Sample records for primer caso humano

  1. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra


    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  2. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar


    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  3. Polyacid macromolecule primers


    Sugama, Toshifumi.


    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  4. Polyacid macromolecule primers


    Sugama, Toshifumi


    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  5. Transmission Investment: A Primer

    SciTech Connect

    McGarvey, Joe


    This primer highlights recent trends in transmission investment, summarizes the division of jurisdictional authority over transmission, and presents four alternative models for transmission ownership. (author)

  6. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur


    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  7. PrimerView: high-throughput primer design and visualization.


    O'Halloran, Damien M


    High-throughput primer design is routinely performed in a wide number of molecular applications including genotyping specimens using traditional PCR techniques as well as assembly PCR, nested PCR, and primer walking experiments. Batch primer design is also required in validation experiments from RNA-seq transcriptome sequencing projects, as well as in generating probes for microarray experiments. The growing popularity of next generation sequencing and microarray technology has created a greater need for more primer design tools to validate large numbers of candidate genes and markers. To meet these demands I here present a tool called PrimerView that designs forward and reverse primers from multi-sequence datasets, and generates graphical outputs that map the position and distribution of primers to the target sequence. This module operates from the command-line and can collect user-defined input for the design phase of each primer. PrimerView is a straightforward to use module that implements a primer design algorithm to return forward and reverse primers from any number of FASTA formatted sequences to generate text based output of the features for each primer, and also graphical outputs that map the designed primers to the target sequence. PrimerView is freely available without restrictions.

  8. China Energy Primer

    SciTech Connect

    Ni, Chun Chun


    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  9. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    USDA-ARS?s Scientific Manuscript database

    A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricte...

  10. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  11. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.


    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  12. Systems Engineering Measurement Primer

    DTIC Science & Technology


    Systems Engineering Measurement Primer A Basic Introduction to Systems Engineering Measurement Concepts and Use Version 1.0 March 1998 This document...Federal Systems Garry Roedler Lockheed Martin Management & Data Systems Cathy Tilton The National Registry, Inc. E. Richard Widmann Raytheon Systems...IV 1. INTRODUCTION

  13. Nulcear materials production: Primer

    SciTech Connect

    Not Available


    The US Department of Energy's (DOE's) Office of Nuclear Materials Production (NMP) is responsible for managing the production and recovery of nuclear materials for national defense. NMP oversees the production of radioactive materials for government, commercial, industrial, and medical applications. This Primer is a general introduction to NMP's major activities.

  14. EasyExonPrimer: automated primer design for exon sequences.


    Wu, Xiaolin; Munroe, David J


    EasyExonPrimer is a web-based software that automates the design of PCR primers to amplify exon sequences from genomic DNA. EasyExonPrimer is written in Perl and uses Primer3 to design PCR primers based on the genome builds and annotation databases available at the University of California, Santa Cruz (UCSC) Genome Browser database ( It masks repeats and known single nucleotide polymorphism (SNP) sites in the genome and designs standardised primers using optimised conditions. Users can input genes by RefSeq mRNA ID, gene name or keyword. The primer design is optimised for large-scale resequencing of exons. For exons larger than 1 kb, the user has the option of breaking the exon sequence down into overlapping smaller fragments. All primer pairs are then verified using the In-Silico PCR software to test for uniqueness in the genome. We have designed >1000 pairs of primers for 90 genes; 95% of the primer pairs successfully amplified exon sequences under standard PCR conditions without requiring further optimisation. EasyExonPrimer is available from The source code is also available upon request. Xiaolin Wu (

  15. Primer on Beam Optics

    DTIC Science & Technology


    emphasis on neutral particle beam (NPB) optical devices. It explains how the motion of charged particles in magnetic and electric fields is...Inc. San Diego, California Table of Contents Page 1. Introduction 1 1.1 Organization of Primer 1 1.2 Introduction to Neutral Particle Beam...102 Figures Figure Pag© 1. Generic Neutral Particle Beam Device 4 2. An orthogonal three dimensional coordinate system 11 3. Trajectory of a

  16. Primer on molecular genetics

    SciTech Connect

    Not Available


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  17. Lead Free Electric Primer

    DTIC Science & Technology


    Resonance NSWC-IH Naval Surface Warfare Center, Indian Head NTI Nano Technology, Inc . PAD Propellant Actuated Devices PEG Polyethylene Glycol... supplied hardware components and WC 868 propellant. Each round was assembled according to the drawing specification modifying only the primer...Nanotechnologies, Inc . (now NovaCentrix since July 2006), and it was characterized by the China Lake Chemistry Division prior to being used in formulation

  18. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins


    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  19. Crystalline Silica Primer

    USGS Publications Warehouse



    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  20. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.


    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  1. Limited-life cartridge primers


    Makowiecki, Daniel M.; Rosen, Robert S.


    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  2. Limited-life cartridge primers


    Makowiecki, D.M.; Rosen, R.S.


    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  3. Limited-life cartridge primers


    Makowiecki, Daniel M.; Rosen, Robert S.


    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  4. Multiplexed Primer Prediction for PCR

    SciTech Connect


    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  5. A primer on water

    USGS Publications Warehouse

    Leopold, Luna Bergere; Langbein, Walter Basil


    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  6. A Brief Taxometrics Primer

    PubMed Central

    Beauchaine, Theodore P.


    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  7. Metabolomics: A Primer.


    Liu, Xiaojing; Locasale, Jason W


    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future.

  8. Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

    PubMed Central

    Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.


    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

  9. Neuraminidase subtyping of avian influenza viruses with PrimerHunter-designed primers and quadruplicate primer pools.


    Huang, Yanyan; Khan, Mazhar I; Khan, Mazhar; Măndoiu, Ion; Măndoiu, Ion I


    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers.

  10. Explanatory chapter: PCR primer design.


    Álvarez-Fernández, Rubén


    This chapter is intended as a guide on polymerase chain reaction (PCR) primer design (for information on PCR, see General PCR and Explanatory Chapter: Troubleshooting PCR). In the next section, general guidelines will be provided, followed by a discussion on primer design for specific applications. A list of recommended software tools is shown at the end. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR


    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  12. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR


    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  13. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR


    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  14. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  15. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  16. BatchPrimer3: a high throughput web application for PCR and sequencing primer design.


    You, Frank M; Huo, Naxin; Gu, Yong Qiang; Luo, Ming-Cheng; Ma, Yaqin; Hane, Dave; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D


    Microsatellite (simple sequence repeat - SSR) and single nucleotide polymorphism (SNP) markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR), as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated in several laboratories. BatchPrimer3 is a

  17. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie


    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  18. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert


    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  19. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert


    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  20. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie


    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  1. Straight Talk: A Communication Primer.

    ERIC Educational Resources Information Center

    Maidment, Robert

    Using typical statements made by teachers and school administrators as examples, this self-help primer offers tips for developing conversational patterns that promote interpersonal understanding. The tips are designed to help readers learn about 40 effective conversational habits, including being specific, talking sparingly, admitting mistakes,…

  2. A Primer on Multilevel Modeling

    ERIC Educational Resources Information Center

    Hayes, Andrew F.


    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  3. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.


    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  4. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  5. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.


    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  6. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.


    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  7. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011


    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  8. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  9. Alternative Teacher Compensation: A Primer

    ERIC Educational Resources Information Center

    Koppich, Julia E.; Rigby, Jessica


    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  10. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan


    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  11. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR


    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  12. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  13. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2012 CFR


    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  14. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2014 CFR


    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  15. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  16. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  17. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  18. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR


    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  19. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2013 CFR


    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  20. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR


    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  1. Primer3--new capabilities and interfaces.


    Untergasser, Andreas; Cutcutache, Ioana; Koressaar, Triinu; Ye, Jian; Faircloth, Brant C; Remm, Maido; Rozen, Steven G


    Polymerase chain reaction (PCR) is a basic molecular biology technique with a multiplicity of uses, including deoxyribonucleic acid cloning and sequencing, functional analysis of genes, diagnosis of diseases, genotyping and discovery of genetic variants. Reliable primer design is crucial for successful PCR, and for over a decade, the open-source Primer3 software has been widely used for primer design, often in high-throughput genomics applications. It has also been incorporated into numerous publicly available software packages and web services. During this period, we have greatly expanded Primer3's functionality. In this article, we describe Primer3's current capabilities, emphasizing recent improvements. The most notable enhancements incorporate more accurate thermodynamic models in the primer design process, both to improve melting temperature prediction and to reduce the likelihood that primers will form hairpins or dimers. Additional enhancements include more precise control of primer placement-a change motivated partly by opportunities to use whole-genome sequences to improve primer specificity. We also added features to increase ease of use, including the ability to save and re-use parameter settings and the ability to require that individual primers not be used in more than one primer pair. We have made the core code more modular and provided cleaner programming interfaces to further ease integration with other software. These improvements position Primer3 for continued use with genome-scale data in the decade ahead.

  2. Strategic Leadership Primer (Third Edition)

    DTIC Science & Technology


    Department of Command, Leadership, and Management United States Army War College STRATEGIC LEADERSHIP PRIMER 3rd Edition 2010 United States Army ...UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) U.S. Army War College,Department of Command, Leadership, and Management,Carlisle, ANSI Std Z39-18 Department of Command, Leadership and Management United States Army War College Carlisle Barracks, PA 17013-5050 3rd Edition

  3. HIV lipodystrophy syndrome: a primer.


    Robinson, F Patrick


    Treatment with highly active antiretroviral therapy (HAART) has been implicated in the development of anthropomorphic and metabolic abnormalities termed HIV lipodystrophy syndrome (or LDS). This primer offers a comprehensive overview of LDS including epidemiology, hypothesized etiologies, and clinical consequences. The evidence-based literature is reviewed for current treatment strategies including discontinuation of specific antiretrovirals, pharmacological management of dyslipidemia and insulin resistance, exercise training, facial augmentation, liposuction, and hormonal therapy. Patient education, counseling, and adherence are discussed.

  4. Combination Primer/Topcoat Coating.

    DTIC Science & Technology


    generally to a coating for metallic or polymeric composite substrates and more particularly to such a coating which can perform as both a primer and a...topcoat.-- 15 Many metal and polymeric composite surfaces require the protection of a coating. For exampleANavy aircraft surfaces need protection from the...invention top-evide-a-si-ngw--coati-ng which-lan be applied directly to.a metal or polymeric composite substrate and also perform as a topcoat.. 15

  5. Output testing of small-arms primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.


    The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

  6. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.


    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  7. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; hide


    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  8. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas


    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  9. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction.


    Ye, Jian; Coulouris, George; Zaretskaya, Irena; Cutcutache, Ioana; Rozen, Steve; Madden, Thomas L


    Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR

  10. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

    PubMed Central


    Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool

  11. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.


    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong


    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  12. PrimerZ: streamlined primer design for promoters, exons and human SNPs.


    Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam


    PrimerZ ( is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database ( are processed before being passed on to Primer3 ( for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

  13. CODEHOP PCR and CODEHOP PCR primer design.


    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M


    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  14. Primer design for large scale sequencing.

    PubMed Central

    Haas, S; Vingron, M; Poustka, A; Wiemann, S


    We have developed PRIDE, a primer design program that automatically designs primers in single contigs or whole sequencing projects to extend the already known sequence and to double strand single-stranded regions. The program is fully integrated into the Staden package (GAP4) and accessible with a graphical user interface. PRIDE uses a fuzzy logic-based system to calculate primer qualities. The computational performance of PRIDE is enhanced by using suffix trees to store the huge amount of data being produced. A test set of 110 sequencing primers and 11 PCR primer pairs has been designed on genomic templates, cDNAs and sequences containing repetitive elements to analyze PRIDE's success rate. The high performance of PRIDE, combined with its minimal requirement of user interaction and its fast algorithm, make this program useful for the large scale design of primers, especially in large sequencing projects. PMID:9611248

  15. Primer design for large scale sequencing.


    Haas, S; Vingron, M; Poustka, A; Wiemann, S


    We have developed PRIDE, a primer design program that automatically designs primers in single contigs or whole sequencing projects to extend the already known sequence and to double strand single-stranded regions. The program is fully integrated into the Staden package (GAP4) and accessible with a graphical user interface. PRIDE uses a fuzzy logic-based system to calculate primer qualities. The computational performance of PRIDE is enhanced by using suffix trees to store the huge amount of data being produced. A test set of 110 sequencing primers and 11 PCR primer pairs has been designed on genomic templates, cDNAs and sequences containing repetitive elements to analyze PRIDE's success rate. The high performance of PRIDE, combined with its minimal requirement of user interaction and its fast algorithm, make this program useful for the large scale design of primers, especially in large sequencing projects.

  16. Degenerate primer design for highly variable genomes.


    Li, Kelvin; Shrivastava, Susmita; Stockwell, Timothy B


    The application of degenerate PCR primers towards target amplification and sequencing is a useful technique when a population of organisms under investigation is evolving rapidly, or is highly diverse. Degenerate bases in these primers are specified with ambiguity codes that represent alternative nucleotide configurations. Degenerate PCR primers allow the simultaneous amplification of a heterogeneous population by providing a mixture of PCR primers each of which anneal to an alternative genotype found in the isolated sample. However, as the number of degenerate bases specified in a pair of primers rises, the likelihood of amplifying unwanted alternative products also increases. These alternative products may confound downstream data analyses if their levels begin to obfuscate the desired PCR products. This chapter describes a set of computational methodologies that may be used to minimize the degeneracy of designed primers, while still maximizing the proportion of genotypes assayed in the targeted population.

  17. Exploratory Development of Corrosion Inhibiting Primers

    DTIC Science & Technology


    PERFORMANCE ASSESSMENT 42 Task 1 — Paint Systems Compatibility. 43 Task 2 — Adhesive Bonding Characteristics 45 PHASE IV - COST AND SCALE -UP...the required mechanical tests and the BR-127 control primer superior in others. PHASE IV - COST AND SCALE -UP ASSESSMENT An engineering assessment...required to provide a universal primer superior in all respects to the state-of-the-art hand- sprayed primer. PHASE IV - COST ANÜ SCALE -UP

  18. Nucleic acid amplification using modular branched primers


    Ulanovsky, Levy


    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  19. In silico PCR primer designing and validation.


    Kumar, Anil; Chordia, Nikita


    Polymerase chain reaction (PCR) is an enzymatic reaction whose efficiency and sensitivity largely depend on the efficiency of the primers that are used for the amplification of a concerned gene/DNA fragment. Selective amplification of nucleic acid molecules initially present in minute quantities provides a powerful tool for analyzing nucleic acids. In silico method helps in designing primers. There are various programs available for PCR primer design. Here we described designing of primers using web-based tools like "Primer3" and "Web Primer". For designing the primer, DNA template sequence is required that can be taken from any of the available sequence databases, e.g., RefSeq database. The in silico validation can be carried out using BLAST tool and Gene Runner software, which check their efficiency and specificity. Thereafter, the primers designed in silico can be validated in the wet lab. After that, these validated primers can be synthesized for use in the amplification of concerned gene/DNA fragment.

  20. Nucleic acid amplification using modular branched primers


    Ulanovsky, Levy; Raja, Mugasimangalam C.


    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  1. Primer: Shotgun Proteomics in Neuroscience

    PubMed Central

    Liao, Lujian; McClatchy, Daniel B.; Yates, John R.


    Mass spectrometry-based proteomics is increasingly used to address basic and clinical questions in biomedical research through studies of differential protein expression, protein-protein interactions, and post-translational modifications. The complex structural and functional organization of the human brain warrants the application of high-throughput, systematic approaches to understand the functional alterations under normal physiological conditions and the perturbations of neurological diseases. This primer focuses on shotgun proteomics based tandem mass spectrometry for the identification of proteins in a complex mixture. It describes the basic concepts of protein differential expression analysis and post-translational modification analysis and discusses several strategies to improve the coverage of the proteome. PMID:19607789

  2. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.


    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  3. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.


    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  4. A Primer on Observational Measurement.


    Girard, Jeffrey M; Cohn, Jeffrey F


    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  5. A Primer on Observational Measurement

    PubMed Central

    Girard, Jeffrey M.; Cohn, Jeffrey F.


    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully-automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore. PMID:26933139

  6. URPD: a specific product primer design tool

    PubMed Central


    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at PMID:22713312

  7. URPD: a specific product primer design tool.


    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong


    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at

  8. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.


    O'Halloran, Damien M


    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  9. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.


    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  10. Primer on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Luna, Tom


    This section of the Idaho Primer on Special Education in Charter Schools is divided into two parts: (1) a discussion of the legal status of charter schools and their linkage to other local education agencies (LEAs), and (2) a synopsis of federal laws that are most relevant to special education in charter schools. The Primer on Special Education in…

  11. A Primer on Sampling for Statewide Assessment.

    ERIC Educational Resources Information Center

    Jaeger, Richard M.

    This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

  12. Polymerase chain reaction with nearby primers.


    Garafutdinov, Ravil R; Galimova, Aizilya A; Sakhabutdinova, Assol R


    DNA analysis of biological specimens containing degraded nucleic acids such as mortal remains, archaeological artefacts, forensic samples etc. has gained more attention in recent years. DNA extracted from these samples is often inapplicable for conventional polymerase chain reaction (PCR), so for its amplification the nearby primers are commonly used. Here we report the data that clarify the features of PCR with nearby and abutting primers. We have shown that the proximity of primers leads to significant reduction of the reaction time and ensures the successful performance of DNA amplification even in the presence of PCR inhibitors. The PCR with abutting primers is usually characterized by the absence of nonspecific amplification products that causes extreme sensitivity with limit of detection on single copy level. The feasibility of PCR with abutting primers was demonstrated on species identification of 100 years old rotten wood. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Electrostatic Discharge testing of propellants and primers

    SciTech Connect

    Berry, R.B.


    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  14. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.


    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  15. Climate change primer for respirologists.


    Takaro, Tim K; Henderson, Sarah B


    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion.

  16. Biomaterials: a primer for surgeons.


    Binyamin, Gary; Shafi, Bilal M; Mery, Carlos M


    Biomaterials offer the surgeon a powerful set of clinical tools for patient treatment and are found in virtually every instrument, device, implant, or piece of equipment in the operating room. In fact, surgeons have historically driven clinical application of biomaterials and stand uniquely positioned to contribute to the ongoing development of biomaterials. Having an understanding of the materials available and their basic properties can contribute to better and more effective outcomes. This article provides an overview of the biomaterials field. It begins with a definition and abbreviated history of the field, highlighting its clinical roots. An introduction to the four material classifications--metals, polymers, ceramics, and composites--is then presented, providing the reader with basic properties of each group and examples of materials. Sections on nanotechnology and tissue engineering also briefly describe development within the field. Finally, the evolution of treatments for pectus excavatum and congenital diaphragmatic hernias are presented, highlighting the role of biomaterials. While providing a primer of the field, this paper shows the broad interdisciplinary reach of material science in surgery and suggests sources for further investigations.

  17. A thermodynamic approach to PCR primer design.


    Mann, Tobias; Humbert, Richard; Dorschner, Michael; Stamatoyannopoulos, John; Noble, William Stafford


    We developed a primer design method, Pythia, in which state of the art DNA binding affinity computations are directly integrated into the primer design process. We use chemical reaction equilibrium analysis to integrate multiple binding energy calculations into a conservative measure of polymerase chain reaction (PCR) efficiency, and a precomputed index on genomic sequences to evaluate primer specificity. We show that Pythia can design primers with success rates comparable with those of current methods, but yields much higher coverage in difficult genomic regions. For example, in RepeatMasked sequences in the human genome, Pythia achieved a median coverage of 89% as compared with a median coverage of 51% for Primer3. For parameter settings yielding sensitivities of 81%, our method has a recall of 97%, compared with the Primer3 recall of 48%. Because our primer design approach is based on the chemistry of DNA interactions, it has fewer and more physically meaningful parameters than current methods, and is therefore easier to adjust to specific experimental requirements. Our software is freely available at

  18. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available


    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  19. PRISE (PRImer SElector): software for designing sequence-selective PCR primers.


    Fu, Qi; Ruegger, Paul; Bent, Elizabeth; Chrobak, Marek; Borneman, James


    This report presents PRImer Selector (PRISE), a new software package that implements several features that improve and streamline the design of sequence-selective PCR primers. The PRISE design process involves two main steps. In the first step, target and non-target DNA sequences are identified. In the second step, primers are designed to amplify target (but not non-target) sequences. One important feature of PRISE is that it automates the task of placing primer-template mismatches at the 3' end of the primers - a property that is crucial for sequence selectivity. Once a list of candidate primers has been produced, sorting tools in PRISE speed up the selection process by allowing a user to sort the primers by properties such as amplicon length, GC content and sequence selectivity. PRISE can be used to design primers with a range of specificities, targeting individual sequences as well as diverse assemblages of genes. PRISE also allows user-defined primers to be analyzed, enabling their properties to be examined in relation to target and non-target sequences. The utility of PRISE was demonstrated by using it to design sequence-selective PCR primers for an rRNA gene from the fungus Pochonia chlamydosporia.

  20. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.


    Yofe, Ido; Schuldiner, Maya


    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at:

  1. A practical primer on geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.


    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  2. Climate Ready Estuaries Rolling Easements Primer

    EPA Pesticide Factsheets

    Rolling easements enable wetlands and beaches to migrate inland and allow society to avoid the costs and hazards of protecting low lands from rising sea levels. This document provides a primer on more than a dozen rolling easement approaches.

  3. PCR hot-start using duplex primers.


    Kong, Deming; Shen, Hanxi; Huang, Yanping; Mi, Huaifeng


    A new technique of PCR hot-start using duplex primers has been developed which can decrease the undesirable products arising throughout PCR amplification thereby giving better results than a manual hot-start method.

  4. Quantitative Microbial Risk Assessment Tutorial - Primer

    EPA Science Inventory

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  5. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W


    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.


    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  7. Hexavalent Chromium IV-Free Primer Development

    NASA Technical Reports Server (NTRS)

    Alldredge, Michael J.; Buck, Amy L.


    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  8. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.


    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  9. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III


    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  10. Environmental Acceptable Medium Caliber Ammunition Percussion Primers

    DTIC Science & Technology


    time (time lapse from primer strike to projectile exit from the weapon) and to make it suitable for use in the extreme temperature environment required...time between the initial contact of the weapon firing pin against the primer and the exit of the projectile from the muzzle. It is often considered the...compared to the standard lead styphnate baseline. All tests were conducted with a 119-mg WC844 (5.56-mm M855 ammunition caliber ball powder) propellant

  11. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers

    DTIC Science & Technology


    patented MIC was made by adding gas generate(s) to meet action time (time lapse from primer strike to projectile exit from the weapon) and to make against the primer and the exit of the projectile from the muzzle. It is often considered the most significant functional performance...WC844 (5.56mm M855 ammunition caliber ball powder) propellant charge. 26 Approved for public release; distribution is unlimited. Figure 16

  12. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.


