyses were performed on the resulting Alpl(+/A116T) mice to validate this model. Alpl(+/A116T) mice featured 50% reduction in plasma ALP activity compared with wild-type controls. No differences in litter size, survival, or body weight were observed in Alpl(+/A116T) versus wild-type mice. The postcranial skeleton of Alpl(+/A116T) mice was normal by radiography, with no differences in femur length, cortical/trabecular structure or mineral density, or mechanical properties. Parietal bone trabecular compartment was mildly altered. Alpl(+/A116T) mice featured alterations in the alveolar bone, including radiolucencies and resorptive lesions, osteoid accumulation on the alveolar bone crest, and significant differences in several bone properties measured by micro-computed tomography. Nonsignificant changes in acellular cementum did not appear to affect periodontal attachment or function, although circulating ALP activity was correlated significantly with incisor cementum thickness. The Alpl(+/A116T) mouse is the first model of odontohypophosphatasia, providing insights on dentoalveolar development and function under reduced ALP, bringing attention to direct effects of HPP on alveolar bone, and offering a new model for testing potential dental-targeted therapies in future studies. © International & American Associations for Dental Research 2015.
Pang, Jian; Ye, Meina; Cao, Yuelong; Zheng, Yuxin; Guo, Hailing; Zhao, Yongfang; Zhan, Hongsheng; Shi, Yinyu
2014-10-09
Objective It is known that bone healing was delayed in the presence of osteoporosis in humans. However, due to the complexities of the healing of osteoporotic fractures, animal models may be more appropriate to study the effects of osteoporosis in more details and to test drugs on the fracture repair process. The purpose of this study was to investigate the influence of ovariectomy-induced osteopenia in bone healing in an open femoral osteotomy model, and to test the feasibility of this model for evaluating the healing process under osteopenic conditions. Methods In assessing the effects of osteopenia on fracture healing, ovariectomized mouse models were employed. A mid-shaft femur osteotomy model was also established 3 weeks after ovariectomy as an osteopenic fracture group (OVX group). Femurs were then harvested at 2 weeks and 6 weeks after fracture for X-ray radiography, micro-computed tomography (micro-CT), histology and biomechanical analysis. A sham-operated group (Sham group) was used for comparison. Results The OVX mice had significantly lower BVF, vBMD and TMD in the fracture calluses at 6 weeks (P < 0.05), and similar trend was observed in 2 weeks. Additionally, larger calluses in OVX animals were observed via micro-CT and X-ray, but these did not result in better healing outcomes as determined by biomechanical test at 6 weeks. Histological images of the healing fractures in the OVX mice found forward of broken end resorption and delay of hard callus remodeling. The impaired biomechanical measurements in the OVX group (P < 0.05) were consistent with micro-CT measurements and radiographic scoring, which also indicated delay in fracture healing of the OVX group. Conclusions This study provided evidences that ovariectomy-induced osteopenia impair the middle and late bone healing process once more. These data also supported the validity of the mouse femoral osteotomy model in evaluating the process of bone healing under osteopenic conditions.
2007-04-01
Teruya, B. Lokensgard, S. Daneshmand, J. Brown, R. J. Gray, et al. 1994. Linkage analysis of the genetic determinants of high density lipoprotein ...and soft tissue function and to clarify the function of these genes. Three hypotheses have been proposed: 1) The high bone density gene in...locus (QTL) that contributes significantly to high bone density on mouse chromosome 1 (Chr. 1) from a cross between C57BL/6J (B6) and CAST/EiJ (CAST
Effect of small and large animal skull bone on photoacoustic signal
NASA Astrophysics Data System (ADS)
Xu, Qiuyun; Volinski, Bridget; Hariri, Ali; Fatima, Afreen; Nasiriavanaki, Mohammadreza
2017-03-01
Photoacoustic imaging (PAI) has proved to be a promising non-invasive technique for diagnosis, prognosis and treatment monitoring of neurological disorders in small and large animals. Skull bone effects both light illumination and ultrasound propagation. Hence, the PA signal is largely affected. This study aims to quantify and compare the attenuation of PA signal due to the skull obstacle in the light illumination path, in the ultrasound propagation path, or in both. The effect of mouse, rat, and mesocephalic dog skull bones, ex-vivo, is quantitatively studied.
Boos, Anja M; Weigand, Annika; Deschler, Gloria; Gerber, Thomas; Arkudas, Andreas; Kneser, Ulrich; Horch, Raymund E; Beier, Justus P
2014-01-01
New therapeutic strategies are required for critical size bone defects, because the gold standard of transplanting autologous bone from an unharmed area of the body often leads to several severe side effects and disadvantages for the patient. For years, tissue engineering approaches have been seeking a stable, axially vascularized transplantable bone replacement suitable for transplantation into the recipient bed with pre-existing insufficient conditions. For this reason, the arteriovenous loop model was developed and various bone substitutes have been vascularized. However, it has not been possible thus far to engineer a primary stable and axially vascularized transplantable bone substitute. For that purpose, a primary stable silica-embedded nanohydroxyapatite (HA) bone substitute in combination with blood, bone marrow, expanded, or directly retransplanted mesenchymal stem cells, recombinant human bone morphogenetic protein 2 (rhBMP-2), and different carrier materials (fibrin, cell culture medium, autologous serum) was tested subcutaneously for 4 or 12 weeks in the sheep model. Autologous serum lead to an early matrix change during degradation of the bone substitute and formation of new bone tissue. The best results were achieved in the group combining mesenchymal stem cells expanded with 60 μg/mL rhBMP-2 in autologous serum. Better ingrowth of fibrovascular tissue could be detected in the autologous serum group compared with the control (fibrin). Osteoclastic activity indicating an active bone remodeling process was observed after 4 weeks, particularly in the group with autologous serum and after 12 weeks in every experimental group. This study clearly demonstrates the positive effects of autologous serum in combination with mesenchymal stem cells and rhBMP-2 on bone formation in a primary stable silica-embedded nano-HA bone grafting material in the sheep model. In further experiments, the results will be transferred to the sheep arteriovenous loop model in order to engineer an axially vascularized primary stable bone replacement in clinically relevant size for free transplantation. PMID:25429218
Conditional Expression of Wnt4 during Chondrogenesis Leads to Dwarfism in Mice
Lee, Hu-Hui; Behringer, Richard R.
2007-01-01
Wnts are expressed in the forming long bones, suggesting roles in skeletogenesis. To examine the action of Wnts in skeleton formation, we developed a genetic system to conditionally express Wnt4 in chondrogenic tissues of the mouse. A mouse Wnt4 cDNA was introduced into the ubiquitously expressed Rosa26 (R26) locus by gene targeting in embryonic stem (ES) cells. The expression of Wnt4 from the R26 locus was blocked by a neomycin selection cassette flanked by loxP sites (floxneo) that was positioned between the Rosa26 promoter and the Wnt4 cDNA, creating the allele designated R26floxneoWnt4. Wnt4 expression was activated during chondrogenesis using Col2a1-Cre transgenic mice that express Cre recombinase in differentiating chondrocytes. R26floxneoWnt4; Col2a1-Cre double heterozygous mice exhibited a growth deficiency, beginning approximately 7 to 10 days after birth, that resulted in dwarfism. In addition, they also had craniofacial abnormalities, and delayed ossification of the lumbar vertebrae and pelvic bones. Histological analysis revealed a disruption in the organization of the growth plates and a delay in the onset of the primary and secondary ossification centers. Molecular studies showed that Wnt4 overexpression caused decreased proliferation and altered maturation of chondrocytes. In addition, R26floxneoWnt4; Col2a1-Cre mice had decreased expression of vascular endothelial growth factor (VEGF). These studies demonstrate that Wnt4 overexpression leads to dwarfism in mice. The data indicate that Wnt4 levels must be regulated in chondrocytes for normal growth plate development and skeletogenesis. Decreased VEGF expression suggests that defects in vascularization may contribute to the dwarf phenotype. PMID:17505543
Chu, Van Trung; Graf, Robin; Wirtz, Tristan; Weber, Timm; Favret, Jeremy; Li, Xun; Petsch, Kerstin; Tran, Ngoc Tung; Sieweke, Michael H; Berek, Claudia; Kühn, Ralf; Rajewsky, Klaus
2016-11-01
Applying clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9)-mediated mutagenesis to primary mouse immune cells, we used high-fidelity single guide RNAs (sgRNAs) designed with an sgRNA design tool (CrispRGold) to target genes in primary B cells, T cells, and macrophages isolated from a Cas9 transgenic mouse line. Using this system, we achieved an average knockout efficiency of 80% in B cells. On this basis, we established a robust small-scale CRISPR-mediated screen in these cells and identified genes essential for B-cell activation and plasma cell differentiation. This screening system does not require deep sequencing and may serve as a precedent for the application of CRISPR/Cas9 to primary mouse cells.
Bruton tyrosine kinase (Btk) suppresses osteoblastic differentiation.
Kaneshiro, Shoichi; Ebina, Kosuke; Shi, Kenrin; Yoshida, Kiyoshi; Otsuki, Dai; Yoshikawa, Hideki; Higuchi, Chikahisa
2015-09-01
The Tec family of nonreceptor tyrosine kinases has been shown to play a key role in inflammation and bone destruction. Bruton tyrosine kinase (Btk) has been the most widely studied because of its critical role in B cells. Furthermore, recent evidence has demonstrated that blocking Btk signaling is effective in ameliorating lymphoma progression and experimental arthritis. The role of Btk in osteoblastic differentiation has not been well elucidated. In this study, we demonstrated the role of Btk in osteoblastic differentiation and investigated the effects of a Btk inhibitor on osteoblastic differentiation in mouse preosteoblastic MC3T3-E1 cells, primary calvarial osteoblasts, and bone marrow stromal ST2 cells. Btk expression was detected in all three cell lines. Btk inhibition stimulated mRNA expression of osteoblastic markers (alkaline phosphatase, osteocalcin, and osterix) and promoted mineralization of the extracellular matrix. In addition, Btk knockdown caused increased mRNA expression of osteoblastic markers. Furthermore, Btk inhibition suppressed the phosphorylation of mitogen-activated protein kinase (MAPK), nuclear factor kappa B (NFκB), and protein kinase Cα (PKCα). Our results indicate that Btk may regulate osteoblastic differentiation through the MAPK, NFκB, and PKCα signaling pathways.
Guo, Jian-Kan; Shi, Hongmei; Koraishy, Farrukh; Marlier, Arnaud; Ding, Zhaowei; Shan, Alan; Cantley, Lloyd G
2013-11-01
Biomedical research often requires primary cultures of specific cell types, which are challenging to obtain at high purity in a reproducible manner. Here we engineered the murine Rosa26 locus by introducing the diphtheria toxin receptor flanked by loxP sites. The resultant strain was nicknamed the Terminator mouse. This approach results in diphtheria toxin-receptor expression in all non-Cre expressing cell types, making these cells susceptible to diphtheria toxin exposure. In primary cultures of kidney cells derived from the Terminator mouse, over 99.99% of cells were dead within 72 h of diphtheria toxin treatment. After crossing the Terminator with the podocin-Cre (podocyte specific) mouse or the Ggt-Cre (proximal tubule specific) mouse, diphtheria toxin treatment killed non-Cre expressing cells but spared podocytes and proximal tubule cells, respectively, enriching the primary cultures to over 99% purity, based on both western blotting and immunostaining of marker proteins. Thus, the Terminator mouse can be a useful tool to selectively and reproducibly obtain even low-abundant cell types at high quantity and purity.
Primary Ewing's Sarcoma of the temporal bone in an infant.
Goudarzipour, Kourosh; Shamsian, Shahin; Alavi, Samin; Nourbakhsh, Kazem; Aghakhani, Roxana; Eydian, Zahra; Arzanian, Mohammad Taghi
2015-04-01
Introduction : Ewing's sarcoma is the second most common primary malignant tumor of bone found in children after Osteosarcoma. It accounts for 4-9% of primary malignant bone tumors and it affects bones of the skull or face in only 1-4% of cases. Hence it rarely affects the head and neck. Subject and Method : In this case report, we describe a case of primary Ewing's sarcoma occurring in the temporal bone. The tumor was surgically excised, and the patient underwent chemotherapy for ten months. Results : Neither recurrence nor distant metastasis was noted in these 10 months after surgery but about 18 months after surgery our patient was expired. Conclusion : Although the prognosis of Ewing's sarcoma is generally poor because of early metastasis to the lungs and to other bones, a review of the article suggested that Ewing's sarcoma occurring in the skull can often be successfully managed by intensive therapy with radical excision and chemotherapy. This result was supported by the case reported here.
Endochondral bone formation in embryonic mouse pre-metatarsals
NASA Technical Reports Server (NTRS)
Klement, B. J.; Spooner, B. S.
1992-01-01
Long term exposure to a reduced gravitational environment has a deleterious effect on bone. The developmental events which occur prior to initial bone deposition will provide insight into the regulation of mature bone physiology. We have characterized a system in which the events preceding bone formation take place in an isolated in vitro organ culture environment. We show that cultured pre-metatarsal tissue parallels development of pre-metatarsal tissue in the embryo. Both undergo mesenchyme differentiation and morphogenesis to form a cartilage rod, which resembles the future bone, followed by terminal chondrocyte differentiation in a definite morphogenetic pattern. These sequential steps occur prior to osteoblast maturation and bone matrix deposition in the developing organism. Alkaline phosphatase (ALP) activity is a distinctive enzymatic marker for mineralizing tissues. We have measured this activity throughout pre-metatarsal development and show (a) where in the tissue it is predominantly found, and (b) that this is indeed the mineralizing isoform of the enzyme.
Osteogenesis Imperfecta: Muscle-Bone Interactions when Bi-directionally Compromised.
Phillips, Charlotte L; Jeong, Youngjae
2018-06-16
Osteogenesis imperfecta (OI) is a hereditary connective tissue disorder of skeletal fragility and more recently muscle weakness. This review highlights our current knowledge of the impact of compromised OI muscle function on muscle-bone interactions and skeletal strength in OI. The ramifications of inherent muscle weakness in OI muscle-bone interactions are just beginning to be elucidated. Studies in patients and in OI mouse models implicate altered mechanosensing, energy metabolism, mitochondrial dysfunction, and paracrine/endocrine crosstalk in the pathogenesis of OI. Compromised muscle-bone unit impacts mechanosensing and the ability of OI muscle and bone to respond to physiotherapeutic and pharmacologic treatment strategies. Muscle and bone are both compromised in OI, making it essential to understand the mechanisms responsible for both impaired muscle and bone functions and their interdependence, as this will expand and drive new physiotherapeutic and pharmacological approaches to treat OI and other musculoskeletal disorders.
Diagnosing and discriminating between primary and secondary aneurysmal bone cysts
Sasaki, Hiromi; Nagano, Satoshi; Shimada, Hirofumi; Yokouchi, Masahiro; Setoguchi, Takao; Ishidou, Yasuhiro; Kunigou, Osamu; Maehara, Kosuke; Komiya, Setsuro
2017-01-01
Aneurysmal bone cysts (ABCs) are benign bony lesions frequently accompanied by multiple cystic lesions and aggressive bone destruction. They are relatively rare lesions, representing only 1% of bone tumors. The pathogenesis of ABCs has yet to be elucidated. In the present study, a series of 22 cases of primary and secondary ABC from patients treated in Department of Orthopedic Surgery, Kagoshima University Hospital (Kagoshima, Japan) from 2001–2015 were retrospectively analyzed. The average age at the time of diagnosis of primary ABC was 17.9 years. Intralesional curettage and artificial bone grafting were performed in the majority of the patients with primary ABC. The local recurrence rate following curettage for primary ABC was 18%, and the cause of local recurrence was considered to be insufficient curettage. Although no adjuvant therapy was administered during the surgeries, it may assist the prevention of local recurrence in certain cases. The cases of secondary ABC were preceded by benign bone tumors, including fibrous dysplasia, giant cell tumors, chondroblastoma and non-ossifying fibroma. The features of the secondary ABC typically reflected those of the preceding bone tumor. In the majority of cases, distinguishing the primary ABC from the secondary ABC was possible based on characteristic features, including age of the patient at diagnosis and the tumor location. In cases that exhibit ambiguous features, including a soft tissue mass or a thick septal enhancement on the preoperative magnetic resonance images, a biopsy must be obtained in order to exclude other types of aggressive bone tumors, including giant cell tumor, osteosarcoma and telangiectatic osteosarcoma. PMID:28454393
Zhong, Zhendong A; Sun, Weihua; Chen, Haiyan; Zhang, Hongliang; Lay, Yu-An E; Lane, Nancy E; Yao, Wei
2015-12-01
For tamoxifen-dependent Cre recombinase, also known as CreER recombinase, tamoxifen (TAM) is used to activate the Cre to generate time- and tissue-specific mouse mutants. TAM is a potent CreER system inducer; however, TAM is also an active selective estrogen receptor modulator (SERM) that can influence bone homeostasis. The purpose of this study was to optimize the TAM dose for Cre recombinase activation while minimizing the effects of TAM on bone turnover in young growing mice. To evaluate the effects of TAM on bone turnover and bone mass, 1-month-old wild-type male and female mice were intraperitoneally injected with TAM at 0, 1, 10 or 100mg/kg/day for four consecutive days, or 100, 300 mg/kg/day for one day. The distal femurs were analyzed one month after the last TAM injection by microCT, mechanical test, and surface-based bone histomorphometry. Similar doses of TAM were used in Col1 (2.3 kb)-CreERT2; mT/mG reporter male mice to evaluate the dose-dependent efficacy of Cre-ER activation in bone tissue. A TAM dose of 100 mg/kg × 4 days significantly increased trabecular bone volume/total volume (BV/TV) of the distal femur, femur length, bone strength, and serum bone turnover markers compared to the 0mg control group. In contrast, TAM doses ≤ 10 mg/kg did not significantly change any of these parameters compared to the 0mg group, although a higher bone strength was observed in the 10mg group. Surface-based histomorphometry revealed that the 100mg/kg dose of TAM dose significantly increased trabecular bone formation and decreased periosteal bone formation at 1-week post-TAM treatment. Using the reporter mouse model Col1-CreERT2; mT/mG, we found that 10mg/kg TAM induced Col1-CreERT2 activity in bone at a comparable level to the 100mg/kg dose. TAM treatment at 100mg/kg/day × 4 days significantly affects bone homeostasis, resulting in an anabolic bone effect on trabecular bone in 1-month-old male mice. However, a lower dose of TAM at 10 mg/kg/day × 4 days can yield similar Col1-CreERT2 induction efficacy with minimum effects on bone turnover in young male mice. Copyright © 2015 Elsevier Inc. All rights reserved.
Development and Tissue Origins of the Mammalian Cranial Base
Iseki, S.; Bamforth, S. D.; Olsen, B. R.; Morriss-Kay, G. M.
2008-01-01
The vertebrate cranial base is a complex structure composed of bone, cartilage and other connective tissues underlying the brain; it is intimately connected with development of the face and cranial vault. Despite its central importance in craniofacial development, morphogenesis and tissue origins of the cranial base have not been studied in detail in the mouse, an important model organism. We describe here the location and time of appearance of the cartilages of the chondrocranium. We also examine the tissue origins of the mouse cranial base using a neural crest cell lineage cell marker, Wnt1-Cre/R26R, and a mesoderm lineage cell marker, Mesp1-Cre/R26R. The chondrocranium develops between E11 and E16 in the mouse, beginning with development of the caudal (occipital) chondrocranium, followed by chondrogenesis rostrally to form the nasal capsule, and finally fusion of these two parts via the midline central stem and the lateral struts of the vault cartilages. X-Gal staining of transgenic mice from E8.0 to 10 days post-natal showed that neural crest cells contribute to all of the cartilages that form the ethmoid, presphenoid, and basisphenoid bones with the exception of the hypochiasmatic cartilages. The basioccipital bone and non-squamous parts of the temporal bones are mesoderm derived. Therefore the prechordal head is mostly composed of neural crest-derived tissues, as predicted by the New Head Hypothesis. However, the anterior location of the mesoderm-derived hypochiasmatic cartilages, which are closely linked with the extra-ocular muscles, suggests that some tissues associated with the visual apparatus may have evolved independently of the rest of the “New Head”. PMID:18680740
Heidari, A H; Shabestani Monfared, A; Mozdarani, H; Mahmoudzadeh, A; Razzaghdoust, A
2017-12-01
We intend to study the inhibitory effect of sulfur compound in Ramsar hot spring mineral on tumor-genesis ability of high natural background radiation. The radioprotective effect of sulfur compounds was previously shown on radiation-induced chromosomal aberration, micronuclei in mouse bone marrow cells and human peripheral lymphocyte. Ramsar is known for having the highest level of natural background radiation on Earth. This study was performed to show the radioprotective effect of sulfur-containing Ramsar mineral water on mouse bone marrow cells. Mice were fed three types of water (drinking water, Ramsar radioactive water containing sulfur and Ramsar radioactive water whose sulfur was removed). Ten days after feeding, mice were irradiated by gamma rays (0, 2 and 4 Gy). 48 and 72 hours after irradiating, mice were killed and femurs were removed. Frequency of micronuclei was determined in bone marrow erythrocytes. A significant reduction was shown in the rate of micronuclei polychromatic erythrocyte in sulfur-containing hot spring water compared to sulfur-free water in hot spring mineral water. Gamma irradiation induced significant increases in micronuclei polychromatic erythrocyte (MNPCE) and decreases in polychromatic erythrocyte/polychromatic erythrocyte + normochromatic erythrocyte ratio (PCEs/PCEs+NCEs) (P < 0.001) in sulfur-containing hot spring water compared to sulfur-free hot spring mineral water. Also, apparently there was a significant difference between drinking water and sulfur-containing hot spring water in micronuclei polychromatic erythrocyte and polychromatic erythrocyte/polychromatic erythrocyte+ normochromatic erythrocyte ratio. The results indicate that sulfur-containing mineral water could result in a significant reduction in radiation-induced micronuclei representing the radioprotective effect of sulfur compounds.