    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  13. Are "universal" DNA primers really universal?


    Sharma, Pranay; Kobayashi, Tsuyoshi


    "Universal" DNA primers LCO 1490 and HCO 2198 were originally designed from three coding and six anticoding strands by comparing highly conserved regions of mitochondrial cytochrome c oxidase subunit I (COI) genes across 15 taxa. These primers have been successful in amplifying a 710-bp fragment of highly conserved regions of the COI gene for more than 80 invertebrate species from 11 phyla. In the present study, 130,843 variations were reviewed in the primer region of mitochondrial molecular markers by comparing 725 COI sequences from the kingdom Animalia. It was found that, for 177 invertebrate species, the forward primer (LCO 1490) showed only four conserved regions, compared to 12 in the original study. For ascidians, fungi and vertebrates, it showed approximately 50 % conserved regions, dropping to one conserved region for echinoderms. However, the reverse primer (HCO 2198) was highly conserved across 725 COI primer sequences. A similar pattern was observed in amino acid distributions. There was a significant difference in the means of base pair differences from the level of family, genus and species for LCO 1490 [analysis of variance (ANOVA), F 6,188 = 8.193, P < 0.001] and at the level of genus and species for HCO 2198 (ANOVA, F 6,77 = 2.538, P < 0.027). We conclude that, at different taxonomic levels, it is possible to design forward primers from reference sequences belonging to the level of order (maximum 5 bp differences), family (maximum 6 bp differences) or genus (maximum 1 bp difference). Reverse primers can be designed from the level of family (maximum 5 bp differences) or genus (maximum 2 bp differences).

  14. Aerospace Non Chrome Corrosion Inhibiting Primer Systems

    DTIC Science & Technology


    Aerospace Coatings | Title 1 AsetsDefense 2009 Workshop Aerospace Non Chrome Corrosion Inhibiting Primer Systems Roger Brown, Akzonobel Aerospace...DATE SEP 2009 2. REPORT TYPE 3. DATES COVERED 00-00-2009 to 00-00-2009 4. TITLE AND SUBTITLE Aerospace Non Chrome Corrosion Inhibiting Primer...Title 2 Overview comments and a historical perspective on non chrome systems A quick test; Technology development for replacement of chromated

  15. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.


    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  16. VizPrimer: a web server for visualized PCR primer design based on known gene structure.


    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang


    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0).;

  17. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.


    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus


    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at

  18. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas


    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  19. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes


    Yoon, Hyejin; Leitner, Thomas


    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  20. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.


    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  1. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.


    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades


    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  2. Specific primer design for the polymerase chain reaction.


    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong


    The design of primers has a major impact on the success of PCR in relation to the specificity and yield of the amplified product. Here, we introduce the applications of PCR as well as the definition and characteristics for PCR primer design. Recent primer design tools based on Primer3, along with several computational intelligence-based primer design methods which have been applied in primer design, are also reviewed. In addition, characteristics of population-based methods used in primer design are discussed in detail.

  3. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner


    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open…

  4. Primer-design for multiplexed genotyping.


    Kaderali, Lars; Deshpande, Alina; Nolan, John P; White, P Scott


    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Mutation analysis by polymerase-mediated single-base primer extension (minisequencing) can be massively parallelized using DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5' end of the minisequencing primer and attaching the complementary antitag to the array or bead surface, the assay can be 'demultiplexed'. Such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. We present a computer program to automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/antitag system is generated, and the pairing of primers and DNA tags is automatically done in a way to avoid any crossreactivity. We report results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping. The software is available to academic users on request.

  5. Exquisite allele discrimination by toehold hairpin primers

    PubMed Central

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.


    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  6. Climate Change, Health, and Communication: A Primer.


    Chadwick, Amy E


    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  7. CEMAsuite: open source degenerate PCR primer design.


    Lane, Courtney E; Hulgan, Daniel; O'Quinn, Kelly; Benton, Michael G


    The codon-equivalent multiple alignment suite begins conservational analysis for polymerase chain reaction primer design at the protein level, allowing the user to design consensus primers capable of detecting homologous coding sequences even when low-to-moderate sequence information is available. This package also condenses the wealth of information associated with multiple sequence alignments and presents them in an intuitive manner, allowing the user to quickly and effectively address degenerate primer design considerations. or Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  8. Primer removal during mammalian mitochondrial DNA replication.


    Uhler, Jay P; Falkenberg, Maria


    The small circular mitochondrial genome in mammalian cells is replicated by a dedicated replisome, defects in which can cause mitochondrial disease in humans. A fundamental step in mitochondrial DNA (mtDNA) replication and maintenance is the removal of the RNA primers needed for replication initiation. The nucleases RNase H1, FEN1, DNA2, and MGME1 have been implicated in this process. Here we review the role of these nucleases in the light of primer removal pathways in mitochondria, highlight associations with disease, as well as consider the implications for mtDNA replication initiation. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Development of Specific Primer for Tricholoma matsutake

    PubMed Central

    Kim, Jang-Han


    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study. PMID:23983557

  10. Primer design versus PCR bias in methylation independent PCR amplifications.


    Wojdacz, Tomasz K; Borgbo, Tanni; Hansen, Lise Lotte


    Many protocols in methylation studies utilize one primer set to generate a PCR product from bisulfite modified template regardless of its methylation status (methylation independent amplification MIP). However, proportional amplification of methylated and unmethylated alleles is hard to achieve due to PCR bias favoring amplification of unmethylated relatively GC poor sequence. Two primer design systems have been proposed to overcome PCR bias in methylation independent amplifications. The first advises against including any CpG dinucleoteides into the primer sequence (CpG-free primers) and the second, recently published by us, is based on inclusion of a limited number of CpG sites into the primer sequence. Here we used the Methylation Sensitive High Resolution Melting (MS-HRM) technology to investigate the ability of primers designed according to both of the above mentioned primer design systems to proportionally amplify methylated and unmethylated templates. Ten "CpG-free" primer pairs and twenty primers containing limited number of CpGs were tested. In reconstruction experiments the "CpG-free" primers showed primer specific sensitivity and allowed us to detect methylation levels in the range from 5 to 50%. Whereas while using primers containing limited number of CpG sites we were able to consistently detect 1-0.1% methylation levels and effectively control PCR amplification bias. In conclusion, the primers with limited number of CpG sites are able to effectively reverse PCR bias and therefore detect methylated templates with significantly higher sensitivity than CpG free primers.

  11. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye


    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  12. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  13. Sex Stereotyping in Mexican Reading Primers.

    ERIC Educational Resources Information Center

    Heathcote, Olvia D.


    An investigation of sex role stereotypes appearing in primers used in Mexico found males depicted as active, intelligent, strong, and in command, and females shown as suitable only for doing housework, providing emotional support, aiding the elderly, and observing active males. (FL)

  14. The FAS Child: A Primer for Teachers.

    ERIC Educational Resources Information Center

    Wentz, Thomas L.; Larson, Julie


    This primer on fetal alcohol syndrome (FAS) distinguishes between the syndrome and fetal alcohol effects (FAE), offers a history of FAS, outlines medical criteria for diagnosis, rates of incidence, factors influencing incidence and severity, developmental stages of children with FAS, clinical features, and educational implications and approaches.…

  15. School Safety & Youth Violence: A Legal Primer.

    ERIC Educational Resources Information Center

    Bailey, Kirk A.; Ross, Catherine J.

    This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…

  16. Primers for Clinical Detection of Paracoccidioides brasiliensis

    PubMed Central

    San-Blas, Gioconda; Niño-Vega, Gustavo; Barreto, Laura; Hebeler-Barbosa, Flavia; Bagagli, Eduardo; Olivero de Briceño, Rosa; Mendes, Rinaldo Poncio


    From a 0.72-kb fragment universally generated in Paracoccidioides brasiliensis strains, primers were designed and tested on genomic DNA of this and other pathogenic fungi. They were specific and highly sensitive for P. brasiliensis DNA. Positive results were obtained when these were tested in clinical samples. PMID:16081993

  17. A primer on effectiveness and efficacy trials.


    Singal, Amit G; Higgins, Peter D R; Waljee, Akbar K


    Although efficacy and effectiveness studies are both important when evaluating interventions, they serve distinct purposes and have different study designs. Unfortunately, the distinction between these two types of trials is often poorly understood. In this primer, we highlight several differences between these two types of trials including study design, patient populations, intervention design, data analysis, and result reporting.

  18. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  19. Apparatus For Tests Of Percussion Primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.


    Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.

  20. A Primer on Basic Effect Size Concepts.

    ERIC Educational Resources Information Center

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  1. Internet Primer: Workshop Design and Objectives.

    ERIC Educational Resources Information Center

    Laverty, Corinne Y. C.


    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  2. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  3. Microsatellite primers for red drum (Sciaenops ocellatus)

    USDA-ARS?s Scientific Manuscript database

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  4. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  5. PrimerDesign-M: a multiple-alignment based multiple-primer design tool for walking across variable genomes.


    Yoon, Hyejin; Leitner, Thomas


    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. Furthermore, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions. PrimerDesign-M is available as a webtool at or Published by Oxford University Press 2014. This work is written by US Government employees and is in the public domain in the US.

  6. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.


    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  7. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur


    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers

  8. Deconstructing the polymerase chain reaction: understanding and correcting bias associated with primer degeneracies and primer-template mismatches.


    Green, Stefan J; Venkatramanan, Raghavee; Naqib, Ankur


    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3-12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled "Polymerase-exonuclease (PEX) PCR", in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3' end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and

  9. Primer design using Primer Express® for SYBR Green-based quantitative PCR.


    Singh, Amarjeet; Pandey, Girdhar K


    To quantitate the gene expression, real-time RT-PCR or quantitative PCR (qPCR) is one of the most sensitive, reliable, and commonly used methods in molecular biology. The reliability and success of a real-time PCR assay depend on the optimal experiment design. Primers are the most important constituents of real-time PCR experiments such as in SYBR Green-based detection assays. Designing of an appropriate and specific primer pair is extremely crucial for correct estimation of transcript abundance of any gene in a given sample. Here, we are presenting a quick, easy, and reliable method for designing target-specific primers using Primer Express(®) software for real-time PCR (qPCR) experiments.

  10. Loop-Mediated Amplification Accelerated by Stem Primers

    PubMed Central

    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence


    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  11. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.


    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  12. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.


    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt


    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (

  13. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    PubMed Central

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt


    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website ( PMID:28117430

  14. Primer3—new capabilities and interfaces

    PubMed Central

    Untergasser, Andreas; Cutcutache, Ioana; Koressaar, Triinu; Ye, Jian; Faircloth, Brant C.; Remm, Maido; Rozen, Steven G.


    Polymerase chain reaction (PCR) is a basic molecular biology technique with a multiplicity of uses, including deoxyribonucleic acid cloning and sequencing, functional analysis of genes, diagnosis of diseases, genotyping and discovery of genetic variants. Reliable primer design is crucial for successful PCR, and for over a decade, the open-source Primer3 software has been widely used for primer design, often in high-throughput genomics applications. It has also been incorporated into numerous publicly available software packages and web services. During this period, we have greatly expanded Primer3’s functionality. In this article, we describe Primer3’s current capabilities, emphasizing recent improvements. The most notable enhancements incorporate more accurate thermodynamic models in the primer design process, both to improve melting temperature prediction and to reduce the likelihood that primers will form hairpins or dimers. Additional enhancements include more precise control of primer placement—a change motivated partly by opportunities to use whole-genome sequences to improve primer specificity. We also added features to increase ease of use, including the ability to save and re-use parameter settings and the ability to require that individual primers not be used in more than one primer pair. We have made the core code more modular and provided cleaner programming interfaces to further ease integration with other software. These improvements position Primer3 for continued use with genome-scale data in the decade ahead. PMID:22730293

  15. Specific PCR product primer design using memetic algorithm.


    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei


    To provide feasible primer sets for performing a polymerase chain reaction (PCR) experiment, many primer design methods have been proposed. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specific PCR product size. In recent years, evolutionary computation has been applied to PCR primer design and yielded promising results. In this article, a memetic algorithm (MA) is proposed to solve primer design problems associated with providing a specific product size for PCR experiments. The MA is compared with a genetic algorithm (GA) using an accuracy formula to estimate the quality of the primer design and test the running time. Overall, 50 accession nucleotide sequences were sampled for the comparison of the accuracy of the GA and MA for primer design. Five hundred runs of the GA and MA primer design were performed with PCR product lengths of 150-300 bps and 500-800 bps, and two different methods of calculating T(m) for each accession nucleotide sequence were tested. A comparison of the accuracy results for the GA and MA primer design showed that the MA primer design yielded better results than the GA primer design. The results further indicate that the proposed method finds optimal or near-optimal primer sets and effective PCR products in a dry dock experiment. Related materials are available online at

  16. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.


    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  17. Fractal antenna and fractal resonator primer

    NASA Astrophysics Data System (ADS)

    Cohen, Nathan


    Self-similarity and fractals have opened new and important avenues for antenna and electronic solutions over the last 25 years. This primer provides an introduction to the benefits provided by fractal geometry in antennas, resonators, and related structures. Such benefits include, among many, wider bandwidths, smaller sizes, part-less electronic components, and better performance. Fractals also provide a new generation of optimized design tools, first used successfully in antennas but applicable in a general fashion.

  18. Genetics and health communication: a primer.


    Greenberg, Marisa S


    The progress of genetic knowledge has been swift and steadfast. As we move forward in the genomic era, post Human Genome Project, and continue to explore how one's genes interact with one's environment, it becomes increasingly important for all audiences to have a firm grasp of the vocabulary used in this health context. This primer is intended to be used as a reference and to introduce and/or make more clear concepts related to genetics to increase understanding.

  19. Chromate concentration bias in primer paint particles.


    LaPuma, P T; Fox, J M; Kimmel, E C


    Chromate-containing primer paints are used to prevent corrosion on metal surfaces. Chromate contains hexavalent chromium (Cr6+), a human carcinogen. The objective of this research was to determine if there is a bias in the fraction of chromate found in various particle sizes generated during primer painting operations. A solvent-based, aviation primer paint was sprayed using a high-volume, low-pressure spray gun. Paint particles were collected and separated by size with seven-stage cascade impactors. It was determined that particles with a mass aerodynamic diameter < 2.0 microm contained significantly less Cr6+ per dry weight of paint than particles > 2.0 microm (P < 0.001). The median concentration of Cr6+ in particles < 2.0 microm is 18 micro g of Cr/mg of dry paint and the median concentration for particles > 2.0 microm is 70 microg of Cr/mg of dry paint. The mixed paint contains 18.75% strontium chromate, which equates to a ratio of 67 microg of Cr/mg of dry paint. Particles > 2.0 microm are more likely to impact in the upper tracheobronchial regions of the lung where mucociliary clearance is relatively rapid. Additionally, chromate emissions from spraying operations may be overestimated because larger particles, which are more easily trapped on an air filter, contain more chromate than the smaller particles, which are more likely to bypass an air filter.

  20. Universal COI primers for DNA barcoding amphibians.


    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping


    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  1. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.


    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei


    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  2. Low-copy nuclear primers and ycf1 primers in Cactaceae.


    Franck, Alan R; Cochrane, Bruce J; Garey, James R


    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  3. MPprimer: a program for reliable multiplex PCR primer design.


    Shen, Zhiyong; Qu, Wubin; Wang, Wen; Lu, Yiming; Wu, Yonghong; Li, Zhifeng; Hang, Xingyi; Wang, Xiaolei; Zhao, Dongsheng; Zhang, Chenggang


    Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs) for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2x to 5x plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy), which has 79 exons, for 20x, 20x, 20x, 14x, and 5x plex PCR reactions in five tubes to detect underlying exon deletions. MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  4. Spectrophotometric determination of tetrazene in primers and primer mixes by use of resorcinol.


    Norwitz, G; Keliher, P N


    A spectrophotometric method is proposed for the determination of tetrazene (tetracene) in primers and primer mixes that involves treatment of the tetrazene with resorcinol solution and measurement of the intensity of the yellow colour of the diazo-dye produced. In the application of the method, lead styphnate and barium nitrate are first removed by extraction with ammonium acetate solution and then nitrocellulose and PETN are removed by extraction with acetone. The insoluble matter containing the tetrazene is boiled with resorcinol reagent, the solution filtered, and the absorbance measured at 400 nm. Conditions for optimum colour development are studied and the nature of the reaction is considered.

  5. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.


    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  6. A Primer on Risks, Issues and Opportunities

    DTIC Science & Technology


    Defense AT&L: July-August 2016 8 9 Defense AT&L: July-August 2016 A Primer on Risks , Issues and Opportunities Thomas L. Conroy II, Ed.D. Conroy...example, program offices deal with tech­ nical risks in the form of technologies that are not mature enough or are unable to provide the same production that was achieved in development. They also deal with cost risks such as an insufficient budget or budgetary cost overruns and

  7. Hubble Space Telescope Primer for Cycle 21

    NASA Astrophysics Data System (ADS)

    Gonzaga, S.; et al.


    The Hubble Space Telescope Primer for Cycle 21 is a companion document to the HST Call for Proposals1. It provides an overview of the Hubble Space Telescope (HST), with basic information about telescope operations, instrument capabilities, and technical aspects of the proposal preparation process. A thorough understanding of the material in this document is essential for the preparation of a competitive proposal. This document is available as an online HTML document and a PDF file. The HTML version, optimized for online browsing, contains many links to additional information. The PDF version is optimized for printing, but online PDF readers have search capabilities for quick retrieval of specific information.

  8. A primer on clinical trial design.


    Ellimoottil, Chad; Vijan, Sandeep; Flanigan, Robert C


    A well-designed and executed clinical trial is the gold standard of evidence-based medicine. It is important for readers to understand the rationale for the study design, identify common pitfalls, and scrutinize limitations. Herein, we present a brief overview of types of designs used for clinical trials and discuss the use of appropriate end points, the selection of study participants, randomization, sample size calculation, blinding, and analysis of data. Finally, we emphasize the importance of accurate and transparent reporting. Our goal is to provide a primer for practicing urologists to enhance their understanding of the clinical trial literature.

  9. Development of TRAP primers for Ricinus communis L.


    Simões, K S; Silva, S A; Machado, E L; Brasileiro, H S


    The objective of this article was to develop TRAP (target region amplification polymorphism) primers for castor bean, with the goal of making functional markers available for genetic studies about the species. To do this, oligonucleotides were designed based on ESTs, obtained from the NCBI (National Center for Biotechnology Information) databank, which code enzymes involved in metabolic routes of fatty acid synthesis, ricin synthesis, and resistance to castor bean pathogens. The forward primers were designed with the help of the Primer3 software and, for the reverse, six arbitrary primers were used. To standardize the amplification reactions, the following criteria were used to select the primers: sizes between 18 and 20 bp, guanine/cytosine (GC) in the range of 40 to 60%, and average annealing temperature between 55° and 62°C. The design quality of the primers was verified using the Net Primer application. Fifty-six primers were designed, which had an average GC percentage of 53.2%. A total of 336 combinations were obtained using the 56 fixed and 6 arbitrary primers. Based on polymerase chain reaction, 330 combinations (89%) presented good amplification patterns for the genomic DNA of castor bean. The size of the fragments amplified varied between 50 and 2072 bp. The TRAP primers designed and validated in this study are the first for castor bean and represent a significant increase in the molecular markers for this species.

  10. Formaldehyde as hypothetical primer of biohomochirality

    NASA Astrophysics Data System (ADS)

    Goldanskii, Vitalii I.


    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and ``annihilation'' of L and D enantiomers) to the series of interactions of FA ``trimers'' (i.e. C3H6O3 compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means ``achirons'' (a=CHn, n>=2 and C=M, M=C,O) and (p) mean ``prochirons'' (p=HC*OM, M=H,C).

  11. Global Health in Family Medicine Summer Primer

    PubMed Central

    Rouleau, Katherine; Janakiram, Praseedha; Nicolle, Eileen; Godoy-Ruiz, Paula; Pakes, Barry N.


    Abstract Problem addressed Despite the rapid emergence of global health training across North American universities, there remains a gap in educational programs focusing on the unique role of family medicine and primary care in global health. Objective of program The objective of the Global Health in Family Medicine Summer Primer, developed in 2013 by the Department of Family and Community Medicine at the University of Toronto in Ontario, is to strengthen global health competencies among family medicine residents and faculty. Program description The course covers the meaning of global health; global health ethics; the place of family medicine, primary care, and primary health care in the global health context; epidemiology; infectious diseases; the social determinants of health; and care of vulnerable populations locally and globally. The course is delivered in an intensive 5-day format with didactic lectures, group discussions, interactive workshops, and lived-experience panels. Conclusion The Global Health in Family Medicine Summer Primer has proven to be a successful educational initiative and provides valuable lessons learned for other academic science centres in developing global health training programs for family medicine residents and faculty. PMID:26380854

  12. Alanylated lipoteichoic acid primer in Bacillus subtilis

    PubMed Central

    Luo, Yu


    Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG) moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid. PMID:27134729

  13. MultiPLX: automatic grouping and evaluation of PCR primers.


    Kaplinski, Lauris; Andreson, Reidar; Puurand, Tarmo; Remm, Maido


    MultiPLX is a new program for automatic grouping of PCR primers. It can use many different parameters to estimate the compatibility of primers, such as primer-primer interactions, primer-product interactions, difference in melting temperatures, difference in product length and the risk of generating alternative products from the template. A unique feature of the MultiPLX is the ability to perform automatic grouping of large number (thousands) of primer pairs. Binaries for Windows, Linux and Solaris are available from A graphical version with limited capabilities can be used through a web interface at The source code of the program is available on request for academic users.

  14. Conflict Termination--Transitioning from Warrior to Constable: A Primer

    DTIC Science & Technology


    of Civilian Buildings. C. Funding. D. Contracts. III. Miscellaneous Issues. A. Status of Parsons. B. Souvenirs and War Trophies. C. Adoptions. D...stability phases. While the primer does not cite examples of conflicts with developed countrieo, the primer will be as applicable to the developing ...countries of Eastern Europe as it is to those found in Africa. Additionally, the principles presented in this primer are also applicable to developed

  15. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    EPA Pesticide Factsheets

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  16. Oligonucleotide primers for PCR amplification of coelomate introns.


    Jarman, Simon N; Ward, Robert D; Elliott, Nicholas G


    Abstract Seven novel oligonucleotide primer pairs for polymerase chain reaction amplification of introns from nuclear genes in coelomates were designed and tested. Each pair bound to adjacent exons that are separated by a single intron in most coelomate species. The primer sets amplified introns in species as widely separated by the course of evolution as oysters (Mollusca: Protostoma) and salmon (Chordata: Deuterostoma). Each primer set was tested on a further 6 coelomate species and found to amplify introns in most cases. These primer sets may therefore be useful tools for developing nuclear DNA markers in diverse coelomate species for studies of population genetics, phylogenetics, or genome mapping.

  17. Homolog-specific PCR primer design for profiling splice variants.


    Srivastava, Gyan Prakash; Hanumappa, Mamatha; Kushwaha, Garima; Nguyen, Henry T; Xu, Dong


    To study functional diversity of proteins encoded from a single gene, it is important to distinguish the expression levels among the alternatively spliced variants. A variant-specific primer pair is required to amplify each alternatively spliced variant individually. For this purpose, we developed a new feature, homolog-specific primer design (HSPD), in our high-throughput primer and probe design software tool, PRIMEGENS-v2. The algorithm uses a de novo approach to design primers without any prior information of splice variants or close homologs for an input query sequence. It not only designs primer pairs but also finds potential isoforms and homologs of the input sequence. Efficiency of this algorithm was tested for several gene families in soybean. A total of 187 primer pairs were tested under five different abiotic stress conditions with three replications at three time points. Results indicate a high success rate of primer design. Some primer pairs designed were able to amplify all splice variants of a gene. Furthermore, by utilizing combinations within the same multiplex pool, we were able to uniquely amplify a specific variant or duplicate gene. Our method can also be used to design PCR primers to specifically amplify homologs in the same gene family. PRIMEGENS-v2 is available at:

  18. Great Lakes rivermouths: a primer for managers

    USGS Publications Warehouse

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul


    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  19. HST archive primer, version 4.1

    NASA Technical Reports Server (NTRS)

    Fruchter, A. (Editor); Baum, S. (Editor)


    This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.

  20. Primer on tritium safe handling practices

    SciTech Connect

    Not Available


    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  1. Spectral analysis of clock noise: a primer

    NASA Astrophysics Data System (ADS)

    Percival, Donald B.


    The statistical characterization of clock noise is important for understanding how well a clock can perform in applications where timekeeping is important. The usual frequency domain characterization of clock noise is the power spectrum. We present a primer on how to estimate the power spectrum of clock noise given a finite sequence of measurements of time (or phase) differences between two clocks. The simplest estimator of the spectrum is the periodogram. Unfortunately this estimator is often problematic when applied to clock noise. Three estimators that overcome the deficiencies of the periodogram are the sinusoidal multitaper spectral estimator, Welch's overlapped segment averaging estimator and Burg's autoregressive estimator. We give complete details on how to calculate these three estimators. We apply them to two examples of clock noise and find that they all improve upon the periodogram and give comparable results. We also discuss some of the uses for the spectrum and its estimates in the statistical characterization of clock noise.

  2. Formaldehyde as hypothetical primer of biohomochirality

    SciTech Connect

    Goldanskii, V.I.


    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  3. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].


    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh


    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  4. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    NASA Astrophysics Data System (ADS)


    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  5. Aluminum Rich Epoxy Primer for Ground and Air Vehicles

    DTIC Science & Technology


    UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements...outlined within the BAA. Development Work: This past month has been spent evaluating different thixotrope systems for the Aluminum Rich

  6. Utilization of ribonucleotides and RNA primers by Tetrahymena telomerase.


    Collins, K; Greider, C W


    Telomerase is a ribonucleoprotein (RNP) DNA polymerase involved in telomere synthesis. A short sequence within the telomerase RNA component provides a template for de novo addition of the G-rich strand of a telomeric simple sequence repeat onto chromosome termini. In vitro, telomerase can elongate single-stranded DNA primers processively: one primer can be extended by multiple rounds of template copying before product dissociation. Telomerase will incorporate dNTPs or ddNTPs and will elongate any G-rich, single-stranded primer DNA. In this report, we show that Tetrahymena telomerase was able to incorporate a ribonucleotide, rGTP, into product polynucleotide. Synthesis of the product [d(TT)r(GGGG)]n was processive, suggesting that the chimeric product remained associated with the enzyme both at the active site and at a second, previously characterized, template-independent product binding site. As predicted by this finding, RNA-containing oligonucleotides served as primers for elongation. More than 3 nt of RNA at a primer 3' end decreased the quantity of product synthesis but increased the affinity of the primer for telomerase. Thus, RNA-containing primers were effective as competitive inhibitors of DNA primer elongation by telomerase. These results support the possible evolutionary origin of telomerase as an RNA-dependent RNA polymerase.

  7. An Evaluation Primer Workbook: Practical Exercises for Educators.

    ERIC Educational Resources Information Center

    Fink, Arlene; Kosecoff, Jacqueline

    This workbook, which accompanies An Evaluation Primer (TM 007 500) consists of 19 practical exercises for applying evaluation skills to hypothetical educational programs. Each chapter corresponds to a chapter in the primer, with answers keyed accordingly. Intended to provide an introduction to evaluation, the exercises include: identifying the…

  8. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    ERIC Educational Resources Information Center

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  9. A Primer for the NEWBASIC/CATALYST System.

    ERIC Educational Resources Information Center

    Dwyer, Thomas A.; And Others

    Assuming no previous experience with computers, this primer is designed to help students, teachers, scientists, and other scholars to learn how to use the NEWBASIC/CATALYST system (NBS). The primer contains nine sections: (1) instructions for establishing contact with the computer (logging on); (2) examples and problems to lead the student through…

  10. Primer of Business Terms and Phrases Related to Libraries.

    ERIC Educational Resources Information Center

    Hayes, Sherman, Ed.

    Although appropriate for all librarians, this primer is aimed at beginning librarians and students pursuing library science degrees, and covers 150 terms used in most libraries. The purpose of the primer is to encourage its readers to analyze their use of the defined business terms and to expose them to new and applicable terminology. The work…

  11. PolyMarker: A fast polyploid primer design pipeline.


    Ramirez-Gonzalez, Ricardo H; Uauy, Cristobal; Caccamo, Mario


    The design of genetic markers is of particular relevance in crop breeding programs. Despite many economically important crops being polyploid organisms, the current primer design tools are tailored for diploid species. Bread wheat, for instance, is a hexaploid comprising of three related genomes and the performance of genetic markers is diminished if the primers are not genome specific. PolyMarker is a pipeline that generates SNP markers by selecting candidate primers for a specified genome using local alignments and standard primer design tools to test the viability of the primers. A command line tool and a web interface are available to the community. PolyMarker is available as a ruby BioGem: bio-polyploid-tools. Web interface: © The Author 2015. Published by Oxford University Press.

  12. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.


    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  13. DNA sequencing technology, walking with modular primers. Final report

    SciTech Connect

    Ulanovsky, L.


    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  14. Moisture insensitive primer: A myth or truth

    PubMed Central

    Shukla, Chandresh; Maurya, Rajkumar; Jain, Upendra; Gupta, Ankur; Garg, Jayshree


    Objectives: To compare the mean shear bond strength (SBS) of moisture insensitive primer (MIP) used for orthodontic bonding in the presence and absence of saliva. Materials and Methods: A total of 60 human noncarious maxillary premolars with sound buccal surfaces, recently extracted were collected in two groups of each 30. Maxillary premolar brackets were bonded to the teeth using light cure (Transbond XT, 3M Unitek, Monrovia, CA, USA) and MIP (Transbond MIP 3M Unitek, Monrovia, CA, USA,) in the presence and absence of saliva. Operators’ saliva was used during the bonding under moist condition. After debonding, all the specimens were examined under a stereomicroscope (×40 magnification) for adhesive remnant using adhesive remnant index (ARI). The SBS tests were done using Instron universal testing machine at cross-head speed of 1 mm/min, force passing parallel to the buccal surface using custom rod and registered in Newtons later converted into Megapascals. Results: Light cure and MIP (Transbond MIP and Transbond XT, 3M Unitek, Monrovia, CA, USA) in the absence of saliva showed higher mean SBS than the presence of saliva. Group I (light cure and MIP) in the absence of saliva showed mean SBS of 9.65 ± 0.90 Mpa. Group II (light cure and MIP) with the presence of saliva showed mean SBS of 9.03 ± 1.14 Mpa. The difference between both the groups was statistically significant, as confirmed by paired t-test (P < 0.05). In-Group I, ARI scores showed that more than half of the adhesive was left over the tooth surface, and Group II showed that there was no or insignificant amount of adhesive left over the tooth surface. Chi-square test revealed significant difference in debonding characteristics among the test groups of ARI (P < 0.05). Failure occurred mainly in resin– bracket base and resin – adhesive interfaces (χ² = 10.04, df = 3, P = 0.031). Conclusion: Moisture insensitive primer is effective in the presence/absence of moisture and has shown SBS value of more

  15. Transforming practices: a primer on action research.


    Acosta, Sandra; Goltz, Heather Honoré


    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  16. Primer on electricity futures and other derivatives

    SciTech Connect

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.


    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  17. Antifungal susceptibility testing: a primer for clinicians.


    Kuper, Kristi M; Coyle, Elizabeth A; Wanger, Audrey


    Antifungal susceptibility testing is not as commonly performed as antibacterial susceptibility testing. The methodology for detecting antifungal resistance is newer and requires different testing supplies that may not be readily available in a clinical laboratory setting. Breakpoints for molds are lacking. Yeast breakpoints are available for most antifungals but are continually updated based on epidemiologic surveillance. Reliable and reproducible antifungal susceptibility testing methods, as well as more research on the role of susceptibility testing in patient care, are necessary in order to provide the clinician with information that can be translated into positive clinical outcomes at the bedside. There are nuances with current testing methods that, if unrecognized, could lead to misinterpretation of results and inappropriate antifungal selection. Clinicians who have an understanding of qualitative and quantitative methods, automated susceptibility testing systems, and other commercial tests can successfully engage this knowledge to improve antifungal use and patient outcomes. This primer describes the common antifungal susceptibility tests used in the clinical microbiology laboratory and reviews literature related to the impact of appropriate drug selection, timing, fungal resistance mechanisms, pharmacokinetics, and pharmacodynamics on clinical outcomes. Both conventional and modern testing methods are discussed. © 2012 Pharmacotherapy Publications, Inc.

  18. Phoenix : Complex Adaptive System of Systems (CASoS) engineering version 1.0.

    SciTech Connect

    Moore, Thomas W.; Quach, Tu-Thach; Detry, Richard Joseph; Conrad, Stephen Hamilton; Kelic, Andjelka; Starks, Shirley J.; Beyeler, Walter Eugene; Brodsky, Nancy S.; Verzi, Stephen J.; Brown, Theresa Jean; Glass, Robert John, Jr.; Sunderland, Daniel J.; Mitchell, Michael David; Ames, Arlo Leroy; Maffitt, S. Louise; Finley, Patrick D.; Russell, Eric Dean; Zagonel, Aldo A.; Reedy, Geoffrey E.; Mitchell, Roger A.; Corbet, Thomas Frank, Jr.; Linebarger, John Michael


    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to pervasive interdependencies and attendant vulnerabilities to cascades in associated systems. Phoenix was initiated to address this high-impact problem space as engineers. Our overarching goals are maximizing security, maximizing health, and minimizing risk. We design interventions, or problem solutions, that influence CASoS to achieve specific aspirations. Through application to real-world problems, Phoenix is evolving the principles and discipline of CASoS Engineering while growing a community of practice and the CASoS engineers to populate it. Both grounded in reality and working to extend our understanding and control of that reality, Phoenix is at the same time a solution within a CASoS and a CASoS itself.

  19. Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.

    SciTech Connect

    Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene; Brown, Theresa Jean; Linebarger, John Michael; Moore, Thomas W.; Glass, Robert John, Jr.; Maffitt, S. Louise; Mitchell, Michael David; Ames, Arlo Leroy


    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understanding and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS

  20. Complex Adaptive System of Systems (CASoS) Engineering Applications. Version 1.0.

    SciTech Connect

    Linebarger, John Michael; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Brown, Theresa Jean; Ames, Arlo Leroy


    Complex Adaptive Systems of Systems, or CASoS, are vastly complex eco-socio-economic-technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to highly-saturated interdependencies and allied vulnerabilities to cascades in associated systems. The Phoenix initiative approaches this high-impact problem space as engineers, devising interventions (problem solutions) that influence CASoS to achieve specific aspirations. CASoS embody the world's biggest problems and greatest opportunities: applications to real world problems are the driving force of our effort. We are developing engineering theory and practice together to create a discipline that is grounded in reality, extends our understanding of how CASoS behave, and allows us to better control those behaviors. Through application to real-world problems, Phoenix is evolving CASoS Engineering principles while growing a community of practice and the CASoS engineers to populate it.

  1. PD5: a general purpose library for primer design software.


    Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda


    Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples:

  2. Plastid primers for angiosperm phylogenetics and phylogeography1

    PubMed Central

    Prince, Linda M.


    Premise of the study: PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Methods: Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Results: Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Discussion: Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. “Universal” primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications. PMID:26082876

  3. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda


    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: PMID:24278254

  4. Shear bond strength comparison of moisture-insensitive primer and self-etching primer

    PubMed Central

    Goswami, Arunima; Mitali, Borah; Roy, BK


    Context: The detrimental effect of moisture on orthodontic bonding has long been known. Hydrophilic bonding materials have been introduced suggesting the possibility of obtaining successful orthodontic bonding to a moisture contaminated enamel surface. Aims: This study has been performed with an aim to compare the in vitro shear bond strength (SBS) and debonding characteristic of moisture-insensitive primer (MIP) (Transbond MIP) (3M Unitek, South Peck Road, Monrovia, California, USA) and self-etching primer (SEP) (Transbond Plus SEP) (3M Unitek, South Peck Road, Monrovia, California, USA) in combination with a color changing adhesive system (Transbond Plus Color Change) (3M Unitek, South Peck Road, Monrovia, California, USA) under both dry and contaminated condition. Settings and Design: Randomized controlled clinical study. Subjects and Methods: One hundred and twenty freshly extracted teeth for the purpose of orthodontic treatment were collected. Teeth were randomly assigned into four groups, each consisting of 30 specimen and stainless steel brackets were bonded using each primer-adhesive combination under different enamel conditions, that is, dry and enamel contaminated with natural saliva. SBS and adhesive remnant index were calculated for each group. Results: Analysis of variance of SBS for both MIP and SEP under dry and contaminated condition showed no statistical significance (P = 0.5). Chi-square test showed significant difference in debonding characteristics among the test groups (P < 0.001). All the groups showed typical debonding characteristics of separation either at the bracket-adhesive interface or within the adhesive itself. Conclusions: Moisture contamination did not affect the SBS and adhesive remaining on tooth for both MIP and SEP. PMID:25143933

  5. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron


    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  6. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.


    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  7. Quantitative PCR measurements of the effects of introducing inosines into primers provides guidelines for improved degenerate primer design.


    Zheng, Linda; Gibbs, Mark J; Rodoni, Brendan C


    Polymerase chain reaction (PCR) is used to detect groups of viruses with the use of group-specific degenerate primers. Inosine residues are sometimes used in the primers to match variable positions within the complementary target sequences, but there is little data on their effects on cDNA synthesis and amplification. A quantitative reverse-transcription PCR was used to measure the rate of amplification with primers containing inosine residues substituted at different positions and in increasing numbers. Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA. Single inosine residues had no affect on the amplification rate in the forward primer, except at one position close to the 3' terminus. Conversely, single inosine residues significantly reduced the amplification rate when placed at three out of four positions in the reverse primer. Four or five inosine substitutions could be tolerated with some decline in rates, but amplification often failed from cRNA templates with primers containing larger numbers of inosines. Greater declines in the rate of amplification were observed with RNA templates, suggesting that reverse transcription suffers more than PCR amplification when inosine is included in the reverse primer.

  8. Complex Adaptive Special Operations (CASO)

    DTIC Science & Technology


    impeded by an organizational command and control superstructure designed to support a centralized decision making process. The four components of...and David. Organizational Survival in the New World: The Intelligent Complex Adaptive System (Burlington, MA: KMCI Press, 2004), 295. 2 Clay, Peter... Behavoir ,, accessed 2 December 2006. 54 Possible CASO rules may include: exposure – don’t get

  9. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    PubMed Central

    Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J


    Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most

  10. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs.


    Housley, Donna J E; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J


    Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6-8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC > or = 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. The most important factors influencing the

  11. Microsatellite primers for the Pacific Northwest conifer Callitropsis nootkatensis (Cupressaceae)


    Tar N. Jennings; Brian J. Knaus; Katherine Alderman; Paul E. Hennon; David V. D’Amore; Richard. Cronn


    Microsatellite primers were developed for Nootka cypress ( Callitropsis nootkatensis ) to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline.

  12. DPPrimer – A Degenerate PCR Primer Design Tool

    PubMed Central

    Gahoi, Shachi; Arya, L; Anil, Rai; Marla, ss


    Designed degenerate primers unlike conventional primers are superior in matching and amplification of large number of genes, from related gene families. DPPrimer tool was designed to predict primers for PCR amplification of homologous gene from related or diverse plant species. The key features of this tool include platform independence and user friendliness in primer design. Embedded features such as search for functional domains, similarity score selection and phylogebetic tree further enhance the user friendliness of DPPrimer tool. Performance of DPPrimer tool was evaluated by successful PCR amplification of ADP-glucose phosphorylase genes from wheat, barley and rice. Availability DPPrimer is freely accessible at PMID:24307773


    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  14. Best Development Practices: A Primer for Smart Growth

    EPA Pesticide Factsheets

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  15. MultiPLX: automatic grouping and evaluation of PCR primers.


    Kaplinski, Lauris; Remm, Maido


    In this chapter, we describe MultiPLX-a tool for automatic grouping of PCR primers for multiplexed PCR. Both generic working principle and step-by-step practical procedures with examples are presented. MultiPLX performs grouping by calculating many important interaction levels between the different primer pairs and then distributes primer pairs to groups, so that the strength of unwanted interactions is kept below user-defined compatibility level. In addition, it can be used to select optimal primer pairs for multiplexing from list of candidates. MultiPLX can be downloaded from Graphical Web-based interface to most functions of MultiPLX is available at

  16. MultiPLX: automatic grouping and evaluation of PCR primers.


    Kaplinski, Lauris; Remm, Maido


    In this chapter we describe MultiPLX-a tool for automatic grouping of PCR primers for multiplexed PCR. Both generic working principle and step-by-step practical procedures with examples are presented. MultiPLX performs grouping by calculating many important interaction levels between the different primer pairs and then distributes primer pairs to groups so that the strength of unwanted interactions is kept below user-defined compatibility level. In addition it can be used to select optimal primer pairs for multiplexing from list of candidates. MultiPLX can be downloaded from Graphical web-based interface to most functions of MultiPLX is available at

  17. 20. BUILDINGS 243247. PRIMER DRYHOUSES. HEATING LAYOUT. October 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. BUILDINGS 243-247. PRIMER DRYHOUSES. HEATING LAYOUT. October 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. BUILDING 239. ARTILLERY PRIMER SHOP. ADDITIONS AND ALTERATIONS. FIRST FLOOR PLAN AND ELEVATIONS. May 12, 1920. - Frankford Arsenal, Building Nos. 239-239A, Southeast corner of Clay Street & Cray Road, Philadelphia, Philadelphia County, PA

  19. 19. BUILDINGS 243247. PRIMER DRYHOUSES. BUILDING LAYOUT. February 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. BUILDINGS 243-247. PRIMER DRYHOUSES. BUILDING LAYOUT. February 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA

  20. 18. BUILDING 243247. PRIMER DRYHOUSES. GENERAL LAYOUT. February 16, 1917 ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. BUILDING 243-247. PRIMER DRYHOUSES. GENERAL LAYOUT. February 16, 1917 - Frankford Arsenal, Building Nos. 242-246A, South side Craig Road between Eakin & Walbach Streets, Philadelphia, Philadelphia County, PA


    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  2. USER-derived cloning methods and their primer design.


    Salomonsen, Bo; Mortensen, Uffe H; Halkier, Barbara A


    Uracil excision-based cloning through USER™ (Uracil-Specific Excision Reagent) is an efficient ligase-free cloning technique that comprises USER cloning, USER fusion, and USER cassette-free (UCF) USER fusion. These USER-derived cloning techniques enable seamless assembly of multiple DNA fragments in one construct. Though governed by a few simple rules primer design for USER-based fusion of PCR fragments can prove time-consuming for inexperienced users. The Primer Help for USER (PHUSER) software is an easy-to-use primer design tool for USER-based methods. In this chapter, we present a PHUSER software protocol for designing primers for USER-derived cloning techniques.

  3. A Primer of Easy Pieces: Teaching through Typical Narrative.

    ERIC Educational Resources Information Center

    Waldman, Peter


    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  4. New primers for DNA barcoding of digeneans and cestodes (Platyhelminthes).


    Van Steenkiste, Niels; Locke, Sean A; Castelin, Magalie; Marcogliese, David J; Abbott, Cathryn L


    Digeneans and cestodes are species-rich taxa and can seriously impact human health, fisheries, aqua- and agriculture, and wildlife conservation and management. DNA barcoding using the COI Folmer region could be applied for species detection and identification, but both 'universal' and taxon-specific COI primers fail to amplify in many flatworm taxa. We found that high levels of nucleotide variation at priming sites made it unrealistic to design primers targeting all flatworms. We developed new degenerate primers that enabled acquisition of the COI barcode region from 100% of specimens tested (n = 46), representing 23 families of digeneans and 6 orders of cestodes. This high success rate represents an improvement over existing methods. Primers and methods provided here are critical pieces towards redressing the current paucity of COI barcodes for these taxa in public databases. © 2014 Her Majesty the Queen in Right of Canada Molecular Ecology Resources © 2014 John Wiley & Sons Ltd.

  5. PCR Primers for identification of high sucrose Saccharum genotypes.


    Vinayak, Vandana; Dhawan, Ashok K; Gupta, V K


    The progeny of a cross between high sucrose sugarcane clone S. officinarum 'Gungera' and a low sucrose clone S. spontaneum 'SES 603' resulted in interspecific hybrids that were named as ISH-1 to ISH-29 and graded on the basis of sucrose content. Hybrids ISH-1, ISH-5, ISH-17 and ISH-23 were selected as very high sucrose (65 to 100 mg/g tissue) genotypes, whereas ISH-10, ISH-11, ISH-12 and ISH-25 were very low sucrose (2 to 25 mg/g tissue) genotypes. DNA from leaves of both the parent clones, as also the progeny hybrids, was amplified using selected primers, in order to identify markers for sucrose content. Ten specific primers were examined: primers 'A' and 'B' that detect polymorphism in promoter region of sucrose synthase-2 gene; primers AI, SS and SPS that were designed on the basis of nucleotide sequences of genes for acid invertase, sucrose synthase and sucrose phosphate synthase enzymes, respectively and primers MSSCIR43, MSSCIRI, SMC226CG, SMC1039CG and SCB07 selected for relation to sucrose accumulation process. DNA products specific to low or high sucrose clones were identified. Primer 'A' and AI amplified DNA products of size 230 and 500 bp, respectively only in high sucrose genotypes ('Gungera', ISH-1, ISH-5, ISH-17 and ISH-23), while primer SMC226CG generated a DNA product of size 920 bp only in low sucrose genotypes ('SES 603', ISH-10, ISH-11, ISH-12 and ISH-25). Ten random decamer primers were also examined, but their products did not show relationship to sucrose content of genotypes.