AN INVESTIGATION OF THE MINERAL IN DUCTILE AND BRITTLE CORTICAL MOUSE BONE
Rodriguez-Florez, Naiara; Garcia-Tunon, Esther; Mukadam, Quresh; Saiz, Eduardo; Oldknow, Karla J.; Farquharson, Colin; Millán, José Luis; Boyde, Alan; Shefelbine, Sandra J.
2015-01-01
Bone is a strong and tough material composed of apatite mineral, organic matter and water. Changes in composition and organization of these building blocks affect bone’s mechanical integrity. Skeletal disorders often affect bone’s mineral phase, either by variations in the collagen or directly altering mineralization. The aim of the current study was to explore the differences in the mineral of brittle and ductile cortical bone at the mineral (nm) and tissue (µm) levels using two mouse phenotypes. Osteogenesis imperfecta murine (oim−/−) mice were used to model brittle bone; PHOSPHO1 mutants (Phospho1−/−) had ductile bone. They were compared to their respective wild-type controls. Femora were defatted and ground to powder to measure average mineral crystal size using X-ray diffraction (XRD), and to monitor the bulk mineral to matrix ratio via thermogravimetric analysis (TGA). XRD scans were run after TGA for phase identification, to assess the fractions of hydroxyapatite and β-tricalcium phosphate. Tibiae were embedded to measure elastic properties with nanoindentation and the extent of mineralization with backscattered electron microscopy (qbSEM). Interestingly, the mineral of brittle oim−/− and ductile Phospho1−/− bones had many similar characteristics. Both pathology models had smaller apatite crystals, lower mineral to matrix ratio, and showed more thermal conversion to β-tricalcium phosphate than their wild-types, indicating deviations from stoichiometric hydroxyapatite in the original mineral. The degree of mineralization of the bone matrix was different for each strain: oim−/− were hypermineralized, while Phospho1−/− were hypomineralized. However, alterations in the mineral were associated with reduced tissue elastic moduli in both pathologies. Results revealed that despite having extremely different whole bone mechanics, the mineral of oim−/− and Phospho1−/− has several similar trends at smaller length scales. This indicates that alterations from normal crystal size, composition, and structure will reduce the mechanical integrity of bone. PMID:25418329
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vuong, A; Chow, J
Purpose: The aim of this study is to investigate the variation of bone dose on photon beam energy (keV – MeV) in small-animal irradiation. Dosimetry of homogeneous and inhomogeneous phantoms as per the same mouse computed tomography image set were calculated using the DOSCTP and DOSXYZnrc based on the EGSnrc Monte Carlo code. Methods: Monte Carlo simulations for the homogeneous and inhomogeneous mouse phantom irradiated by a 360 degree photon arc were carried out. Mean doses of the bone tissue in the irradiated volumes were calculated at various photon beam energies, ranging from 50 keV to 1.25 MeV. The effectmore » of bone inhomogeneity was examined through the Inhomogeneous Correction Factor (ICF), a dose ratio of the inhomogeneous to the homogeneous medium. Results: From our Monte Carlo results, higher mean bone dose and ICF were found when using kilovoltage photon beams compared to megavoltage. In beam energies ranging from 50 keV to 200 keV, the bone dose was found maximum at 50 keV, and decreased significantly from 2.6 Gy to 0.55 Gy, when 2 Gy was delivered at the center of the phantom (isocenter). Similarly, the ICF were found decreasing from 4.5 to 1 when the photon beam energy was increased from 50 keV to 200 keV. Both mean bone dose and ICF remained at about 0.5 Gy and 1 from 200 keV to 1.25 MeV with insignificant variation, respectively. Conclusion: It is concluded that to avoid high bone dose in the small-animal irradiation, photon beam energy higher than 200 keV should be used with the ICF close to one, and bone dose comparable to the megavoltage beam where photoelectric effect is not dominant.« less
Enríquez-Pérez, Iris A; Galindo-Ordoñez, Karla E; Pantoja-Ortíz, Christian E; Martínez-Martínez, Arisaí; Acosta-González, Rosa I; Muñoz-Islas, Enriqueta; Jiménez-Andrade, Juan M
2017-08-10
Type-1 diabetes mellitus (T1DM) results in loss of innervation in some tissues including epidermis and retina; however, the effect on bone innervation is unknown. Likewise, T1DM results in pathological bone loss and increased risk of fracture. Thus, we quantified the density of calcitonin gene-related peptide (CGRP + ) sensory and tyrosine hydroxylase (TH + ) sympathetic nerve fibers and determined the association between the innervation density and microarchitecture of trabecular bone at the mouse femoral neck. Ten weeks-old female mice received 5 daily administrations of streptozocin (i.p. 50mg/kg) or citrate (control group). Twenty weeks later, femurs were analyzed by microCT and processed for immunohistochemistry. Confocal microscopy analysis revealed that mice with T1DM had a significant loss of both CGRP + and TH + nerve fibers in the bone marrow at the femoral neck. Likewise, microCT analysis revealed a significant decrease in the trabecular bone mineral density (tBMD), bone volume/total volume ratio (BV/TB), trabecular thickness (Tb.Th), trabecular number (Tb.N) and trabecular separation (Tb.Sp) in mice with T1DM as compared to control mice. Analysis of correlation revealed a positive and significant association between density of CGRP + or TH + nerve fibers with tBMD, BV/TV, Tb.Th and Tb.Sp, but not with trabecular number (there was a positive association only for CGRP + ) and degree of anisotropy (DA). This study suggests an interaction between sensory and sympathetic nervous system and T1DM-induced bone loss. Identification of the factors involved in the loss of CGRP + sensory and TH + sympathetic fibers and how they regulate bone loss may result in new avenues to treat T1DM-related osteoporosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Wise, L M; Wang, Z; Grynpas, M D
2007-10-01
Fractography has not been fully developed as a useful technique in assessing failure mechanisms of bone. While fracture surfaces of osteonal bone have been explored, this may not apply to conventional mechanical testing of mouse bone. Thus, the focus of this work was to develop and evaluate the efficacy of a fractography protocol for use in supplementing the interpretation of failure mechanisms in mouse bone. Micro-computed tomography and three-point bending were performed on femora of two groups of 6-month-old mice (C57BL/6 and a mixed strain background of 129SV/C57BL6). SEM images of fracture surfaces were collected, and areas of "tension", "compression" and "transition" were identified. Percent areas of roughness were identified and estimated within areas of "tension" and "compression" and subsequently compared to surface roughness measurements generated from an optical profiler. Porosity parameters were determined on the tensile side. Linear regression analysis was performed to evaluate correlations between certain parameters. Results show that 129 mice exhibit significantly increased bone mineral density (BMD), number of "large" pores, failure strength, elastic modulus and energy to failure compared to B6 mice (p<0.001). Both 129 and B6 mice exhibit significantly (p<0.01) more percent areas of tension (49+/-1%, 42+/-2%; respectively) compared to compression (26+/-2%, 31+/-1%; respectively). In terms of "roughness", B6 mice exhibit significantly less "rough" areas (30+/-4%) compared to "smooth" areas (70+/-4%) on the tensile side only (p<0.001). Qualitatively, 129 mice demonstrate more evidence of bone toughening through fiber bridging and loosely connected fiber bundles. The number of large pores is positively correlated with failure strength (p=0.004), elastic modulus (p=0.002) and energy to failure (p=0.041). Percent area of tensile surfaces is positively correlated with failure strength (p<0.001), elastic modulus (p=0.016) and BMD (p=0.037). Percent area of rough compressive surfaces is positively correlated with energy to failure (p=0.039). Evaluation of fracture surfaces has helped to explain why 129 mice have increased mechanical properties compared to B6 mice, namely via toughening mechanisms on the compressive side of failure. Several correlations exist between fractography parameters and mechanical behavior, supporting the utility of fractography with skeletal mouse models.
NASA Astrophysics Data System (ADS)
Maddin, Hillary C.; Piekarski, Nadine; Sefton, Elizabeth M.; Hanken, James
2016-08-01
Bones of the cranial vault appear to be highly conserved among tetrapod vertebrates. Moreover, bones identified with the same name are assumed to be evolutionarily homologous. However, recent developmental studies reveal a key difference in the embryonic origin of cranial vault bones between representatives of two amniote lineages, mammals and birds, thereby challenging this view. In the mouse, the frontal is derived from cranial neural crest (CNC) but the parietal is derived from mesoderm, placing the CNC-mesoderm boundary at the suture between these bones. In the chicken, this boundary is located within the frontal. This difference and related data have led several recent authors to suggest that bones of the avian cranial vault are misidentified and should be renamed. To elucidate this apparent conflict, we fate-mapped CNC and mesoderm in axolotl to reveal the contributions of these two embryonic cell populations to the cranial vault in a urodele amphibian. The CNC-mesoderm boundary in axolotl is located between the frontal and parietal bones, as in the mouse but unlike the chicken. If, however, the avian frontal is regarded instead as a fused frontal and parietal (i.e. frontoparietal) and the parietal as a postparietal, then the cranial vault of birds becomes developmentally and topologically congruent with those of urodeles and mammals. This alternative hypothesis of cranial vault homology is also phylogenetically consistent with data from the tetrapod fossil record, where frontal, parietal and postparietal bones are present in stem lineages of all extant taxa, including birds. It further implies that a postparietal may be present in most non-avian archosaurs, but fused to the parietal or supraoccipital as in many extant mammals.
König, Matthias A; Canepa, Daisy D; Cadosch, Dieter; Casanova, Elisa; Heinzelmann, Michael; Rittirsch, Daniel; Plecko, Michael; Hemmi, Sonja; Simmen, Hans-Peter; Cinelli, Paolo; Wanner, Guido A
2016-01-01
Fractures with a critical size bone defect (e.g., open fracture with segmental bone loss) are associated with high rates of delayed union and non-union. The prevention and treatment of these complications remain a serious issue in trauma and orthopaedic surgery. Autologous cancellous bone grafting is a well-established and widely used technique. However, it has drawbacks related to availability, increased morbidity and insufficient efficacy. Mesenchymal stromal cells can potentially be used to improve fracture healing. In particular, human fat tissue has been identified as a good source of multilineage adipose-derived stem cells, which can be differentiated into osteoblasts. The main issue is that mesenchymal stromal cells are a heterogeneous population of progenitors and lineage-committed cells harboring a broad range of regenerative properties. This heterogeneity is also mirrored in the differentiation potential of these cells. In the present study, we sought to test the possibility to enrich defined subpopulations of stem/progenitor cells for direct therapeutic application without requiring an in vitro expansion. We enriched a CD146+NG2+CD45- population of pericytes from freshly isolated stromal vascular fraction from mouse fat tissue and tested their osteogenic differentiation capacity in vitro and in vivo in a mouse model for critical size bone injury. Our results confirm the ability of enriched CD146+NG2+CD45- cells to efficiently generate osteoblasts in vitro, to colonize cancellous bone scaffolds and to successfully contribute to regeneration of large bone defects in vivo. This study represents proof of principle for the direct use of enriched populations of cells with stem/progenitor identity for therapeutic applications. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Kim, Sungwoo; Bedigrew, Katherine; Guda, Teja; Maloney, William J.; Park, Sangwon; Wenke, Joseph C.; Yang, Yunzhi Peter
2014-01-01
The purpose of this study was to develop and characterize a novel photo-cross-linkable chitosan-lactide-fibrinogen (CLF) hydrogel and evaluate the efficacy of bone morphogenetic protein-2 (BMP-2) containing CLF hydrogel for osteogenesis in vitro and in vivo. We synthesized the CLF hydrogels and characterized their chemical structure, degradation rate, compressive modulus, and in vitro BMP-2 release kinetics. We evaluated bioactivities of the BMP-2 containing CLF hydrogels (0, 50, 100, and 500 ng/ml) in vitro using W-20-17 preosteoblast mouse bone marrow stromal cells and C2C12 mouse myoblast cells. The effect of BMP-2 containing CLF gels (0, 0.5, 1, 2, and 5μg) on bone formation was evaluated using rat critical size segmental bone defects for 4 weeks. FTIR spectra and SEM images showed chemical and structural changes by addition of fibrinogen into chitosan-lactide copolymer. Incorporation of fibrinogen molecules significantly increased compressive modulus of the hydrogels. In vitro BMP-2 release study showed initial burst releases from the CLF hydrogels followed by sustained releases, regardless of the concentration of the BMP-2 over 4 weeks. Cells in all groups were viable in the presence of the hydrogels regardless of BMP-2 doses, indicating non-cytotoxicity of hydrogels. Alkaline phosphate activity and mineralization of cells exhibited dose dependence on BMP-2 containing CLF hydrogels. Radiographs, microcomputed tomography, and histology confirmed that the BMP-2 containing CLF hydrogels prompted neo-osteogenesis and accelerated healing of the defects in a dose-dependent manner. Thus the CLF hydrogel is a promising delivery system of growth factors for bone regeneration. PMID:25174669
Infectivity of five different types of macrophages by Leishmania infantum.
Maia, C; Rolão, N; Nunes, M; Gonçalves, L; Campino, L
2007-08-01
Leishmania are intracellular parasites that multiply as the amastigote form in the macrophages of their vertebrate hosts. Since vaccines against leishmaniases are still under development, the control of these diseases relies on prompt diagnosis and chemotherapy in infected humans as well as in dogs, which are the main reservoir of Leishmania infantum, in Mediterranean countries. To establish the macrophage type to be used as an in vitro model for antileishmanial chemotherapeutic studies, we analysed the susceptibility of human peripheral blood derived macrophages, macrophages derived from mouse bone marrow, mouse peritoneal macrophages and macrophages differentiated from cell lines U-937 and DH82 to infection by two L. infantum strains, one obtained from a human leishmanial infection and other from a canine infection. Both strains displayed comparable behaviour in their capacity of infecting the different macrophage types. Human peripheral blood macrophages and DH82 cells were less infectable by both strains. U-937, mouse peritoneal macrophages and mouse bone marrow derived macrophages are the most active cells to phagocytose the parasites. However, U-937 cell line appears to be the most useful as Leishmania infection model providing an unlimited source of homogeneous host cells with reproducibility of the results, is less time consuming, less expensive and tolerate high doses of first line drugs for human and canine visceral leishmaniasis treatment.
Roberts, Edward W.; Deonarine, Andrew; Jones, James O.; Denton, Alice E.; Feig, Christine; Lyons, Scott K.; Espeli, Marion; Kraman, Matthew; McKenna, Brendan; Wells, Richard J.B.; Zhao, Qi; Caballero, Otavia L.; Larder, Rachel; Coll, Anthony P.; O’Rahilly, Stephen; Brindle, Kevin M.; Teichmann, Sarah A.; Tuveson, David A.
2013-01-01
Fibroblast activation protein-α (FAP) identifies stromal cells of mesenchymal origin in human cancers and chronic inflammatory lesions. In mouse models of cancer, they have been shown to be immune suppressive, but studies of their occurrence and function in normal tissues have been limited. With a transgenic mouse line permitting the bioluminescent imaging of FAP+ cells, we find that they reside in most tissues of the adult mouse. FAP+ cells from three sites, skeletal muscle, adipose tissue, and pancreas, have highly similar transcriptomes, suggesting a shared lineage. FAP+ cells of skeletal muscle are the major local source of follistatin, and in bone marrow they express Cxcl12 and KitL. Experimental ablation of these cells causes loss of muscle mass and a reduction of B-lymphopoiesis and erythropoiesis, revealing their essential functions in maintaining normal muscle mass and hematopoiesis, respectively. Remarkably, these cells are altered at these sites in transplantable and spontaneous mouse models of cancer-induced cachexia and anemia. Thus, the FAP+ stromal cell may have roles in two adverse consequences of cancer: their acquisition by tumors may cause failure of immunosurveillance, and their alteration in normal tissues contributes to the paraneoplastic syndromes of cachexia and anemia. PMID:23712428
MicroRNAs for osteosarcoma in the mouse: a meta-analysis
Chang, Junli; Yao, Min; Li, Yimian; Zhao, Dongfeng; Hu, Shaopu; Cui, Xuejun; Liu, Gang; Shi, Qi; Wang, Yongjun; Yang, Yanping
2016-01-01
Osteosarcoma (OS) is the most common primary malignant bone carcinoma with high morbidity that happens mainly in children and young adults. As the key components of gene-regulatory networks, microRNAs (miRNAs) control many critical pathophysiological processes, including initiation and progression of cancers. The objective of this study is to summarize and evaluate the potential of miRNAs as targets for prevention and treatment of OS in mouse models, and to explore the methodological quality of current studies. We searched PubMed, Web of Science, Embase, Wan Fang Database, VIP Database, China Knowledge Resource Integrated Database, and Chinese BioMedical since their beginning date to 10 May 2016. Two reviewers separately screened the controlled studies, which estimate the effects of miRNAs on osteosarcoma in mice. A pair-wise analysis was performed. Thirty six studies with enough randomization were selected and included in the meta-analysis. We found that blocking oncogenic or restoring decreased miRNAs in cancer cells could significantly suppress the progression of OS in vivo, as assessed by tumor volume and tumor weight. This meta-analysis suggests that miRNAs are potential therapeutic targets for OS and correction of the altered expression of miRNAs significantly suppresses the progression of OS in mouse models, however, the overall methodological quality of studies included here was low, and more animal studies with the rigourous design must be carried out before a miRNA-based treatment could be translated from animal studies to clinical trials. PMID:27852052
Contributions of Raman spectroscopy to the understanding of bone strength.
Mandair, Gurjit S; Morris, Michael D
2015-01-01
Raman spectroscopy is increasingly commonly used to understand how changes in bone composition and structure influence tissue-level bone mechanical properties. The spectroscopic technique provides information on bone mineral and matrix collagen components and on the effects of various matrix proteins on bone material properties as well. The Raman spectrum of bone not only contains information on bone mineral crystallinity that is related to bone hardness but also provides information on the orientation of mineral crystallites with respect to the collagen fibril axis. Indirect information on collagen cross-links is also available and will be discussed. After a short introduction to bone Raman spectroscopic parameters and collection methodologies, advances in in vivo Raman spectroscopic measurements for animal and human subject studies will be reviewed. A discussion on the effects of aging, osteogenesis imperfecta, osteoporosis and therapeutic agents on bone composition and mechanical properties will be highlighted, including genetic mouse models in which structure-function and exercise effects are explored. Similarly, extracellular matrix proteins, proteases and transcriptional proteins implicated in the regulation of bone material properties will be reviewed.
Who, Who, Who Gives a Hoot about Bones?
ERIC Educational Resources Information Center
Dolan, Arthur
1988-01-01
Describes a mouse skeleton reconstruction activity from owl pellets. Gives information about the materials, directions for students, and a five-day unit schedule. Provides some owl pellet sources. (YP)
McCauley, Laurie K; Tözüm, Tolga F; Rosol, Thomas J
2002-01-01
Estrogens have long been known to be important for skeletal homeostasis, but their precise mechanisms of action in bone are still unclear. Mice with targeted deletions of the estrogen receptors alpha (ERalpha) and beta (ERbeta) have been generated by two research groups and several studies performed characterizing the phenotype of ERalpha knockout (ERKOalpha), ERbeta knockout (ERKObeta), or double deletion of ERalpha and ERbeta (DERKO) mice. Initial studies reported a reduction in bone mineral density in male ERKOalpha mice. More extensive analyses have been puzzling, likely because of compensatory mechanisms in ERKO mice. Furthermore, the existence of a third ER continues to be a potential explanation for some actions of estrogen in bone. Other rodent models, including the testicular feminized mouse and rat, the aromatase knockout mouse, and a rat with a dominant negative ER mutation, have added information regarding estrogen's actions in bone. This review summarizes many reports characterizing available rodent models with genetic alterations relevant to estrogen action. The sum of these reports suggests that the ERbeta is not highly protective in bone because loss of its function results in minimal alterations in the skeleton. Furthermore, loss of both the ERalpha and the ERbeta does not account for loss of estrogen action in bone, because the impact of DERKO is seemingly not as great as the impact of gonadectomy on the skeleton. Finally, through studies of ERKO mice and other rodent models of altered sex steroid action, it appears that estrogen may be more protective in the skeleton than androgens.