  6. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.


    Pauthenier, Cyrille; Faulon, Jean-Loup


    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling

    PubMed Central

    Pauthenier, Cyrille; Faulon, Jean-Loup


    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457

  8. Simple sequence repeat marker loci discovery using SSR primer.


    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David


    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at

  9. Universal PCR primers for detection of phytopathogenic Agrobacterium strains.

    PubMed Central

    Haas, J H; Moore, L W; Ream, W; Manulis, S


    Two PCR primer pairs, based on the virD2 and ipt genes, detected a wide variety of pathogenic Agrobacterium strains. The endonuclease domain of VirD2 protein, which cleaves transferred DNA (T-DNA) border sequences, is highly conserved; primer oligonucleotides specific for the endonuclease portion of virD2 detected all pathogenic strains of Agrobacterium tested. PCR primers corresponding to conserved sequences in ipt, the T-DNA-borne cytokinin synthesis gene, detected only Agrobacterium tumefaciens and distinguished it from Agrobacterium rhizogenes. The virD2 and ipt primer pairs did not interfere with each other when included in the same PCR amplification, and this permitted simultaneous detection of both genes in a single reaction. One nonpathogenic Agrobacterium radiobacter strain contained virD2 but not ipt; we speculate that this strain arose from a pathogenic progenitor through a deletion in the T-DNA. The virD2 primer pair appears to be universal for all pathogenic Agrobacterium species; used together, the primer sets reported here should allow unambiguous identification of Ti plasmid DNA in bacteria isolated from soil and plants. PMID:7487020

  10. Polymerization behavior of Klenow fragment and Taq DNA polymerase in short primer extension reactions.


    Zhao, Guojie; Guan, Yifu


    DNA polymerases amplify DNA fragments through primer extension reactions. However, polymerization behavior of short primers in the primer extension process has not been systematically explored. In this study, we examined the minimal primer length required for primer extension, and the effect of primer length, mismatches and other conditions on DNA polymerization using a non-radioactive method. Under the condition we conducted, the shortest primers polymerized by Klenow fragment (KF) and Taq DNA polymerase in our experiments were respectively heptamer and octamer. The extension efficiency was also affected by the up-stream overhanging structure of the primer-template complex. We hypothesized a simple model to interpret these observations based on the polymerase structures. Furthermore, it was found that the longer the primer, the more efficient is the primer extension. These polymerization behavior of short primers lay foundation about DNA polymerization mechanism and development of novel nucleic acid detection assays.

  11. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    SciTech Connect

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M; Busch, Robert D.; Emerson, Scott


    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  12. MPD: multiplex primer design for next-generation targeted sequencing.


    Wingo, Thomas S; Kotlar, Alex; Cutler, David J


    Targeted resequencing offers a cost-effective alternative to whole-genome and whole-exome sequencing when investigating regions known to be associated with a trait or disease. There are a number of approaches to targeted resequencing, including microfluidic PCR amplification, which may be enhanced by multiplex PCR. Currently, there is no open-source software that can design next-generation multiplex PCR experiments that ensures primers are unique at a genome-level and efficiently pools compatible primers. We present MPD, a software package that automates the design of multiplex PCR primers for next-generation sequencing. The core of MPD is implemented in C for speed and uses a hashed genome to ensure primer uniqueness, avoids placing primers over sites of known variation, and efficiently pools compatible primers. A JavaScript web application ( ) utilizing the MPD Perl package provides a convenient platform for users to make designs. Using a realistic set of genes identified by genome-wide association studies (GWAS), we achieve 90% coverage of all exonic regions using stringent design criteria. Using the first 47 primer pools for wet-lab validation, we sequenced ~25Kb at 99.7% completeness with a mean coverage of 300X among 313 samples simultaneously and identified 224 variants. The number and nature of variants we observe are consistent with high quality sequencing. MPD can successfully design multiplex PCR experiments suitable for next-generation sequencing, and simplifies retooling targeted resequencing pipelines to focus on new targets as new genetic evidence emerges.

  13. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy


    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  14. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David


    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  15. Rapid and simple method of qPCR primer design.


    Thornton, Brenda; Basu, Chhandak


    Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool for analysis and quantification of gene expression. It is advantageous compared to traditional gel-based method of PCR, as gene expression can be visualized "real-time" using a computer. In qPCR, a reporter dye system is used which intercalates with DNA's region of interest and detects DNA amplification. Some of the popular reporter systems used in qPCR are the following: Molecular Beacon(®), SYBR Green(®), and Taqman(®). However, success of qPCR depends on the optimal primers used. Some of the considerations for primer design are the following: GC content, primer self-dimer, or secondary structure formation. Freely available software could be used for ideal qPCR primer design. Here we have shown how to use some freely available web-based software programs (such as Primerquest(®), Unafold(®), and Beacon designer(®)) to design qPCR primers.

  16. Primer design for PCR reactions in forensic biology.


    Elkins, Kelly M


    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  17. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.


    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G


    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  18. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    PubMed Central


    Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

  19. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    PubMed Central

    Yao, Jiqiang; Lin, Hong; Van Deynze, Allen; Doddapaneni, Harshavardhan; Francis, Martha; Lemos, Eliana Gertrudes Macedo; Civerolo, Edwin L


    Background The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the identification of the few loci in the genome that can serve as unique markers for strain differentiation. PrimerSNP attempts to identify reliable strain-specific markers, on which specific primers are designed for pathogen detection purpose. Results PrimerSNP is an online tool to design primers based on strain specific SNPs for multiple strains/species of microorganisms at the whole genome level. The allele-specific primers could distinguish query sequences of one strain from other homologous sequences by standard PCR reaction. Additionally, PrimerSNP provides a feature for designing common primers that can amplify all the homologous sequences of multiple strains/species of microorganisms. PrimerSNP is freely available at . Conclusion PrimerSNP is a high-throughput specific primer generation tool for the differentiation of phylogenetically-related strains/species. Experimental validation showed that this software had a successful prediction rate of 80.4 – 100% for strain specific primer design. PMID:18937861

  20. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    USDA-ARS?s Scientific Manuscript database

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  1. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    SciTech Connect

    Bowman, Stephen M


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  2. New cyt b gene universal primer set for forensic analysis.


    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M


    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  3. A High Temperature Hermetic Primer and a Variable Spring Tester

    SciTech Connect

    Begeal, D.R.


    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  4. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    Lucas, D.S.


    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  5. Primers role in plastering systems on concrete surfaces

    NASA Astrophysics Data System (ADS)

    Fischer, H. B.


    A drastic reduction in time frames between the manufacturing process of concrete units and the rendering phase (including prior priming) does not allow the concrete to dry well. This fact is also underlined by changes in concrete technology (denser concrete and denser concrete surfaces). The tests showed that the reduction of drying time (storage time) had a significant influence on the bonding properties of gypsum plaster on concrete surfaces. In such cases it is absolutely necessary to use an appropriate primer no matter what the processing temperature (2 °C to 20 °C) might be. In this publication the varying primer quality is shown.

  6. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.


    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan


    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera.

  7. Selective and universal primers for trematode barcoding in freshwater snails.


    Routtu, J; Grunberg, D; Izhar, R; Dagan, Y; Guttel, Y; Ucko, M; Ben-Ami, F


    Trematodes are significant pathogens of high medical, veterinary, and environmental importance. They are hard to isolate from their intermediate hosts, and their early life stages are difficult to identify morphologically. Therefore, primers were developed for trematodes to create a species barcoding system and allow selective PCR amplification in mixed samples. The specific oligonucleotide primer was universal for trematodes that infected several freshwater snail species in Israel. The diagnostic tool is based on the 18S rDNA gene. In contrast to morphological identification, trematode barcoding is rapid as it is based on a sequence of only 800 bp, and it classifies species accurately due to high polymorphism between conserved areas.

  8. ConservedPrimers 2.0: a high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery.


    You, Frank M; Huo, Naxin; Gu, Yong Q; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D


    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they are located in exonic sequences which are usually conserved between related species, "conserved primers". They are useful for large-scale single nucleotide polymorphism (SNP) discovery and marker development, especially in species, such as wheat, for which a large number of ESTs are available but for which genome sequences and intron/exon boundaries are not available. To date, no suitable high-throughput tool is available for this purpose. We have developed, the ConservedPrimers 2.0 pipeline, for designing intron-flanking primers for large-scale SNP discovery and marker development, and demonstrated its utility in wheat. This tool uses non-redundant wheat EST sequences, such as wheat contigs and singleton ESTs, and related genomic sequences, such as those of rice, as inputs. It aligns the ESTs to the genomic sequences to identify unique colinear exon blocks and predicts intron lengths. Intron-flanking primers are then designed based on the intron/exon information using the Primer3 core program or BatchPrimer3. Finally, a tab-delimited file containing intron-flanking primer pair sequences and their primer properties is generated for primer ordering and their PCR applications. Using this tool, 1,922 bin-mapped wheat ESTs (31.8% of the 6,045 in total) were found to have unique colinear exon blocks suitable for primer design and 1,821 primer pairs were designed from these single- or low-copy genes for PCR amplification and SNP discovery. With these primers and subsequently designed genome-specific primers, a total of 1,527 loci were found to contain one or more genome-specific SNPs. The ConservedPrimers 2.0 pipeline for designing intron-flanking primers was developed and its

  9. Changes in Rous Sarcoma Virus RNA Secondary Structure near the Primer Binding Site upon tRNATrp Primer Annealing

    PubMed Central

    Morris, Shannon; Leis, Jonathan


    Predicted secondary-structure elements encompassing the primer binding site in the 5′ untranslated region of Rous sarcoma virus (RSV) RNA play an integral role in multiple viral replications steps including reverse transcription, DNA integration, and RNA packaging (A. Aiyar, D. Cobrinik, Z. Ge, H. J. Kung, and J. Leis, J. Virol. 66:2464–2472, 1992; D. Cobrinik, A. Aiyar, Z. Ge, M. Katzman, H. Huang, and J. Leis, J. Virol. 65:3864–3872, 1991; J. T. Miller, Z. Ge, S. Morris, K. Das, and J. Leis, J. Virol. 71:7648–7656, 1997). These elements include the U5-Leader stem, U5-IR stem-loop, and U5-TΨC interaction region. Limited digestion of the 5′ untranslated region of wild-type and mutant RSV RNAs with structure- and/or sequence-specific RNases detects the presence of the U5-Leader stem and the U5-IR stem-loop. When a tRNATrp primer is annealed to wild-type RNAs in vitro, limited nuclease mapping indicates that the U5-IR stem becomes partially unwound. This is not observed when mutant RNAs with altered U5-IR stem-loop structures are substituted for wild-type RNAs. The U5-Leader stem also becomes destabilized when the tRNA primer is annealed to either wild-type or mutant RNA fragments. Nuclease mapping studies of tRNATrp, as well as the viral RNA, indicate that the U5-TΨC helix does form in vitro upon primer annealing. Collectively, these data suggest that the various structural elements near the RSV primer binding site undergo significant changes during the process of primer annealing. PMID:10400722

  10. Complex Adaptive Systems of Systems (CASOS) engineering environment.

    SciTech Connect

    Detry, Richard Joseph; Linebarger, John Michael; Finley, Patrick D.; Maffitt, S. Louise; Glass, Robert John, Jr.; Beyeler, Walter Eugene; Ames, Arlo Leroy


    Complex Adaptive Systems of Systems, or CASoS, are vastly complex physical-socio-technical systems which we must understand to design a secure future for the nation. The Phoenix initiative implements CASoS Engineering principles combining the bottom up Complex Systems and Complex Adaptive Systems view with the top down Systems Engineering and System-of-Systems view. CASoS Engineering theory and practice must be conducted together to develop a discipline that is grounded in reality, extends our understanding of how CASoS behave and allows us to better control the outcomes. The pull of applications (real world problems) is critical to this effort, as is the articulation of a CASoS Engineering Framework that grounds an engineering approach in the theory of complex adaptive systems of systems. Successful application of the CASoS Engineering Framework requires modeling, simulation and analysis (MS and A) capabilities and the cultivation of a CASoS Engineering Community of Practice through knowledge sharing and facilitation. The CASoS Engineering Environment, itself a complex adaptive system of systems, constitutes the two platforms that provide these capabilities.

  11. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer.

    PubMed Central

    Lund, A H; Duch, M; Lovmand, J; Jørgensen, P; Pedersen, F S


    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology. PMID:8995641

  12. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.


    Lam, Ching-wan; Mak, Chloe Miu


    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Depth profiles and free volume in aircraft primer films

    NASA Astrophysics Data System (ADS)

    Van Horn, J. D.; Chen, H.; Jean, Y. C.; Zhang, W.; Jaworowski, M. R.


    Positron annihilation lifetime spectroscopy (PALS) and associated techniques provide non-destructive methods to study the free volume inside polymeric materials, and to study material characteristics over a depth profile. Cast free films of organic- or aqueous-based, non-chromated aerospace primers, when cured for about one week, had very different water vapour transport (through-plane) behaviour. In addition, both types of primer films showed strong anisotropic behaviour in in-plane versus through-plane water vapour transport rates. We report the differences between the organic- and aqueous-based aircraft primer films samples and their surface depth profiles. In bulk PALS measurements, an aged, organic-based film exhibited typical lifetimes and intensities for a particulate-containing polymer film on both faces. In contrast, aqueous-based films exhibited face oriented-dependent differences. In all aqueous- based samples, the I3 value of the back of the sample was smaller. The primer film samples were also evaluated with mono-energetic positron beam techniques to generate depth profile information. The heterogeneity in the samples was verified by Doppler broadening of energy spectroscopy (DBES). A model for the differences in the faces of the films, and their layered structure is discussed.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  15. Children on Medication: A Primer for School Personnel.

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.

    Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…

  16. Blood Donation and Transfusion: A Primer for Health Educators.

    ERIC Educational Resources Information Center

    Felts, W. Michael; Glascoff, Mary A.


    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  17. Improved primer for bonding polyurethane adhesives to metals

    NASA Technical Reports Server (NTRS)

    Constanza, L. J.


    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  18. A Primer on Ways To Explore Item Bias.

    ERIC Educational Resources Information Center

    Cromwell, Susan

    This paper provides an introductory primer on methods for exploring item bias. The purposes of item bias analysis are to investigate whether test scores are affected by different sources of variance in the various subpopulations, and if different sources of variance are found, to determine if an unfair advantage exists. The review discusses three…

  19. Wash Primer Replacement Based on the Superprimer Technology

    DTIC Science & Technology


    wash primer on  CRS  under military primers  and a CARC topcoat ( creep  in mm)   Table 19. SST and CCT test results for AU­23 and modified versions as a...wash primer on  CRS   under epoxy primers and a CARC topcoat ( creep  in mm)   Table 20. SST and CCT test results for EPZ­0 and EPZ­1 on  CRS  under epoxy... alloys , that is completely devoid of  Cr (VI), HAPs, phosphoric acid  and has low VOC, without sacrificing corrosion protection  performance under

  20. Assessing the Nation's Literacy: A State Policy Primer.

    ERIC Educational Resources Information Center

    National Governors' Association, Washington, DC.

    This primer is designed to provide a step-by-step guide for state policymakers and state agency officials interested in assessing the literacy skills of the people of their state. Chapter 1 describes the importance of assessing the literacy skills in each state. Literacy is discussed as an economic necessity, a requirement for a healthy democracy,…

  1. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary


    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  2. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    ERIC Educational Resources Information Center

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  3. Philosophical Foundations: A Primer for Adult Continuing Education.

    ERIC Educational Resources Information Center

    Rampp, Lary C., Ed.; Guffey, J. Stephen, Ed.

    This document, which is intended as a primer for adult continuing education, contains 11 chapters examining the philosophical foundations of adult and continuing education. The chapter titles and authors are as follows: "Progressivism and Adult Continuing Education" (Michael Day); "Progressivism: An Anthology" (Andrea Reeve);…

  4. Deeper Learning: A Primer for State Legislators. ECS Education Trends

    ERIC Educational Resources Information Center

    Aragon, Stephanie


    A growing number of schools across the country are working hard to provide a "deeper" learning experience for their students, and state legislators are being asked to create policies that support wide-scale implementation of 21st century learning practices. This primer is created for state policymakers seeking to modify instruction and…

  5. Sights, Sounds, Senses in Step with Reading. Primer.

    ERIC Educational Resources Information Center

    Norris, Mildred W.; Messerli, John H.

    This Title III bibliography presents books, films, filmstrips, and records that correlate with stories from primers. The list of books is prepared from the suggested lists of the Ginn, Houghton Mifflin, Lippincott, and Scott, Foresman reading series. The bibliography includes sections about animals, birthdays, cowboys, fantasy, helpers, holidays,…

  6. A Primer on Fresh Water: The Environmental Citizenship Series.

    ERIC Educational Resources Information Center

    Environment Canada, Ottawa (Ontario).

    Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

  7. Exploding the Myths about DETC Accreditation: A Primer for Students

    ERIC Educational Resources Information Center

    Distance Education and Training Council, 2011


    Prospective distance education students are faced with a bewildering number of choices in selecting an institution that is best suited to achieving their educational goals. They also face a confusing forest of institutions' promotional claims of being the best or most respected school. This primer is intended to help the prospective student of an…

  8. The development, characterization and testing of magnesium-rich primers

    NASA Astrophysics Data System (ADS)

    Battocchi, Dante

    Aluminum alloys are widely used in aircraft industry for their strength and light weight. Those alloys that are hardened by precipitation, especially the Copper-rich of the 2000 series, are prone to corrosion and are protected against it using chromate containing coatings. The primary component of these coating systems is Chromium 6+ (CrVI) that has been found to be very toxic in the environment and carcinogenic, toxic and mutagenic in humans. The Mg-rich primer development is the result of a successful multi-year project funded by the US Air-force with its objective the replacement of coatings based on CrVI with a class of coatings less toxic and with comparable protective performances. The Mg rich primer fulfilled the USAF requirements and it is currently undergoing commercial and military qualifications testing. The use of Mg as one of the active pigments in coatings allows the primer to protect the underlying Al sacrificially, not considered possible for this substrate until now. Mg is anodic to most of the other structural metals and when particulate Mg became available commercially, the concept of the primer was first developed by analogy to Zn-rich coatings for steel. When Mg and Al are in contact and immersed in a corrosive environment, magnesium corrodes preferentially and protects the aluminum.

  9. Blood Donation and Transfusion: A Primer for Health Educators.

    ERIC Educational Resources Information Center

    Felts, W. Michael; Glascoff, Mary A.


    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  10. STITCHER 2.0: primer design for overlapping PCR applications

    PubMed Central

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin


    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: PMID:28358011

  11. STITCHER 2.0: primer design for overlapping PCR applications.


    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin


    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage:

  12. A Primer on Individualized Education Programs for Handicapped Children.

    ERIC Educational Resources Information Center

    Torres, Scottie, Ed.

    Intended to be a practical guide for administrators, teachers, and parents on how to meet the individualized education program (IEP) requirements of Public Law 94-142, the primer provides 10 author contributed chapters to aid the reader in developing, implementing, and monitoring an IEP for every handicapped child. Chapters have the following…

  13. Racial Microaggressions: A Primer with Implications for Counseling Practice

    ERIC Educational Resources Information Center

    Houshmand, Sara; Spanierman, Lisa B.; De Stefano, Jack


    Given their societal toll and ubiquitous nature, counselors and other mental health professionals inevitably will encounter clients who have experienced racial microaggressions in their practice. In this primer, we examine key issues relative to racial microaggressions and their impact on the lives of members of racial and ethnic minority groups.…

  14. Method to amplify variable sequences without imposing primer sequences


    Bradbury, Andrew M.; Zeytun, Ahmet


    The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

  15. A Primer on Economics for Financial Aid Professionals.

    ERIC Educational Resources Information Center

    Baum, Sandy

    This primer is intended to provide college financial aid professionals with a background in fundamental areas of economics. Its goal is to provide a stronger understanding of the key principles that shape need analysis systems. Part 1 presents basic economic concepts and discusses their application to college enrollment and student aid. These…

  16. Criticality calculations with MCNP{sup TM}: A primer

    SciTech Connect

    Mendius, P.W.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.


    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  17. Comparison of three different primer sets for sexing birds.


    Çakmak, Emel; Akın Pekşen, Çiğdem; Bilgin, C Can


    Because many bird species are monomorphic or only sexually dimorphic in adult stages, it is difficult to determine their sexes, which may cause significant problems in population and conservation studies. DNA-based sexing relies on the chromodomain helicase DNA binding ( CHD) gene located on the W chromosome and its homolog on the Z chromosome, giving distinct banding patterns on agarose gel as a result of length differences in intronic regions within this gene. We used 3 specific primer sets, CHD1F/CHD1R, 2550F/2718R, and P2/P8, for sex determination of 230 samples from 77 avian species. We report here the records for 70 of those species analyzed using the CHD1F/CHD1R primer set, and 49 species using 2550F/2718R, and 46 species using P2/P8. CHD1F/CHD1R PCR products on agarose gel generally showed an apparent single band in males and 2 bands in females, but the products of 2550F/2718R (61%) and P2/P8 (42%) showed distinct banding patterns for separate bird orders. However, when PCR products of these last 2 primer pairs labeled with fluorescent dye were run in a capillary gel and detected using a DNA analyzer, P2/P8 gave 2 distinguishable peaks in females, whereas 2550F/2718R results remained the same. DNA sexing with any of those 3 primer sets can be used for all sexually monomorphic avian taxa although the primer sets should be compared before choosing the most efficient one for molecular sexing of the studied species.

  18. Criticality calculations with MCNP{trademark}: A primer

    SciTech Connect

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.


    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  19. SeqState: primer design and sequence statistics for phylogenetic DNA datasets.


    Müller, Kai


    Choosing and designing primers based on available DNA sequence data and statistical contrasting of domains or structural features is a common routine among molecular biologists. Currently available, free software tools were found to lack desirable features related to these tasks. This was the motivation for developing a new program, SeqState. SeqState locates regions that remain to be sequenced in phylogenetic DNA datasets, evaluates user-provided primers and selects primers best suited to fill gaps in the sequences. If the primers provided by the user are unsuitable, new primers are designed. Primers can be loaded from a primer database, be supplied as part of the alignment or be entered manually. The position of internal primers is automatically localised in the loaded data file. Primers can be edited, and changes and new primers can be saved to the database. Primer sheets allow the user to view internal dimers, complements to a second primer, mismatches to all loaded sequences, and other primer characteristics. Calculation of various sequence statistics can be requested for the whole dataset or parts thereof (character sets), with standard errors estimated by bootstrapping. Insertion-deletion events can be evaluated statistically and encoded for subsequent phylogenetic analysis according to several published coding principles.

  20. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.


    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo


    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  1. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.


    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  2. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers.