Little, David G; Peacock, Lauren; Mikulec, Kathy; Kneissel, Michaela; Kramer, Ina; Cheng, Tegan L; Schindeler, Aaron; Munns, Craig
2017-08-01
In this study, we examined the therapeutic potential of anti-Sclerostin Antibody (Scl-Ab) and bisphosphonate treatments for the bone fragility disorder Osteogenesis Imperfecta (OI). Mice with the Amish OI mutation (Col1a2 G610C mice) and control wild type littermates (WT) were treated from week 5 to week 9 of life with (1) saline (control), (2) zoledronic acid given 0.025mg/kg s.c. weekly (ZA), (3) Scl-Ab given 50mg/kg IV weekly (Scl-Ab), or (4) a combination of both (Scl-Ab/ZA). Functional outcomes were prioritized and included bone mineral density (BMD), bone microarchitecture, long bone bending strength, and vertebral compression strength. By dual-energy absorptiometry, Scl-Ab treatment alone had no effect on tibial BMD, while ZA and Scl-Ab/ZA significantly enhanced BMD by week 4 (+16% and +27% respectively, P<0.05). Scl-Ab/ZA treatment also led to increases in cortical thickness and tissue mineral density, and restored the tibial 4-point bending strength to that of control WT mice. In the spine, all treatments increased compression strength over controls, but only the combined group reached the strength of WT controls. Scl-Ab showed greater anabolic effects in the trabecular bone than in cortical bone. In summary, the Scl-Ab/ZA intervention was superior to either treatment alone in this OI mouse model, however further studies are required to establish its efficacy in other preclinical and clinical scenarios. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.
NF-κB RelB Negatively Regulates Osteoblast Differentiation and Bone Formation
Yao, Zhenqiang; Li, Yanyun; Yin, Xiaoxiang; Dong, Yufeng; Xing, Lianping; Boyce, Brendan F.
2013-01-01
RelA-mediated NF-κB canonical signaling promotes mesenchymal progenitor cell (MPC) proliferation, but inhibits differentiation of mature osteoblasts (OBs) and thus negatively regulates bone formation. Previous studies suggest that NF-κB RelB may also negatively regulate bone formation through non-canonical signaling, but they involved a complex knockout mouse model and the molecular mechanisms involved were not investigated. Here, we report that RelB−/− mice develop age-related increased trabecular bone mass associated with increased bone formation. RelB−/− bone marrow stromal cells expanded faster in vitro and have enhanced OB differentiation associated with increased expression of the osteoblastogenic transcription factor, Runx2. In addition, RelB directly targeted the Runx2 promoter to inhibit its activation. Importantly, RelB−/− bone-derived MPCs formed bone more rapidly than wild-type cells after they were injected into a murine tibial bone defect model. Our findings indicate that RelB negatively regulates bone mass as mice age and limits bone formation in healing bone defects, suggesting that inhibition of RelB could reduce age-related bone loss and enhance bone repair. PMID:24115294
Lentiviral gene transduction of mouse and human hematopoietic stem cells.
van Til, Niek P; Wagemaker, Gerard
2014-01-01
Lentiviral vectors can be used to genetically modify a broad range of cells. Hematopoietic stem cells (HSCs) are particularly suitable for lentiviral gene augmentation, because these cells can be enriched with relative ease from mouse bone marrow and human hematopoietic sources, and in principle require relatively limited cell numbers to completely reconstitute the hematopoietic system in vivo. Furthermore, lentiviral vectors are very efficient if pseudotyped with broad tropism envelope proteins. This chapter focuses on gene modification by the use of self-inactivating third-generation human immunodeficiency virus-derived lentiviral vectors for ex vivo HSC modification for both mouse and human application.
Neuronal Representation of Ultraviolet Visual Stimuli in Mouse Primary Visual Cortex
Tan, Zhongchao; Sun, Wenzhi; Chen, Tsai-Wen; Kim, Douglas; Ji, Na
2015-01-01
The mouse has become an important model for understanding the neural basis of visual perception. Although it has long been known that mouse lens transmits ultraviolet (UV) light and mouse opsins have absorption in the UV band, little is known about how UV visual information is processed in the mouse brain. Using a custom UV stimulation system and in vivo calcium imaging, we characterized the feature selectivity of layer 2/3 neurons in mouse primary visual cortex (V1). In adult mice, a comparable percentage of the neuronal population responds to UV and visible stimuli, with similar pattern selectivity and receptive field properties. In young mice, the orientation selectivity for UV stimuli increased steadily during development, but not direction selectivity. Our results suggest that, by expanding the spectral window through which the mouse can acquire visual information, UV sensitivity provides an important component for mouse vision. PMID:26219604
Generation of an immortalized mouse embryonic palatal mesenchyme cell line
Soriano, Philippe
2017-01-01
Palatogenesis is a complex morphogenetic process, disruptions in which result in highly prevalent birth defects in humans. In recent decades, the use of model systems such as genetically-modified mice, mouse palatal organ cultures and primary mouse embryonic palatal mesenchyme (MEPM) cultures has provided significant insight into the molecular and cellular defects underlying cleft palate. However, drawbacks in each of these systems have prevented high-throughput, large-scale studies of palatogenesis in vitro. Here, we report the generation of an immortalized MEPM cell line that maintains the morphology, migration ability, transcript expression and responsiveness to exogenous growth factors of primary MEPM cells, with increased proliferative potential over primary cultures. The immortalization method described in this study will facilitate the generation of palatal mesenchyme cells with an unlimited capacity for expansion from a single genetically-modified mouse embryo and enable mechanistic studies of palatogenesis that have not been possible using primary culture. PMID:28582446
Hanusch, Alex Lucas; de Oliveira, Guilherme Roberto; de Sabóia-Morais, Simone Maria Teixeira; Machado, Rafael Cosme; dos Anjos, Murilo Machado; Chen Chen, Lee
2015-01-01
Neolignans are secondary metabolites found in various groups of Angiosperms. They belong to a class of natural compounds with great diversity of chemical structures and pharmacological activities. These compounds are formed by linking two phenylpropanoid units. Several compounds that have ability to prevent genetic damage have been isolated from plants, and can be used to prevent or delay the development of tumor cells. Genetic toxicology evaluation is widely used in risk assessment of new drugs in preclinical screening tests. In this study, we evaluated the genotoxicity and cytotoxicity of the neolignan analogue 2-(4-nitrophenoxy)-1-phenylethanone (4NF) and its protective effect against DNA damage using the mouse bone marrow micronucleus test and the comet assay in mouse peripheral blood. Our results showed that this neolignan analogue had no genotoxic activity and was able to reduce induced damage both in mouse bone marrow and peripheral blood. Although the neolignan analogue 4NF was cytotoxic, it reduced cyclophosphamide-induced cytotoxicity. In conclusion, it showed no genotoxic action, but exhibited cytotoxic, antigenotoxic, and anticytotoxic activities. PMID:26554835
Wu, Mengrui; Li, Chenguan; Zhu, Guochun; Wang, Yiping; Jules, Joel; Lu, Yun; McConnell, Matthew; Wang, Yong-Jun; Shao, Jian-Zhong; Li, Yi-Ping; Chen, Wei
2015-01-01
Core-binding factor β (Cbfβ) is a subunit of the Cbf family of heterodimeric transcription factors which plays a critical role in skeletal development through its interaction with the Cbfα subunits, also known as Runt-related transcription factors (Runxs). However, the mechanism by which Cbfβ regulates cartilage and bone development remains unclear. Existing Cbfβ-deficient mouse models cannot specify the role of Cbfβ in skeletal cell lineage. Herein, we sought to specifically address the role of Cbfβ in cartilage and bone development by using a conditional knockout (CKO) approach. A mesenchymal-specific Cbfβ CKO mouse model was generated by using the Dermo1-Cre mouse line to specifically delete Cbfβ in mesenchymal stem cells, which give rise to osteoblasts and chondrocytes. Surprisingly, the mutant mice had under-developed larynx and tracheal cartilage causing alveolus defects which led to death shortly after birth from suffocation. Also, the mutant mice exhibited severe skeletal deformities from defective intramembranous and endochondral ossification, owing to delayed chondrocyte maturation and impaired osteoblast differentiation. Almost all bones of the mutant mice, including the calvariae, vertebrae, tibiae, femurs, ribs, limbs and sternums were defective. Importantly, we showed that Cbfβ was expressed throughout the skeleton during both embryonic and postnatal development, which explains the multiple-skeletal defects observed in the mutant mice. Consistently, Cbfβ deficiency impaired both chondrocyte proliferation and hypertrophy zone hypertrophy during growth-plate development in the long bones of mutant mice. Notably, Cbfβ, Runx1 and Runx2 displayed different expression patterns in the growth plates of the wildtype mice indicating that Cbfβ/Runx1 complex and Cbfβ/Runx2 complex may regulate chondrocyte proliferation and hypertrophy, respectively, in a spatial and temporal manner. Cbfβ deletion in the mesenchymal progenitors impacted bone development by dramatically down-regulating Collagen X (Col X) and Osterix (Osx), but had a dispensable effect on osteoclast development. Collectively, the results demonstrate that Cbfβ mediates cartilage and bone development by interacting with Runx1 and Runx2 to regulate the expressions of Col X and Osx for chondrocyte and osteoblast development. These findings not only reveal a critical role for Cbfβ in cartilage and bone development, but also facilitate the design of novel therapeutic approaches for skeletal diseases. PMID:24798493
Wu, Mengrui; Li, Chenguan; Zhu, Guochun; Wang, Yiping; Jules, Joel; Lu, Yun; McConnell, Matthew; Wang, Yong-Jun; Shao, Jian-Zhong; Li, Yi-Ping; Chen, Wei
2014-08-01
Core-binding factor β (Cbfβ) is a subunit of the Cbf family of heterodimeric transcription factors, which plays a critical role in skeletal development through its interaction with the Cbfα subunits, also known as Runt-related transcription factors (Runxs). However, the mechanism by which Cbfβ regulates cartilage and bone development remains unclear. Existing Cbfβ-deficient mouse models cannot specify the role of Cbfβ in skeletal cell lineage. Herein, we sought to specifically address the role of Cbfβ in cartilage and bone development by using a conditional knockout (CKO) approach. A mesenchymal-specific Cbfβ CKO mouse model was generated by using the Dermo1-Cre mouse line to specifically delete Cbfβ in mesenchymal stem cells, which give rise to osteoblasts and chondrocytes. Surprisingly, the mutant mice had under-developed larynx and tracheal cartilage, causing alveolus defects that led to death shortly after birth from suffocation. Also, the mutant mice exhibited severe skeletal deformities from defective intramembranous and endochondral ossification, owing to delayed chondrocyte maturation and impaired osteoblast differentiation. Almost all bones of the mutant mice, including the calvariae, vertebrae, tibiae, femurs, ribs, limbs and sternums were defective. Importantly, we showed that Cbfβ was expressed throughout the skeleton during both embryonic and postnatal development, which explains the multiple-skeletal defects observed in the mutant mice. Consistently, Cbfβ deficiency impaired both chondrocyte proliferation and hypertrophy zone hypertrophy during growth-plate development in the long bones of mutant mice. Notably, Cbfβ, Runx1 and Runx2 displayed different expression patterns in the growth plates of the wild-type mice, indicating that Cbfβ/Runx1 complex and Cbfβ/Runx2 complex may regulate chondrocyte proliferation and hypertrophy, respectively, in a spatial and temporal manner. Cbfβ deletion in the mesenchymal progenitors affected bone development by dramatically down-regulating Collagen X (Col X) and Osterix (Osx) but had a dispensable effect on osteoclast development. Collectively, the results demonstrate that Cbfβ mediates cartilage and bone development by interacting with Runx1 and Runx2 to regulate the expressions of Col X and Osx for chondrocyte and osteoblast development. These findings not only reveal a critical role for Cbfβ in cartilage and bone development but also facilitate the design of novel therapeutic approaches for skeletal diseases. Copyright © 2014. Published by Elsevier Inc.
Mechanical signals promote osteogenic fate through a primary cilia-mediated mechanism
Chen, Julia C.; Hoey, David A.; Chua, Mardonn; Bellon, Raymond; Jacobs, Christopher R.
2016-01-01
It has long been suspected, but never directly shown, that bone formed to accommodate an increase in mechanical loading is related to the creation of osteoblasts from skeletal stem cells. Indeed, biophysical stimuli potently regulate osteogenic lineage commitment in vitro. In this study, we transplanted bone marrow cells expressing green fluorescent protein, to enable lineage tracing, and subjected mice to a biophysical stimulus, to elicit a bone-forming response. We detected cells derived from transplanted progenitors embedded within the bone matrix near active bone-forming surfaces in response to loading, demonstrating for the first time, that mechanical signals enhance the homing and attachment of bone marrow cells to bone surfaces and the commitment to an osteogenic lineage of these cells in vivo. Furthermore, we used an inducible Cre/Lox recombination system to delete kinesin family member 3A (Kif3a), a gene that is essential for primary cilia formation, at will in transplanted cells and their progeny, regardless of which tissue may have incorporated them. Disruption of the mechanosensing organelle, the primary cilium in a progenitor population, significantly decreased the amount of bone formed in response to mechanical stimulation. The collective results of our study directly demonstrate that, in a novel experimental stem cell mechanobiology model, mechanical signals enhance osteogenic lineage commitment in vivo and that the primary cilium contributes to this process.—Chen, J. C., Hoey, D. A., Chua, M., Bellon, R., Jacobs, C. R. Mechanical signals promote osteogenic fate through a primary cilia-mediated mechanism. PMID:26675708
2017-10-01
Colonization PRINCIPAL INVESTIGATOR: Srinivas Nandana CONTRACTING ORGANIZATION: Cedars-Sinai Medical Center Los Angeles, CA, 90048 REPORT DATE...8. PERFORMING ORGANIZATION REPORT NUMBER Cedars-Sinai Medical Center, 8700 Beverly Blvd, Los Angeles, CA, 90048 9. SPONSORING / MONITORING...Revised Statement of Work (SOW): PROPOSED START DATE Sep 30, 2016 ACTUAL START DATE – Sep 18, 2017 Site: Uro -Oncology, Dept of Medicine
Bone and muscle endocrine functions: Unexpected paradigms of inter-organ communication
Karsenty, Gerard; Olson, Eric N.
2016-01-01
Most physiological functions originate with the communication between organs. Mouse genetics has revived this holistic view of physiology through the identification of inter-organ communications that are unanticipated, functionally important and would have been difficult to uncover otherwise. This review highlights this point by showing how two tissues usually not seen as endocrine ones, bone and striated muscles, influence in a significant manner several physiological processes. PMID:26967290
ZBTB32 restricts the duration of memory B cell recall responses1
Jash, Arijita; Wang, Yinan; Weisel, Florian J.; Scharer, Christopher D.; Boss, Jeremy M.; Shlomchik, Mark J.; Bhattacharya, Deepta
2016-01-01
Memory B cell responses are more rapid and of greater magnitude than are primary antibody responses. The mechanisms by which these secondary responses are eventually attenuated remain unknown. We demonstrate that the transcription factor ZBTB32 limits the rapidity and duration of antibody recall responses. ZBTB32 is highly expressed by mouse and human memory B cells, but not by their naïve counterparts. Zbtb32−/− mice mount normal primary antibody responses to T-dependent antigens. However, Zbtb32−/− memory B cell-mediated recall responses occur more rapidly and persist longer than do control responses. Microarray analyses demonstrate that Zbtb32−/− secondary bone marrow plasma cells display elevated expression of genes that promote cell cycle progression and mitochondrial function relative to wild-type controls. BrdU labeling and adoptive transfer experiments confirm more rapid production and a cell-intrinsic survival advantage of Zbtb32−/− secondary plasma cells relative to wild-type counterparts. ZBTB32 is therefore a novel negative regulator of antibody recall responses. PMID:27357154
NASA Astrophysics Data System (ADS)
Rodionova, Natalia; Kabitskaya, Olga
2016-07-01
Using the methods of electron microscopy and autoradiography with ³N-glycine and ³N-thymidine on biosatellites "Bion-11" (Macaca mulatta, the duration of the experiments -10 days), "Bion-M1" (mouse C57 Black, duration of the flight - 30 days) in the experiments with modeled hypokinesia (white rats, hind limbs unloading, the duration of the experiments 28 days) new data about the morpho-functional peculiarities of cellular interactions in adaptive remodeling zones of bone structures under normal conditions and after exposure of animals to microgravity. Our conception on remodeling proposes the following sequence in the development of cellular interactions after decrease of the mechanical loading: a primary response of osteocytes (mechanosensory cells) to the mechanical stimulus; osteocytic remodeling (osteolysis); transmission of the mechanical signals through a system of canals and processes to functionally active osteoblasts and paving endost one as well as to the bone-marrow stromal cells and perivascular cells. As a response to the mechanical stimulus (microgravity) the system of perivascular cell-stromal cell-preosteoblast-osteoblast shows a delay in proliferation, differentiation and specific functioning of the osteogenetic cells, the number of apoptotic osteoblasts increases. Then the osteoclastic reaction occurs (attraction of monocytes and formation of osteoclasts, bone matrix resorption in the loci of apoptosis of osteoblasts and osteocytes). The macrophagal reaction is followed by osteoblastogenesis, which appears to be a rehabilitating process. However, during prolonged absence of mechanical stimuli (microgravity, long-time immobilization) the adaptive activization of osteoblastogenesis doesn't occur (as it is the case during the physiological remodeling of bone tissue) or it occurs to a smaller degree. The loading deficit leads to an adaptive differentiation of stromal cells to fibroblastic cells and adipocytes in remodeling loci. These cell reactions are considered as adaptive-compensatory, but they don't result in rehabilitation of the resorbed bone tissue. This sequence of cells interactions is considered as a mechanism of bone tissue loss which underlies the development of osteopenia and osteoporosis under the mechanical loading deficit.
Cancer-associated bone disease
Body, J.-J.; Brandi, M.-L.; Cannata-Andia, J.; Chappard, D.; El Maghraoui, A.; Glüer, C.C.; Kendler, D.; Napoli, N.; Papaioannou, A.; Pierroz, D.D.; Rahme, M.; Van Poznak, C.H.; de Villiers, T.J.; El Hajj Fuleihan, G.
2016-01-01
Bone is commonly affected in cancer. Cancer-induced bone disease results from the primary disease, or from therapies against the primary condition, causing bone fragility. Bone-modifying agents, such as bisphosphonates and denosumab, are efficacious in preventing and delaying cancer-related bone disease. With evidence-based care pathways, guidelines assist physicians in clinical decision-making. Of the 57 million deaths in 2008 worldwide, almost two thirds were due to non-communicable diseases, led by cardiovascular diseases and cancers. Bone is a commonly affected organ in cancer, and although the incidence of metastatic bone disease is not well defined, it is estimated that around half of patients who die from cancer in the USA each year have bone involvement. Furthermore, cancer-induced bone disease can result from the primary disease itself, either due to circulating bone resorbing substances or metastatic bone disease, such as commonly occurs with breast, lung and prostate cancer, or from therapies administered to treat the primary condition thus causing bone loss and fractures. Treatment-induced osteoporosis may occur in the setting of glucocorticoid therapy or oestrogen deprivation therapy, chemotherapy-induced ovarian failure and androgen deprivation therapy. Tumour skeletal-related events include pathologic fractures, spinal cord compression, surgery and radiotherapy to bone and may or may not include hypercalcaemia of malignancy while skeletal complication refers to pain and other symptoms. Some evidence demonstrates the efficacy of various interventions including bone-modifying agents, such as bisphosphonates and denosumab, in preventing or delaying cancer-related bone disease. The latter includes treatment of patients with metastatic skeletal lesions in general, adjuvant treatment of breast and prostate cancer in particular, and the prevention of cancer-associated bone disease. This has led to the development of guidelines by several societies and working groups to assist physicians in clinical decision making, providing them with evidence-based care pathways to prevent skeletal-related events and bone loss. The goal of this paper is to put forth an IOF position paper addressing bone diseases and cancer and summarizing the position papers of other organizations. PMID:24146095
Adissu, Hibret A.; Estabel, Jeanne; Sunter, David; Tuck, Elizabeth; Hooks, Yvette; Carragher, Damian M.; Clarke, Kay; Karp, Natasha A.; Project, Sanger Mouse Genetics; Newbigging, Susan; Jones, Nora; Morikawa, Lily; White, Jacqueline K.; McKerlie, Colin
2014-01-01
The Mouse Genetics Project (MGP) at the Wellcome Trust Sanger Institute aims to generate and phenotype over 800 genetically modified mouse lines over the next 5 years to gain a better understanding of mammalian gene function and provide an invaluable resource to the scientific community for follow-up studies. Phenotyping includes the generation of a standardized biobank of paraffin-embedded tissues for each mouse line, but histopathology is not routinely performed. In collaboration with the Pathology Core of the Centre for Modeling Human Disease (CMHD) we report the utility of histopathology in a high-throughput primary phenotyping screen. Histopathology was assessed in an unbiased selection of 50 mouse lines with (n=30) or without (n=20) clinical phenotypes detected by the standard MGP primary phenotyping screen. Our findings revealed that histopathology added correlating morphological data in 19 of 30 lines (63.3%) in which the primary screen detected a phenotype. In addition, seven of the 50 lines (14%) presented significant histopathology findings that were not associated with or predicted by the standard primary screen. Three of these seven lines had no clinical phenotype detected by the standard primary screen. Incidental and strain-associated background lesions were present in all mutant lines with good concordance to wild-type controls. These findings demonstrate the complementary and unique contribution of histopathology to high-throughput primary phenotyping of mutant mice. PMID:24652767
Henry-Bonami, Rachel A; Williams, Jonathan M; Rachakonda, Amita B; Karamali, Mariam; Kendall, Peggy L; Thomas, James W
2013-06-15
Effective central tolerance is required to control the large extent of autoreactivity normally present in the developing B cell repertoire. Insulin-reactive B cells are required for type 1 diabetes in the NOD mouse, because engineered mice lacking this population are protected from disease. The Cg-Tg(Igh-6/Igh-V125)2Jwt/JwtJ (VH125Tg) model is used to define this population, which is found with increased frequency in the periphery of NOD mice versus nonautoimmune C57BL/6 VH125Tg mice; however, the ontogeny of this disparity is unknown. To better understand the origins of these pernicious B cells, anti-insulin B cells were tracked during development in the polyclonal repertoire of VH125Tg mice. An increased proportion of insulin-binding B cells is apparent in NOD mice at the earliest point of Ag commitment in the bone marrow. Two predominant L chains were identified in B cells that bind heterologous insulin. Interestingly, Vκ4-57-1 polymorphisms that confer a CDR3 Pro-Pro motif enhance self-reactivity in VH125Tg/NOD mice. Despite binding circulating autoantigen in vivo, anti-insulin B cells transition from the parenchyma to the sinusoids in the bone marrow of NOD mice and enter the periphery unimpeded. Anti-insulin B cells expand at the site of autoimmune attack in the pancreas and correlate with increased numbers of IFN-γ-producing cells in the repertoire. These data identify the failure to cull autoreactive B cells in the bone marrow as the primary source of anti-insulin B cells in NOD mice and suggest that dysregulation of central tolerance permits their escape into the periphery to promote disease.