    Hommes, N G; Arp, D J; Sayavedra-Soto, L A


    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  3. Stability of the high-temperature G-16 primer composition

    SciTech Connect

    Durand, N.A.; Weinmaster, R.R.; Massis, T.A.; Fleming, W.


    The stability of the G-16 pyrotechnic primer mixture of antimony sulfide, calcium silicide, and potassium chlorate was studied at temperatures up to 200/sup 0/C in sealed and open environments. Data have shown that this mixture is stable in open environments at 200/sup 0/C for up to 48 hours. However, in sealed, limited volume environments, the mixture completely decomposes within 24 hours at 200/sup 0/C. In sealed environments, the mixture shows stability with copper present. Both functional testing and chemical analysis were used to evaluate the primer composition after temperature exposure. The degree of degradation of the mixture was determined from the concentration of final reaction products (sulfate and chloride ions), using ion chromatography. When copper was present, the intermediate reaction products were scavenged by the copper, and the degradation was reduced. The role of copper in the reaction was verified with differential scanning calorimetry and surface analysis. 3 refs., 9 figs., 2 tabs.

  4. Microsatellite primer development for post oak, Quercus stellata (Fagaceae).


    Chatwin, Warren B; Carpenter, Kyrie K; Jimenez, Felix R; Elzinga, Dave B; Johnson, Leigh A; Maughan, Peter J


    The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata). This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. • Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. • We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  5. Microsatellite primers for the rare shrub Acacia adinophylla (Fabaceae)1

    PubMed Central

    Nevill, Paul G.; Wardell-Johnson, Grant


    Premise of the study: Microsatellite primers were developed for the rare shrub Acacia adinophylla (Fabaceae) to assess genetic diversity and its spatial structuring. Methods and Results: Shotgun sequencing on an Illumina MiSeq produced 6,372,575 reads. Using the QDD pipeline, we designed 60 primer pairs, which were screened using PCR. Seventeen loci were developed, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. These loci were then screened for variation in individuals from three populations. The number of alleles observed for these 12 loci ranged from three to 18 and expected heterozygosity ranged from 0.13 to 0.85. Conclusions: These markers will enable the quantification of genetic impact of proposed mining activities on the short-range endemic Acacia adinophylla. PMID:27843728

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  7. Recombination of polynucleotide sequences using random or defined primers


    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.


    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  8. Recombination of polynucleotide sequences using random or defined primers


    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.


    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  9. Primer and interviews: molecular mechanisms of morphological evolution.


    Kiefer, Julie C


    The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead.

  10. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  11. [Screening of peafowl microsatellite primers and analysis of genetic diversity].


    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang


    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing.

  12. New primer strategy improves precision of differential display.


    Zhao, S; Ooi, S L; Pardee, A B


    To increase the reproducibility and to reduce the false positives in the initial mRNA differential display, modified long composite primers were developed based on both mRNA differential display and RNA arbitrarily primed PCR fingerprinting methods. Ten-base nucleotides were added at the 5' ends of the primers used in the initial mRNA differential display. These included a restriction site to aid cloning. PCR began with one low-stringency cycle (40 degrees C for annealing) followed by 35 high-stringency cycles (60 degrees C for annealing). The modified method significantly improved the reproducibility and sensitivity of the mRNA differential display while still keeping the characteristics of the original method.

  13. Microsatellite primers for vulnerable seagrass Halophila beccarii (Hydrocharitaceae).


    Jiang, Kai; Shi, Yi-Su; Zhang, Jian; Xu, Na-Na


    Polymorphic microsatellite primers were developed in the vulnerable seagrass Halophila beccarii to investigate genetic variation and provide necessary markers for studying its population genetic structure. Six polymorphic and six monomorphic microsatellite loci were developed in H. beccarii. Most loci were successfully amplified across 40 H. beccarii individuals collected from three populations from coastal regions of southern China. Two to four alleles per locus were observed at the six polymorphic loci. The highest expected heterozygosity was 0.5737. The results demonstrate low levels of polymorphism in H. beccarii from coastal regions of southern China. They also illustrate that these primers may be useful for studying the mating system and population genetics of H. beccarii on a global scale.

  14. Primer and interviews: Molecular mechanisms of morphological evolution

    PubMed Central

    Kiefer, Julie C


    The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831

  15. Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism.


    Chen, Chunxian; Bock, Clive H; Beckman, Tom G


    This study was to explore genomic factors affecting the performance and polymorphism of 340 randomly selected EST-SSR (expressed sequence tag-simple sequence repeat) primers through BLAST of primer sequences to a reference genome. Genotyping showed 111 failed and 229 succeeded. The failed types included "no peaks" (NP, 69 primers), "weak peaks" (WP, 30), and "multiple peaks" (MP, 12). The successful types were divided into HM (homozygous between two selected parents, 78 primers) and HT (heterozygous at least in one parent, 151 primers). The BLAST revealed primer alignment status, genomic amplicon size (GAS), and genomic and expressed amplicon size difference (ASD). The alignment status was categorized as: "no hits found" (NHF); "multiple partial alignments" (MPA); "single partial alignment" (SPA); "multiple full alignments" (MFA); and "single full alignment" (SFA). NHF and partial alignment (PA) mainly resulted from discrepant nucleotides in contig-derived primers. The ASD separated 247 non-NHF primers into: "deletion", "same size", "insertion", "intron (GAS ≤500)", "intron (GAS >500)", and "error" categories. Most SFA primers were successful. About 88 % "error", 53 % NHF primers, and 47 % "intron (GAS >500)" failed. The "deletion" and "insertion" primers had the higher HT rates, and the "same size" had the highest HM rate. Optimized primer selection criteria are discussed.

  16. Design of primers and probes for quantitative real-time PCR methods.


    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J


    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  17. Effect of surface preparation on service life of top-coats applied to weathered primer paint


    R. Sam Williams; Mark Knaebe; Peter Sotos


    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  18. Chemical and mechanical aspects of HMR primer in relationship to wood bonding


    Alfred W. Christiansen


    The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...

  19. Development of a Nonchromate Structural Adhesive Bond Primer

    DTIC Science & Technology


    Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non-inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate...solubility of multiple inhibitors 7705 Al / EcoTuff™ After corrosion test Bright deposits: 50 wt% W + Zn mixed oxide 3M Commercial EW5000AS(P) 3M Lab

  20. Primer on Molecular Genetics; DOE Human Genome Program

    DOE R&D Accomplishments Database


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  1. Primer on molecular genetics. DOE Human Genome Program

    SciTech Connect

    Not Available


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  2. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    USGS Publications Warehouse

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie


    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  3. Genotypic resistance testing in HIV by arrayed primer extension

    PubMed Central

    Bodem, Jochen; Gerhold-Ay, Aslihan; Jacob, Anette; Fellenberg, Kurt; Kräusslich, Hans-Georg; Hoheisel, Jörg D.


    The analysis of mutations that are associated with the occurrence of drug resistance is important for monitoring the antiretroviral therapy of patients infected with human immunodeficiency virus (HIV). Here, we describe the establishment and successful application of Arrayed Primer Extension (APEX) for genotypic resistance testing in HIV as a rapid and economical alternative to standard sequencing. The assay is based on an array of oligonucleotide primers that are immobilised via their 5′-ends. Upon hybridisation of template DNA, a primer extension reaction is performed in the presence of the four dideoxynucleotides, each labelled with a distinct fluorophore. The inserted label immediately indicates the sequence at the respective position. Any mutation changes the colour pattern. We designed a microarray for the analysis of 26 and 33 codons in the HIV protease and reverse transcriptase, respectively, which are of special interest with respect to drug resistance. The enormous genome variability of HIV represents a big challenge for genotypic resistance tests, which include a hybridisation step, both in terms of specificity and probe numbers. The use of degenerated oligonucleotides resulted in a significant reduction in the number of primers needed. For validation, DNA of 94 and 48 patients that exhibited resistance to inhibitors of HIV protease and reverse transcriptase, respectively, were analysed. The validation included HIV subtype B, prevalent in industrialised countries, as well as non-subtype B samples that are more common elsewhere. Electronic supplementary material The online version of this article (doi:10.1007/s00216-007-1775-0) contains supplementary material, which is available to authorized users. PMID:18202840

  4. Retention of Pre-Construction Primer in Tank Coating System

    DTIC Science & Technology


    tanks. In ballast tanks this trend has been reversed; however, technology has not caught up with the change in direction. Five marine coatings...but is in the process of changing to some of the newer zinc filled silicate types. The Zaliv Shipyard is using Ameron 139 iron oxide epoxy primer...deterioration of the organic binder. Where this was apparent (i.e., the coating had changed color) the defective material could be removed during secondary

  5. Small Commercial Building Re-tuning: A Primer

    SciTech Connect

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas


    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  6. Sensory reception of the primer pheromone ethyl oleate

    NASA Astrophysics Data System (ADS)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang


    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  7. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    D. S. Lucas


    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at

  8. Preliminary Evaluation of the Acute Toxicity of Desensitized Primer Compounds and Primer Waste Effluents to Representative Aquatic Organisims

    DTIC Science & Technology


    daphnids, with 48-hour LC50 values for these two materials being several orders of magnitude lower than those observed for lead styphnate , PETN and... styphnate (PoTNR), tetracene (= tetrazene), pentaerythritol tetranitrate (PETN), .and FA 956 priming mixture. The FA 956 mixture is composed of: 37...PbTNR, 4% tetracene, 5% PETN, 32% barium nitrate, 15% antimony sulfide and 7% aluminum (Small and Rosenblatt, 1974). Each of these primer components was

  9. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    PubMed Central


    Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI) gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1) to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups. PMID:20615258

  10. Modified tetra-primer ARMS PCR as a single-nucleotide polymorphism genotyping tool.


    Mesrian Tanha, Hamzeh; Mojtabavi Naeini, Marjan; Rahgozar, Soheila; Rasa, Seyed Mohammad Mahdi; Vallian, Sadeq


    Genotyping of single-nucleotide polymorphisms (SNPs) has been applied in various genetic contexts. Tetra-primer amplification refractory mutation system (ARMS) polymerase chain reaction (PCR) is reported as a prominent assay for SNP genotyping. However, there were published data that may question the reliability of this method on some occasions, in addition to a laborious and time-consuming procedure of the optimization step. In the current study, a new SNP genotyping method named modified tetra-primer ARMS (MTPA) PCR was developed based on tetra-primer ARMS PCR. The modified method has two improvements in its instruction, including equalization of outer primer and inner primer strength by additional mismatch in outer primers, and consideration of equal annealing temperature of specific fragments more than melting temperature of primers. Advantageously, a new computer software was provided for designing primers based on novel concepts. The usual tetra-primer ARMS PCR has a laborious process for optimization. In nonoptimal PCR programs, identification of the accurate genotype was found to be very difficult. However, in MTPA PCR, equalization of the amplicons and primer strength leads to increasing specificity and convenience of genotyping, which was validated by sequencing. In the MTPA PCR technique, a new mismatch at -2 positions of outer primers and equal annealing temperature improve the genotyping procedure. Together, the introduced method could be suggested as a powerful tool for genotyping single-nucleotide mutations and polymorphisms.

  11. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.


    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R


    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  12. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.


    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V


    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding.

  13. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.


    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  14. Studies on the minimal lengths required for DNA primers to be extended by the Tetrahymena telomerase: implications for primer positioning by the enzyme.


    Baran, Nava; Haviv, Yonit; Paul, Beena; Manor, Haim


    Telomerase is a specialized reverse transcriptase that contains an integral RNA subunit including a short template sequence. It extends telomeric 3' overhangs and chromosome breakpoints by catalyzing reiterative copying of this internal template into single-stranded telomeric DNA repeats. Here we report for the first time that in vitro the ciliate Tetrahymena telomerase can efficiently extend very short single-stranded DNA primers (<6 nt). These data indicate that interactions with nucleotides further upstream are not essential for elongation of longer primers. We also report that the minimal lengths required for primers to be extended by the telomerase depend on the positions along the template at which the primers are initially aligned. At a primer concentration of 2.5 micro M, primers aligned in the beginning, middle and next to the end of the template, respectively, must consist of at least 4, 5 and 6 nt to be extended by the telomerase. At a primer concentration of 50 micro M, the corresponding minimal lengths are 3, 4 and 5 nt. The systematic variation of the minimal required primer lengths supports the presence of a site within the telomerase ribonucleoprotein complex that mediates specific positioning of 3' termini of telomeric and non-telomeric DNA in the beginning of the template during telomere synthesis.

  15. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    PubMed Central


    Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in

  16. Rapid identification of Zygosaccharomyces with genus-specific primers.


    Hulin, Michelle; Wheals, Alan


    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design.

  17. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers.


    Robeson, Michael S; Costello, Elizabeth K; Freeman, Kristen R; Whiting, Jeremy; Adams, Byron; Martin, Andrew P; Schmidt, Steve K


    The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms.Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in a variety of soils.

  18. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.


    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  19. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    NASA Technical Reports Server (NTRS)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.


    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  20. A universal procedure for primer labelling of amplicons.

    PubMed Central

    Neilan, B A; Wilton, A N; Jacobs, D


    Detection and visualisation of nucleic acids is integral to genome analyses. Exponential amplification procedures have provided the means for the manipulation of nucleic acid sequences, which were otherwise inaccessible. We describe the development and application of a universal method for the labelling of any PCR product using a single end-labelled primer. Amplification was performed in a single reaction with the resulting amplicon labelled to a high specific activity. The method was adapted to a wide range of PCRs and significantly reduced the expense of such analyses. PMID:9207046

  1. The Primer for Sports Medicine Professionals on Imaging

    PubMed Central

    Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda


    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  2. Shining On: A primer on solar radiation data

    SciTech Connect

    Dunlap, M.A.; Cook, G.; Marion, B.; Riordan, C.; Renne, D.


    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  3. A NASTRAN primer for the analysis of rotating flexible blades

    NASA Technical Reports Server (NTRS)

    Lawrence, Charles; Aiello, Robert A.; Ernst, Michael A.; Mcgee, Oliver G.


    This primer provides documentation for using MSC NASTRAN in analyzing rotating flexible blades. The analysis of these blades includes geometrically nonlinear (large displacement) analysis under centrifugal loading, and frequency and mode shape (normal modes) determination. The geometrically nonlinear analysis using NASTRAN Solution sequence 64 is discussed along with the determination of frequencies and mode shapes using Solution Sequence 63. A sample problem with the complete NASTRAN input data is included. Items unique to rotating blade analyses, such as setting angle and centrifugal softening effects are emphasized.

  4. Genus-wide microsatellite primers for the goldenrods (Solidago; Asteraceae).


    Beck, James B; Semple, John C; Brull, Justin M; Lance, Stacey L; Phillips, Mai M; Hoot, Sara B; Meyer, Gretchen A


    Microsatellite primers were developed for studies of polyploid evolution, ecological genetics, conservation genetics, and species delimitation in the genus Solidago. • Illumina sequencing of a shotgun library from S. gigantea identified ca. 1900 putative single-copy loci. Fourteen loci were subsequently shown to be amplifiable, single-copy, and variable in a broad range of Solidago species. • The utility of these markers both across the genus and in herbarium specimens of a wide age range will facilitate numerous inter- and intraspecific studies in the ca. 120 Solidago species.

  5. Microsatellite primers for the neotropical epiphyte Epidendrum firmum (Orchidaceae).


    Kartzinel, Tyler R; Trapnell, Dorset W; Glenn, Travis C


    Ten microsatellite loci were isolated and characterized for the neotropical epiphytic orchid Epidendrum firmum to examine levels of genetic diversity and genetic structure at multiple spatial scales. We screened loci in 12-25 individuals from each of two populations in Costa Rica and identified 10 polymorphic loci. The number of alleles per locus ranged from one to 15 while observed heterozygosity for polymorphic loci ranged from 0.360 to 0.960. Primers for these informative genetic markers will be useful for quantifying genetic diversity, spatial genetic structure, and gene flow in E. firmum.

  6. Microsatellite primers for the endangered aquatic herb, Ottelia acuminata (Hydrocharitaceae).


    Xu, Chao; Du, Zhi-Yuan; Chen, Jin-Ming; Wang, Qing-Feng


    Microsatellite primers were developed in the endangered aquatic herb, Ottelia acuminata, to characterize its genetic diversity and understand its population structure. Eight polymorphic microsatellite markers were developed from two populations of O. acuminata in China. The number of alleles per locus ranged from one to 15; the observed and expected heterozygosities ranged from 0 to 0.885 and from 0 to 0.888, respectively, in the two populations. Selected loci also amplified successfully in O. sinensis. These microsatellite markers will facilitate further studies on the conservation genetics and evolutionary history of O. acuminata.

  7. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    PubMed Central

    Sharpe, Richard M; Dunn, Sade N; Cahoon, A Bruce


    Background Quantitative Real Time RT-PCR (q2(RT)PCR) is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RT)PCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR) as visualized on agarose gels and subsequently verified by q2(RT)PCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis) supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RT)PCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption. PMID:18518993

  8. A primer design strategy for PCR amplification of GC-rich DNA sequences.


    Li, Li-Yan; Li, Qiang; Yu, Yan-Hong; Zhong, Mei; Yang, Lei; Wu, Qing-Hong; Qiu, Yu-Rong; Luo, Shen-Qiu


    To establish a primer design method for amplification of GC-rich DNA sequences. A group of 15 pairs of primers with higher T(m) (>79.7°C) and lower level ΔT(m) (<1°C) were designed to amplify GC-rich sequences (66.0%-84.0%). The statistical analysis of primer parameters and GC content of PCR products was performed and compared with literatures. Other control experiments were conducted using shortened primers for GC-rich PCR amplifications in this study, and the statistical analysis of shortened primer parameters and GC content of PCR products was performed compared with primers not shortened. A group of 26 pairs of primers were designed to test the applicability of this primer designing strategy in amplifications of non-GC-rich sequences (35.2%-53.5%). All the DNA sequences in this study were successfully amplified. Statistical analyses show that the T(m) and ΔT(m) were the main factors influencing amplifications. This primer designing strategy offered a perfect tool for amplification of GC-rich sequences. It proves that the secondary structures cannot be formed at higher annealing temperature conditions (>65°C), and we can overcome this difficulty easily by designing primers and using higher annealing temperature. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

  9. Microsatellite primer development for post oak, Quercus stellata (Fagaceae)1

    PubMed Central

    Chatwin, Warren B.; Carpenter, Kyrie K.; Jimenez, Felix R.; Elzinga, Dave B.; Johnson, Leigh A.; Maughan, Peter J.


    • Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata). This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. • Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. • Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants. PMID:25309841

  10. Development of a unique polyurethane primer/topcoat

    NASA Technical Reports Server (NTRS)

    Novak, Howard L.; Klotz, James M.


    USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.

  11. FullSSR: Microsatellite Finder and Primer Designer.


    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia


    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  12. A Primer on U.S. Strategic Nuclear Policy

    SciTech Connect



    This primer presents a succinct summary of the evolution of U.S. nuclear deterrence policy from the initial development of nuclear weapons until the present day. This is not a definitive history but an introduction to deterrence policy for those with limited background in this area. The concept of deterrence is discussed in several ways--in a general description of deterrence theory, in an historical review of nuclear policy evolution, in a discussion of the future of deterrence, in historical examples of deterrence successes and failures, and in a review of significant contributors to the study of nuclear policy. The intent is to present an authoritative, unclassified account. To accomplish this, to the extent possible, primary source documents were located and utilized if they were available and declassified. These included unclassified Presidential nuclear policy guidance from the Presidential libraries, official JCS histories and State Department Foreign Relations histories. The writings of noted nuclear strategists and historians were also valuable resources for this primer on U.S. strategic nuclear policy.

  13. FullSSR: Microsatellite Finder and Primer Designer

    PubMed Central

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia


    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  14. Primer for evaluating ecological risk at petroleum release sites.


    Claff, R


    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  15. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven


    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and

  16. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë


    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  17. Inosine at Different Primer Positions to Study Structure and Diversity of Prokaryotic Populations.


    Ben-Dov, Eitan; Kushmaro, Ariel


    Culture-independent methods, employed to study the diversity and complexity of microbial communities that are based on amplification of rRNA genes with universal primers, include gradient gel electrophoresis (denaturing or temperature), single-strand-conformation polymorphism, restriction fragment length polymorphism, qPCR and high-throughput DNA sequencing. Substituting one or more base(s) within or at the 3'-termi of the universal primers by inosine can overcome some of their shortcomings improving amplification capacity. Universal primer sets do not usually amplify sequences with nucleotide mismatch to the templates, particularly in the last three bases, whereas inosine-modified primers anneal and amplify a variety of rRNA gene sequences. Inosine-containing primers are therefore might be useful to detect more species in diverse prokaryotic populations. The article summarizes the pros and cons of using inosine especially at the 3' termini of universal primers in nucleic acid amplification for the study of microbial diversity.

  18. Universal multiplexable matK primers for DNA barcoding of angiosperms1

    PubMed Central

    Heckenhauer, Jacqueline; Barfuss, Michael H. J.; Samuel, Rosabelle


    Premise of the study: PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. Methods and Results: We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. Conclusions: These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification. PMID:27347449

  19. Universal multiplexable matK primers for DNA barcoding of angiosperms.


    Heckenhauer, Jacqueline; Barfuss, Michael H J; Samuel, Rosabelle


    PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification.

  20. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.


    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  1. A method for predicting service life of zinc rich primers on carbon steel

    NASA Technical Reports Server (NTRS)

    Hoppesch, C. W.


    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  2. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  3. Design of a Percussion and Electric Primer Gun Firing Power Supply

    DTIC Science & Technology


    Design of a Percussion and Electric Primer Gun Firing Power Supply by Peter T. Bartkowski ARL-TR-6987 July 2014... Percussion and Electric Primer Gun Firing Power Supply Peter T. Bartkowski Weapons and Materials Research Directorate, ARL...Design of a Percussion and Electric Primer Gun Firing Power Supply 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S

  4. Quantitative experimental determination of primer-dimer formation risk by free-solution conjugate electrophoresis.


    Desmarais, Samantha M; Leitner, Thomas; Barron, Annelise E


    DNA barcodes are short, unique ssDNA primers that "mark" individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 base-pairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive base-pairs formed, yet non-consecutive base-pairs did not create stable dimers even when 20 out of 30 possible base-pairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation.