High resolution 3D laboratory x-ray tomography data of femora from young, 1-14 day old C57BL/6 mice.
Bortel, Emely L; Duda, Georg N; Mundlos, Stefan; Willie, Bettina M; Fratzl, Peter; Zaslansky, Paul
2015-09-01
This data article contains high resolution (1.2 µm effective pixel size) lab-based micro-computed tomography (µCT) reconstructed volume data of the femoral mid-shafts from young C57BL/6 mice. This data formed the basis for the analyses of bone structural development in healthy mice, including closed and open porosity as reported in Bortel et al. [1]. The data reveals changes seen in bone material and porosity distribution observed when mouse bones transform from porous scaffolds into solid structures during normal organogenesis.
NASA Technical Reports Server (NTRS)
Bromage, Timothy G.; Doty, Stephen B.; Smolyar, Igor; Holton, Emily
1996-01-01
Our stated primary objective is to quantify the growth rate variability of rat lamellar bone exposed to micro and macrogravity (2G). The primary significance of the proposed work is that an elegant method will be established that unequivocally characterizes the morphological consequences of gravitational factors on developing bone. The integrity of this objective depends upon our successful preparation of thin sections suitable for imaging individual bone lamellae, and our imaging and quantitation of growth rate variability in populations of lamellae from individual bone samples.
E-cadherin and beta-catenin are down-regulated in prostatic bone metastases.
Bryden, A A G; Hoyland, J A; Freemont, A J; Clarke, N W; Schembri Wismayer, D; George, N J R
2002-03-01
To determine the E-cadherin and beta-catenin expression phenotype in untreated primary prostate cancer and corresponding bone metastases. Paired bone metastasis and primary prostate specimens were obtained from 14 men with untreated metastatic prostate carcinoma. The tumours were histologically graded by an independent pathologist. Expression of mRNA for E-cadherin and beta-catenin was detected within the tumour cells using in-situ hybridization with a 35S-labelled cDNA probe. The expression of E-cadherin and beta-catenin were graded as uniform, heterogeneous or negative. The mRNA for E-cadherin was expressed in 13 of 14 primary carcinomas and 11 bone metastases; beta-catenin was expressed by 13 and nine, respectively. Of the primary tumours, nine expressed E-cadherin and beta-catenin uniformly; in contrast, all metastases had down-regulated E-cadherin and/or beta-catenin. The down-regulation of E-cadherin and beta-catenin are a feature of the metastatic phenotype, which may be a significant factor in the genesis of bone metastases. However, this does not appear to be reflected in the expression of these molecules in the primary tumours.
van Apeldoorn, Aart A; de Boer, Jan; van Steeg, Harry; Hoeijmakers, Jan H J; Otto, Cees; van Blitterswijk, Clemens A
2007-01-01
Although it has been established that premature aging trichothiodystrophy (TTD) mice display typical signs of osteoporosis, exact changes in physicochemical properties of these mice have not been elucidated. We used confocal Raman microscopy and histology to study femora of TTD mice. We measured femora isolated from xeroderma pigmentosum group A (XPA)/TTD double mutant mice to establish that Raman microscopy can be applied to measure differences in bone composition. Raman data from XPA/TTD mice showed remarkable changes in bone mineral composition. Moreover, we observed a severe form of osteoporosis, with strongly reduced cortical bone thickness. We used Raman microscopy to analyze bone composition in eight wild-type and eight TTD animals, and observed decreased levels of phosphate and carbonate in the cortex of femora isolated from TTD mice. In contrast, the bands representing the bone protein matrix were not affected in these mice.
Altered paracrine signaling from the injured knee joint impairs postnatal long bone growth.
Roselló-Díez, Alberto; Stephen, Daniel; Joyner, Alexandra L
2017-07-25
Regulation of organ growth is a poorly understood process. In the long bones, the growth plates (GPs) drive elongation by generating a scaffold progressively replaced by bone. Although studies have focused on intrinsic GP regulation, classic and recent experiments suggest that local signals also modulate GP function. We devised a genetic mouse model to study extrinsic long bone growth modulation, in which injury is specifically induced in the left hindlimb, such that the right hindlimb serves as an internal control. Remarkably, when only mesenchyme cells surrounding postnatal GPs were killed, left bone growth was nevertheless reduced. GP signaling was impaired by altered paracrine signals from the knee joint, including activation of the injury response and, in neonates, dampened IGF1 production. Importantly, only the combined prevention of both responses rescued neonatal growth. Thus, we identified signals from the knee joint that modulate bone growth and could underlie establishment of body proportions.
Lipid Osteoclastokines Regulate Breast Cancer Bone Metastasis
Krzeszinski, Jing Y.; Schwaid, Adam G.; Cheng, Wing Yin; Jin, Zixue; Gallegos, Zachary R.; Saghatelian, Alan
2017-01-01
Bone metastasis is a deadly consequence of cancers, in which osteoclast forms a vicious cycle with tumor cells. Bone metastasis attenuation by clinical usage of osteoclast inhibitors and in our osteopetrotic mouse genetic models with β-catenin constitutive activation or peroxisome proliferator-activated receptor γ deficiency fully support the important role of osteoclast in driving the bone metastatic niche. However, the mechanisms for this “partnership in crime” are underexplored. Here we show that osteoclasts reprogram their lipid secretion to support cancer cells. Metabolomic profiling reveals elevated prometastatic arachidonic acid (AA) but reduced antimetastatic lysophosphatidylcholines (LPCs). This shift in lipid osteoclastokines synergistically stimulates tumor cell proliferation, migration, survival, and expression of prometastatic genes. Pharmacologically, combined treatment with LPCs and BW-755C, an inhibitor of AA signaling via blocking lipoxygenase and cyclooxygenase, impedes breast cancer bone metastasis. Our findings elucidate key paracrine mechanisms for the osteoclast-cancer vicious cycle and uncover important therapeutic targets for bone metastasis. PMID:27967239
Value of Osteoblast-Derived Exosomes in Bone Diseases.
Ge, Min; Wu, Yingzhi; Ke, Ronghu; Cai, Tianyi; Yang, Junyi; Mu, Xiongzheng
2017-06-01
The authors' purpose is to reveal the value of osteoblast-derived exosomes in bone diseases. Microvesicles from supernatants of mouse Mc3t3 were isolated by ultracentrifugation and then the authors presented the protein profile by proteomics analysis. The authors detected a total number of 1536 proteins by mass spectrometry and found 172 proteins overlap with bone database. The Ingenuity Pathway Analysis shows network of "Skeletal and Muscular System Development and Function, Developmental Disorder, Hereditary Disorder" and pathway about osteogenesis. EFNB1 and transforming growth factor beta receptor 3 in the network, LRP6, bone morphogenetic protein receptor type-1, and SMURF1 in the pathway seemed to be valuable in the exosome research of related bone disease. The authors' study unveiled the content of osteoblast-derived exosome and discussed valuable protein in it which might provide novel prospective in bone diseases research.
Floreani, A; Carderi, I; Ferrara, F; Rizzotto, E R; Luisetto, G; Camozzi, V; Baldo, V
2007-06-01
International guidelines for managing osteoporosis in cirrhosis or severe cholestasis indicate a <-2.5 t-score as a cut-off for medical treatment, while no treatment is recommended in the case of osteopenia (t-scores ranging from -1.0 to -2.5). We conducted a prospective study in primary biliary cirrhosis with a view to optimizing the rationale for the medical treatment of bone loss. All naïve post-menopausal women with primary biliary cirrhosis were enrolled in the study. Bone metabolism was evaluated by measuring 25-hydroxy-vitamin D, parathyroid hormone, osteocalcin. Bone mineral density was assessed at the lumbar spine by dual-photon X-ray absorptiometry at the baseline and every 2 years for up to 4 years. Patients with either osteopenia or osteoporosis received the following treatment: oral calcium carbonate (1000 mg/day)+vitamin D3 (880 IU/day)+i.m. disodium clodronate 100mg every 10 days for 4 years. Ninety-six patients completed the study: 30 had a normal bone mineral density (group 1), 37 had osteopenia (group 2), 29 had osteoporosis (group 3). No significant differences in biochemical parameters of bone metabolism were observed between the three groups. A total of 288 bone mineral density measurements were taken. Linear regression analysis failed to reveal significant changes in t-score over the follow-up in all groups. A 4-year treatment with clodronate+calcium/vitamin D3 supplements does not significantly improve osteoporosis or osteopenia in primary biliary cirrhosis women in menopause, but prevents the natural bone loss in these patients. Extensive international trials are warranted to optimize the prevention and treatment of bone loss in primary biliary cirrhosis.
Jiang, Tao; Yu, Xiaohua; Carbone, Erica J; Nelson, Clarke; Kan, Ho Man; Lo, Kevin W-H
2014-11-20
Delivering drugs specifically to bone tissue is very challenging due to the architecture and structure of bone tissue. Poly(lactic-co-glycolic acid) (PLGA)-based nanoparticles (NPs) hold great promise for the delivery of therapeutics to bone tissue. The goal of the present research was to formulate a PLGA-based NP drug delivery system for bone tissue exclusively. Since poly-aspartic acids (poly-Asp) peptide sequence has been shown to bind to hydroxyapatite (HA), and has been suggested as a molecular tool for bone-targeting applications, we fabricated PLGA-based NPs linked with poly-Asp peptide sequence. Nanoparticles made of methoxy - poly(ethylene glycol) (PEG)-PLGA and maleimide-PEG-PLGA were prepared using a water-in-oil-in-water double emulsion and solvent evaporation method. Fluorescein isothiocyanate (FITC)-tagged poly-Asp peptide was conjugated to the surface of the nanoparticles via the alkylation reaction between the sulfhydryl groups at the N-terminal of the peptide and the CC double bond of maleimide at one end of the polymer chain to form thioether bonds. The conjugation of FITC-tagged poly-Asp peptide to PLGA NPs was confirmed by NMR analysis and fluorescent microscopy. The developed nanoparticle system is highly aqueous dispersible with an average particle size of ∼80 nm. In vitro binding analyses demonstrated that FITC-poly-Asp NPs were able to bind to HA gel as well as to mineralized matrices produced by human mesenchymal stem cells and mouse bone marrow stromal cells. Using a confocal microscopy technique, an ex vivo binding study of mouse major organ ground sections revealed that the FITC-poly-Asp NPs were able to bind specifically to the bone tissue. In addition, proliferation studies indicated that our FITC-poly-Asp NPs did not induce cytotoxicity to human osteoblast-like MG63 cell lines. Altogether, these promising results indicated that this nanoscale targeting system was able to bind to bone tissue specifically and might have a great potential for bone disease therapy in clinical applications. Copyright © 2014 Elsevier B.V. All rights reserved.
Stabnov, L; Kasukawa, Y; Guo, R; Amaar, Y; Wergedal, J E; Baylink, D J; Mohan, S
2002-06-01
Insulin-like growth factor-1 (IGF-1) increases both bone formation and bone resorption processes. To test the hypothesis that treatment with an antiresorber along with IGF-1, during the pubertal growth phase, would be more effective than IGF-1 alone to increase peak bone mass, we used an IGF-1 MIDI mouse model, which exhibits a >60% reduction in circulating IGF-1 levels. We first determined an optimal IGF-1 delivery by evaluating IGF-1 administration (2 mg/kg body weight/day) by either a single daily injection, three daily injections, or by continuous delivery via a minipump during puberty. Of the three regimens, the three daily IGF-1 injections and IGF-1 through a minipump produced a significant increase in total body bone mineral density (BMD) (6.0% and 4.4%, respectively) and in femoral BMD (4.3% and 6.2%, respectively) compared with the control group. Single subcutaneous (s.c.) administration did not increase BMD. We chose IGF-1 administration three times daily for testing the combined effects of IGF-1 and alendronate (100 microg/kg per day). The treatment of IGF-1 + alendronate for a period of 2 weeks increased total body BMD at 1 week and 3 weeks after treatment (21.1% and 20.5%, respectively) and femoral BMD by 29% at 3 weeks after treatment. These increases were significantly greater than those produced by IGF-1 alone. IGF-1, but not alendronate, increased bone length. IGF-1 and/or alendronate increased both periosteal and endosteal circumference. Combined treatment caused a greater increase in the total body bone mineral content (BMC) and periosteal circumference compared with individual treatment with IGF-1 or alendronate. Our data demonstrate that: (1) inhibition of bone turnover during puberty increases net bone density; and (2) combined treatment with IGF-1 and alendronate is more effective than IGF-1 or alendronate alone in increasing peak bone mass in an IGF-1-deficient MIDI mouse model.
Gebert, A; Peters, J; Bishop, N E; Westphal, F; Morlock, M M
2009-01-01
Primary stability is essential to the success of uncemented prostheses. It is strongly influenced by implantation technique, implant design and bone quality. The goal of this study was to investigate the effect of press-fit parameters on the primary stability of uncemented femoral head resurfacing prostheses. An in vitro study with human specimens and prototype implants (nominal radial interference 170 and 420 microm) was used to investigate the effect of interference on primary stability. A finite element model was used to assess the influence of interference, friction between implant and bone, and bone quality. Primary stability was represented by the torque capacity of the implant. The model predicted increasing stability with actual interference, bone quality and friction coefficient; plastic deformation of the bone began at interferences of less than 100 microm. Experimentally, however, stability was not related to interference. This may be due to abrasion or the collapse of trabecular bone structures at higher interferences, which could not be captured by the model. High nominal interferences as tested experimentally appear unlikely to result in improved stability clinically. An implantation force of about 2,500 N was estimated to be sufficient to achieve a torque capacity of about 30 N m with a small interference (70 microm).
2016-10-01
sclerosis as in human PTOA. We also find that PLR is deregulated in human PTOA. We have made great strides in understanding the mechanosensitive regulation...conditions. We conducted an extremely thorough analysis of multiple experimental variables (loading regimen, mouse age, time course analysis) to better...Aim 3. Determine the extent of causality between defective PLR and cartilage degeneration in PTOA. A role for PLR in bone sclerosis
Experimental characterization of recurrent ovarian immature teratoma cells after optimal surgery.
Tanaka, Tetsuji; Toujima, Saori; Utsunomiya, Tomoko; Yukawa, Kazunori; Umesaki, Naohiko
2008-07-01
Minimal optimal surgery without chemotherapy is often performed for patients with ovarian immature teratoma, which frequently occurs in young women who hope for future pregnancies. If tumors recur after the operation, anticancer drug chemotherapy is often administered, although few studies have highlighted differences between the recurrent and the primary tumor cells. Therefore, we have established experimental animal models of recurrent ovarian immature teratoma cells after optimal surgery and characterized the anticancer drug sensitivity and antigenicity of the recurrent tumors. Surgically-excised tumor cells of a grade II ovarian immature teratoma were cultured in vitro and transplanted into nude mice to establish stable cell lines. Differential drug sensitivity and antigenicity of the tumor cells were compared between the primary and the nude mouse tumors. Nude mouse tumor cells showed a normal 46XX karyotype. Cultured primary cells showed a remarkably high sensitivity to paclitaxel, docetaxel, adriamycin and pirarubicin, compared to peritoneal cancer cells obtained from a patient with ovarian adenocarcinomatous peritonitis. The drug sensitivity of teratoma cells to 5-fluorouracil, bleomycin or peplomycin was also significantly higher. However, there was no significant difference in sensitivity to platinum drugs between the primary teratoma and the peritoneal adenocarcinoma cells. As for nude mouse tumor cells, sensitivity to 12 anticancer drugs was significantly lower than that of the primary tumor cells, while there was little difference in sensitivity to carboplatin or peplomycin between the primary and nude mouse tumor cells. Flow cytometry showed that the expression of smooth muscle actin (SMA) significantly decreased in nude mouse tumor cells when compared to cultured primary cells. In conclusion, ovarian immature teratomas with normal karyotypes have a malignant potential to recur after minimal surgery. During nude mouse transplantation, SMA-overexpressing cells appeared to be selectively excluded and nude mouse tumor cells were less sensitive to the majority of anticancer drugs than the primary tumor cells. These results indicate that after optimal surgery for ovarian immature teratoma, recurrent cells can be more resistant to anticancer drugs than the primary tumors. Therefore, it is likely that adjuvant chemotherapy lowers the risk of ovarian immature teratomas recurring after optimal surgery. BEP and PBV regimens are frequently given to teratoma patients. However, paclitaxel/carboplatin or docetaxel/carboplatin, which are the most effective chemotherapy treatments for epithelial ovarian cancer patients, are considered to be an alternative regimen, especially in the prevention of reproductive toxicity.
Yoon, Sung-Hee; Chen, Jinghan; Grynpas, Marc D; Mitchell, Jane
2016-09-01
Glucocorticoids are extensively used to treat patients with Duchenne muscular dystrophy because of their ability to delay muscle damage, prolong ambulation and extend life. However, use of glucocorticoids significantly increases bone loss, fragility and fractures. To determine if antiresorptive bisphosphonates could prevent the effects of glucocorticoids on bone quality, we used dystrophic mdx mice treated with the glucocorticoid prednisone during 8weeks of rapid bone growth from 5 to 13weeks of age and treated some mice with the bisphosphonate pamidronate during the first two weeks of prednisone administration. Prednisone reduced long bone growth, decreased cortical bone thickness and area and decreased the strength of the femurs. Pamidronate treatment protected mice from cortical bone loss but did not increase bone strength. The combination of prednisone and pamidronate inhibited remodeling of metaphyseal trabecular bone with large numbers of trabeculae containing remnants of calcified cartilage. Prednisone improved muscle strength in the mdx mice and decreased serum creatine kinase with evidence of improved muscle histology and these effects were maintained in mice treated with pamidronate. Copyright © 2016. Published by Elsevier Inc.
Shinohara, Masahiro; Chang, Betty Y; Buggy, Joseph J; Nagai, Yusuke; Kodama, Tatsuhiko; Asahara, Hiroshi; Takayanagi, Hiroshi
2014-03-01
Bone-resorbing osteoclasts play an essential role in normal bone homeostasis, as well as in various bone disorders such as osteoporosis and rheumatoid arthritis. Previously we showed that the Tec family of tyrosine kinases is essential for the differentiation of osteoclasts and the inhibition of Btk is a promising strategy for the prevention of the bone loss in osteoclast-associated bone disorders. Here we demonstrate that an orally available Btk inhibitor, ibrutinib (PCI-32765), suppresses osteoclastic bone resorption by inhibiting both osteoclast differentiation and function. Ibrutinib downregulated the expression of NFATc1, the key transcription factor for osteoclastogenesis, and disrupted the formation of the actin ring in mature osteoclasts. In addition, genome-wide screening revealed that Btk regulates the expression of the genes involved in osteoclast differentiation and function in both an NFATc1-dependent and -independent manner. Finally, we showed that ibrutinib administration ameliorated the bone loss that developed in a RANKL-induced osteoporosis mouse model. Thus, this study suggests ibrutinib to be a promising therapeutic agent for osteoclast-associated bone diseases. Copyright © 2013 Elsevier Inc. All rights reserved.
Wnt and the Wnt signaling pathway in bone development and disease
Wang, Yiping; Li, Yi-Ping; Paulson, Christie; Shao, Jian-Zhong; Zhang, Xiaoling; Wu, Mengrui; Chen, Wei
2014-01-01
Wnt signaling affects both bone modeling, which occurs during development, and bone remodeling, which is a lifelong process involving tissue renewal. Wnt signals are especially known to affect the differentiation of osteoblasts. In this review, we summarize recent advances in understanding the mechanisms of Wnt signaling, which is divided into two major branches: the canonical pathway and the noncanonical pathway. The canonical pathway is also called the Wnt/β-catenin pathway. There are two major noncanonical pathways: the Wnt-planar cell polarity pathway (Wnt-PCP pathway) and the Wnt-calcium pathway (Wnt-Ca2+ pathway). This review also discusses how Wnt ligands, receptors, intracellular effectors, transcription factors, and antagonists affect both the bone modeling and bone remodeling processes. We also review the role of Wnt ligands, receptors, intracellular effectors, transcription factors, and antagonists in bone as demonstrated in mouse models. Disrupted Wnt signaling is linked to several bone diseases, including osteoporosis, van Buchem disease, and sclerosteosis. Studying the mechanism of Wnt signaling and its interactions with other signaling pathways in bone will provide potential therapeutic targets to treat these bone diseases. PMID:24389191
Decursin from Angelica gigas suppresses RANKL-induced osteoclast formation and bone loss.
Wang, Xin; Zheng, Ting; Kang, Ju-Hee; Li, Hua; Cho, Hyewon; Jeon, Raok; Ryu, Jae-Ha; Yim, Mijung
2016-03-05
Osteoclasts are the only cells capable of breaking down bone matrix, and excessive activation of osteoclasts is responsible for bone-destructive diseases. In this study, we investigated the effects of decursin from extract of Angelica gigas root on receptor activator of nuclear factor kappa B ligand (RANKL)-induced osteoclast formation using mouse bone marrow-derived macrophages (BMMs). Decursin inhibited RANKL-induced osteoclast formation without cytotoxicity. In particular, decursin maintains the characteristics of macrophages by blocking osteoclast differentiation by RANKL. Furthermore, the RANKL-stimulated bone resorption was diminished by decursin. Mechanistically, decursin blocked the RANKL-triggered ERK mitogen-activated protein kinases (MAPK) phosphorylation, which results in suppression of c-Fos and the nuclear factor of activated T cells (NFATc1) expression. In accordance with the in vitro study, decursin reduced lipopolysaccharide (LPS)- or ovariectomy (OVX)-induced bone loss in vivo. Therefore, decursin exerted an inhibitory effect on osteoclast formation and bone loss in vitro and in vivo. Decursin could be useful for the treatment of bone diseases associated with excessive bone resorption. Copyright © 2016 Elsevier B.V. All rights reserved.
Lee, Su-Ui; Park, Sang-Joon; Kwak, Han Bok; Oh, Jaemin; Min, Yong Ki; Kim, Seong Hwan
2008-01-01
In the field of osteoporosis, there has been growing interest in anabolic agents that enhance bone mass and improve bone architecture. In this study, we demonstrated that the ubiquitous plant triterpenoid, ursolic acid, enhances differentiation and mineralization of osteoblasts in vitro. We found that ursolic acid induced the expression of osteoblast-specific genes with the activation of mitogen-activated protein kinases, nuclear factor-kappaB, and activator protein-1. Additionally, noggin, an antagonist of bone morphogenetic proteins (BMPs), inhibited ursolic acid-induced osteoblast differentiation. Noggin also inhibited the activation of Smad and the induction of BMP-2 mRNA expression by ursolic acid in the late stage of osteoblast differentiation. Importantly, ursolic acid was shown to have bone-forming activity in vivo in a mouse calvarial bone formation model. A high proportion of positive immunostaining of BMP-2 was found in the nuclear region of woven bone formed by ursolic acid. These results suggested that ursolic acid has the anabolic potential to stimulate osteoblast differentiation and enhance new bone formation.
Arriero, María del Mar; Ramis, Joana M.; Perelló, Joan; Monjo, Marta
2012-01-01
Background Inoxitol hexakisphosphate (IP6) has been found to have an important role in biomineralization and a direct effect inhibiting mineralization of osteoblasts in vitro without impairing extracellular matrix production and expression of alkaline phosphatase. IP6 has been proposed to exhibit similar effects to those of bisphosphonates on bone resorption, however, its direct effect on osteoclasts (OCL) is presently unknown. Methodology/Principal Findings The aim of the present study was to investigate the effect of IP6 on the RAW 264.7 monocyte/macrophage mouse cell line and on human primary osteoclasts. On one hand, we show that IP6 decreases the osteoclastogenesis in RAW 264.7 cells induced by RANKL, without affecting cell proliferation or cell viability. The number of TRAP positive cells and mRNA levels of osteoclast markers such as TRAP, calcitonin receptor, cathepsin K and MMP-9 was decreased by IP6 on RANKL-treated cells. On the contrary, when giving IP6 to mature osteoclasts after RANKL treatment, a significant increase of bone resorption activity and TRAP mRNA levels was found. On the other hand, we show that 1 µM of IP6 inhibits osteoclastogenesis of human peripheral blood mononuclear cells (PBMNC) and their resorption activity both, when given to undifferentiated and to mature osteoclasts. Conclusions/Significance Our results demonstrate that IP6 inhibits osteoclastogenesis on human PBMNC and on the RAW264.7 cell line. Thus, IP6 may represent a novel type of selective inhibitor of osteoclasts and prove useful for the treatment of osteoporosis. PMID:22905230
Surface Functionalization of Orthopedic Titanium Implants with Bone Sialoprotein
Ritz, Ulrike; Ackermann, Angelika; Anthonissen, Joris; Kaufmann, Kerstin B.; Brendel, Christian; Götz, Hermann; Rommens, Pol M.; Hofmann, Alexander
2016-01-01
Orthopedic implant failure due to aseptic loosening and mechanical instability remains a major problem in total joint replacement. Improving osseointegration at the bone-implant interface may reduce micromotion and loosening. Bone sialoprotein (BSP) has been shown to enhance bone formation when coated onto titanium femoral implants and in rat calvarial defect models. However, the most appropriate method of BSP coating, the necessary level of BSP coating, and the effect of BSP coating on cell behavior remain largely unknown. In this study, BSP was covalently coupled to titanium surfaces via an aminosilane linker (APTES), and its properties were compared to BSP applied to titanium via physisorption and untreated titanium. Cell functions were examined using primary human osteoblasts (hOBs) and L929 mouse fibroblasts. Gene expression of specific bone turnover markers at the RNA level was detected at different intervals. Cell adhesion to titanium surfaces treated with BSP via physisorption was not significantly different from that of untreated titanium at any time point, whereas BSP application via covalent coupling caused reduced cell adhesion during the first few hours in culture. Cell migration was increased on titanium disks that were treated with higher concentrations of BSP solution, independent of the coating method. During the early phases of hOB proliferation, a suppressive effect of BSP was observed independent of its concentration, particularly when BSP was applied to the titanium surface via physisorption. Although alkaline phosphatase activity was reduced in the BSP-coated titanium groups after 4 days in culture, increased calcium deposition was observed after 21 days. In particular, the gene expression level of RUNX2 was upregulated by BSP. The increase in calcium deposition and the stimulation of cell differentiation induced by BSP highlight its potential as a surface modifier that could enhance the osseointegration of orthopedic implants. Both physisorption and covalent coupling of BSP are similarly effective, feasible methods, although a higher BSP concentration is recommended. PMID:27111551
The regulation and regulatory role of collagenase in bone
NASA Technical Reports Server (NTRS)
Partridge, N. C.; Walling, H. W.; Bloch, S. R.; Omura, T. H.; Chan, P. T.; Pearman, A. T.; Chou, W. Y.
1996-01-01
Interstitial collagenase plays an important role in both the normal and pathological remodeling of collagenous extracellular matrices, including skeletal tissues. The enzyme is a member of the family of matrix metalloproteinases. Only one rodent interstitial collagenase has been found but there are two human enzymes, human collagenase-1 and -3, the latter being the homologue of the rat enzyme. In developing rat and mouse bone, collagenase is expressed by hypertrophic chondrocytes, osteoblasts, and osteocytes, a situation that is replicated in a fracture callus. Cultured osteoblasts derived from neonatal rat calvariae show greater amounts of collagenase transcripts late in differentiation. These levels can be regulated by parathyroid hormone (PTH), retinoic acid, and insulin-like growth factors, as well as the degree of matrix mineralization. Much of the work on collagenase in bone has been derived from studies on the rat osteosarcoma cell line, UMR 106-01. All bone-resorbing agents stimulate these cells to produce collagenase mRNA and protein, with PTH being the most potent stimulator. Determination of secreted levels of collagenase has been difficult because UMR cells, normal rat osteoblasts, and rat fibroblasts possess a scavenger receptor that removes the enzyme from the extracellular space, internalizes and degrades it, thus imposing another level of control. PTH can also regulate the abundance of the receptor as well as the expression and synthesis of the enzyme. Regulation of the collagenase gene by PTH appears to involve the cAMP pathway as well as a primary response gene, possibly Fos, which then contributes to induction of the collagenase gene. The rat collagenase gene contains an activator protein-1 sequence that is necessary for basal expression, but other promoter regions may also participate in PTH regulation. Thus, there are many levels of regulation of collagenase in bone perhaps constraining what would otherwise be a rampant enzyme.
Metabolic analysis of osteoarthritis subchondral bone based on UPLC/Q-TOF-MS.
Yang, Gang; Zhang, Hua; Chen, Tingmei; Zhu, Weiwen; Ding, Shijia; Xu, Kaiming; Xu, Zhongwei; Guo, Yanlei; Zhang, Jian
2016-06-01
Osteoarthritis (OA), one of the most widespread musculoskeletal joint diseases among the aged, is characterized by the progressive loss of articular cartilage and continuous changes in subchondral bone. The exact pathogenesis of osteoarthritis is not completely clear. In this work, ultra-performance liquid chromatography coupled with quadrupole time-of-flight tandem mass spectrometry (UPLC/Q-TOF-MS) in combination with multivariate statistical analysis was applied to analyze the metabolic profiling of subchondral bone from 42 primary osteoarthritis patients. This paper described a modified two-step method for extracting the metabolites of subchondral bone from primary osteoarthritis patients. Finally, 68 metabolites were identified to be significantly changed in the sclerotic subchondral bone compared with the non-sclerotic subchondral bone. Taurine and hypotaurine metabolism and beta-alanine metabolism were probably relevant to the sclerosis of subchondral bone. Taurine, L-carnitine, and glycerophospholipids played a vital regulation role in the pathological process of sclerotic subchondral bone. In the sclerotic process, beta-alanine and L-carnitine might be related to the increase of energy consumption. In addition, our findings suggested that the intra-cellular environment of sclerotic subchondral bone might be more acidotic and hypoxic compared with the non-sclerotic subchondral bone. In conclusion, this study provided a new insight into the pathogenesis of subchondral bone sclerosis. Our results indicated that metabolomics could serve as a promising approach for elucidating the pathogenesis of subchondral bone sclerosis in primary osteoarthritis. Graphical Abstract Metabolic analysis of osteoarthritis subchondral bone.
Chai, Ryan C; Kouspou, Michelle M; Lang, Benjamin J; Nguyen, Chau H; van der Kraan, A Gabrielle J; Vieusseux, Jessica L; Lim, Reece C; Gillespie, Matthew T; Benjamin, Ivor J; Quinn, Julian M W; Price, John T
2014-05-09
Many anticancer therapeutic agents cause bone loss, which increases the risk of fractures that severely reduce quality of life. Thus, in drug development, it is critical to identify and understand such effects. Anticancer therapeutic and HSP90 inhibitor 17-(allylamino)-17-demethoxygeldanamycin (17-AAG) causes bone loss by increasing osteoclast formation, but the mechanism underlying this is not understood. 17-AAG activates heat shock factor 1 (Hsf1), the master transcriptional regulator of heat shock/cell stress responses, which may be involved in this negative action of 17-AAG upon bone. Using mouse bone marrow and RAW264.7 osteoclast differentiation models we found that HSP90 inhibitors that induced a heat shock response also enhanced osteoclast formation, whereas HSP90 inhibitors that did not (including coumermycin A1 and novobiocin) did not affect osteoclast formation. Pharmacological inhibition or shRNAmir knockdown of Hsf1 in RAW264.7 cells as well as the use of Hsf1 null mouse bone marrow cells demonstrated that 17-AAG-enhanced osteoclast formation was Hsf1-dependent. Moreover, ectopic overexpression of Hsf1 enhanced 17-AAG effects upon osteoclast formation. Consistent with these findings, protein levels of the essential osteoclast transcription factor microphthalmia-associated transcription factor were increased by 17-AAG in an Hsf1-dependent manner. In addition to HSP90 inhibitors, we also identified that other agents that induced cellular stress, such as ethanol, doxorubicin, and methotrexate, also directly increased osteoclast formation, potentially in an Hsf1-dependent manner. These results, therefore, indicate that cellular stress can enhance osteoclast differentiation via Hsf1-dependent mechanisms and may significantly contribute to pathological and therapeutic related bone loss.
Oestreich, Arin K.; Kamp, William M.; McCray, Marcus G.; Carleton, Stephanie M.; Karasseva, Natalia; Lenz, Kristin L.; Jeong, Youngjae; Daghlas, Salah A.; Yao, Xiaomei; Wang, Yong; Pfeiffer, Ferris M.; Ellersieck, Mark R.; Schulz, Laura C.; Phillips, Charlotte L.
2016-01-01
During fetal development, the uterine environment can have effects on offspring bone architecture and integrity that persist into adulthood; however, the biochemical and molecular mechanisms remain unknown. Myostatin is a negative regulator of muscle mass. Parental myostatin deficiency (Mstntm1Sjl/+) increases muscle mass in wild-type offspring, suggesting an intrauterine programming effect. Here, we hypothesized that Mstntm1Sjl/+ dams would also confer increased bone strength. In wild-type offspring, maternal myostatin deficiency altered fetal growth and calvarial collagen content of newborn mice and conferred a lasting impact on bone geometry and biomechanical integrity of offspring at 4 mo of age, the age of peak bone mass. Second, we sought to apply maternal myostatin deficiency to a mouse model with osteogenesis imperfecta (Col1a2oim), a heritable connective tissue disorder caused by abnormalities in the structure and/or synthesis of type I collagen. Femora of male Col1a2oim/+ offspring from natural mating of Mstntm1Sjl/+ dams to Col1a2oim/+sires had a 15% increase in torsional ultimate strength, a 29% increase in tensile strength, and a 24% increase in energy to failure compared with age, sex, and genotype-matched offspring from natural mating of Col1a2oim/+ dams to Col1a2oim/+ sires. Finally, increased bone biomechanical strength of Col1a2oim/+ offspring that had been transferred into Mstntm1Sjl/+ dams as blastocysts demonstrated that the effects of maternal myostatin deficiency were conferred by the postimplantation environment. Thus, targeting the gestational environment, and specifically prenatal myostatin pathways, provides a potential therapeutic window and an approach for treating osteogenesis imperfecta. PMID:27821779
Loss of c-Kit function impairs arteriogenesis in a mouse model of hindlimb ischemia.
Hernandez, Diana R; Artiles, Adriana; Duque, Juan C; Martinez, Laisel; Pinto, Mariana T; Webster, Keith A; Velazquez, Omaida C; Vazquez-Padron, Roberto I; Lassance-Soares, Roberta M
2018-04-01
Arteriogenesis is a process whereby collateral vessels remodel usually in response to increased blood flow and/or wall stress. Remodeling of collaterals can function as a natural bypass to alleviate ischemia during arterial occlusion. Here we used a genetic approach to investigate possible roles of tyrosine receptor c-Kit in arteriogenesis. Mutant mice with loss of c-Kit function (Kit W/W-v ), and controls were subjected to hindlimb ischemia. Blood flow recovery was evaluated pre-, post-, and weekly after ischemia. Foot ischemic damage and function were assessed between days 1 to 14 post-ischemia while collaterals remodeling were measured 28 days post-ischemia. Both groups of mice also were subjected to wild type bone marrow cells transplantation 3 weeks before hindlimb ischemia to evaluate possible contributions of defective bone marrow c-Kit expression on vascular recovery. Kit W/W-v mice displayed impaired blood flow recovery, greater ischemic damage and foot dysfunction after ischemia compared to controls. Kit W/W-v mice also demonstrated impaired collateral remodeling consistent with flow recovery findings. Because arteriogenesis is a biological process that involves bone marrow-derived cells, we investigated which source of c-Kit signaling (bone marrow or vascular) plays a major role in arteriogenesis. Kit W/W-v mice transplanted with bone marrow wild type cells exhibited similar phenotype of impaired blood flow recovery, greater tissue ischemic damage and foot dysfunction as nontransplanted Kit W/W-v mice. This study provides evidence that c-Kit signaling is required during arteriogenesis. Also, it strongly suggests a vascular role for c-Kit signaling because rescue of systemic c-Kit activity by bone marrow transplantation did not augment the functional recovery of Kit W/W-v mouse hindlimbs. Copyright © 2017 Elsevier Inc. All rights reserved.
Oestreich, Arin K; Kamp, William M; McCray, Marcus G; Carleton, Stephanie M; Karasseva, Natalia; Lenz, Kristin L; Jeong, Youngjae; Daghlas, Salah A; Yao, Xiaomei; Wang, Yong; Pfeiffer, Ferris M; Ellersieck, Mark R; Schulz, Laura C; Phillips, Charlotte L
2016-11-22
During fetal development, the uterine environment can have effects on offspring bone architecture and integrity that persist into adulthood; however, the biochemical and molecular mechanisms remain unknown. Myostatin is a negative regulator of muscle mass. Parental myostatin deficiency (Mstn tm1Sjl/+ ) increases muscle mass in wild-type offspring, suggesting an intrauterine programming effect. Here, we hypothesized that Mstn tm1Sjl/+ dams would also confer increased bone strength. In wild-type offspring, maternal myostatin deficiency altered fetal growth and calvarial collagen content of newborn mice and conferred a lasting impact on bone geometry and biomechanical integrity of offspring at 4 mo of age, the age of peak bone mass. Second, we sought to apply maternal myostatin deficiency to a mouse model with osteogenesis imperfecta (Col1a2 oim ), a heritable connective tissue disorder caused by abnormalities in the structure and/or synthesis of type I collagen. Femora of male Col1a2 oim/+ offspring from natural mating of Mstn tm1Sjl/+ dams to Col1a2 oim/+ sires had a 15% increase in torsional ultimate strength, a 29% increase in tensile strength, and a 24% increase in energy to failure compared with age, sex, and genotype-matched offspring from natural mating of Col1a2 oim/+ dams to Col1a2 oim/+ sires. Finally, increased bone biomechanical strength of Col1a2 oim/+ offspring that had been transferred into Mstn tm1Sjl/+ dams as blastocysts demonstrated that the effects of maternal myostatin deficiency were conferred by the postimplantation environment. Thus, targeting the gestational environment, and specifically prenatal myostatin pathways, provides a potential therapeutic window and an approach for treating osteogenesis imperfecta.
Yang, Haisheng; Albiol, Laia; Chan, Wing-Lee; Wulsten, Dag; Seliger, Anne; Thelen, Michael; Thiele, Tobias; Spevak, Lyudmila; Boskey, Adele; Kornak, Uwe; Checa, Sara; Willie, Bettina M
2017-12-08
Gerodermia osteodysplastica (GO) is a segmental progeroid disorder caused by loss-of-function mutations in the GORAB gene, associated with early onset osteoporosis and bone fragility. A conditional mouse model of GO (Gorab Prx1 ) was generated in which the Gorab gene was deleted in long bones. We examined the biomechanical/functional relevance of the Gorab Prx1 mutants as a premature aging model by characterizing bone composition, tissue-level strains, and whole-bone morphology and mechanical properties of the tibia. MicroCT imaging showed that Gorab Prx1 tibiae had an increased anterior convex curvature and decreased cortical cross-sectional area, cortical thickness and moments of inertia, compared to littermate control (LC) tibiae. Fourier transform infrared (FTIR) imaging indicated a 34% decrease in mineral/matrix ratio and a 27% increase in acid phosphate content in the posterior metaphyseal cortex of the Gorab Prx1 tibiae (p < .05), suggesting delayed mineralization. In vivo strain gauge measurement and finite element analysis showed ∼two times higher tissue-level strains within the Gorab Prx1 tibiae relative to LC tibiae when subjected to axial compressive loads of the same magnitude. Three-point bending tests suggested that Gorab Prx1 tibiae were weaker and more brittle, as indicated by decreasing whole-bone strength (46%), stiffness (55%), work-to-fracture (61%) and post-yield displacement (47%). Many of these morphological and biomechanical characteristics of the Gorab Prx1 tibia recapitulated changes in other animal models of skeletal aging. Future studies are necessary to confirm how our observations might guide the way to a better understanding and treatment of GO. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bone marrow cell migration to the heart in a chimeric mouse model of acute chagasic disease
Irion, Camila Iansen; Paredes, Bruno Diaz; Brasil, Guilherme Visconde; da Cunha, Sandro Torrentes; Paula, Luis Felipe; Carvalho, Alysson Roncally; de Carvalho, Antonio Carlos Campos; Carvalho, Adriana Bastos; Goldenberg, Regina Coeli dos Santos
2017-01-01
BACKGROUND Chagas disease is a public health problem caused by infection with the protozoan Trypanosoma cruzi. There is currently no effective therapy for Chagas disease. Although there is some evidence for the beneficial effect of bone marrow-derived cells in chagasic disease, the mechanisms underlying their effects in the heart are unknown. Reports have suggested that bone marrow cells are recruited to the chagasic heart; however, studies using chimeric mouse models of chagasic cardiomyopathy are rare. OBJECTIVES The aim of this study was to investigate the migration of bone marrow cells to the heart after T. cruzi infection in a model of chagasic disease in chimeric mice. METHODS To obtain chimerical mice, wild-type (WT) C57BL6 mice were exposed to full body irradiation (7 Gy), causing bone marrow ablation. Then, bone marrow cells from green fluorescent protein (GFP)-transgenic mice were infused into the mice. Graft effectiveness was confirmed by flow cytometry. Experimental mice were divided into four groups: (i) infected chimeric (iChim) mice; (ii) infected WT (iWT) mice, both of which received 3 × 104 trypomastigotes of the Brazil strain; (iii) non-infected chimeric (Chim) mice; and (iv) non-infected WT mice. FINDINGS At one-month post-infection, iChim and iWT mice showed first degree atrioventricular block with decreased heart rate and treadmill exercise parameters compared to those in the non-infected groups. MAIN CONCLUSIONS iChim mice showed an increase in parasitaemia, myocarditis, and the presence of amastigote nests in the heart tissue compared to iWT mice. Flow cytometry analysis did not detect haematopoietic progenitor cells in the hearts of infected mice. Furthermore, GFP+ cardiomyocytes were not detected in the tissues of chimeric mice. PMID:28767980
Bone marrow cell migration to the heart in a chimeric mouse model of acute chagasic disease.