  5. PRISE2: software for designing sequence-selective PCR primers and probes.


    Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James


    PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

  6. Anti-biofilm dentin primer with quaternary ammonium and silver nanoparticles.


    Cheng, L; Zhang, K; Melo, M A S; Weir, M D; Zhou, X; Xu, H H K


    Antibacterial bonding agents could combat recurrent caries at the tooth-composite margins. The objectives of this study were to develop novel antibacterial dentin primers containing quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg), and to investigate the effects on dentin bond strength and dental plaque microcosm biofilms for the first time. Scotchbond Multi-Purpose ("SBMP") bonding agent was used. QADM and NAg were incorporated into SBMP primer, yielding 4 primers: SBMP primer (control), control + 10% QADM (mass), control + 0.05% NAg, and control + 10% QADM + 0.05% NAg. Human saliva was collected to grow microcosm biofilms. The NAg particle size (mean ± SD; n = 100) was 2.7 ± 0.6 nm. Dentin shear bond strengths (n = 10) with human third molars were approximately 30 MPa for all groups (p > 0.1). QADM-NAg-containing primer increased the bacteria inhibition zone by 9-fold, compared with control primer (p < 0.05). QADM-NAg-containing primer reduced lactic acid production and colony-forming units of total micro-organisms, total streptococci, and mutans streptococci by an order of magnitude. In conclusion, novel QADM-NAg-containing primers were strongly antibacterial without compromising dentin bond strength, and hence are promising to inhibit biofilms and secondary caries. The processing method of incorporating QADM and NAg together into the same primer produced the strongest antibacterial effect, which could have a wide applicability to other bonding systems.

  7. Greene SCPrimer: a rapid comprehensive tool for designing degenerate primers from multiple sequence alignments

    PubMed Central

    Jabado, Omar J.; Palacios, Gustavo; Kapoor, Vishal; Hui, Jeffrey; Renwick, Neil; Zhai, Junhui; Briese, Thomas; Lipkin, W. Ian


    Polymerase chain reaction (PCR) is widely applied in clinical and environmental microbiology. Primer design is key to the development of successful assays and is often performed manually by using multiple nucleic acid alignments. Few public software tools exist that allow comprehensive design of degenerate primers for large groups of related targets based on complex multiple sequence alignments. Here we present a method for designing such primers based on tree building followed by application of a set covering algorithm, and demonstrate its utility in compiling Multiplex PCR primer panels for detection and differentiation of viral pathogens. PMID:17135211

  8. The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.


    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  9. Express Primer Tool for high-throughput gene cloning and expression

    SciTech Connect


    A tool to assist in the design of primers for DNA amplification. The Express Primer web-based tool generates primer sequences specifically for the generation of expression clones for both lab scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for simultaneous amplification of multiple target genes. The Express Primer Tool enables the user to specify various experimental parameters (e.g. optimal Tm, Tm range, maximum Tm difference) for single or multiple candidate sequence(s) in FASTA format input as a flat text (ASCII) file. The application generates condidate primers, selects optimal primer pairs, and writes the forward and reverse primers pairs to an Excel file that is suitable for electronic submission to a synthesis facility. The program parameters emphasize high-throughput but allow for target atrition at various stages of the project.

  10. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.


    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  11. Plasmid ColE1 incompatibility determined by interaction of RNA I with primer transcript.

    PubMed Central

    Tomizawa, J; Itoh, T


    Mutants of plasmid pNT7 that can coexist with plasmid pMB9 in growing bacteria have been isolated. These mutants show altered incompatibility properties and increased copy numbers. Each mutant has a single base change at or near the center of one of the three palindromes in the region that specifies two RNA species: a larger one (primer transcripts) that provides a primer for DNA replication and a smaller one (RNA I) that is the incompatibility-specific inhibitor of primer formation. In vitro transcription studies show that the single base changes affect both the ability of RNA I to inhibit primer formation and the sensitivity of primer formation to inhibition by RNA I. RNA I hybridizes to the primer transcript, and the rate of hybridization is reduced by the single base changes. Based on analyses of inhibition of in vitro primer formation by RNA I and of in vivo properties of the mutant plasmids, we conclude that incompatibility between two plasmids can be attributed to inhibition of primer formation on one of the plasmids by the RNA I of the other. Inhibition of primer formation by RNA I appears to be the mechanism that determines the copy number of pNT7 and its derivatives. Images PMID:6171811

  12. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1

    PubMed Central

    Nevill, Paul G.; Wardell-Johnson, Grant


    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  13. Primer Part 1-The building blocks of epilepsy genetics.


    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C


    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  14. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    NASA Astrophysics Data System (ADS)


    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  15. Prader-Willi syndrome: A primer for clinicians

    PubMed Central


    The advent of sensitive genetic testing modalities for the diagnosis of Prader-Willi syndrome has helped to define not only the phenotypic features of the syndrome associated with the various genotypes but also to anticipate clinical and psychological problems that occur at each stage during the life span. With advances in hormone replacement therapy, particularly growth hormone children born in circumstances where therapy is available are expected to have an improved quality of life as compared to those born prior to growth hormone. This manuscript was prepared as a primer for clinicians-to serve as a resource for those of you who care for children and adults with Prader-Willi syndrome on a daily basis in your practices. Appropriate and anticipatory interventions can make a difference. PMID:22008714

  16. Antibiotic resistance: a primer and call to action.


    Smith, Rachel A; M'ikanatha, Nkuchia M; Read, Andrew F


    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention, 2013; World Health Organization, 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral, and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices.

  17. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    SciTech Connect

    Hernandez, L.S.; Garcia, G. |; Lopez, C.


    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  18. Antibiotic Resistance: A Primer and Call to Action

    PubMed Central

    Smith, Rachel A.; M’ikanatha, Nkuchia M.; Read, Andrew F.


    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention [CDC], 2013; World Health Organization [WHO], 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices. PMID:25121990

  19. Primer and interviews: The dynamic stem cell niche.


    Kiefer, Julie C


    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  20. ParaDiS-FEM dislocation dynamics simulation code primer

    SciTech Connect

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A


    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  1. A Primer to Single-Particle Cryo-Electron Microscopy

    PubMed Central

    Cheng, Yifan; Grigorieff, Nikolaus; Penczek, Pawel A.; Walz, Thomas


    Summary Cryo-electron microscopy (cryo-EM) of single-particle specimens is used to determine the structure of proteins and macromolecular complexes without the need for crystals. Recent advances in detector technology and software algorithms now allow images of unprecedented quality to be recorded and structures to be determined at near-atomic resolution. However, compared with X-ray crystallography, cryo-EM is a young technique with distinct challenges. This primer explains the different steps and considerations involved in structure determination by single-particle cryo-EM to provide an overview for scientists wishing to understand more about this technique and the interpretation of data obtained with it, as well as a starting guide for new practitioners. PMID:25910204

  2. Development of a Universal Intimin Antiserum and PCR Primers

    PubMed Central

    Batchelor, Miranda; Knutton, Stuart; Caprioli, Alfredo; Huter, Veronika; Zanial, Mazlina; Dougan, Gordon; Frankel, Gad


    Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) constitute a significant risk to human health worldwide. A hallmark of both pathogens is their ability to produce characteristic attaching-and-effacing (A/E) lesions in intestinal epithelial cells. Genes encoding A/E lesion formation map to a chromosomal pathogenicity island termed the locus of enterocyte effacement (LEE). Intimin, an LEE-encoded bacterial adhesion molecule, mediates the intimate bacterium-host cell interaction characteristic of A/E lesions. On the basis of characterization of the C-terminal 280-amino-acid cell binding domain of intimin (Int280661–939), four distinct Int280 types (types α, β, γ, and δ) have been identified. Importantly, Int280α and Int280β antisera specifically recognized their respective intimin types. Using a conserved region of the intimin molecule (Int388–667) and primers synthesized to generate the recombinant Int388–667, we have now generated universal intimin antiserum and PCR primers that are reactive with the different intimin types expressed by both human and animal A/E lesion-forming strains. Use of immunogold electron microscopy to visualize intimin on the surfaces of EPEC and EHEC strains revealed, in general, a uniform distribution on the bacterial cell surface. However, a filamentous staining pattern was observed with a few strains expressing intimin γ. Cloning of the intimin eae gene from one such strain (strain ICC57) into strain CVD206, an EPEC strain which harbors a null deletion in eae, produced a uniform intimin staining pattern indicating that, if the filamentous staining pattern defines a filamentous form of intimin γ, it is dependent upon the genetic background of the strain and is not a feature of the intimin molecule. PMID:10565891

  3. [Influence of primers ' chemical composition on shear bond strength of resin cement to zirconia ceramic].


    Łagodzińska, Paulina; Bociong, Kinga; Dejak, Beata


    Resin cements establish a strong durable bond between zirconia ceramic and hard tissues of teeth. It is essential to use primers with proper chemical composition before cementation. The aim of this study was to assess the influence of primer's chemical composition on the shear bond strength of zirconia ceramic to resin cements. 132 zirconia specimens were randomly assigned to four groups. There were four resin systems used. They included resin cement and respective primer, dedicated to zirconia: Clearfil Ceramic Primer/Panavia F2.0, Monobond Plus/Multilink Automix, AZ - Primer/ResiCem, Z - Prime Plus/Duo-Link. In each group the protocol of cementation was as follows: application of primer to the zirconia surface and application of the respective resin cement in cylindric mold (dimensions: 3.0 mm height and 3.0 mm diameter). Then, the shear bond strength was evaluated and the failure type was assessed in lupes (×2.5 magnification), also random specimens under SEM. The Wilcoxon test was used to analyze the data, the level of significance was α = 0.05. Finally, the known chemical composition of each primer was analysed in reference to probable chemical bonds, which may occure between primers and zirconia. The mean shear bond strength between resin cements and zirconia was the highest for Z-Prime Plus/Duo-Link (8.24 ± 3,21 MPa) and lowest for Clearfil Ceramic Primer/Panavia F 2.0 (4.60 ± 2.21 MPa). The analysis revealed significant difference between all groups, except pair Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem. The failure type in groups of Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem was mainly adhesive, in groups Monobond Plus/ /Multilink Automix and Z-Prime Plus/Duo-Link mainly mixed. The chemical composition of primers affects different bond mechanisms between resin cements and zirconia. The highest shear bond strength of resin cement to zirconia can be obtained for the primer composed of 10-Methacryloyloxydecyl dihydrogen

  4. Development of a ceramic primer with higher bond durability for resin cement.


    Li, Rui


    To increase the bond durability of resin to the CAD/CAM ceramic surface, two types of two-bottle type ceramic primers, consisting of Primer A1 or A2 and Primer B, were designed. Primer A1 was prepared by dissolving 25, 50, or 100 mg of gamma-methacryloxypropyltrimethoxysilane in 1 mL of ethanol. Primer A2 was prepared by dissolving 50 mg of mixed silanes, consisting of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane, in 1 mL of ethanol. Mole fractions of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane were 0, 10, 20, 30, 40 and 50 mol%. Primer B was prepared after dissolving 0.01, 0.05 or 0.1 mol L(-1) hydrochloric acid in ethanol by 50 vol%. Ceramic surface was silanated with a mixture of Primers A1 and B or Primers A2 and B for 1 min, and then air-dried. Commercial GC ceramic primer and Porcelain Liner M were utilized. Thereafter, dual-curing type resin cement was bonded to silanated ceramic surface through visible-light irradiation. Shear bond strength of resin to the ceramic surface was measured, before and after thermo-cycling. Addition of 0.01 or 0.05 mol L(-1) hydrochloric acid to the gamma-methacryloxypropyltrimethoxysilane allowed for significant increases in the bond strength. However, thermo-cycling resulted in significant decreases of approximately 5 MPa in the bond strength. Conversely, when the mixed silane, where 30 mol% of 1,2-bis(trimethoxysilyl)ethane dissolved in gamma-methacryloxypropyltrimethoxysilane, was utilized with 0.05 mol L(-1) hydrochloric acid, the reduction in the bond strength decreased to approximately 2 MPa. The designed ceramic primers exhibited higher ceramic bond durability than commercial ceramic primers.

  5. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

    PubMed Central

    Marcon, Helena Sanches; Coscrato, Virgínia Elias; Selivon, Denise; Perondini, André Luiz Paranhos; Marino, Celso Luis


    Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity. PMID:24031693

  6. A tool for design of primers for microRNA-specific quantitative RT-qPCR

    PubMed Central


    Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. Conclusions The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language. PMID:24472427

  7. A tool for design of primers for microRNA-specific quantitative RT-qPCR.


    Busk, Peter K


    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  8. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing.


    Li, Kelvin; Shrivastava, Susmita; Brownley, Anushka; Katzel, Dan; Bera, Jayati; Nguyen, Anh Thu; Thovarai, Vishal; Halpin, Rebecca; Stockwell, Timothy B


    In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute's (JCVI) high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus sequence that encapsulates the allelic variation of the targeted

  9. Comparison of Shear Bond Strength of New Self-etching Primer with Conventional Self-etching Primers: An In-vitro Study.


    Sorake, Abhinay; Rai, Rohan; Hegde, Gautham; Suneja, Ridhima; Kumar, Naveena; Skaria, Jibin


    In the past few years, there has been a major research drive to increase bond strength between dental materials and dental hard tissue and to reduce the associated demineralization around fixed orthodontic appliances. Thus, a recent approach is to incorporate an antibacterial agent into the primer to reduce the demineralization and enhance bond strength. The objective of this study was: (1) To evaluate the shear bond strength of orthodontic preadjusted edgewise appliance brackets bonded to extracted premolar teeth with antimicrobial self-etch primer (Reliance self-etching primer, Clearfil Protect Bond) and self-etching primer without antimicrobial agent (Clearfil SE bond). (2) To compare the mean shear bond strength values of the tested materials to conventional self-etching primer Transbond Plus. A total of 125 extracted human premolar teeth were randomly divided into five groups of 25 teeth each. Each sample was embedded in an acrylic block of polymethyl meth acrylate resin till coronal portion. Instron testing machine model LR LOYD 50 K was used for testing the shear bond strength of individual samples. The results of the study showed that all five groups had adequate clinically acceptable bond strength. In intergroup comparison, there was statistically significant difference in bond strength of Reliance self-etching primer, Promt L pop, Clearfil Protect Bond, clearfil SE bond and Transbond Plus. Reliance self-etching primer showed highest bond strength, followed by Clearfil Protect Bond, clearfil SE bond, and Transbond Plus. Clearfil Protect Bond primer containing methacryloxy dodecyl pyridium bromide have been demonstrated to kill Streptococcus mutans within a short time of contact and also exhibits an inhibitory effect on the growth of bacteria on its surface.

  10. ITS fungal barcoding primers vs 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.


    Berruti, A; Desirò, A; Visentin, S; Zecca, O; Bonfante, P


    ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil), and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) since it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. This article is protected by copyright. All rights reserved. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. A new PCR method: one primer amplification of PCR-CTPP products.


    Yin, Guang; Mitsuda, Yoko; Ezaki, Takayuki; Hamajima, Nobuyuki


    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) is a convenient method for genotyping single nucleotide polymorphisms, saving time, and costs. It uses four primers for PCR; F1 and R1 for one allele, and F2 and R2 for the other allele, by which three different sizes of DNA are amplified; between F1 and R1, between F2 and R2, and between F1 and R2. To date, we have applied PCR-CTPP successfully for genotyping more than 60 polymorphisms. However, it is not rare that PCR does not produce balanced amplification of allele specific bands. Accordingly, the method was modified by attaching a common sequence at the 5' end of two-pair primers and adding another primer with the common sequence in PCR, in total five different primers in a tube for PCR. The modification allowed one primer amplification for the products of initial PCR with confronting two-pair primers, named as one primer amplification of PCR-CTPP products (OPA-CTPP). This article demonstrates an example for an A/G polymorphism of paraoxonase 1 (PON1) Gln192Arg (rs662). PCR-CTPP failed clear genotyping for the polymorphism, while OPA-CTPP successfully produced PCR products corresponding to the allele. The present example indicated that the OPA-CTPP would be useful in the case that PCR-CTPP failed to produce balanced PCR products specific to each allele.

  12. Sediment transport primer: estimating bed-material transport in gravel-bed rivers


    Peter Wilcock; John Pitlick; Yantao Cui


    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  13. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    PubMed Central

    Gaby, John Christian; Buckley, Daniel H.


    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitrogen fixers, but that there are also 23 nifH primers that target less than 50% of nifH sequences. The nifH primers we evaluated vary in their phylogenetic bias and their ability to recover sequences from commonly sampled environments. In addition, many of these primers will amplify genes that do not mediate nitrogen fixation, and thus it would be advisable for researchers to screen their sequencing results for the presence of non-target genes before analysis. Universal primers that performed well in silico were tested empirically with soil samples and with genomic DNA from a phylogenetically diverse set of nitrogen-fixing strains. This analysis will be of great utility to those engaged in molecular analysis of nifH genes from isolates and environmental samples. PMID:22848735

  14. Microarrays for high-throughput genotyping of MICA alleles using allele-specific primer extension.


    Baek, I C; Jang, J-P; Choi, H-B; Choi, E-J; Ko, W-Y; Kim, T-G


    The role of major histocompatibility complex (MHC) class I chain-related gene A (MICA), a ligand of NKG2D, has been defined in human diseases by its allele associations with various autoimmune diseases, hematopoietic stem cell transplantation (HSCT) and cancer. This study describes a practical system to develop MICA genotyping by allele-specific primer extension (ASPE) on microarrays. From the results of 20 control primers, strict and reliable cut-off values of more than 30,000 mean fluorescence intensity (MFI) as positive and less than 3000 MFI as negative, were applied to select high-quality specific extension primers. Among 55 allele-specific primers, 44 primers could be initially selected as optimal primer. Through adjusting the length, six primers were improved. The other failed five primers were corrected by refractory modification. MICA genotypes by ASPE on microarrays showed the same results as those by nucleotide sequencing. On the basis of these results, ASPE on microarrays may provide high-throughput genotyping for MICA alleles for population studies, disease-gene associations and HSCT.

  15. MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity.


    Qu, Wubin; Zhou, Yang; Zhang, Yanchun; Lu, Yiming; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang


    Evaluating the specificity of polymerase chain reaction (PCR) primers is an essential step in PCR primer design. The MFEprimer-2.0 server allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. MFEprimer-2.0 uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported on the results page. Based on these characteristics and the user-friendly output, users can readily draw conclusions about the specificity of PCR primers. Analyses for degenerate primers and multiple PCR primers are also supported in MFEprimer-2.0. In addition, the databases supported by MFEprimer-2.0 are comprehensive, and custom databases can also be supported on request. The MFEprimer-2.0 server does not require a login and is freely available at More over, the MFEprimer-2.0 command-line version and local server version are open source and can be downloaded at

  16. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.


    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong


    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease.

  17. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

    PubMed Central


    Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

  18. A Highly Reactive Imidazolium-Bridged Dinucleotide Intermediate in Nonenzymatic RNA Primer Extension.


    Walton, Travis; Szostak, Jack W


    Because of its importance for the origin of life, the nonenzymatic copying of RNA templates has been the subject of intense study for several decades. Previous characterizations of template-directed primer extension using 5'-phosphoryl-2-methylimidazole-activated nucleotides (2-MeImpNs) as substrates have assumed a classical in-line nucleophilic substitution mechanism, in which the 3'-hydroxyl of the primer attacks the phosphate of the incoming monomer, displacing the 2-methylimidazole leaving group. However, we have found that the initial rate of primer extension depends on the pH and concentration at which the activated monomer is maintained prior to the primer extension reaction. These and other results suggest an alternative mechanism, in which two monomers react with each other to form an imidazolium-bridged dinucleotide intermediate, which then binds to the template. Subsequent attack of the 3'-hydroxyl of the primer displaces an activated nucleotide as the leaving group and results in extension of the primer by one nucleotide. Analysis of monomer solutions by NMR indicates formation of the proposed imidazolium-bridged dinucleotide in the expected pH-dependent manner. We have used synthetic methods to prepare material that is enriched in this proposed intermediate and show that it is a highly reactive substrate for primer extension. The formation of an imidazolium-bridged dinucleotide intermediate provides a mechanistic interpretation of previously observed catalysis by an activated nucleotide located downstream from the site of primer extension.

  19. GSP: A web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  20. Single primer-triggered isothermal amplification for double-stranded DNA detection.


    Ma, Cuiping; Han, Dianang; Deng, Meilian; Wang, Jingfei; Shi, Chao


    Here we have devised a new generation of isothermal double-stranded DNA (dsDNA) detection method, termed single primer-triggered isothermal amplification (SAMP). It is very simple only requiring one primer and a few copies of dsDNA in less than an hour are detectable with multiple signal amplification steps.

  1. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Rhim, Lauren Morando; Kowal, Julie


    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  2. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.


    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo


    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  3. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    EPA Science Inventory

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  4. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

    PubMed Central

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart


    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at Database URL: PMID:21917859

  5. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets.


    Brodin, Johanna; Krishnamoorthy, Mohan; Athreya, Gayathri; Fischer, Will; Hraber, Peter; Gleasner, Cheryl; Green, Lance; Korber, Bette; Leitner, Thomas


    Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples.

  6. Mutagenic primer design for mismatch PCR-RFLP SNP genotyping using a genetic algorithm.


    Yang, Cheng-Hong; Cheng, Yu-Huei; Yang, Cheng-Huei; Chuang, Li-Yeh


    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) is useful in small-scale basic research studies of complex genetic diseases that are associated with single nucleotide polymorphism (SNP). Designing a feasible primer pair is an important work before performing PCR-RFLP for SNP genotyping. However, in many cases, restriction enzymes to discriminate the target SNP resulting in the primer design is not applicable. A mutagenic primer is introduced to solve this problem. GA-based Mismatch PCR-RFLP Primers Design (GAMPD) provides a method that uses a genetic algorithm to search for optimal mutagenic primers and available restriction enzymes from REBASE. In order to improve the efficiency of the proposed method, a mutagenic matrix is employed to judge whether a hypothetical mutagenic primer can discriminate the target SNP by digestion with available restriction enzymes. The available restriction enzymes for the target SNP are mined by the updated core of SNP-RFLPing. GAMPD has been used to simulate the SNPs in the human SLC6A4 gene under different parameter settings and compared with SNP Cutter for mismatch PCR-RFLP primer design. The in silico simulation of the proposed GAMPD program showed that it designs mismatch PCR-RFLP primers. The GAMPD program is implemented in JAVA and is freely available at

  7. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    USDA-ARS?s Scientific Manuscript database

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  8. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    PubMed Central

    Li, Kelvin; Brownley, Anushka; Stockwell, Timothy B; Beeson, Karen; McIntosh, Tina C; Busam, Dana; Ferriera, Steve; Murphy, Sean; Levy, Samuel


    Background Polymerase chain reaction (PCR) is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing costs associated with labor and

  9. Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.


    Campos, Maria Jorge; Quesada, Alberto


    PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

  10. A novel technique for detecting single nucleotide polymorphisms by analyzing consumed allele-specific primers.


    Watanabe, G; Umetsu, K; Yuasa, I; Sato, M; Sakabe, M; Naito, E; Yamanouchi, H; Suzuki, T


    We present a simple and rapid polymerase chain reaction (PCR)-based technique, termed consumed allele-specific primer analysis (CASPA), as a new strategy for single nucleotide polymorphism (SNP) analysis. The method involves the use of labeled allele-specific primers, differing in length, with several noncomplementary nucleotides added in the 5'-terminal region. After PCR amplification, the amounts of the remaining primers not incorporated into the PCR products are determined. Thus, nucleotide substitutions are identified by measuring the consumption of primers. In this study, the CASPA method was successfully applied to ABO genotyping. In the present method, the allele-specific primer only anneals with the target polymorphic site on the DNA, so it is not necessary to analyze the PCR products. Therefore, this method is only little affected by modification of the PCR products. The CASPA method is expected to be a useful tool for typing of SNPs.