Irion, Camila Iansen; Paredes, Bruno Diaz; Brasil, Guilherme Visconde; Cunha, Sandro Torrentes da; Paula, Luis Felipe; Carvalho, Alysson Roncally; Carvalho, Antonio Carlos Campos de; Carvalho, Adriana Bastos; Goldenberg, Regina Coeli Dos Santos
2017-08-01
Chagas disease is a public health problem caused by infection with the protozoan Trypanosoma cruzi. There is currently no effective therapy for Chagas disease. Although there is some evidence for the beneficial effect of bone marrow-derived cells in chagasic disease, the mechanisms underlying their effects in the heart are unknown. Reports have suggested that bone marrow cells are recruited to the chagasic heart; however, studies using chimeric mouse models of chagasic cardiomyopathy are rare. The aim of this study was to investigate the migration of bone marrow cells to the heart after T. cruzi infection in a model of chagasic disease in chimeric mice. To obtain chimerical mice, wild-type (WT) C57BL6 mice were exposed to full body irradiation (7 Gy), causing bone marrow ablation. Then, bone marrow cells from green fluorescent protein (GFP)-transgenic mice were infused into the mice. Graft effectiveness was confirmed by flow cytometry. Experimental mice were divided into four groups: (i) infected chimeric (iChim) mice; (ii) infected WT (iWT) mice, both of which received 3 × 104 trypomastigotes of the Brazil strain; (iii) non-infected chimeric (Chim) mice; and (iv) non-infected WT mice. At one-month post-infection, iChim and iWT mice showed first degree atrioventricular block with decreased heart rate and treadmill exercise parameters compared to those in the non-infected groups. iChim mice showed an increase in parasitaemia, myocarditis, and the presence of amastigote nests in the heart tissue compared to iWT mice. Flow cytometry analysis did not detect haematopoietic progenitor cells in the hearts of infected mice. Furthermore, GFP+ cardiomyocytes were not detected in the tissues of chimeric mice.
Cardiotonic agent milrinone stimulates resorption in rodent bone organ culture.
Krieger, N S; Stappenbeck, T S; Stern, P H
1987-01-01
The cardiotonic agent amrinone inhibits bone resorption in vitro. Milrinone, an amrinone analog, is a more potent cardiotonic agent with lower toxicity. In contrast to amrinone, milrinone stimulated resorption in cultures of neonatal mouse calvaria and fetal rat limb bones. Threshold doses were 0.1 microM in calvaria and 0.1 mM in limb bones; maximal stimulation occurred in calvaria at 0.1 mM. Maximal responses to milrinone and parathyroid hormone were comparable. Milrinone concentrations below 0.1 mM did not affect calvarial cyclic AMP. 0.5 microM indomethacin inhibited milrinone effects in calvaria but usually not in limb bones. 3 nM calcitonin inhibited milrinone-stimulated resorption and there was no escape from this inhibition. Structural homology between milrinone and thyroxine has been reported. We find similarities between milrinone and thyroxine actions on bone, because prostaglandin production was crucial for the effects of both agents in calvaria but not in limb bones, and neither agent exhibited escape from calcitonin inhibition. PMID:3027124
Targeting skeletal endothelium to ameliorate bone loss.
Xu, Ren; Yallowitz, Alisha; Qin, An; Wu, Zhuhao; Shin, Dong Yeon; Kim, Jung-Min; Debnath, Shawon; Ji, Gang; Bostrom, Mathias P; Yang, Xu; Zhang, Chao; Dong, Han; Kermani, Pouneh; Lalani, Sarfaraz; Li, Na; Liu, Yifang; Poulos, Michael G; Wach, Amanda; Zhang, Yi; Inoue, Kazuki; Di Lorenzo, Annarita; Zhao, Baohong; Butler, Jason M; Shim, Jae-Hyuck; Glimcher, Laurie H; Greenblatt, Matthew B
2018-06-01
Recent studies have identified a specialized subset of CD31 hi endomucin hi (CD31 hi EMCN hi ) vascular endothelium that positively regulates bone formation. However, it remains unclear how CD31 hi EMCN hi endothelium levels are coupled to anabolic bone formation. Mice with an osteoblast-specific deletion of Shn3, which have markedly elevated bone formation, demonstrated an increase in CD31 hi EMCN hi endothelium. Transcriptomic analysis identified SLIT3 as an osteoblast-derived, SHN3-regulated proangiogenic factor. Genetic deletion of Slit3 reduced skeletal CD31 hi EMCN hi endothelium, resulted in low bone mass because of impaired bone formation and partially reversed the high bone mass phenotype of Shn3 -/- mice. This coupling between osteoblasts and CD31 hi EMCN hi endothelium is essential for bone healing, as shown by defective fracture repair in SLIT3-mutant mice and enhanced fracture repair in SHN3-mutant mice. Finally, administration of recombinant SLIT3 both enhanced bone fracture healing and counteracted bone loss in a mouse model of postmenopausal osteoporosis. Thus, drugs that target the SLIT3 pathway may represent a new approach for vascular-targeted osteoanabolic therapy to treat bone loss.
Mammalian bone palaeohistology: a survey and new data with emphasis on island forms
Scheyer, Torsten M.; Veitschegger, Kristof; Forasiepi, Analia M.; Amson, Eli; Van der Geer, Alexandra A.E.; Van den Hoek Ostende, Lars W.; Hayashi, Shoji; Sánchez-Villagra, Marcelo R.
2015-01-01
The interest in mammalian palaeohistology has increased dramatically in the last two decades. Starting in 1849 via descriptive approaches, it has been demonstrated that bone tissue and vascularisation types correlate with several biological variables such as ontogenetic stage, growth rate, and ecology. Mammalian bone displays a large variety of bone tissues and vascularisation patterns reaching from lamellar or parallel-fibred to fibrolamellar or woven-fibred bone, depending on taxon and individual age. Here we systematically review the knowledge and methods on cynodont and mammalian bone microstructure as well as palaeohistology and discuss potential future research fields and techniques. We present new data on the bone microstructure of two extant marsupial species and of several extinct continental and island placental mammals. Extant marsupials display mainly parallel-fibred primary bone with radial and oblique but mainly longitudinal vascular canals. Three juvenile specimens of the dwarf island hippopotamid Hippopotamus minor from the Late Pleistocene of Cyprus show reticular to plexiform fibrolamellar bone. The island murid Mikrotia magna from the Late Miocene of Gargano, Italy displays parallel-fibred primary bone with reticular vascularisation and strong remodelling in the middle part of the cortex. Leithia sp., the dormouse from the Pleistocene of Sicily, is characterised by a primary bone cortex consisting of lamellar bone and a high amount of compact coarse cancellous bone. The bone cortex of the fossil continental lagomorph Prolagus oeningensis and three fossil species of insular Prolagus displays mainly parallel-fibred primary bone and reticular, radial as well as longitudinal vascularisation. Typical for large mammals, secondary bone in the giant rhinocerotoid Paraceratherium sp. from the Late Oligocene of Turkey is represented by dense Haversian bone. The skeletochronological features of Sinomegaceros yabei, a large-sized deer from the Pleistocene of Japan closely related to Megaloceros, indicate a high growth rate. These examples and the synthesis of existing data show the potential of bone microstructure to reveal essential information on life history evolution. The bone tissue and the skeletochronological data of the sampled island species suggest the presence of various modes of bone histological modification and mammalian life history evolution on islands to depend on factors of island evolution such as island size, distance from mainland, climate, phylogeny, and time of evolution. PMID:26528418
Onal, Melda; Bishop, Kathleen A; St John, Hillary C; Danielson, Allison L; Riley, Erin M; Piemontese, Marilina; Xiong, Jinhu; Goellner, Joseph J; O'Brien, Charles A; Pike, J Wesley
2015-05-01
Receptor activator of NF-κB ligand (RANKL) is a TNFα-like cytokine that is produced by a diverse set of lineage-specific cells and is involved in a wide variety of physiological processes that include skeletal remodeling, lymph node organogenesis, mammary gland development, and thermal regulation. Consistent with these diverse functions, control of RANKL expression is accomplished in a cell-specific fashion via a set of at least 10 regulatory enhancers that are located up to 170 kb upstream of the gene's transcriptional start site. Here we examined the in vivo consequence of introducing a contiguous DNA segment containing these components into a genetically deleted RANKL null mouse strain. In contrast to RANKL null littermates, null mice containing the transgene exhibited normalized body size, skeletal development, and bone mass as well as normal bone marrow cavities, normalized spleen weights, and the presence of developed lymph nodes. These mice also manifested normalized reproductive capacity, including the ability to lactate and to produce normal healthy litters. Consistent with this, the transgene restored endogenous-like RANKL transcript levels in several RANKL-expressing tissues. Most importantly, restoration of RANKL expression from this segment of DNA was fully capable of rescuing the complex aberrant skeletal and immune phenotype of the RANKL null mouse. RANKL also restored appropriate levels of B220+ IgM+ and B220+ IgD+ B cells in spleen. Finally, we found that RANKL expression from this transgene was regulated by exogenously administered 1,25(OH)2 D3 , parathyroid hormone (PTH), and lipopolysaccharide (LPS), thus recapitulating the ability of these same factors to regulate the endogenous gene. These findings fully highlight the properties of the Tnfsf11 gene locus predicted through previous in vitro dissection. We conclude that the mouse Tnfsf11 gene locus identified originally through unbiased chromatin immunoprecipitation with DNA microarray (ChIP-chip) analysis contains the necessary genetic information to direct appropriate tissue-specific and factor-regulated RANKL expression in vivo. © 2014 American Society for Bone and Mineral Research.
Cadieux, Brigitte; Blanchfield, Burke; Smith, James P; Austin, John W
2005-05-01
A simple, rapid, cost-effective in vitro slot blot immunoassay was developed for the detection and quantification of botulinum neurotoxin type E (BoNT/E) in cultures. Culture supernatants of 36 strains of clostridia, including 12 strains of Clostridium botulinum type E, 12 strains of other C. botulinum neurotoxin serotypes, and 12 strains of other clostridial species were tested. Samples containing BoNT/E were detected using affinity-purified polyclonal rabbit antisera prepared against BoNT/E with subsequent detection of secondary antibodies using chemiluminescence. All strains of C. botulinum type E tested positive, while all non C. botulinum type E strains tested negative. The sensitivity of the slot blot immunoassay for detection of BoNT/E was approximately four mouse lethal doses (MLD). The intensity of chemiluminescence was directly correlated with the concentration of BoNT/E up to 128 MLD, allowing quantification of BoNT/E between 4 and 128 MLD. The slot blot immunoassay was compared to the mouse bioassay for detection of BoNT/E using cultures derived from fish samples inoculated with C. botulinum type E, and cultures derived from naturally contaminated environmental samples. A total of 120 primary enrichment cultures derived from fish samples, of which 103 were inoculated with C. botulinum type E, and 17 were uninoculated controls, were assayed. Of the 103 primary enrichment cultures derived from inoculated fish samples, all were positive by mouse bioassay, while 94 were also positive by slot blot immunoassay, resulting in a 7.5% false-negative rate. All 17 primary enrichment cultures derived from the uninoculated fish samples were negative by both mouse bioassay and slot blot immunoassay. A total of twenty-six primary enrichment cultures derived from environmental samples were tested by mouse bioassay and slot blot immunoassay. Of 13 primary enrichment cultures positive by mouse bioassay, 12 were also positive by slot blot immunoassay, resulting in a 3.8% false-negative rate. All 13 primary enrichment cultures that tested negative by mouse bioassay also tested negative by slot blot immunoassay. The slot blot immunoassay could be used routinely as a positive screen for BoNT/E in primary enrichment cultures, and could be used as a replacement for the mouse bioassay for pure cultures.
Onal, M.; St John, H.C.; Danielson, A.L.; Pike, J.W.
2016-01-01
Receptor activator of nuclear factor-κB ligand (RANKL) is a TNF-like cytokine that is necessary for osteoclast formation and survival. Elevated RANKL synthesis is associated with both increased osteoclast number and bone resorption. Earlier studies identified an enhancer 76 kb upstream of the Tnfsf11 transcriptional start site (TSS) termed RL-D5 or the distal control region (DCR) that modulates RANKL expression in response to PTH, 1,25(OH)2D3, and an array of cytokines. Mice lacking RL-D5 exhibit high bone mass associated with decreased RANKL expression in bone, spleen, and thymus. In addition to RL-D5, genome-wide studies have identified 9 additional Tnfsf11 enhancers residing upstream of the gene’s TSS, which provide RANKL cell type-specificity and responsiveness to local and systemic factors. ChIP-chip analysis has revealed inducible VDR and CREB binding at an enhancer termed RL-D2 23 kb upstream of the Tnfsf11 TSS in osteoblastic ST2 cells. Herein, we use ChIP-seq analysis to confirm this finding and delete this enhancer from the mouse genome to determine its physiological role in vivo. RL-D2−/− primary stromal cells showed decreased RANKL-induction by both forskolin and 1,25(OH)2D3 ex vivo. Consistent with this, the PTH induction of RANKL expression was significantly blunted in RL-D2−/− mice in vivo. In contrast, lack of RL-D2 had no effect on 1,25(OH)2D3 induction of RANKL in vivo. Similar to the results seen in RL-D5−/− mice, lack of RL-D2 led to decreased skeletal RANKL expression, resulting in decreased osteoclast numbers and a progressive increase in bone mineral density. Lack of RL-D2 increased cancellous bone mass in femur and spine, but did not alter femoral cortical bone thickness. These results highlight the role of distal enhancers in the regulation of RANKL expression by PTH and perhaps 1,25(OH)2D3, and suggest that the RL-D2 and RL-D5 enhancers contribute in either an additive or synergistic manner to regulate bone remodeling. PMID:26332516
DC-STAMP Is an Osteoclast Fusogen Engaged in Periodontal Bone Resorption
Wisitrasameewong, W.; Kajiya, M.; Movila, A.; Rittling, S.; Ishii, T.; Suzuki, M.; Matsuda, S.; Mazda, Y.; Torruella, M.R.; Azuma, M.M.; Egashira, K.; Freire, M.O.; Sasaki, H.; Wang, C.Y.; Han, X.; Taubman, M.A.; Kawai, T.
2017-01-01
Dendritic cell-specific transmembrane protein (DC-STAMP) plays a key role in the induction of osteoclast (OC) cell fusion, as well as DC-mediated immune regulation. While DC-STAMP gene expression is upregulated in the gingival tissue with periodontitis, its pathophysiological roles in periodontitis remain unclear. To evaluate the effects of DC-STAMP in periodontitis, anti-DC-STAMP–monoclonal antibody (mAb) was tested in a mouse model of ligature-induced periodontitis (n = 6–7/group) where Pasteurella pneumotropica (Pp)-reactive immune response activated T cells to produce receptor activator of nuclear factor kappa-B ligand (RANKL), which, in turn, promotes the periodontal bone loss via upregulation of osteoclastogenesis. DC-STAMP was expressed on the cell surface of mature multinuclear OCs, as well as immature mononuclear OCs, in primary cultures of RANKL-stimulated bone marrow cells. Anti-DC-STAMP-mAb suppressed the emergence of large, but not small, multinuclear OCs, suggesting that DC-STAMP is engaged in the late stage of cell fusion. Anti-DC-STAMP-mAb also inhibited pit formation caused by RANKL-stimulated bone marrow cells. Attachment of ligature to a second maxillary molar induced DC-STAMP messenger RNA and protein, along with elevated tartrate-resistant acid phosphatase–positive (TRAP+) OCs and alveolar bone loss. As we expected, systemic administration of anti-DC-STAMP-mAb downregulated the ligature-induced alveolar bone loss. Importantly, local injection of anti-DC-STAMP-mAb also suppressed alveolar bone loss and reduced the total number of multinucleated TRAP+ cells in mice that received ligature attachment. Attachment of ligature induced significantly elevated tumor necrosis factor–α, interleukin-1β, and RANKL in the gingival tissue compared with the control site without ligature (P < 0.05), which was unaffected by local injection with either anti-DC-STAMP-mAb or control-mAb. Neither in vivo anti-Pp IgG antibody nor in vitro anti-Pp T-cell response and resultant production of RANKL was affected by anti-DC-STAMP-mAb. This study illustrated the roles of DC-STAMP in promoting local OC cell fusion without affecting adaptive immune responses to oral bacteria. Therefore, it is plausible that a novel therapeutic regimen targeting DC-STAMP could suppress periodontal bone loss. PMID:28199142
Occurrence of metastases in beagles with skeletal malignancies induced by internal irradiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lloyd, R.D.; Angus, W.; Taylor, G.N.
1994-03-01
Metastases from malignant bone tumors often are responsible for the fatal effects of these cancers. Characteristics of primary skeletal malignancies in beagles injected with bone-seeking radionuclides were studied by Thurman (1971) and summarized by Thurman et al. (1971). There were 212 tumors in 186 of these dogs for which we subsequently received information on bone tumor metastases. Evaluation of bone and soft tissue slides from these animals allowed us to compare parameters reported previously with the occurrence of grossly apparent bone tumor metastases. Data included growth-rate of the primary tumor, volume of the primary tumor at death, sex of themore » animal, growth period of the primary tumor, degree of calcification of the primary tumor, skeletal location of the primary tumor, cumulative radiation dose to the skeleton, dose equivalent to the skeleton, and year of death. For most of the comparisons, no significant differences could be established between dogs with and without metastases. However, tumor volume at death appeared to be correlated with probability of metastasis (p < 0.05), with the larger tumors being associated with higher rates of metastasis. Comparisons of dogs with and without metastases as a function of tumor growth-rate did not, for the most part, yield significantly different results between groups. 10 refs., 11 tabs.« less
Expression analysis of G Protein-Coupled Receptors in mouse macrophages.
Lattin, Jane E; Schroder, Kate; Su, Andrew I; Walker, John R; Zhang, Jie; Wiltshire, Tim; Saijo, Kaoru; Glass, Christopher K; Hume, David A; Kellie, Stuart; Sweet, Matthew J
2008-04-29
Monocytes and macrophages express an extensive repertoire of G Protein-Coupled Receptors (GPCRs) that regulate inflammation and immunity. In this study we performed a systematic micro-array analysis of GPCR expression in primary mouse macrophages to identify family members that are either enriched in macrophages compared to a panel of other cell types, or are regulated by an inflammatory stimulus, the bacterial product lipopolysaccharide (LPS). Several members of the P2RY family had striking expression patterns in macrophages; P2ry6 mRNA was essentially expressed in a macrophage-specific fashion, whilst P2ry1 and P2ry5 mRNA levels were strongly down-regulated by LPS. Expression of several other GPCRs was either restricted to macrophages (e.g. Gpr84) or to both macrophages and neural tissues (e.g. P2ry12, Gpr85). The GPCR repertoire expressed by bone marrow-derived macrophages and thioglycollate-elicited peritoneal macrophages had some commonality, but there were also several GPCRs preferentially expressed by either cell population. The constitutive or regulated expression in macrophages of several GPCRs identified in this study has not previously been described. Future studies on such GPCRs and their agonists are likely to provide important insights into macrophage biology, as well as novel inflammatory pathways that could be future targets for drug discovery.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsai, M.; Takeishi, Takashi; Geissler, E.N.
1991-07-15
The authors investigated the effects of a newly recognized multifunctional growth factor, the c-kit ligand stem cell factor (SCF), on mouse mast cell proliferation and phenotype. Recombinant rat SCF{sup 164} (rrSCF{sup 164}) induced the development of large numbers of dermal mast cells in normal mice in vivo. Many of these mast cells had features of connective tissue-type mast cells (CTMC), in that they were reactive both with the heparin-binding fluorescent dye berberine sulfate and with safranin. In vitro, rrSCF{sup 164} induced the proliferation of cloned interleukin 3 (IL-3)-dependent mouse mast cells and primary populations of IL-3-dependent, bone marrow-derived cultured mastmore » cells (BMCMC), which represent immature mast cells, and purified peritoneal mast cells, which represent a type of mature CTMC> BMCMC maintained in rrSCF{sup 164} not only proliferated but also matured. These findings identify SCF as a single cytokine that can induce immature, IL-3-dependent mast cells to mature and to acquire multiple characteristics of CTMC. These findings also directly demonstrate that SCF can regulate the development of a cellular lineage expressing c-kit through effects on both proliferation and maturation.« less
Primary Ewing's Sarcoma of the Temporal Bone: A Rare Case Report and Literature Review.
Gupta, Divya; Gulati, Achal; Purnima
2017-09-01
Ewing's sarcoma is a malignant, round cell tumor arising from the bones and primarily affecting children and adolescent, accounting for 3 % of all childhood malignancies. Although the long bones and the trunk are typically affected, rare cases of it involving isolated bones throughout the body have been reported. Involvement of the skull bones is rare, constituting 1-6 % of the total Ewing's sarcoma cases but those affecting the cranial bones are rarer still, constituting only 1 %. We describe an 8 months old infant having Ewing sarcoma, of the petrous and mastoid parts of temporal bone along with the occipital bone, whose clinical presentation mimicked mastoiditis with facial nerve palsy. We discuss the clinical and therapeutic course of an extensive primary Ewing sarcoma of the temporal bone, which was treated without performing surgery and review this entity's literature in detail.
Choroidal metastasis from primary bone leiomyosarcoma.
Cristina, Nieto Gómez; Francisco, Escudero Domínguez; Vanesa, Rivero Gutiérrez; Fernando, Cruz González; Luis, Cacharro Moras; Emiliano, Hernández Galilea
2015-10-01
Choroidal metastases, the most common form of intraocular malignancies, are principally caused by primary tumors from breast, lung, and gastrointestinal tract. These lesions are mostly symptomatic and rarely detected incidentally in the extension study of a previously diagnosed tumor. Leiomyosarcoma is a neoplasm of mesenchymal cells with smooth muscle differentiation and represents the most prevalent soft-tissue sarcoma. Leiomyosarcoma is a notably rare tumor in ophthalmic region. We report a case of primary bone leiomyosarcoma metastatic to the choroid that was treated with chemotherapy and surgery. Although three cases of choroidal metastasis from leiomyosarcomas have been already reported, to our knowledge this is the first case of choroidal metastasis from primary bone leiomyosarcoma.
Dacquin, Romain; Starbuck, Michael; Schinke, Thorsten; Karsenty, Gérard
2002-06-01
Cell- and time-specific gene inactivation should enhance our knowledge of bone biology. Implementation of this technique requires construction of transgenic mouse lines expressing Cre recombinase in osteoblasts, the bone forming cell. We tested several promoter fragments for their ability to drive efficient Cre expression in osteoblasts. In the first mouse transgenic line, the Cre gene was placed under the control of the 2.3-kb proximal fragment of the alpha1(I)-collagen promoter, which is expressed at high levels in osteoblasts throughout their differentiation. Transgenic mice expressing this transgene in bone were bred with the ROSA26 reporter (R26R) strain in which the ROSA26 locus is targeted with a conditional LacZ reporter cassette. In R26R mice, Cre expression and subsequent Cre-mediated recombination lead to expression of the LacZ reporter gene, an event that can be monitored by LacZ staining. LacZ staining was detected in virtually all osteoblasts of alpha1(I)-Cre;R26R mice indicating that homologous recombination occurred in these cells. No other cell type stained blue. In the second line studied, the 1.3-kb fragment of osteocalcin gene 2 (OG2) promoter, which is active in differentiated osteoblasts, was used to drive Cre expression. OG2-Cre mice expressed Cre specifically in bone. However, cross of OG2-Cre mice with R26R mice did not lead to any detectable LacZ staining in osteoblasts. Lastly, we tested a more active artificial promoter derived from the OG2 promoter. The artificial OG2-Cre transgene was expressed by reverse transcriptase-polymerase chain reaction in cartilage and bone samples. After cross of the artificial OG2-Cre mice with R26R mice, we detected a LacZ staining in articular chondrocytes but not in osteoblasts. Our data suggest that the only promoter able to drive Cre expression at a level sufficient to induce recombination in osteoblasts is the alpha1(I)-collagen promoter. Copyright 2002 Wiley-Liss, Inc.
COMPARISON OF THE EFFECTS OF PAPAIN AND VITAMIN A ON CARTILAGE
Fell, Honor B.; Thomas, Lewis
1960-01-01
The effects of papain protease and of vitamin A on explanted limb bone rudiments from 7- and 13-day chick embryos and fetal mice have been studied and compared. The incubation of cartilaginous rudiments from 7-day chick embryos in a solution containing papain and cysteine resulted in complete loss of the metachromasia of the cartilage matrix within 1 hour; explants treated in this fashion recovered normal metachromatic staining properties when grown in normal medium for 4 days. The incubation of 7-day chick cartilage rudiments in a solution containing papain without cysteine resulted in partial loss of metachromasia from cartilage within 1 hour; the addition of vitamin A to the solution did not enhance the effect of papain during this period. The addition of papain to the culture medium in which 7-day chick embryo cartilage rudiments were grown resulted in uniform loss of the metachromasia of the cartilage matrix; similar explants grown in the presence of excess vitamin A also showed loss of the metachromasia of cartilage, but certain regions of the cartilage were affected earlier and more severely than others. Changes in cartilage cells, including loss of glycogen, occurred when the rudiment was grown in medium containing excess vitamin A, but not when it was grown in the presence of papain. Bone rudiments from 13-day chick embryos showed changes in cartilage similar to those seen in 7-day chick embryo rudiments when grown in the presence of papain or of excess vitamin A; the existing bone was not affected under these conditions. When grown in the presence of papain or excess vitamin A, the cartilage of late fetal mouse bone underwent changes similar to those already described in chick embryo rudiments. In contrast to the chick embryo rudiments, those from the fetal mouse showed rapid resorption of bone when grown in the presence of excess vitamin A. Papain had no effect on bone from either source. The changes seen in cartilage of explants grown in the presence of vitamin A and papain together were greater than those seen with either agent alone. The changes seen in fetal mouse bone grown in the presence of vitamin A were not enhanced by the additional presence of papain. On the basis of these observations, it is suggested that the changes in cartilage seen in experimental hypervitaminosis A may be the result of activation of a proteolytic enzyme or enzymes with properties similar to papain. PMID:13698767
Increased Bone Mass in Female Mice Lacking Mast Cell Chymase
Lind, Thomas; Gustafson, Ann-Marie; Calounova, Gabriela; Hu, Lijuan; Rasmusson, Annica; Jonsson, Kenneth B.; Wernersson, Sara; Åbrink, Magnus; Andersson, Göran; Larsson, Sune; Melhus, Håkan; Pejler, Gunnar
2016-01-01
Here we addressed the potential impact of chymase, a mast-cell restricted protease, on mouse bone phenotype. We show that female mice lacking the chymase Mcpt4 acquired a persistent expansion of diaphyseal bone in comparison with wild type controls, reaching a 15% larger diaphyseal cross sectional area at 12 months of age. Mcpt4-/- mice also showed increased levels of a bone anabolic serum marker and higher periosteal bone formation rate. However, they were not protected from experimental osteoporosis, suggesting that chymase regulates normal bone homeostasis rather than the course of osteoporosis. Further, the absence of Mcpt4 resulted in age-dependent upregulation of numerous genes important for bone formation but no effects on osteoclast activity. In spite of the latter, Mcpt4-/- bones had increased cortical porosity and reduced endocortical mineralization. Mast cells were found periosteally and, notably, bone-proximal mast cells in Mcpt4-/- mice were degranulated to a larger extent than in wild type mice. Hence, chymase regulates degranulation of bone mast cells, which could affect the release of mast cell-derived factors influencing bone remodelling. Together, these findings reveal a functional impact of mast cell chymase on bone. Further studies exploring the possibility of using chymase inhibitors as a strategy to increase bone volume may be warranted. PMID:27936149
NASA Astrophysics Data System (ADS)
Mederacke, Ingmar; Hsu, Christine C.; Troeger, Juliane S.; Huebener, Peter; Mu, Xueru; Dapito, Dianne H.; Pradere, Jean-Philippe; Schwabe, Robert F.
2013-11-01
Although organ fibrosis causes significant morbidity and mortality in chronic diseases, the lack of detailed knowledge about specific cellular contributors mediating fibrogenesis hampers the design of effective antifibrotic therapies. Different cellular sources, including tissue-resident and bone marrow-derived fibroblasts, pericytes and epithelial cells, have been suggested to give rise to myofibroblasts, but their relative contributions remain controversial, with profound differences between organs and different diseases. Here we employ a novel Cre-transgenic mouse that marks 99% of hepatic stellate cells (HSCs), a liver-specific pericyte population, to demonstrate that HSCs give rise to 82-96% of myofibroblasts in models of toxic, cholestatic and fatty liver disease. Moreover, we exclude that HSCs function as facultative epithelial progenitor cells in the injured liver. On the basis these findings, HSCs should be considered the primary cellular target for antifibrotic therapies across all types of liver disease.
[A boy with a painful knee: bone tumour or stress fracture?].
Robben, Bart J; Jutte, Paul C
2012-01-01
The symptoms of a stress fracture are almost identical to those of most bone tumours. Even with the use of various imaging techniques, it can be difficult to establish the correct diagnosis. Although a primary bone tumour requires early treatment to improve its prognosis, the discriminative factor in the diagnosis of a stress fracture is its clinical development over time. A 10-year-old boy was referred to our outpatient clinic on the suspicion of a primary bone tumour in his right tibia. A case was once described in this journal in which a stress fracture had eventually led to an amputation. The suspicion of primary bone tumour often marks the start of a long and intense diagnostic course. A stress fracture is the major diagnostic pitfall when there is a suspicion of such a tumour. If doubts persist after a diagnostic work-up by imaging, consultation with the Bone Tumour Committee is indicated. The patient can also be quickly referred to a centre specialised in treating bone tumours, as was the case in this article.
2014-07-01
sensing receptor channels, such as TRPV1 , such that the channels are constitutively activated, leading to the sensation of chronic pain without any...Cancer Pain, Heterotrimeric G protein betagamma subunits, G protein coupled receptors (GPCRs), TRPV1 , Nociceptor Sensitization 3. Overall project...well as mediating GPCR-regulated TRPV1 channel function in cultured mouse sensory neurons (Aim 1). Major Goal/Objective 1: Determine the role of G
Local Controlled Release of Polyphenol Conjugated with Gelatin Facilitates Bone Formation
Honda, Yoshitomo; Tanaka, Tomonari; Tokuda, Tomoko; Kashiwagi, Takahiro; Kaida, Koji; Hieda, Ayato; Umezaki, Yasuyuki; Hashimoto, Yoshiya; Imai, Koichi; Matsumoto, Naoyuki; Baba, Shunsuke; Shimizutani, Kimishige
2015-01-01
Catechins are extensively used in health care treatments. Nevertheless, there is scarce information about the feasibility of local administration with polyphenols for bone regeneration therapy, possibly due to lack of effective delivery systems. Here we demonstrated that the epigallocatechin-3-gallate-conjugated gelatin (EGCG/Gel) prepared by an aqueous chemical synthesis using 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-morpholinium chloride (DMT-MM) gradually disintegrated with time and facilitated bone formation in a critical size defect of a mouse calvaria. Conjugation of EGCG with the Gel generated cross-linking between the two molecules, thereby leading to a retardation of the degradation of the EGCG/Gel and to a delayed release of EGCG. The prepared EGCG/Gels represented significant osteogenic capability compared with that of the uncross-linked Gel and the cross-linked Gel with uncombined-EGCG. In vitro experiments disclosed that the EGCG/Gel induced osteoblastogenesis of a mouse mesenchymal stem cell line (D1 cells) within 14 days. Using fluorescently-labeled EGCG/Gel, we found that the fraction of EGCG/Gel adsorbed onto the cell membrane of the D1 cells possibly via a Gel-cell interaction. The interaction might confer the long-term effects of EGCG on the cells, resulting in a potent osteogenic capability of the EGCG/Gel in vivo. These results should provide insight into local controlled release of polyphenols for bone therapy. PMID:26110386
Raccor, Brianne S; Sun, Jianxun; Lawrence, Ross F; Li, Lei; Zhang, Hai; Somerman, Martha J; Totah, Rheem A
2013-09-15
An in vitro method for extraction and quantification of zoledronic acid (ZA) from murine bone was developed. Whole mouse bones were incubated in ZA solutions with predetermined concentrations and bound ZA was subsequently extracted from bone with phosphoric acid and derivatized using trimethylsilyl diazomethane (TMS-DAM). ZA tetra-methyl phosphonate was quantified by liquid chromatography coupled with tandem mass spectrometry (LC/MS/MS). This resulted in a sensitive, accurate, and precise method that was linear over three orders of magnitude (0.0250-50.0μg/mL ZA). For quality control (QC) samples, intra-and inter-day coefficients of variance were calculated and were less than 10%. This method was then applied to an in vivo model to quantitate ZA from the femur and mandible of three mice treated with ZA for two weeks. The mean ZA extracted from the mandible was four fold higher than that extracted from the femur (3.06±0.52 vs. 0.76±0.09ng/mg, respectively) indicating that ZA did not distribute equally in the skeleton and had a preference to the mandible. In conclusion, a highly sensitive method to measure ZA from mouse skeleton was developed, which can be easily adapted to multiple mammalian models including humans receiving ZA treatment. Copyright © 2013 Elsevier B.V. All rights reserved.
Hosseinimehr, Seyed Jalal; Azadbakht, Mohammad; Mousavi, Seyedeh Maryam; Mahmoudzadeh, Aziz; Akhlaghpoor, Shahram
2007-01-01
The radioprotective effect of hawthorn (Crataegus microphylla) fruit extract against genotoxicity induced by gamma irradiation has been investigated in mouse bone marrow cells. A single intraperitoneal (ip) administration of hawthorn extract at doses of 25, 50, 100 and 200 mg/kg 1h prior to gamma irradiation (2 Gy) reduced the frequencies of micronucleated polychromatic erythrocytes (MnPCEs). All four doses of hawthorn extract significantly reduced the frequencies of MnPCEs and increased the PCE/PCE+NCE ratio (polychromatic erythrocyte/ polychromatic erythrocyte + normochromatic erythrocyte) in mice bone marrow compared with the non drug-treated irradiated control (p < 0.02-0.00001). The maximum reduction in MnPCEs was observed in mice treated with extract at a dose of 200 mg/kg. Administration of amifostine at dose 100 mg/kg and hawthorn at dose 200 mg/kg reduced the frequency of MnPCE almost 4.8 and 5.7 fold; respectively, after being exposed to 2 Gy of gamma rays, compare with the irradiated control group. Crataegus extract exhibited concentration-dependent activity on 1,1-diphenyl 2-picrylhydrazyl free radical showing that Crataegus contained high amounts of phenolic compounds and the HPLC analysis determined that it contained chlorogenic acid, epicatechin and hyperoside. It appeared that hawthorn extract with antioxidant activity reduced the genotoxicity induced by gamma irradiation in bone marrow cells.
Loss of bone sialoprotein leads to impaired endochondral bone development and mineralization.
Holm, Erik; Aubin, Jane E; Hunter, Graeme K; Beier, Frank; Goldberg, Harvey A
2015-02-01
Bone sialoprotein (BSP) is an anionic phosphoprotein in the extracellular matrix of mineralized tissues, and a promoter of biomineralization and osteoblast development. Previous studies on the Bsp-deficient mouse (Bsp(-/-)) have demonstrated a significant bone and periodontal tissue phenotype in adulthood. However, the role of BSP during early long bone development is not known. To address this, early endochondral ossification in the Bsp(-/-) mouse was studied. Embryonic day 15.5 (E15.5) wild-type (WT) tibiae showed early stages of ossification that were absent in Bsp(-/-) mice. At E16.5, mineralization had commenced in the Bsp(-/-) mice, but staining for mineral was less intense and more dispersed compared with that in WT controls. Tibiae from Bsp(-/-) mice also demonstrated decreased mineralization and shortened length at postnatal day 0.5 (P0.5) compared to WT bones. There was no detectable difference in the number of tartrate-resistant acid phosphatase-positive foci at P0.5, although the P0.5 Bsp(-/-) tibiae had decreased Vegfα expression compared with WT tissue. Due to the shortened tibiae the growth plates were examined and determined to be of normal overall length. However, the length of the resting zone was increased in P0.5 Bsp(-/-) tibiae whereas that of the proliferative zone was decreased, with no change in the hypertrophic zone length of Bsp(-/-) mice. A reduction in cells positive for Ki-67, an S-phase cell-cycle marker, was noted in the proliferative zone. Decreased numbers of TUNEL-positive hypertrophic chondrocytes were also apparent in the Bsp(-/-) tibial growth plates, suggesting decreased apoptosis. Expression of the osteogenic markers Alp1, Col1a1, Sp7, Runx2, and Bglap was reduced in the endochondral bone of the neonatal Bsp(-/-) compared to WT tibiae. These results suggest that BSP is an important and multifaceted protein that regulates both chondrocyte proliferation and apoptosis as well as transition from cartilage to bone during development of endochondral bone. Copyright © 2014 Elsevier Inc. All rights reserved.
Madhu, Vedavathi; Li, Ching-Ju; Dighe, Abhijit S; Balian, Gary; Cui, Quanjun
2014-01-01
Clinical trials on fracture repair have challenged the effectiveness of bone morphogenetic proteins (BMPs) but suggest that delivery of mesenchymal stem cells (MSCs) might be beneficial. It has also been reported that BMPs could not increase mineralization in several MSCs populations, which adds ambiguity to the use of BMPs. However, an exogenous supply of MSCs combined with vascular endothelial growth factor (VEGF) and BMPs is reported to synergistically enhance fracture repair in animal models. To elucidate the mechanism of this synergy, we investigated the osteoblastic differentiation of cloned mouse bone marrow derived MSCs (D1 cells) in vitro in response to human recombinant proteins of VEGF, BMPs (-2, -4, -6, -9) and the combination of VEGF with BMP-6 (most potent BMP). We further investigated ectopic bone formation induced by MSCs pre-conditioned with VEGF, BMP-6 or both. No significant increase in mineralization, phosphorylation of Smads 1/5/8 and expression of the ALP, COL1A1 and osterix genes was observed upon addition of VEGF or BMPs alone to the cells in culture. The lack of CD105, Alk1 and Alk6 expression in D1 cells correlated with poor response to BMPs indicating that a greater care in the selection of MSCs is necessary. Interestingly, the combination of VEGF and BMP-6 significantly increased the expression of ALP, COL1A1 and osterix genes and D1 cells pre-conditioned with VEGF and BMP-6 induced greater bone formation in vivo than the non-conditioned control cells or the cells pre-conditioned with either VEGF or BMP-6 alone. This enhanced bone formation by MSCs correlated with higher CADM1 expression and OPG/RANKL ratio in the implants. Thus, combined action of VEGF and BMP on MSCs enhances osteoblastic differentiation of MSCs and increases their bone forming ability, which cannot be achieved through use of BMPs alone. This strategy can be effectively used for bone repair.
Shang‐Guan, Yangfan; Ma, Jing; Hu, Hang; Wang, Linlong; Magdalou, Jacques; Chen, Liaobin
2016-01-01
Abstract Background and Purpose Prenatal exposure to dexamethasone slows down fetal linear growth and bone mineralization but the regulatory mechanism remains unknown. Here we assessed how dexamethasone regulates bone development in the fetus. Experimental Approach Dexamethasone (1 mg·kg−1·day−1) was injected subcutaneously every morning in pregnant rats from gestational day (GD)9 to GD20. Fetal femurs and tibias were harvested at GD20 for histological and gene expression analysis. Femurs of 12‐week‐old female offspring were harvested for microCT (μCT) measurement. Primary chondrocytes were treated with dexamethasone (10, 50, 250 and 1000 nM). Key Results Prenatal dexamethasone exposure resulted in accumulation of hypertrophic chondrocytes and delayed formation of the primary ossification centre in fetal long bone. The retardation was accompanied by reduced maturation of hypertrophic chondrocytes, decreased osteoclast number and down‐regulated expression of osteocalcin and bone sialoprotein in long bone. In addition, the mitogen‐inducible gene‐6 (Mig6) and osteoprotegerin (OPG) expression were stimulated, and the receptor activator of NF‐κB ligand (RANKL) expression was repressed. Moreover, dexamethasone activated OPG and repressed RANKL expression in both primary chondrocytes and primary osteoblasts, and the knockdown of Mig6 abolished the effect of dexamethasone on OPG expression. Further, μCT measurement showed loss of bone mass in femur of 12‐week‐old offspring with prenatal dexamethasone exposure. Conclusions and Implications Prenatal dexamethasone exposure delays endochondral ossification by suppressing chondrocyte maturation and osteoclast differentiation, which may be partly mediated by Mig6 activation in bone. Bone development retardation in the fetus may be associated with reduced bone mass in later life. PMID:27128203
Hadzik, Jakub; Botzenhart, Ute; Krawiec, Maciej; Gedrange, Tomasz; Heinemann, Friedhelm; Vegh, Andras; Dominiak, Marzena
2017-09-01
Short dental implants can be an alternative method of treatment to a vertical bone augmentation procedure at sites of reduced alveolar height. However, for successful treatment, an implant system that causes a minimal marginal bone loss (MBL) should be taken into consideration. The aim of the study has been to evaluate implantation effectiveness for bone level and tissue level short implants provided in lateral aspects of partially edentulous mandible and limited alveolar ridge height. The MBL and primary as well as secondary implant stability were determined in the study. Patients were randomly divided into two groups according to the method of treatment provided. Sixteen short Bone Level Implants (OsseoSpeed TX, Astra tech) and 16 short Tissue Level Implants (RN SLActive ® , Straumann) were successfully placed in the edentulous part of the mandible. The determination of the marginal bone level was based on radiographic evaluation after 12 and 36 weeks. Implant stability was measured immediately after insertion and after 12 weeks. The marginal bone level of Bone Level Implants was significantly lower compared to Tissue Level Implants. Furthermore, the Bone Level Implants had greater primary and secondary stability in comparison with Tissue Level Implants (Primary: 77.8 ISQ versus 66.5 ISQ; Secondary: 78.9 ISQ versus 73.9 ISQ, respectively). Since short Bone Level Implants showed a significantly decreased MBL 12 and 36 weeks after implantation as well as better results for the primary stability compared to Tissue Level Implants, they should preferentially be used for this mentioned indication. Copyright © 2017 Elsevier GmbH. All rights reserved.
Contribution of dietary and loading changes to the effects of suspension on mouse femora
NASA Technical Reports Server (NTRS)
Simske, S. J.; Broz, J. J.; Fleet, M. L.; Schmeister, T. A.; Gayles, E. C.; Luttges, M. W.; Spooner, B. S. (Principal Investigator)
1994-01-01
The present study assessed the contributions of feeding changes and unloading to the overall measured effects of 2-wk hindlimb (Tail) suspension on the mouse femora. Feeding changes were addressed by considering the effects of matched feeding among suspended and control mice. The effects of hind limb unloading were considered by comparing suspended mice to mice equipped identically (though not suspended) and matched-fed. The feeding and unloading aspects of suspension appear to cause distinctly differing effects on the stereotypic modeling of the femora. Matched-feeding was accompanied by increased resorption surface in comparison to suspended mice, while unloading led to reduced bone formation at the mid-diaphysis of the femora. Reduced mineral content was observed in the bones of suspended mice when compared to the other mice groups, but without increased resorption surface. Thus, the unloading aspects of the antiorthostatic suspension protocol apparently causes reduced formation and mineralization in the femur.
Steenackers, Ellen; Yorgan, Timur A.; Hermans, Christophe; Boudin, Eveline; Waterval, Jérôme J.; Jansen, Ineke D. C.; Aydemir, Tolunay Beker; Kamerling, Niels; Plumeyer, Christine; D’Haese, Patrick C.; Everts, Vincent; Lammens, Martin; Mortier, Geert; Cousins, Robert J.; Schinke, Thorsten; Stokroos, Robert J.; Manni, Johannes J.; Van Hul, Wim
2018-01-01
Hyperostosis Cranialis Interna (HCI) is a rare bone disorder characterized by progressive intracranial bone overgrowth at the skull. Here we identified by whole-exome sequencing a dominant mutation (L441R) in SLC39A14 (ZIP14). We show that L441R ZIP14 is no longer trafficked towards the plasma membrane and excessively accumulates intracellular zinc, resulting in hyper-activation of cAMP-CREB and NFAT signaling. Conditional knock-in mice overexpressing L438R Zip14 in osteoblasts have a severe skeletal phenotype marked by a drastic increase in cortical thickness due to an enhanced endosteal bone formation, resembling the underlying pathology in HCI patients. Remarkably, L438R Zip14 also generates an osteoporotic trabecular bone phenotype. The effects of osteoblastic overexpression of L438R Zip14 therefore mimic the disparate actions of estrogen on cortical and trabecular bone through osteoblasts. Collectively, we reveal ZIP14 as a novel regulator of bone homeostasis, and that manipulating ZIP14 might be a therapeutic strategy for bone diseases. PMID:29621230
Reinholz, Monica M; Zinnen, Shawn P; Dueck, Amylou C; Dingli, David; Reinholz, Gregory G; Jonart, Leslie A; Kitzmann, Kathleen A; Bruzek, Amy K; Negron, Vivian; Abdalla, Abdalla K; Arendt, Bonnie K; Croatt, Anthony J; Sanchez-Perez, Luis; Sebesta, David P; Lönnberg, Harri; Yoneda, Toshiyuki; Nath, Karl A; Jelinek, Diane F; Russell, Stephen J; Ingle, James N; Spelsberg, Thomas C; Dixon, Henry B F Hal; Karpeisky, Alexander; Lingle, Wilma L
2010-07-01
Despite palliative treatments, tumor-induced bone disease (TIBD) remains highly debilitating for many cancer patients and progression typically results in death within two years. Therefore, more effective therapies with enhanced anti-resorptive and cytotoxic characteristics are needed. We developed bisphosphonate-chemotherapeutic conjugates designed to bind bone and hydrolyze, releasing both compounds, thereby targeting both osteoclasts and tumor cells. This study examined the effects of our lead compound, MBC-11 (the anhydride formed between arabinocytidine (AraC)-5'-phosphate and etidronate), on bone tumor burden, bone volume, femur bone mineral density (BMD), and overall survival using two distinct mouse models of TIBD, the 4T1/luc breast cancer and the KAS-6/1-MIP1alpha multiple myeloma models. In mice orthotopically inoculated with 4T1/luc mouse mammary cells, MBC-11 (0.04 microg/day; s.c.) reduced the incidence of bone metastases to 40% (4/10), compared to 90% (9/10; p=0.057) and 100% (5/5; p=0.04) of PBS- or similarly-dosed, zoledronate-treated mice, respectively. MBC-11 also significantly decreased bone tumor burden compared to PBS- or zoledronate-treated mice (p=0.021, p=0.017, respectively). MBC-11 and zoledronate (0.04 microg/day) significantly increased bone volume by two- and four-fold, respectively, compared to PBS-treated mice (p=0.005, p<0.001, respectively). In mice systemically injected with human multiple myeloma KAS-6/1-MIP1alpha cells, 0.04 and 4.0 microg/day MBC-11 improved femur BMD by 13% and 16%, respectively, compared to PBS (p=0.025, p=0.017, respectively) at 10 weeks post-tumor cell injection and increased mean survival to 95 days compared to 77 days in mice treated with PBS (p=0.047). Similar doses of zoledronate also improved femur BMD (p< or =0.01 vs PBS) and increased mean survival to 86 days, but this was not significantly different than in PBS-treated mice (p=0.53). These results demonstrate that MBC-11 decreases bone tumor burden, maintains bone structure, and may increase overall survival, warranting further investigation as a treatment for TIBD. 2010 Elsevier Inc. All rights reserved.
Kawabata, Shigeru; Christine Hollander, M; Munasinghe, Jeeva P.; Brinster, Lauren R.; Mercado-Matos, José R.; Li, Jie; Regales, Lucia; Pao, William; Jänne, Pasi A.; Wong, Kwok-Kin; Butman, John A.; Lonser, Russell R.; Hansen, Marlan R.; Gurgel, Richard K.; Vortmeyer, Alexander O.; Dennis, Phillip A.
2015-01-01
Adenomatous tumors in the middle ear and temporal bone are rare but highly morbid because they are difficult to detect prior to the development of audiovestibular dysfunction. Complete resection is often disfiguring and difficult because of location and the late stage at diagnosis, so identification of molecular targets and effective therapies is needed. Here, we describe a new mouse model of aggressive papillary ear tumor that was serendipitously discovered during the generation of a mouse model for mutant EGFR-driven lung cancer. Although these mice did not develop lung tumors, 43% developed head tilt and circling behavior. Magnetic resonance imaging (MRI) scans showed bilateral ear tumors located in the tympanic cavity. These tumors expressed mutant EGFR as well as active downstream targets such as Akt, mTOR and ERK1/2. EGFR-directed therapies were highly effective in eradicating the tumors and correcting the vestibular defects, suggesting these tumors are addicted to EGFR. EGFR activation was also observed in human ear neoplasms, which provides clinical relevance for this mouse model and rationale to test EGFR-targeted therapies in these rare neoplasms. PMID:26027747
Kawabata, Shigeru; Hollander, M Christine; Munasinghe, Jeeva P; Brinster, Lauren R; Mercado-Matos, José R; Li, Jie; Regales, Lucia; Pao, William; Jänne, Pasi A; Wong, Kwok-Kin; Butman, John A; Lonser, Russell R; Hansen, Marlan R; Gurgel, Richard K; Vortmeyer, Alexander O; Dennis, Phillip A
2015-05-10
Adenomatous tumors in the middle ear and temporal bone are rare but highly morbid because they are difficult to detect prior to the development of audiovestibular dysfunction. Complete resection is often disfiguring and difficult because of location and the late stage at diagnosis, so identification of molecular targets and effective therapies is needed. Here, we describe a new mouse model of aggressive papillary ear tumor that was serendipitously discovered during the generation of a mouse model for mutant EGFR-driven lung cancer. Although these mice did not develop lung tumors, 43% developed head tilt and circling behavior. Magnetic resonance imaging (MRI) scans showed bilateral ear tumors located in the tympanic cavity. These tumors expressed mutant EGFR as well as active downstream targets such as Akt, mTOR and ERK1/2. EGFR-directed therapies were highly effective in eradicating the tumors and correcting the vestibular defects, suggesting these tumors are addicted to EGFR. EGFR activation was also observed in human ear neoplasms, which provides clinical relevance for this mouse model and rationale to test EGFR-targeted therapies in these rare neoplasms.
Zhang, Zhuo; Leong, Daniel J; Xu, Lin; He, Zhiyong; Wang, Angela; Navati, Mahantesh; Kim, Sun J; Hirsh, David M; Hardin, John A; Cobelli, Neil J; Friedman, Joel M; Sun, Hui B
2016-06-03
Curcumin has been shown to have chondroprotective potential in vitro. However, its effect on disease and symptom modification in osteoarthritis (OA) is largely unknown. This study aimed to determine whether curcumin could slow progression of OA and relieve OA-related pain in a mouse model of destabilization of the medial meniscus (DMM). Expression of selected cartilage degradative-associated genes was evaluated in human primary chondrocytes treated with curcumin and curcumin nanoparticles and assayed by real-time PCR. The mice subjected to DMM surgery were orally administered curcumin or topically administered curcumin nanoparticles for 8 weeks. Cartilage integrity was evaluated by Safranin O staining and Osteoarthritis Research Society International (OARSI) score, and by immunohistochemical staining of cleaved aggrecan and type II collagen, and levels of matrix metalloproteinase (MMP)-13 and ADAMTS5. Synovitis and subchondral bone thickness were scored based on histologic images. OA-associated pain and symptoms were evaluated by von Frey assay, and locomotor behavior including distance traveled and rearing. Both curcumin and nanoparticles encapsulating curcumin suppressed mRNA expression of pro-inflammatory mediators IL-1β and TNF-α, MMPs 1, 3, and 13, and aggrecanase ADAMTS5, and upregulated the chondroprotective transcriptional regulator CITED2, in primary cultured chondrocytes in the absence or presence of IL-1β. Oral administration of curcumin significantly reduced OA disease progression, but showed no significant effect on OA pain relief. Curcumin was detected in the infrapatellar fat pad (IPFP) following topical administration of curcumin nanoparticles on the skin of the injured mouse knee. Compared to vehicle-treated controls, topical treatment led to: (1) reduced proteoglycan loss and cartilage erosion and lower OARSI scores, (2) reduced synovitis and subchondral plate thickness, (3) reduced immunochemical staining of type II collagen and aggrecan cleavage epitopes and numbers of chondrocytes positive for MMP-13 and ADAMTS5 in the articular cartilage, and (4) reduced expression of adipokines and pro-inflammatory mediators in the IPFP. In contrast to oral curcumin, topical application of curcumin nanoparticles relieved OA-related pain as indicated by reduced tactile hypersensitivity and improved locomotor behavior. This study provides the first evidence that curcumin significantly slows OA disease progression and exerts a palliative effect in an OA mouse model.
Effects of Testosterone on Erythropoiesis in a Female Mouse Model of Anemia of Inflammation
Schmidt, Paul J.; Fleming, Mark D.; Bhasin, Shalender
2016-01-01
The anemia of inflammation is a common problem in inflammatory and autoimmune diseases. We characterized a mouse model of anemia of chronic inflammation induced by repeated injections of low doses of heat-killed Brucella abortus (HKBA), and determined the effects of T administration on erythropoiesis in this model. Female C57BL/6NCrl mice were injected weekly with HKBA for 10 wk. Weekly injections of T or vehicle oil were started 4 wk later. Control mice were injected with saline and vehicle oil in parallel. HKBA-injected mice had significantly lower hemoglobin, hematocrit, mean corpuscular volume, reticulocyte hemoglobin, transferrin saturation (TSAT), and tissue nonheme iron in liver and spleen, enlarged spleen, and up-regulated hepatic expression of inflammatory markers, serum amyloid A1, and TNFα, but down-regulated IL-6, bone morphogenic protein 6, and hepcidin compared with saline controls. HKBA also reduced serum hepcidin and increased serum erythropoietin. Bone marrow erythroid precursors were substantially reduced in HKBA-injected mice. Cotreatment with T increased the percentage of late-stage erythroid precursors in the bone marrow relative to HKBA-injected and saline controls and reversed HKBA-induced suppression of hemoglobin and hematocrit. T also normalized serum erythropoietin, TSAT, and reticulocyte hemoglobin without correcting the expression of the hepatic inflammation markers. Conclusions are that low-dose HKBA induces moderate anemia characterized by chronic inflammation, decreased iron stores, and suppression of erythroid precursors in the bone marrow. T administration reverses HKBA-induced anemia by stimulating erythropoiesis, which is associated with a shift toward accelerated maturation of erythroid precursors in the bone marrow. PMID:27074351
NASA Technical Reports Server (NTRS)
Yamaguchi, T.; Kifor, O.; Chattopadhyay, N.; Bai, M.; Brown, E. M.; O'Malley, B. W. (Principal Investigator)
1998-01-01
The calcium-sensing receptor (CaR) is a G protein-coupled receptor that plays key roles in extracellular calcium ion (Ca2+o) homeostasis in parathyroid gland and kidney. Macrophage-like mononuclear cells appear at sites of osteoclastic bone resorption during bone remodeling and may play a role in the "reversal" phase following osteoclastic resorption and preceding bone formation. Bone resorption produces substantial local increases in Ca2+o that could provide a signal for bone marrow mononuclear cells in the vicinity, leading us to investigate whether such mononuclear cells express the CaR. In this study, we used the mouse J774 cell line, which exhibits a pure monocyte-macrophage phenotype. Both immunocytochemistry and Western blot analysis, using polyclonal antisera specific for the CaR, detected CaR protein in J774 cells. The use of reverse transcriptase-polymerase chain reaction with CaR-specific primers, including a set of intron-spanning primers, followed by nucleotide sequencing of the amplified products, also identified CaR transcripts in J774 cells. Exposure of J774 cells to high Ca2+o (2.8 mM or more) or the polycationic CaR agonist, neomycin (100 microM), stimulated both chemotaxis and DNA synthesis in J774 cells. Therefore, taken together, our data strongly suggest that the monocyte-macrophage cell line, J774, possesses both CaR protein and mRNA very similar, if not identical, to those in parathyroid and kidney.
Kurabayashi, Atsushi; Inoue, Keiji; Fukuhara, Hideo; Karashima, Takashi; Fukata, Satoshi; Kawada, Chiaki; Shuin, Taro; Furihata, Mutsuo
2015-08-01
The aim of this study was to investigate whether the third-generation nitrogen-containing bisphosphonate (YM529) can inhibit the progression of established bone renal cell carcinoma (RCC) and to elucidate its mechanism. Antiproliferative effect and apoptosis induction of RCC cells and mouse osteoclasts by YM529 and/or interferon-alpha (IFN-α) were evaluated in vitro using cell counting and in vivo using soft X-ray, the TUNEL method and tartrate-resistant acid phosphatase stain. For the in vivo study, male athymic BALB/cA Jc1-nu nude mice bearing human RCC cell line RBM1-IT4 cells were treated with YM529 and/or IFN-α. The biological activity of osteoclasts was evaluated using the pit formation assay. The antiangiogenetic effect by YM529 and/or IFN-α was analyzed using micro-vessel density and in situ mRNA hybridization. Osteoclast number in bone tumors was decreased in YM529-treated mouse. YM529 also inhibited osteoclast activity and proliferation in vitro, whereas basic fibroblast growth factor expressions and micro-vessel density within tumors were inhibited by IFN-α. Neither YM529 nor IFN-α alone significantly inhibited the growth of established bone metastatic tumors. Combined treatment with YM529 and IFN-α may be beneficial in patients with human RCC bone metastasis. Their effects are mediated by osteoclast recruitment inhibition and inactivation by YM529 and antiangiogenesis by IFN-α. © 2015 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.
Liu, Yan-gang; Chen, Ji-kuai; Zhang, Zi-teng; Ma, Xiu-juan; Chen, Yong-chun; Du, Xiu-ming; Liu, Hong; Zong, Ying; Lu, Guo-cai
2017-01-01
A limit to the clinical benefit of radiotherapy is not an incapacity to eliminate tumor cells but rather a limit on its capacity to do so without destroying normal tissue and inducing inflammation. Recent evidence reveals that the inflammasome is essential for mediating radiation-induced cell and tissue damage. In this study, using primary cultured bone marrow-derived macrophages (BMDM) and a mouse radiation model, we explored the role of NLRP3 inflammasome activation and the secondary pyroptosis underlying radiation-induced immune cell death. We observed an increasing proportion of pyroptosis and elevating Caspase-1 activation in 10 and 20 Gy radiation groups. Nlrp3 knock out significantly diminished the quantity of cleaved-Caspase-1 (p10) and IL-1β as well as the proportion of pyroptosis. Additionally, in vivo research shows that 9.5 Gy of radiation promotes Caspase-1 activation in marginal zone cells and induces death in mice, both of which can be significantly inhibited by knocking out Nlrp3. Thus, based on these findings, we conclude that the NLRP3 inflammasome activation mediates radiation-induced pyroptosis in BMDMs. Targeting NLRP3 inflammasome and pyroptosis may serve as effective strategies to diminish injury caused by radiation. PMID:28151471
Nakamura, Miki; Suetsugu, Atsushi; Hasegawa, Kousuke; Matsumoto, Takuro; Aoki, Hitomi; Kunisada, Takahiro; Shimizu, Masahito; Saji, Shigetoyo; Moriwaki, Hisataka; Hoffman, Robert M
2017-12-01
The tumor microenvironment (TME) promotes tumor growth and metastasis. We previously established the color-coded EL4 lymphoma TME model with red fluorescent protein (RFP) expressing EL4 implanted in transgenic C57BL/6 green fluorescent protein (GFP) mice. Color-coded imaging of the lymphoma TME suggested an important role of stromal cells in lymphoma progression and metastasis. In the present study, we used color-coded imaging of RFP-lymphoma cells and GFP stromal cells to identify yellow-fluorescent genetically recombinant cells appearing only during metastasis. The EL4-RFP lymphoma cells were injected subcutaneously in C57BL/6-GFP transgenic mice and formed subcutaneous tumors 14 days after cell transplantation. The subcutaneous tumors were harvested and transplanted to the abdominal cavity of nude mice. Metastases to the liver, perigastric lymph node, ascites, bone marrow, and primary tumor were imaged. In addition to EL4-RFP cells and GFP-host cells, genetically recombinant yellow-fluorescent cells, were observed only in the ascites and bone marrow. These results indicate genetic exchange between the stromal and cancer cells. Possible mechanisms of genetic exchange are discussed as well as its ramifications for metastasis. J. Cell. Biochem. 118: 4216-4221, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Efficacy of ALK5 inhibition in myelofibrosis
Zhao, Wanke; Ho, Wanting Tina; Han, Ying; Murdun, Cem; Mailloux, Adam W.; Zhang, Ling; Wang, Xuefeng; Budhathoki, Anjali; Pradhan, Kith; Rapaport, Franck; Wang, Huaquan; Shao, Zonghong; Ren, Xiubao; Steidl, Ulrich; Levine, Ross L.; Zhao, Zhizhuang Joe; Verma, Amit; Epling-Burnette, Pearlie K.
2017-01-01
Myelofibrosis (MF) is a bone marrow disorder characterized by clonal myeloproliferation, aberrant cytokine production, extramedullary hematopoiesis, and bone marrow fibrosis. Although somatic mutations in JAK2, MPL, and CALR have been identified in the pathogenesis of these diseases, inhibitors of the Jak2 pathway have not demonstrated efficacy in ameliorating MF in patients. TGF-β family members are profibrotic cytokines and we observed significant TGF-β1 isoform overexpression in a large cohort of primary MF patient samples. Significant overexpression of TGF-β1 was also observed in murine clonal MPLW515L megakaryocytic cells. TGF-β1 stimulated the deposition of excessive collagen by mesenchymal stromal cells (MSCs) by activating the TGF-β receptor I kinase (ALK5)/Smad3 pathway. MSCs derived from MPLW515L mice demonstrated sustained overproduction of both collagen I and collagen III, effects that were abrogated by ALK5 inhibition in vitro and in vivo. Importantly, use of galunisertib, a clinically active ALK5 inhibitor, significantly improved MF in both MPLW515L and JAK2V617F mouse models. These data demonstrate the role of malignant hematopoietic stem cell (HSC)/TGF-β/MSC axis in the pathogenesis of MF, and provide a preclinical rationale for ALK5 blockade as a therapeutic strategy in MF. PMID:28405618