  11. Multi-primer target PCR for rapid identification of bovine DRB3 alleles.


    Ledwidge, S A; Mallard, B A; Gibson, J P; Jansen, G B; Jiang, Z H


    Multi-primer target polymerase chain reaction (MPT-PCR) is a rapid method for the identification of specific BoLA-DRB3 alleles. In a single PCR reaction, the presence of two alleles associated with increased risk, DRB3.2*23 (DRB3*2701-2703, 2705-2707) and decreased risk, DRB3.2*16 (DRB3*1501, 1502), of mastitis in Canadian Holstein can be detected. Two outer primers amplify exon 2 of DRB3. Simultaneously, two inner, allele-specific primers amplify individual alleles. Initially, 40 cows previously typed by PCR-restriction fragment length polymorphism (PCR-RFLP) were genotyped using the multi-primer approach. An additional 30 cows were first genotyped by multi-primer target PCR, then by PCR-RFLP. All animals were correctly identified and there were no false positives. This technique can readily be modified to identify other BoLA alleles of interest.

  12. Degenerative primer design and gene sequencing validation for select turkey genes.


    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald


    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. © 2016 Poultry Science Association Inc.

  13. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2012 CFR


    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of... combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission...

  14. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2013 CFR


    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of... combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission...

  15. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2014 CFR


    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of... combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission...

  16. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2011 CFR


    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of... control emissions from my electrodeposition primer system if I want to comply with the combined primer...

  17. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2010 CFR


    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of... control emissions from my electrodeposition primer system if I want to comply with the combined primer...

  18. Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum.


    Haugland, R A; Heckman, J L


    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relationships of these organisms and to search for sequence specific polymerase chain reaction (PCR) primers for S. chartarum in the internal transcribed spacer (ITS) regions. Searches for candidate primers were performed both by computer using the commercially available Oligo(R) v5.0 primer analysis software package and by manual inspection of the aligned sequences. Primers identified in both types of searches were evaluated for their specificities using a priming efficiency analysis algorithm available in the Oligo(R) 5.0 software. The automated computer searches were unsuccessful in finding S. chartarum-specific primers but did identify a group-specific reverse primer (designated as StacR4) for a phylogenetically related cluster of species that included S. chartarum. Manual searches led to the identification of a reverse primer (designated as StacR3) that was predicted to be specific for only S. chartarum and one other species of Stachybotrys. Experimental PCR analyses using these primers in conjunction with a universal forward primer indicated that the computer-generated amplification efficiency predictions were correct in most instances. A notable exception was the finding that StacR3 was specific only for S. chartarum. The relative merits of different PCR strategies for the detection of S. chartarum employing either one or both of the primers identified in this study are discussed.

  19. Design and in vitro evaluation of new rpoB-DGGE primers for ruminants.


    Perumbakkam, Sudeep; Craig, A Morrie


    Two new primer sets based on the rpoB gene were designed and evaluated with bovine and ovine rumen samples. The newly developed rpoB-DGGE primer set was used along with the 16S rRNA gene-V3, and another (old) rpoB-DGGE-based primer set from a previous study to in vitro compare the bovine and ovine rumen ecosystems. The results indicate a significant (P<0.001) difference in the microbial population between the two ruminants irrespective of the primers used in the analysis. Qualitative comparison of the data provides evidence for the presence of similar phyla profiles between the 16S rRNA gene and the newly developed rpoB primers. A comparison between the two rpoB-based primer sets (old and new) showed that the old rpoB-based primers failed to amplify phylum Bacteroidetes (a common phylum in the rumen) in both bovine and ovine rumen samples. The old and new rpoB-DGGE-based primers amplified a large number of clones belonging to phylum Proteobacteria, providing a useful insight into the microbial structure of the rumen. ChaoI, ACE, Simpson, and Shannon-Weaver index analysis estimated the bovine rumen to be more diverse than the ovine rumen for all three primer sets. These results provide a new insight into the community structure among ruminants using the newly developed primers in this study. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  20. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer


    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  1. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.


    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer


    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  2. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    SciTech Connect

    Busch, R.D.


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  3. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    PubMed Central

    Martin, Kendall J; Rygiewicz, Paul T


    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP) fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR), Length Heterogeneity PCR (LH-PCR) and Terminal Restriction Fragment Length Polymorphism (T-RFLP) analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was developed with an emphasis on

  4. Primer of statistics in dental research: Part II.


    Shintani, Ayumi


    The Part I of Primer of Statistics in Dental Research covered five topics that are often mentioned in statistical check list of many peer-review journals including (1) statistical graph, (2) how to deal with outliers, (3) p-value and confidence interval, (4) testing equivalence, and (5) multiplicity Adjustment. The Part II of the series covers another set of important topics in dental statistics including (1) selecting the proper statistical tests, (2) repeated measures analysis, (3) epidemiological consideration for causal association, and (4) analysis of agreement. First, a guide in selecting the proper statistical tests based on the research question will be laid out in text and with a table so that researchers choose the univariable statistical test by answering five simple questions. Second, the importance of utilizing repeated measures analysis will be illustrated. This is a key component of data analysis as in many dental studies, observations are considered repeated in a single patient (several teeth are measured in a single patient). Third, concepts of confounding and the use of regression analysis are explained by going over a famous observational cohort study. Lastly, the use of proper agreement analysis vs. correlation for study of agreement will be discussed to avoid a common pitfall in dental research.

  5. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    PubMed Central

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin


    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  6. The corrosion mechanisms for primer coated 2219-T87 aluminum

    NASA Technical Reports Server (NTRS)

    Danford, Merlin D.; Knockemus, Ward W.


    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  7. A primer to frequent itemset mining for bioinformatics

    PubMed Central

    Naulaerts, Stefan; Meysman, Pieter; Bittremieux, Wout; Vu, Trung Nghia; Vanden Berghe, Wim; Goethals, Bart


    Over the past two decades, pattern mining techniques have become an integral part of many bioinformatics solutions. Frequent itemset mining is a popular group of pattern mining techniques designed to identify elements that frequently co-occur. An archetypical example is the identification of products that often end up together in the same shopping basket in supermarket transactions. A number of algorithms have been developed to address variations of this computationally non-trivial problem. Frequent itemset mining techniques are able to efficiently capture the characteristics of (complex) data and succinctly summarize it. Owing to these and other interesting properties, these techniques have proven their value in biological data analysis. Nevertheless, information about the bioinformatics applications of these techniques remains scattered. In this primer, we introduce frequent itemset mining and their derived association rules for life scientists. We give an overview of various algorithms, and illustrate how they can be used in several real-life bioinformatics application domains. We end with a discussion of the future potential and open challenges for frequent itemset mining in the life sciences. PMID:24162173

  8. Congenital heart disease: A primer for the pediatric neuropsychologist.


    Cassidy, Adam R; Ilardi, Dawn; Bowen, Susan R; Hampton, Lyla E; Heinrich, Kimberley P; Loman, Michelle M; Sanz, Jacqueline H; Wolfe, Kelly R


    Congenital heart disease (CHD) affects millions of people worldwide, including over one million children in the United States. Approximately 25% of children born with CHD require intensive surgical intervention within the first year of life. Despite improved rates of survival into adulthood - rates that exceed 90% in the modern era - children and adolescents with CHD remain at risk for neurological injury and a range of neurobehavioral and psychosocial challenges that pose a threat to quality of life across the lifespan. Consequently, as experts in both clinical psychology and brain development, neuropsychologists are becoming increasingly involved in cardiac follow-up and monitoring to promote optimal developmental outcomes. The primary objective of this paper is to provide an evidence-based, clinically-oriented primer on CHD for pediatric neuropsychologists working with this growing population of survivors. Following an introduction to current standard-of-care guidelines for managing children and adolescents with CHD, we present an overview of brain development within the context of CHD, review neuropsychological outcomes, examine factors influencing variability in outcomes, and discuss implications and strategies for clinical assessment.

  9. A primer to frequent itemset mining for bioinformatics.


    Naulaerts, Stefan; Meysman, Pieter; Bittremieux, Wout; Vu, Trung Nghia; Vanden Berghe, Wim; Goethals, Bart; Laukens, Kris


    Over the past two decades, pattern mining techniques have become an integral part of many bioinformatics solutions. Frequent itemset mining is a popular group of pattern mining techniques designed to identify elements that frequently co-occur. An archetypical example is the identification of products that often end up together in the same shopping basket in supermarket transactions. A number of algorithms have been developed to address variations of this computationally non-trivial problem. Frequent itemset mining techniques are able to efficiently capture the characteristics of (complex) data and succinctly summarize it. Owing to these and other interesting properties, these techniques have proven their value in biological data analysis. Nevertheless, information about the bioinformatics applications of these techniques remains scattered. In this primer, we introduce frequent itemset mining and their derived association rules for life scientists. We give an overview of various algorithms, and illustrate how they can be used in several real-life bioinformatics application domains. We end with a discussion of the future potential and open challenges for frequent itemset mining in the life sciences.

  10. A primer on on-demand polymerase chain reaction technology.


    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise


    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  11. Review of Attachment, play, and authenticity: A Winnicott primer.


    Penn, Linda S


    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  12. A Transparent Window into Biology: A Primer on Caenorhabditis elegans.


    Corsi, Ann K; Wightman, Bruce; Chalfie, Martin


    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host-parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. Copyright © 2015 Corsi, Wightman, and Chalfie.

  13. Complement: A primer for the coming therapeutic revolution.


    Barnum, Scott R


    The complement system is an important part of the innate and adaptive immune systems. Originally characterized as a single serum component contributing to the killing of bacteria, we now know that there are close to sixty complement proteins, multiple activation pathways and a wide range of effector functions mediated by complement. The system plays a critical role in host defense against bacteria, viruses, fungi and other pathogens. However, inappropriate complement activation contributes to the pathophysiology of autoimmune diseases and many inflammatory syndromes. Over the last several decades, therapeutic approaches to inhibit complement activation at various steps in the pathways have met with initial success, particularly at the level of the terminal pathway. This success, combined with insight from animal model studies, has lead to an unprecedented effort by biotech and pharmaceutical companies to begin developing complement inhibitors. As a result, complement has been brought for the first time to the attention of pharmacologists, toxicologists, project managers and others in the drug development industry, as well as those in the investment world. The purpose of this primer is to provide a broad overview of complement immunobiology to help those new to complement understand the rationale behind the current therapeutic directions and the investment potential of these new therapeutics. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Genetic analysis of presbycusis by arrayed primer extension.


    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris


    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  15. Maximum Likelihood, Profile Likelihood, and Penalized Likelihood: A Primer

    PubMed Central

    Cole, Stephen R.; Chu, Haitao; Greenland, Sander


    The method of maximum likelihood is widely used in epidemiology, yet many epidemiologists receive little or no education in the conceptual underpinnings of the approach. Here we provide a primer on maximum likelihood and some important extensions which have proven useful in epidemiologic research, and which reveal connections between maximum likelihood and Bayesian methods. For a given data set and probability model, maximum likelihood finds values of the model parameters that give the observed data the highest probability. As with all inferential statistical methods, maximum likelihood is based on an assumed model and cannot account for bias sources that are not controlled by the model or the study design. Maximum likelihood is nonetheless popular, because it is computationally straightforward and intuitive and because maximum likelihood estimators have desirable large-sample properties in the (largely fictitious) case in which the model has been correctly specified. Here, we work through an example to illustrate the mechanics of maximum likelihood estimation and indicate how improvements can be made easily with commercial software. We then describe recent extensions and generalizations which are better suited to observational health research and which should arguably replace standard maximum likelihood as the default method. PMID:24173548

  16. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Technical Reports Server (NTRS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, B.


    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high quality data for many areas of investigation. Unconditioned simple aperture time-series photometry are however affected by systematic structure. Examples of these systematics are differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler's primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 10(exp 5) stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have occurred to remove or reduce systematic artifacts. This paper provides a conceptual primer for users of the Kepler data archive to understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  17. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Astrophysics Data System (ADS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, Steve B.


    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high-quality data for many areas of investigation. Unconditioned simple aperture time-series photometry is, however, affected by systematic structure. Examples of these systematics include differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler’s primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 105 stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have helped to remove or reduce systematic artifacts. This paper provides a conceptual primer to help users of the Kepler data archive understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  18. A Transparent window into biology: A primer on Caenorhabditis elegans.

    PubMed Central

    Corsi, Ann K; Wightman, Bruce; Chalfie, Martin


    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host-parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26087236

  19. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.; Mowrey, C.; Reis, E.


    Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

  20. In vitro short-term bonding performance of zirconia treated with hot acid etching and primer conditioning etching and primer conditioning.


    Xie, Haifeng; Chen, Chen; Dai, Wenyong; Chen, Gang; Zhang, Feimin


    This study aimed to investigate and compare the resin bond strengths of zirconia conditioned as follows: alumina sandblasting; alumina sandblasting+application of 10-MDP-containing primer; alumina sandblasting+application of Z-Prime Plus or Metal/Zirconia Primer (new zirconia primers); tribochemical silica coating+silanization; hot acid etching in three different combinations [H2SO4/(NH4)2SO4, HF/HNO3, H2SO4/HF/HNO3]+application of 10-MDP-containing primer. Shear bond strengths (SBS) after water storage for 24 h and 40 days were measured to assess resin bonding performance. Surface and chemical properties of conditioned zirconia surfaces and primers were characterized using scanning electron microscopy, energy dispersive X-ray spectrometry, Fourier transform infrared spectroscopy, and atomic force microscopy. Surface roughness ranked in descending order was: hot acid etching > tribochemical silica coating > alumina sandblasting. Combination of tribochemical silica coating and silanization showed the highest initial SBS (12.46±2.13 MPa) (P<0.01). Etching with H2SO4/(NH4)2SO4 (13.15±3.24 MPa) and HF/HNO3 (13.48±2.15 MPa) showed significantly better bond durability (P<0.01). Hot acid etching seemed to be a promising surface roughening treatment to improve resin-zirconia bonding.

  1. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes


    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...


    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus.more » Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  2. Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G.


    Chook, Jack Bee; Teo, Woon Li; Ngeow, Yun Fong; Tee, Kok Keng; Ng, Kee Peng; Mohamed, Rosmawati


    Hepatitis B virus (HBV) has been divided into 10 genotypes, A to J, based on an 8% nucleotide sequence divergence between genotypes. The conventional practice of using a single set of primers to amplify a near-complete HBV genome is hampered by its low analytical sensitivity. The current practice of using overlapping conserved primer sets to amplify a complete HBV genome in a clinical sample is limited by the lack of pan-primers to detect all HBV genotypes. In this study, we designed six highly conserved, overlapping primer sets to cover the complete HBV genome. We based our design on the sequences of 5,154 HBV genomes of genotypes A to I downloaded from the GenBank nucleotide database. These primer sets were tested on 126 plasma samples from Malaysia, containing genotypes A to D and with viral loads ranging from 20 to >79,780,000 IU/ml. The overall success rates for PCR amplification and sequencing were >96% and >94%, respectively. Similarly, there was 100% amplification and sequencing success when the primer sets were tested on an HBV reference panel of genotypes A to G. Thus, we have established primer sets that gave a high analytical sensitivity for PCR-based detection of HBV and a high rate of sequencing success for HBV genomes in most of the viral genotypes, if not all, without prior known sequence data for the particular genotype/genome.

  3. Shop primer as part of the corrosion protective coating for submerged steel structures

    SciTech Connect

    Bjordal, M.; Steinsmo, U.


    In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough if the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.

  4. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV.


    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G


    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  5. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    PubMed Central

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.


    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  6. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies.


    O'Donnell, James L; Kelly, Ryan P; Lowell, Natalie C; Port, Jesse A


    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary.

  7. Human DNA polymerase α in binary complex with a DNA:DNA template-primer.


    Coloma, Javier; Johnson, Robert E; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K


    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually engages with a DNA:DNA helix during primer synthesis. We present here the first crystal structure of human Polα polymerase subunit in complex with a DNA:DNA helix. Unexpectedly, we find that portion of the DNA:DNA helix in contact with the polymerase is not in a B-form but in a hybrid A-B form. Almost all of the contacts observed previously with an RNA primer are preserved with a DNA primer--with the same set of polymerase residues tracking the sugar-phosphate backbone of the DNA or RNA primer. Thus, rather than loss of specific contacts, the free energy cost of distorting DNA from B- to hybrid A-B form may augur the termination of primer synthesis in eukaryotes.

  8. Guidelines for the tetra-primer ARMS-PCR technique development.


    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa


    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way.

  9. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.


    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar


    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  10. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    PubMed Central

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti


    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  11. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    PubMed Central


    Background MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological settings. Results We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision in microRNA quantification. Conclusions MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification. PMID:21702990

  12. Comprehensive primer design for analysis of population genetics in non-sequenced organisms.


    Tezuka, Ayumi; Matsushima, Noe; Nemoto, Yoriko; Akashi, Hiroshi D; Kawata, Masakado; Makino, Takashi


    Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris), anole lizard (Anolis sagrei), guppy (Poecilia reticulata), and fruit fly (Drosophila melanogaster), for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation.

  13. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo


    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database ( contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  14. Comprehensive Primer Design for Analysis of Population Genetics in Non-Sequenced Organisms

    PubMed Central

    Tezuka, Ayumi; Matsushima, Noe; Nemoto, Yoriko; Akashi, Hiroshi D.; Kawata, Masakado; Makino, Takashi


    Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris), anole lizard (Anolis sagrei), guppy (Poecilia reticulata), and fruit fly (Drosophila melanogaster), for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation. PMID:22393396

  15. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.


    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter


    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  16. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.


    Caetano-Anollés, G; Gresshoff, P M


    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  17. An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.


    To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

  18. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy


    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  19. Design and evaluation of primers targeting genes encoding NO-forming nitrite reductases: implications for ecological inference of denitrifying communities

    PubMed Central

    Bonilla-Rosso, Germán; Wittorf, Lea; Jones, Christopher M.; Hallin, Sara


    The detection of NO-forming nitrite reductase genes (nir) has become the standard when studying denitrifying communities in the environment, despite well-known amplification biases in available primers. We review the performance of 35 published and 121 newly designed primers targeting the nirS and nirK genes, against sequences from complete genomes and 47 metagenomes from three major habitats where denitrification is important. There were no optimal universal primer pairs for either gene, although published primers targeting nirS displayed up to 75% coverage. The alternative is clade-specific primers, which show a trade-off between coverage and specificity. The test against metagenomic datasets showed a distinct performance of primers across habitats. The implications of clade-specific nir primers choice and their performance for ecological inference when used for quantitative estimates and in sequenced-based community ecology studies are discussed and our phylogenomic primer evaluation can be used as a reference along with their environmental specificity as a guide for primer selection. Based on our results, we also propose a general framework for primer evaluation that emphasizes the testing of coverage and phylogenetic range using full-length sequences from complete genomes, as well as accounting for environmental range using metagenomes. This framework serves as a guideline to simplify primer performance comparisons while explicitly addressing the limitations and biases of the primers evaluated. PMID:27966627

  20. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.


    Cheng, Yu-Huei


    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  1. Estimation of teaching-learning-based optimization primer design using regression analysis for different melting temperature calculations.


    Cheng, Yu-Huei


    Primers plays important role in polymerase chain reaction (PCR) experiments, thus it is necessary to select characteristic primers. Unfortunately, manual primer design manners are time-consuming and easy to get human negligence because many PCR constraints must be considered simultaneously. Automatic programs for primer design were developed urgently. In this study, the teaching-learning-based optimization (TLBO), a robust and free of algorithm-specific parameters method, is applied to screen primers conformed primer constraints. The optimal primer frequency (OPF) based on three known melting temperature formulas is estimated by 500 runs for primer design in each different number of generations. We selected optimal primers from fifty random nucleotide sequences of Homo sapiens at NCBI. The results indicate that the SantaLucia's formula is better coupled with the method to get higher optimal primer frequency and shorter CPU-time than the Wallace's formula and the Bolton and McCarthy's formula. Through the regression analysis, we also find the generations are significantly associated with the optimal primer frequency. The results are helpful for developing the novel TLBO-based computational method to design feasible primers.

  2. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    SciTech Connect

    Warwick, William M.


    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  3. Chrome-Free Paint Primer for Zn/Ni Plated High-Strength Steel (Briefing Charts)

    DTIC Science & Technology


    Chrome-Free Paint Primer for Zn/Ni Plated High- Strength Steel 11-19-14 Presentation at ASETSDefense 2014 George Zafiris Team: Mark Jaworowski, Mike...AND SUBTITLE Chrome-Free Paint Primer for Zn/Ni Plated High-Strength Steel 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER ANSI Std Z39-18 Background High-Strength Steel (Substrate) LHE Cd layer Cr(VI) Primer CCC High-Strength Steel (Substrate) LHE Zn/Ni layer

  4. Express primer tool for high-throughput gene cloning and expression.

    SciTech Connect

    Yoon, J. R.; Laible, P. D.; Gu, M.; Scott, H. N.; Collart, F. R.; Biosciences Division


    High-throughput approaches for gene cloning and expression require the development of new nonstandard tools for molecular biologists and biochemists. We introduce a Web-based tool to design primers specifically for the generation of expression clones for both laboratory-scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for the simultaneous amplification of multiple target genes.

  5. Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes).


    Lohman, David J; Prawiradilaga, Dewi M; Meier, Rudolf


    The All Birds Barcoding Initiative aims to assemble a DNA barcode database for all bird species, but the 648-bp 'barcoding' region of cytochrome c oxidase subunit I (COI) can be difficult to amplify in Southeast Asian perching birds (Aves: Passeriformes). Using COI sequences from complete mitochondrial genomes, we designed a primer pair that more reliably amplifies and sequences the COI barcoding region of Southeast Asian passerine birds. The 655-bp region amplified with these primers overlaps the COI region amplified with other barcoding primer pairs, enabling direct comparison of sequences with previously published DNA barcodes. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.

  6. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples1

    PubMed Central

    Zuntini, Alexandre R.; Fonseca, Luiz Henrique M.; Lohmann, Lúcia G.


    • Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae. PMID:25202586

  7. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera.


    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W; Rota, Jadranka


    We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods.

  8. Express primer tool for high-throughput gene cloning and expression.


    Yoon, J R; Laible, P D; Gu, M; Scott, H N; Collart, F R


    High-throughput approaches for gene cloning and expression require the development of new nonstandard tools for molecular biologists and biochemists. We introduce a Web-based tool to design primers specifically for the generation of expression clones for both laboratory-scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for the simultaneous amplification of multiple target genes.

  9. Microsatellite primers in the lichen symbiotic alga Trebouxia decolorans (Trebouxiophyceae)1

    PubMed Central

    Dal Grande, Francesco; Beck, Andreas; Singh, Garima; Schmitt, Imke


    • Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. • Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. • Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont. PMID:25202529

  10. Binary electrokinetic separation of target DNA from background DNA primers.

    SciTech Connect

    James, Conrad D.; Derzon, Mark Steven


    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  11. Pharmacological Chaperoning: A Primer on Mechanism and Pharmacology

    PubMed Central

    Ryder, Katelyn G.


    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs is considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  12. A primer on trace metal-sediment chemistry

    USGS Publications Warehouse

    Horowitz, Arthur J.


    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  13. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    NASA Astrophysics Data System (ADS)

    Blackman, Eric G.


    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  14. A primer on incentive regulation for electric utilities

    SciTech Connect

    Hill, L.J.


    In contemplating a regulatory approach, the challenge for regulators is to develop a model that provides incentives for utilities to engage in socially desirable behavior. In this primer, we provide guidance on this process by discussing (1) various models of economic regulation, (2) problems implementing these models, and (3) the types of incentives that various models of regulation provide electric utilities. We address five regulatory models in depth. They include cost-of-service regulation in which prudently incurred costs are reflected dollar-for-dollar in rates and four performance-based models: (1) price-cap regulation, in which ceilings are placed on the average price that a utility can charge its customers; (2) revenue-cap regulation, in which a ceiling is placed on revenues; (3) rate-of-return bandwidth regulation, in which a utility`s rates are adjusted if earnings fall outside a {open_quotes}band{close_quotes} around equity returns; and (4) targeted incentives, in which a utility is given incentives to improve specific components of its operations. The primary difference between cost-of-service and performance-based approaches is the latter sever the tie between costs and prices. A sixth, {open_quotes}mixed approach{close_quotes} combines two or more of the five basic ones. In the recent past, a common mixed approach has been to combine targeted incentives with cost-of-service regulation. A common example is utilities that are subject to cost-of-service regulation are given added incentives to increase the efficiency of troubled electric-generating units.

  15. Microsatellite primers in the foundation tree species Pinus edulis and P. monophylla (Pinaceae)1

    PubMed Central

    Krohn, Andrew L.; Flores-Rentería, Lluvia; Gehring, Catherine A.


    • Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. • Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. • Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species. PMID:25202571

  16. A Telecommunications Primer for College Presidents. Part I. The Technologies Defined. Educational Technology Profile 25.

    ERIC Educational Resources Information Center

    Smith, Ralph Lee


    Intended for use by presidents, planners, and administrators to acquaint them with developments in electronic communications, this primer describes cable television, common carrier, videotape recorders and videodiscs, satellites, microwave, circuit integration, digital transmission, data packet switching, and fiber optics. (LBH)

  17. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.


    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J


    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.


    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  19. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola


    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  20. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.


    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola


    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  1. Design of primer pairs for species-specific diagnosis of Leishmania (Leishmania) infantum chagasi using PCR.


    da Silveira Neto, Osvaldo José; Duarte, Sabrina Castilho; da Costa, Hérika Xavier; Linhares, Guido Fontgalland Coelho


    The objective of this study was to design and evaluate new primers for species-specific detection of L. infantum chagasi using PCR. Two combinations of primer pairs were established with the aim of obtaining specific amplification products from the L. infantum chagasi 18S rRNA gene. The combinations of the primer pairs and the respective sizes of the PCR products, based on the U422465 GenBank reference sequence of L. infantum chagasi, were: LCS1/LCS3 (259 bp) and LCS2/LCS3 (820 bp). It was concluded that the new PCR assays optimized using the primer pairs LCS1/LCS3 and LCS2/LCS3 were effective for specific detection of L. infantum chagasi, with analytical sensitivity to detect 1 pg/µL of DNA.

  2. Abridged adapter primers increase the target scope of Hi-Plex.


    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J


    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  3. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    SciTech Connect

    Matamala, G.; Droguett, G. ); Smeltzer, W. . Inst. for Materials Research)


    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showed the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.


    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  5. A Telecommunications Primer for College Presidents. Part I. The Technologies Defined. Educational Technology Profile 25.

    ERIC Educational Resources Information Center

    Smith, Ralph Lee


    Intended for use by presidents, planners, and administrators to acquaint them with developments in electronic communications, this primer describes cable television, common carrier, videotape recorders and videodiscs, satellites, microwave, circuit integration, digital transmission, data packet switching, and fiber optics. (LBH)

  6. A new approach to primer selection in polymerase chain reaction experiments

    SciTech Connect

    Pearson, W.R.; Robins, G.; Wrege, D.E.; Zhang, Tongtong


    We address the problem of primer selection in polymerase chain reaction (PCR) experiments. We prove that the problem of minimizing the number of primers required to amplify a set of DNA sequences is NP-complete, and show that even approximating solutions to this problem to within a constant factor times optimal is intractable. On the practical side, we give a simple branch-and-bound algorithm that solves the primers minimization problem within reasonable time for typical instances. We present an efficient approximation scheme for this problem, and prove that our heuristic always produces solutions no worse than a logarithmic factor times the optimal, this being the best approximation possible within polynomial time. Finally, we analyze a weighted variant, where both the number of primers as well as the sum of their {open_quotes}costs{close_quotes} is optimized simultaneously. We conclude by presenting the empirical performance of our methods on biological data.

  7. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.


    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi


    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  8. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji


    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  9. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž


    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  10. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    PubMed Central

    Lee, Ji-Yeon; Kim, Jin-Seok


    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm2. The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). Results The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Conclusions Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses. PMID:26258062

  11. Prim-SNPing: a primer designer for cost-effective SNP genotyping.


    Chang, Hsueh-Wei; Chuang, Li-Yeh; Cheng, Yu-Huei; Hung, Yu-Chen; Wen, Cheng-Hao; Gu, De-Leung; Yang, Cheng-Hong


    Many kinds of primer design (PD) software tools have been developed, but most of them lack a single nucleotide polymorphism (SNP) genotyping service. Here, we introduce the web-based freeware "Prim-SNPing," which, in addition to general PD, provides three kinds of primer design functions for cost-effective SNP genotyping: natural PD, mutagenic PD, and confronting two-pair primers (CTPP) PD. The natural PD and mutagenic PD provide primers and restriction enzyme mining for polymerase chain reaction-restriction fragment of length polymorphism (PCR-RFLP), while CTPP PD provides primers for restriction enzyme-free SNP genotyping. The PCR specificity and efficiency of the designed primers are improved by BLAST searching and evaluating secondary structure (such as GC clamps, dimers, and hairpins), respectively. The length pattern of PCR-RFLP using natural PD is user-adjustable, and the restriction sites of the RFLP enzymes provided by Prim-SNPing are confirmed to be absent within the generated PCR product. In CTPP PD, the need for a separate digestion step in RFLP is eliminated, thus making it faster and cheaper. The output of Prim-SNPing includes the primer list, melting temperature (Tm) value, GC percentage, and amplicon size with enzyme digestion information. The reference SNP (refSNP, or rs) clusters from the Single Nucleotide Polymorphism database (dbSNP) at the National Center for Biotechnology Information (NCBI), and multiple other formats of human, mouse, and rat SNP sequences are acceptable input. In summary, Prim-SNPing provides interactive, user-friendly and cost-effective primer design for SNP genotyping. It is freely available at

  12. The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.


    Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore


    To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.


    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R


    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  14. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool.


    Zou, Bin; Li, JieFu; Zhou, Quan; Quan, Zhe-Xue


    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples.

  15. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    PubMed Central

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam


    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconia with sandblasting, etching, and porcelain primer (GP); and glazed zirconia with sandblasting, etching, zirconia primer, and porcelain primer (GZP). A stainless steel metal bracket was bonded to each target surface with resin cement, and all specimens underwent thermal cycling. The shear bond strength of the specimens was measured by a universal testing machine. A scanning electron microscope, three-dimensional optical surface-profiler, and stereoscopic microscope were used to image the zirconia surfaces. The data were analyzed with one-way analyses of variance and the Fisher exact test. Results Group GZ showed significantly lower shear bond strength than did the other groups. No statistically significant differences were found among groups NZ, GP, and GZP. All specimens in group GZ showed adhesive failure between the zirconia and resin cement. In groups NZ and GP, bonding failed at the interface between the resin cement and bracket base or showed complex adhesive and cohesive failure. Conclusions Porcelain primer is the more appropriate choice for bonding a metal bracket to the surface of a full-contour glazed zirconia crown with resin cement. PMID:26629476

  16. Investigation of Metastable Interstitial Composite (MIC) Materials for Electrically Initiated Lead Free Primers

    DTIC Science & Technology


    metals such as lead ( Pb ). The U. S. Army accepted this challenge for small caliber ammunition several years ago and established the ‘Green Ammunition...Program. One of the elements of this effort was to eliminate the use of lead ( Pb ) in percussion primers for small caliber gun ammunition. The U...proposed to engage parallel problems associated with the use of lead ( Pb ) in electric primers for medium caliber gun ammunition. The various MIC

  17. Comparison of different PCR primers on detecting arbuscular mycorrhizal communities inside plant roots.


    Jiang, Shengjing; Shi, Guoxi; Mao, Lin; Pan, Jianbin; An, Lizhe; Liu, Yongjun; Feng, Huyuan


    Communities of arbuscular mycorrhizal fungi (AMF) colonizing roots have been increasingly investigated by molecular approaches with AMF-specific PCR primers. However, it is difficult to compare the species diversity and species compositions of AMF communities across various studies due to the PCR primers used differently, and also little is known if significant difference of community compositions is characterized by different primers. We aim to compare the difference of efficiency of four primers for AMF. We chose four commonly used AMF-specific primer combinations (NS31-AM1, AMLl-AML2, NS31-AML2 and SSUmCf-LSUmBr), and used 18S rDNA clone libraries to describe the AMF diversity and community. Our results showed that the specificity and coverage varied among the tested primers, different primer combinations would yield distinct patterns of species diversity and composition of AMF community. SSUmCf-LSUmBr had the best specificity and coverage in amplifying AMF sequences, followed by NS31-AML2 and NS31-AM1, and AML1-AML2 showed the lowest specificity towards AMF sequences. SSUmCf-LSUmBr is not the optimal primer pair for AMF community study in current stage due to limited reference sequences and large DNA size. As an alternative, NS31-AML2 is more suitable in AMF community study, because its target rDNA region could well match the increasingly used virtual taxonomy database (http://maarjam. and also its suitable DNA size could be efficiently used in high-throughput sequencing.

  18. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    PubMed Central

    Zhou, Quan


    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  19. Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.


    Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan


    The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.

  20. Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation

    NASA Technical Reports Server (NTRS)

    Hockridge, R. R.; Thibault, H. G.


    The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.

  1. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners

    PubMed Central

    Feemster, Agnes Ann


    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail’s ability to meet language standards, enhance the writer’s image, and successfully transmit information. PMID:26715801

  2. Simple and efficient oligonucleotide-directed mutagenesis using one primer and circular plasmid DNA template.


    Marotti, K R; Tomich, C S


    A rapid and simple procedure for site-directed mutagenesis is described. This method uses only a single oligonucleotide primer with the double-stranded circular plasmid DNA as the template for mutagenesis. The phage T4 gene 32 product is included during primer extension in vitro to increase efficiency. Single and multiple changes as well as deletions have been obtained at an efficiency of 1-2%.

  3. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    PubMed Central

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra


    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (P<.05). However, in Ti alloy, there was no significant difference between Alloy Primer and MAC-Bond II. Tarnished Co-Cr and Au-Ag-Pd alloy surfaces presented significantly decreased shear bond strength. CONCLUSION Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  4. New primers for the class Actinobacteria: application to marine and terrestrial environments.


    Stach, James E M; Maldonado, Luis A; Ward, Alan C; Goodfellow, Michael; Bull, Alan T


    In this study, we redesigned and evaluated primers for the class Actinobacteria. In silico testing showed that the primers had a perfect match with 82% of genera in the class Actinobacteria, representing a 26-213% improvement over previously reported primers. Only 4% of genera that displayed mismatches did so in the terminal three bases of the 3' end, which is most critical for polymerase chain reaction success. The primers, designated S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19, amplified an approximately 640 bp stretch of the 16S rRNA gene from all actinobacteria tested (except Rubrobacter radiotolerans) up to an annealing temperature of 72 degrees C. An Actinobacteria Amplification Resource ( was generated to provide a visual guide to aid the amplification of actinobacterial 16S rDNA. Application of the primers to DNA extracted from marine and terrestrial samples revealed the presence of actinobacteria that have not been described previously. The use of 16S rDNA similarity and DNA-DNA pairing correlations showed that almost every actinomycete clone represented either a new species or a novel genus. The results of this study reinforce the proposition that current culture-based techniques drastically underestimate the diversity of Actinobacteria in the environment and highlight the need to evaluate taxon-specific primers regularly in line with improvements in databases holding 16S rDNA sequences.

  5. Morphological categorization of acid-base resistant zones with self-etching primer adhesive systems.


    Inoue, Go; Nikaido, Toru; Sadr, Alireza; Tagami, Junji


    This study investigated the influence of the composition of self-etching primer adhesive systems on the morphology of acid-base resistant zones (ABRZs). One-step self-etching primer systems (Clearfil Tri-S Bond, G-Bond, and One-Up Bond F Plus) and two-step self-etching primer systems (Clearfil SE Bond, Clearfil Protect Bond, UniFil Bond, and Mac Bond II) were used in this study. Each adhesive was applied on prepared dentin disk surfaces, and a resin composite was placed between two dentin disks. All resin-bonded specimens were subjected to acid-base challenge. Observation under a scanning electron microscope (SEM) revealed the creation of an ABRZ adjacent to the hybrid layer for all the self-etch primer adhesive systems, even when non-fluoride releasing adhesives were used. The presence of fluoride in two-step self-etching adhesive significantly increased the thickness of ABRZ created. Results suggested that an ABRZ was created with the use of self-etching primer adhesive systems, but its morphology differed between one-and two-step self-etching primer adhesive systems and was influenced by fluoride release activity.

  6. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  7. Primer and platform effects on 16S rRNA tag sequencing


    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  8. Enamel shear bond strength of different primers combined with an orthodontic adhesive paste.


    Seeliger, Julia H; Botzenhart, Ute U; Gedrange, Tomasz; Kozak, Karol; Stepien, Lukas; Machoy, Monika


    The aim of this study was a comparison of shear bond strength (SBS) on tooth enamel of different primers combined with the adhesive paste Transbond XT. Forty bovine teeth were used in order to create 40 test blocks. The blocks were divided into four groups of 10 blocks each: group A - sample primer (SP); group B - Opal Seal (OS); group C - Transbond Plus SEP (TSEP); group D - Transbond XT Primer (TXT). After surface preparation and application of the primer, respectively, two stainless steel brackets were fixed on each tooth by using Transbond XT. Accordingly, 80 brackets were debonded (n=20). Shear bond strength and adhesive remnant index (ARI) scores were evaluated. Statistical analyses were performed by using the Student's t-test and Mann-Whitney U test. All tested groups revealed high shear bond strength in a similar size range. There were no significant differences between the groups concerning shear bond strength. The ARI scores of group C showed significantly lower ARI scores (0 and 1) than that of group D. Apart from that there was no statistical difference. In combination with the adhesive paste Transbond XT, all tested primers were suitable for fixing orthodontic brackets. The primers could be changed according to the clinical situation.

  9. UniPrime2: a web service providing easier Universal Primer design.


    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C


    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  10. Single-primer PCR correction: a strategy for false-positive exclusion.


    Ma, J; Wang, P W; Yao, D; Wang, Y P; Yan, W; Guan, S C


    Polymerase chain reaction (PCR) technology plays an important role in molecular biology research, but false-positive and nonspecific PCR amplification have plagued many researchers. Currently, research on the optimization of the PCR system focuses on double-primer-based PCR products. This research has shown that PCR amplification based on single-primer binding to the DNA template is an important contributing factor to obtaining false-positive results, fragment impurity, and nonspecific fragment amplification, when the PCR conditions are highly restricted during PCR-based target gene cloning, detection of transgenic plants, simple-sequence repeat marker-assisted selection, and mRNA differential display. Here, we compared single- and double-primer amplification and proposed "single-primer PCR correction"; improvements in PCR that eliminate interference caused by single-primer-based nonspecific PCR amplification were demonstrated and the precision and success rates of experiments were increased. Although for some kinds of experiments, the improvement effect of single-primer PCR correction was variable, the precision and success rate could be elevated at 12-50% in our experiment by this way.

  11. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers.


    Gryndler, Milan; Hršelová, Hana; Soukupová, Lucie; Streiblová, Eva; Valda, Slavomír; Borovička, Jan; Gryndlerová, Hana; Gažo, Ján; Miko, Marián


    Tuber aestivum is becoming an important commodity of great economical value in some European countries. At the same time, it is a highly protected organism in other countries, where it needs careful treatment. A reliable method of detection in roots and soil is thus needed for assessment of geographic distribution, ecological studies and inoculation efficiency testing in man-made experiments. A PCR-based method of detection of T. aestivum using specific primers was therefore developed. A pair of PCR primers Tu1sekvF/Tu2sekvR selective for T. aestivum and some genotypes of Tuber mesentericum was designed on the basis of the known internal transcribed spacer T. aestivum sequences. TaiI restriction cleavage was then used to distinguish the two species. The selectivity of the designed primer pair was evaluated using DNA extracted from specimens of a further 13 Tuber spp. Subsequently, the selectivity and robustness to false-positive results with nontarget DNA of the designed primers was compared with two other primer pairs (UncI/UncII and BTAE-F/BTAEMB-R). The occurrence of T. aestivum in soil and ectomycorrhizae collected in its native habitat has been successfully detected using the designed primers and nested PCR. The method is reliable and thus suitable for detection of T. aestivum in the field.

  12. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.


    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong


    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  13. A Primer on Population Health Management and Its Perioperative Application.


    Boudreaux, Arthur M; Vetter, Thomas R


    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  14. Universal primers for fluorescent labelling of PCR fragments--an efficient and cost-effective approach to genotyping by fluorescence.


    Blacket, M J; Robin, C; Good, R T; Lee, S F; Miller, A D


    Directly labelling locus-specific primers for microsatellite analysis is expensive and a common limitation to small-budget molecular ecology projects. More cost-effective end-labelling of PCR products can be achieved through a three primer PCR approach, involving a fluorescently labelled universal primer in combination with modified locus-specific primers with 5' universal primer sequence tails. This technique has been widely used but has been limited largely due to a lack of available universal primers suitable for co-amplifying large numbers of size overlapping loci and without requiring locus-specific PCR conditions to be modified. In this study, we report a suite of four high-performance universal primers that can be employed in a three primer PCR approach for efficient and cost-effective fluorescent end-labelling of PCR fragments. Amplification efficiency is maximized owing to high universal primer Tm values (approximately 60+ °C) that enhance primer versatility and enable higher annealing temperatures to be employed compared with commonly used universal primers such as M13. We demonstrate that these universal primers can be combined with multiple fluorophores to co-amplify multiple loci efficiently via multiplex PCR. This method provides a level of multiplexing and PCR efficiency similar to microsatellite fluorescent detection assays using directly labelled primers while dramatically reducing project costs. Primer performance is tested using several alternative PCR strategies that involve both single and multiple fluorophores in single and multiplex PCR across a wide range of taxa. © 2012 Blackwell Publishing Ltd.

  15. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    USDA-ARS?s Scientific Manuscript database

    The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the id...

  16. Circulating primers enhance platelet function and induce resistance to antiplatelet therapy

    PubMed Central

    Blair, T A; Moore, S F; Hers, I


    Background Aspirin and P2Y12 antagonists are antiplatelet compounds that are used clinically in patients with thrombosis. However, some patients are ‘resistant’ to antiplatelet therapy, which increases their risk of developing acute coronary syndromes. These patients often present with an underlying condition that is associated with altered levels of circulating platelet primers and platelet hyperactivity. Platelet primers cannot stimulate platelet activation, but, in combination with physiologic stimuli, significantly enhance platelet function. Objectives To explore the role of platelet primers in resistance to antiplatelet therapy, and to evaluate whether phosphoinositide 3-kinase (PI3K) contributes to this process. Methods and Results We used platelet aggregation, thromboxane A2 production and ex vivo thrombus formation as functional readouts of platelet activity. Platelets were treated with the potent P2Y12 inhibitor AR-C66096, aspirin, or a combination of both, in the presence or absence of the platelet primers insulin-like growth factor-1 (IGF-1) and thrombopoietin (TPO), or the Gz-coupled receptor ligand epinephrine. We found that platelet primers largely overcame the inhibitory effects of antiplatelet compounds on platelet functional responses. IGF-1-mediated and TPO-mediated, but not epinephrine-mediated, enhancements in the presence of antiplatelet drugs were blocked by the PI3K inhibitors wortmannin and LY294002. Conclusions These results demonstrate that platelet primers can contribute to antiplatelet resistance. Furthermore, our data demonstrate that there are PI3K-dependent and PI3K-independent mechanisms driving primer-mediated resistance to antiplatelet therapy. PMID:26039631

  17. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  18. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    PubMed Central

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.


    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  19. A randomised trial comparing the antibacterial effects of dentine primers against bacteria in natural root caries.


    Rolland, S L; McCabe, J F; Imazato, S; Walls, A W G


    As people are living longer and retaining their teeth into old age, root caries is an increasingly significant problem. A minimally invasive treatment strategy, involving sealing the root caries lesion with an antibacterial resin sealant, could be highly beneficial. The aim of this study was to compare the antibacterial properties of the primers of two proprietary dentine bonding agents, Clearfil SE Bond (SE; Kuraray Medical, Japan) and Clearfil Protect Bond (PB; Kuraray Medical), which contains the antibacterial monomer methacryloyloxydodecylpyridinium bromide. Fifty-two root caries lesions were identified and randomly assigned to a primer. The lesion was cleaned, isolated, sampled with a sharp spoon excavator, a primer applied and a second sample taken. Samples were transported in fastidious anaerobe broth, vortex-dispersed and serial dilutions inoculated onto selective agars. Reduction in colony-forming units (CFU, %) after primer application was calculated for both primers for bacterial growth on each selective agar and compared to a hypothesised mean of 100% (one-sample t test, p < 0.05). No significant differences between primers were seen, indicating efficient bacterial elimination by both materials. Comparing percent reduction between SE and PB for each agar (Mann-Whitney test, p < 0.05), a significantly greater CFU reduction by PB was seen for streptococci but not other bacteria. More lesions exhibited bacterial growth and several lesions demonstrated marked bacterial growth after treatment with SE compared with PB. Therefore, PB appears to exhibit superior antimicrobial properties, particularly against streptococci. Both primers are highly antibacterial towards root caries bacteria and may therefore be suitable for minimally invasive treatment.

  20. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.


    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong


    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes.