Sample records for primer caso humano

  1. REFORZANDO LAS CAPACIDADES EN INVESTIGACIÓN EN INFORMÁTICA PARA LA SALUD GLOBAL EN LA REGIÓN ANDINA A TRAVÉS DE LA COLABORACIÓN INTERNACIONAL

    PubMed Central

    Curioso, Walter H.; García, Patricia J.; Castillo, Greta M.; Blas, Magaly M.; Perez-Brumer, Amaya; Zimic, Mirko

    2011-01-01

    RESUMEN Para mejorar la salud global y bienestar de una población se requiere de recursos humanos capacitados, no solo en el campo de la medicina y salud, sino también en el campo de la informática. Desafortunadamente, los programas de entrenamiento e investigación en informática biomédica en países en desarrollo son escasos y poco documentados. El objetivo del presente trabajo es reportar los resultados del primer Taller Internacional de Expertos en Informática para la región andina que se llevó a cabo en marzo de 2010 en Lima y que incluye la descripción de nueve casos de estudio procedentes de instituciones de América Latina. En el taller participaron 23 expertos latinoamericanos, quienes discutieron la necesidad de entrenamiento e investigación multidisciplinaria en informática biomédica en áreas prioritarias para América Latina. Además, se estableció la Red QUIPU debido a la necesidad de ampliar y consolidar una red de investigación y entrenamiento a nivel regional y global. PMID:21152740

  2. Visceral leishmaniasis in the state of Sao Paulo, Brazil: spatial and space-time analysis.

    PubMed

    Cardim, Marisa Furtado Mozini; Guirado, Marluci Monteiro; Dibo, Margareth Regina; Chiaravalloti, Francisco

    2016-08-11

    To perform both space and space-time evaluations of visceral leishmaniasis in humans in the state of Sao Paulo, Brazil. The population considered in the study comprised autochthonous cases of visceral leishmaniasis and deaths resulting from it in Sao Paulo, between 1999 and 2013. The analysis considered the western region of the state as its studied area. Thematic maps were created to show visceral leishmaniasis dissemination in humans in the municipality. Spatial analysis tools Kernel and Kernel ratio were used to respectively obtain the distribution of cases and deaths and the distribution of incidence and mortality. Scan statistics were used in order to identify spatial and space-time clusters of cases and deaths. The visceral leishmaniasis cases in humans, during the studied period, were observed to occur in the western portion of Sao Paulo, and their territorial extension mainly followed the eastbound course of the Marechal Rondon highway. The incidences were characterized as two sequences of concentric ellipses of decreasing intensities. The first and more intense one was found to have its epicenter in the municipality of Castilho (where the Marechal Rondon highway crosses the border of the state of Mato Grosso do Sul) and the second one in Bauru. Mortality was found to have a similar behavior to incidence. The spatial and space-time clusters of cases were observed to coincide with the two areas of highest incidence. Both the space-time clusters identified, even without coinciding in time, were started three years after the human cases were detected and had the same duration, that is, six years. The expansion of visceral leishmaniasis in Sao Paulo has been taking place in an eastbound direction, focusing on the role of highways, especially Marechal Rondon, in this process. The space-time analysis detected the disease occurred in cycles, in different spaces and time periods. These meetings, if considered, may contribute to the adoption of actions that aim to prevent the disease from spreading throughout the whole territory of São Paulo or to at least reducing its expansion speed. Avaliar, no espaço e espaço-tempo, a ocorrência da leishmaniose visceral em humanos no estado de São Paulo, Brasil. Considerou-se como população de estudo os casos autóctones e óbitos por leishmaniose visceral em humanos ocorridos em São Paulo entre 1999 e 2013 e, como área de estudo, a região oeste do estado. Construíram-se mapas temáticos que mostraram a disseminação da leishmaniose visceral em humanos nos municípios. Ferramentas de análise espacial Kernel e razão Kernel foram utilizadas para obter, respectivamente, a distribuição dos casos e óbitos e a distribuição da incidência e mortalidade. Utilizaram-se estatísticas de varredura para identificar aglomerados espaciais e espaço-temporais de casos e óbitos. Os casos de leishmaniose visceral em humanos, no período de estudo, ocorreram na parte ocidental de São Paulo e sua expansão territorial seguiu principalmente o curso da rodovia Marechal Rondon, no sentido oeste-leste. As incidências foram caracterizadas como duas sequências de elipses concêntricas com intensidade decrescente. A primeira, com maior intensidade, teve epicentro no município de Castilho (cruzamento da rodovia Marechal Rondon com a divisa com o estado de Mato Grosso do Sul) e a segunda, em Bauru. A mortalidade apresentou comportamento similar ao da incidência. Os aglomerados espaciais e espaço-temporais de casos coincidiram com as duas áreas de maiores incidências. Ambos os aglomerados espaço-temporais identificados, mesmo sem coincidirem temporalmente, tiveram início após três anos da detecção dos casos humanos e tiveram a mesma duração, seis anos. A expansão da leishmaniose visceral em São Paulo vem ocorrendo no sentido oeste-leste, com destaque ao papel das rodovias, especialmente a Marechal Rondon, neste processo. A análise espaço-temporal detectou, em diferentes espaços e períodos de tempo, ciclicidade na ocorrência da doença. Esses encontros, se considerados, podem colaborar para a adoção de ações que visem a evitar que a doença se espalhe por todo o território paulista ou, no mínimo, diminuir sua velocidade de expansão.

  3. Cosmoeducação: uma proposta para o ensino de astronomia

    NASA Astrophysics Data System (ADS)

    Medeiros, L. A. L.; Jafelice, L. C.

    2003-08-01

    Entende-se por cosmoeducação o desenvolvimento vivencial da unidade homem-cosmo. Este conceito é norteado pela psicologia transpessoal, que estuda o ser humano em sua totalidade, onde suas relações ecológicas e cósmicas são de grande importância. Constata-se uma necessidade latente no ser humano moderno em resgatar uma relação holística com o Universo. Neste trabalho exploramos meios de cultivar a consciência de que o ser humano constitui parte integrante do cosmo e se relaciona com este com o objetivo de promover em si uma percepção ambiental mais ampla. Nossa hipótese de trabalho inicial foi que o ensino de conteúdos básicos em astronomia realizado através de uma abordagem holística, que incorpore práticas vivenciais correlacionadas àqueles conteúdos, pode despertar no indivíduo sua identidade cósmica. O método que utilizamos é o fenomenológico e o universo desta pesquisa é um grupo de estudantes da disciplina de Astronomia (Curso de Licenciatura em Geografia/UFRN), onde realizamos observação participante, entrevistas, depoimentos e as práticas vivenciais mencionadas. Neste caso estamos desenvolvendo e adaptando exercícios de algumas técnicas terapêuticas de psicologia transpessoal, que um de nós (LALM) tem aplicado no contexto clínico, para trabalhar aspectos cognitivos envolvidos naquele processo de conscientização cósmica. Resultados parciais claramente referendam a hipótese inicial. Um resultado a destacar é fruto de uma dinâmica de representação corporal interiorizada do eclipse lunar, envolvendo um pequeno grupo daqueles estudantes, na qual conteúdos míticos afloraram de maneira espontânea e contundente para todos, sugerindo ressonância, ou pelo menos isomorfismo, entre o macro e o microcosmo. Este e outros resultados são discutidos em detalhe neste trabalho. (PPGECNM/UFRN; PRONEX/FINEP; NUPA/USP; Temáticos/FAPESP).

  4. [Health, environment and sustainable development in Mexico].

    PubMed

    1998-09-01

    This article is based on "Salud, ambiente y desarrollo humano sostenible: el caso de México," a document prepared in June 1997 by the Comité Técnico Nacional para el Desarrollo Sostenible. It opens with information regarding the epidemiologic and demographic changes that have taken place in Mexico, such as the decrease in communicable diseases, the rise in noncommunicable diseases, and the less conspicuous increase in lesions resulting from accidents or acts of violence. This is followed by a discussion of priority problems and problems of lesser magnitude in environmental health, specifically those relating to water and air quality, as well as disposal of household and dangerous wastes. Finally, it proposes three areas of intervention in light of the structural problems detected: the absence of an integrated information system covering the area of health, environment, and development; the absence of channels of communication within and between institutions and sectors, and the lack of coordination in planning and implementing programs and actions in this field.

  5. Descompresión microvascular en neuralgia del trigémino: Reporte de 36 casos y revisión de la literatura

    PubMed Central

    Campero, Alvaro; Ajler, Pablo; Campero, Abraham Agustín

    2014-01-01

    Objetivo: El propósito del presente trabajo es presentar los resultados de 36 pacientes con diagnóstico de neuralgia del trigémino (NT), en los cuales se realizó una descompresión microvascular (DMV). Material y Método: Desde junio de 2005 a mayo de 2012, 36 pacientes con diagnóstico de NT fueron operados por el primer autor (AC), realizando una DMV. Se evaluó: Edad, sexo, tiempo de sintomatología previo a la cirugía, hallazgos intraoperatorios (a través de los videos quirúrgicos), y resultados postoperatorios. Resultados: De los 36 pacientes operados, 25 fueron mujeres y 11 varones. El promedio de edad fue de 48 años. El seguimiento postoperatorio fue en promedio de 38 meses. De los 36 pacientes, 32 (88%) evolucionaron sin dolor hasta la fecha. De los 4 casos con recurrencia de dolor, en dos pacientes se observó como hallazgo intraoperatorio un conflicto venoso. Conclusión: La DMV como tratamiento de la NT es un procedimiento efectivo y seguro. El hallazgo intraoperatorio de una “compresión” venosa podría indicar una evolución postoperatoria desfavorable. PMID:25379343

  6. Accounting for the Impact of Conservation on Human Well-Being

    PubMed Central

    Milner-Gulland, EJ; Mcgregor, JA; Agarwala, M; Atkinson, G; Bevan, P; Clements, T; Daw, T; Homewood, K; Kumpel, N; Lewis, J; Mourato, S; Palmer Fry, B; Redshaw, M; Rowcliffe, JM; Suon, S; Wallace, G; Washington, H; Wilkie, D

    2014-01-01

    Conservationists are increasingly engaging with the concept of human well-being to improve the design and evaluation of their interventions. Since the convening of the influential Sarkozy Commission in 2009, development researchers have been refining conceptualizations and frameworks to understand and measure human well-being and are starting to converge on a common understanding of how best to do this. In conservation, the term human well-being is in widespread use, but there is a need for guidance on operationalizing it to measure the impacts of conservation interventions on people. We present a framework for understanding human well-being, which could be particularly useful in conservation. The framework includes 3 conditions; meeting needs, pursuing goals, and experiencing a satisfactory quality of life. We outline some of the complexities involved in evaluating the well-being effects of conservation interventions, with the understanding that well-being varies between people and over time and with the priorities of the evaluator. Key challenges for research into the well-being impacts of conservation interventions include the need to build up a collection of case studies so as to draw out generalizable lessons; harness the potential of modern technology to support well-being research; and contextualize evaluations of conservation impacts on well-being spatially and temporally within the wider landscape of social change. Pathways through the smog of confusion around the term well-being exist, and existing frameworks such as the Well-being in Developing Countries approach can help conservationists negotiate the challenges of operationalizing the concept. Conservationists have the opportunity to benefit from the recent flurry of research in the development field so as to carry out more nuanced and locally relevant evaluations of the effects of their interventions on human well-being. Consideración del Impacto de la Conservación sobre el Bienestar Humano Resumen Los conservacionistas cada vez más se comprometen con el concepto del bienestar humano para mejorar el diseño y la evaluación de sus intervenciones. Desde la convención de la influyente Comisión Sarkozy en 2009, los investigadores del desarrollo han estado refinando las conceptualizaciones y los marcos de trabajo para entender y medir el bienestar humano y están comenzando a convergir con un entendimiento común de cuál es la mejor forma de hacer esto. En la conservación el término bienestar humano tiene un uso amplio, pero existe la necesidad de la orientación en su operación para medir los impactos de las intervenciones de la conservación sobre la gente. Presentamos un marco de trabajo para entender el bienestar humano que podría ser útil particularmente en la conservación. El marco de trabajo incluye tres condiciones: cumplir con las necesidades, perseguir objetivos y experimentar una calidad satisfactoria de vida. Resumimos algunas de las complejidades involucradas en la evaluación de los efectos del bienestar de las intervenciones de la conservación con el entendimiento de que el bienestar varía entre la gente, en el tiempo y con las prioridades del evaluador. Los retos clave para la investigación de los impactos del bienestar de las intervenciones de la conservación incluyen la necesidad de crear una colección de estudios de caso para trazar lecciones generalizables: hacer uso del potencial de la tecnología moderna para apoyar la investigación del bienestar; y contextualizar espacial y temporalmente las evaluaciones de los impactos de la conservación sobre el bienestar dentro del marco más amplio del cambio social. Existen caminos que atraviesan la confusión que rodea al término bienestar, y los marcos de trabajo existentes, como el del acercamiento de Bienestar en Países en Desarrollo, pueden ayudar a los conservacionistas a negociar los obstáculos de la operación del concepto. Los conservacionistas tienen la oportunidad de beneficiarse del frenesí reciente de investigación en el campo del desarrollo para así realizar evaluaciones más matizadas y relevantes localmente de los efectos de sus intervenciones sobre el bienestar humano. PMID:24641551

  7. The Zapatista Social Netwar in Mexico

    DTIC Science & Technology

    1998-01-01

    on the Internet. 4From a statement by Subcommandante Marcos, March 4, 1994, as reported by the Academia Mexicana de Derechos Humanos , Special...Indigenas de Mexico, Mexico City: Comisiön Nacional de Derechos Humanos , 1995. Evan, William M., "An Organization-Set Model of Interorganizational...City: Comision Nacional de Dere- chos Humanos , 1995. Meisel, James, The Fall of the Republic: Military Revolt in France, Ann Arbor: University of

  8. Papiloma invertido sinunasal con invasión intracraneal: Reporte de caso y revisión bibliográfica

    PubMed Central

    Di Pietrantonio, Andrés; Asmus, Humberto; Ingratta, Christian; Brennan, Walter; Schulz, Javier; Carballo, Leandro

    2018-01-01

    Resumen IntroducciÓn: El papiloma invertido es una neoplasia benigna de los senos paranasales localmente agresiva con alto potencial de recurrencia y de malignización. La extensión intracraneal es infrecuente y más aún, la penetración dural, asociándose a menudo a la recurrencia de la enfermedad o a su degeneración en carcinoma de células escamosas. Caso clínico: Presentamos el caso de una paciente de 32 años que consultó por lesión exofítica en fosa nasal derecha y exoftalmos, asociada a cefalea, anosmia y disgeusia. Se estudió con TC cerebro, macizo facial y RM de encéfalo que evidencian lesión en fosa nasal derecha con ocupación de senos aéreos, osteólisis de pared medial orbitaria y base de cráneo anterior e invasión intracraneal frontal derecha, con efecto de masa y compresión del parénquima encefálico adyacente. Intervención: Se realizó una nasofibroscopía en primer tiempo con diagnóstico anatomopatológico de papiloma invertido y posteriormente resección de la lesión mediante doble abordaje más reconstrucción de la fosa craneal anterior. Se obtuvo diagnóstico definitivo de papiloma invertido de tipo Schneideriano con áreas de transformación atípica in situ. La paciente evolucionó de forma favorable y sin complicaciones, con permeabilidad de vía aérea superior, sin signos de recidiva lesional luego de 4 años de seguimiento. Conclusión: La invasión intracraneal de esta patología es sumamente infrecuente. Cuando existe, es indicador de agresividad y potencial recidiva, por lo que la exéresis completa de la misma define el pronóstico de la enfermedad. PMID:29430328

  9. Honduran-U.S. Relations

    DTIC Science & Technology

    2009-08-04

    Miami Herald, July 16, 2009; “Informe Preliminar: Violaciones a Derechos Humanos en el Marco del Golpe de Estado en Honduras,” Comité de Familiares de...Detenidos Desaparecidos en Honduras (CONFADEH), July 15, 2009; “Reporte de Violaciones a Derechos Humanos Después del Golpe de Estado Político-Militar...del 28 de Junio de 2009,” Centro de Investigacion y Promocion de los Derechos Humanos (CIPRODEH), July 17, 2009. 31 For more on the U.S. response

  10. Securing Tyrants or Fostering Reform? U.S. Internal Security Assistance to Repressive and Transitioning Regimes

    DTIC Science & Technology

    2006-01-01

    los Derechos Humanos , “Informe de Labores, Junio 1997–Mayo 1998,” San Salvador, 1998, pp. 230–238. Also see Call, “Democratisation, War and State...countries in the region: Costa Rica, Guatemala, Haiti, Mexico, and Panama. Based on 57 Procuraduría para la Defensa de los Derechos Humanos , pp. 230–238...www.state.gov/p/sa/rls/rm/26277.htm. Procuraduría para la Defensa de los Derechos Humanos , “Informe de Labores, Junio 1997–Mayo 1998,” San Salvador, 1998

  11. Bulimia nerviosa

    MedlinePlus

    ... Virus del papiloma humano (VPH) Infertilidad Síndrome de ovario poliquístico (SOP) Infecciones de transmisión sexual (ITS) Fibromas ... Virus del papiloma humano (VPH) Infertilidad Síndrome de ovario poliquístico (SOP) Infecciones de transmisión sexual (ITS) Fibromas ...

  12. The Guatemalan Military: Transition from War to Peace

    DTIC Science & Technology

    2001-06-01

    1992. Cerdas Cruz, Rodolfo. El Precio de Una Herencia. Fuerza Armadas, Democracia y Derechos Humanos en Centroamérica. San José: Instituto...Interamericano de Derechos Humanos , 1996. Cullather, Nick. Secret History, The CIA’s Classified Account of Its Operations in Guatemala, 1952-1954. Stanford

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moore, Thomas W.; Quach, Tu-Thach; Detry, Richard Joseph

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which we must understand to design a secure future for the nation and the world. Perturbations/disruptions in CASoS have the potential for far-reaching effects due to pervasive interdependencies and attendant vulnerabilities to cascades in associated systems. Phoenix was initiated to address this high-impact problem space as engineers. Our overarching goals are maximizing security, maximizing health, and minimizing risk. We design interventions, or problem solutions, that influence CASoS to achieve specific aspirations. Through application to real-world problems, Phoenix is evolving the principles and discipline ofmore » CASoS Engineering while growing a community of practice and the CASoS engineers to populate it. Both grounded in reality and working to extend our understanding and control of that reality, Phoenix is at the same time a solution within a CASoS and a CASoS itself.« less

  14. Complex Adaptive Systems of Systems (CASoS) engineering and foundations for global design.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brodsky, Nancy S.; Finley, Patrick D.; Beyeler, Walter Eugene

    2012-01-01

    Complex Adaptive Systems of Systems, or CASoS, are vastly complex ecological, sociological, economic and/or technical systems which must be recognized and reckoned with to design a secure future for the nation and the world. Design within CASoS requires the fostering of a new discipline, CASoS Engineering, and the building of capability to support it. Towards this primary objective, we created the Phoenix Pilot as a crucible from which systemization of the new discipline could emerge. Using a wide range of applications, Phoenix has begun building both theoretical foundations and capability for: the integration of Applications to continuously build common understandingmore » and capability; a Framework for defining problems, designing and testing solutions, and actualizing these solutions within the CASoS of interest; and an engineering Environment required for 'the doing' of CASoS Engineering. In a secondary objective, we applied CASoS Engineering principles to begin to build a foundation for design in context of Global CASoS« less

  15. Success in Mexico Requires a Military Solution

    DTIC Science & Technology

    2011-10-27

    Nacional de los Derechos Humanos México. Background – National Commission on Human Rights, 2011, http://www.cndh.org.mx/node/17 [page translated by...Nacional de los Derechos Humanos México. Background – National Commission on Human Rights, 2011, http://www.cndh.org.mx/node/17. [page translated by

  16. Intelligence Reform in Colombia: Transparency and Effectiveness against Internal Threats

    DTIC Science & Technology

    2007-05-01

    Humanos Y Derecho Internacional Humano 2004, page 228. Statistics for 2006 may be viewed at: http://www.derechoshumanos.gov.co/index.php?newsecc...used here are projections based on official government statistics through May of 2006. Statistics for 2003 are contained in Informe Annual de Derechos

  17. Thermally stimulated luminescence studies of undoped, Cu- and Mn-doped CaSO4 compounds

    NASA Astrophysics Data System (ADS)

    Manam, J.; Das, S.

    Thermally stimulated luminescence (TSL) of undoped and doped CaSO4 with activators such as Cu and Mn has been investigated. The polycrystalline samples of undoped and doped CaSO4 are prepared by the melting method. The formation of CaSO4 compound is confirmed by X-ray diffraction and Fourier transform infrared studies. Scanning electron microscopic studies of CaSO4 are also carried out. The TSL glow curves of undoped CaSO4, Cu- and Mn-doped CaSO4 are studied. Comparison of the thermoluminescence (TL) intensity of the most intensive glow peak of Cu-doped CaSO4 compound with that of undoped CaSO4 shows that addition of Cu impurity in CaSO4 compound enhances the TL intensity by about four times. However, the addition of Mn impurity to undoped CaSO4 increases the TL intensity by about three times when compared with that of undoped CaSO4. The TL-dose dependence of all three samples was studied and was observed to be almost linear in the studied range of irradiation time. Among the samples studied, namely undoped CaSO4 and Cu- and Mn-doped CaSO4, Cu-doped CaSO4 is found to be the most sensitive. The trap parameters, namely order of kinetics (b), activation energy (E) and frequency factor (s) associated with the most intensive glow peaks of CaSO4:Mn, CaSO4:Cu and CaSO4 phosphors were determined using the glow curve shape (Chen's) method.

  18. Disintegration in Peru - Consolidation in Chile: The Case for Militant Capitalism in Latin America

    DTIC Science & Technology

    1990-06-01

    organization Comision Chilena de Derechos Humanos (CCDH), (which along with the Church-sponsored Vicaria de la Solaridad are the principal watchdog...34 reported by Chile’s human rights group Comision de Desechos Humanos (CCDH), the majority reflect a particular 134 period in time during which DINA was the

  19. DESAFÍOS ÉTICOS DE LA INVESTIGACIÓN CON ANIMALES, MANIPULACIÓN GENÉTICA

    PubMed Central

    Yunta, Eduardo Rodríguez

    2012-01-01

    En la investigación con animales existen cuestionamientos éticos tanto en el uso como modelos de enfermedades humanas y requisito previo para ensayos en humanos como en la introducción de modificaciones genéticas. Algunos de estos cuestionamientos son: no representar exactamente la condición humana como modelos, realizar pruebas de toxicidad con grave daño para los animales, alterar su naturaleza mediante modificaciones genéticas, riesgos de la introducción de organismos genéticamente modificados. El uso de animales en investigación para beneficio humano, impone al ser humano la responsabilidad moral de respetarlo, no haciéndoles sufrir innecesariamente, al estar trabajando con seres vivientes y sentientes. PMID:23338641

  20. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

    PubMed Central

    2012-01-01

    Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

  1. Prevalence of HIV, STIs, and Risk Behaviors in a Cross-Sectional Community- and Clinic-Based Sample of Men Who Have Sex with Men (MSM) in Lima, Peru

    DTIC Science & Technology

    2013-04-25

    of Medicine at University of California at Los Angeles, Los Angeles, California, United States of America, 2Unidad de Salud Sexual y Derechos Humanos ...Sexualidad y Derechos Humanos ; and the staff of the Bacteriology and Virology Laboratories of the U.S. Naval Medical Center Research Laboratory, Lima

  2. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  3. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

    PubMed Central

    2009-01-01

    Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

  4. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    PubMed

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  5. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    PubMed Central

    2012-01-01

    Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

  6. PrimerZ: streamlined primer design for promoters, exons and human SNPs.

    PubMed

    Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

    2007-07-01

    PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

  7. The ternary system K2SO4MgSO4CaSO4

    USGS Publications Warehouse

    Rowe, J.J.; Morey, G.W.; Silber, C.C.

    1967-01-01

    Melting and subsolidus relations in the system K2SO4MgSO4CaSO4 were studied using heating-cooling curves, differential thermal analysis, optics, X-ray diffraction at room and high temperatures and by quenching techniques. Previous investigators were unable to study the binary MgSO4CaSO4 system and the adjacent area in the ternary system because of the decomposition of MgSO4 and CaSO4 at high temperatures. This problem was partly overcome by a novel sealed-tube quenching method, by hydrothermal synthesis, and by long-time heating in the solidus. As a result of this study, we found: (1) a new compound, CaSO4??3MgSO4 (m.p. 1201??C) with a field extending into the ternary system; (2) a high temperature form of MgSO4 with a sluggishly reversible inversion. An X-ray diffraction pattern for this polymorphic form is given; (3) the inversion of ??-CaSO4 (anhydrite) to ??-CaSO4 at 1195??C, in agreement with grahmann; (1) (4) the melting point of MgSO4 is 1136??C and that of CaSO4 is 1462??C (using sealed tube methods to prevent decomposition of the sulphates); (5) calcium langbeinite (K2SO4??2CaSO4) is the only compound in the K2SO4CaSO4 binary system. This resolved discrepancies in the results of previous investigators; (6) a continuous solid solution series between congruently melting K2SOP4??2MgSO4 (langbeinite) and incongruently melting K2SO4??2CaSO4 (calcium langbeinite); (7) the liquidus in the ternary system consists of primary phase fields of K2SO4, MgSO4, CaSO4, langbeinite-calcium langbeinite solid solution, and CaSO4??3MgSO4. The CaSO4 field extends over a large portion of the system. Previously reported fields for the compounds (K2SO4??MgSO4??nCaSO4), K2SO4??3CaSO4 and K2SO4??CaSO4 were not found; (8) a minimum in the ternary system at: 740??C, 25% MgSO4, 6% CaSO4, 69% K2SO4; and ternary eutectics at 882??C, 49% MgSO4, 19% CaSO4, 32% K2SO4; and 880??, 67??5% MgSO4, 5% CaSO4, 27??5% K2SO4. ?? 1967.

  8. PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

    PubMed Central

    Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

    2006-01-01

    PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

  9. Primer3_masker: integrating masking of template sequence with primer design software.

    PubMed

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  10. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    PubMed

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  11. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930

  12. miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

    PubMed Central

    Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

    2018-01-01

    MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

  13. MethPrimer: designing primers for methylation PCRs.

    PubMed

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  14. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  15. Enablers and Obstacles to Democratic Consolidation and Civil-Military Relations Reform: A Comparative Analysis of Argentina and Guatemala

    DTIC Science & Technology

    2014-03-01

    the war. Even the Procuraduría de los Derechos Humanos (PDH, or Human Rights Ombudsman), which was established in 1985, was infested with racist...Procuraduría de los Derechos Humanos (PDH)145 The PDH’s purpose was to document human rights abuses in order to promote their reduction and eventual...conditions. In addition to the Madres, the Asamblea Permanente por los Derechos 61 Fagen

  16. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    PubMed Central

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  17. Outsourcing and "dismantling" of steady jobs at hospitals.

    PubMed

    Souza, Helton Saragor de; Mendes, Áquilas Nogueira

    2016-04-01

    To relate hospitals' organizational structure as the core of a web of outsourced services and flexible employment bonds among healthcare professionals in the context of finance capitalism, analyzing work arrangements based mainly on the type of employment bond. Qualitative research through ethnography, interviews, data analysis, and case studies. The case studies were concentrated in 3 hospitals located in the São Paulo metropolitan region under different management types: public administration; outsourced administration via a healthcare social organization (HSO); and private administration. This study highlights a trend in outsourcing, dismantling of steady jobs, and shaping working relations asymmetrically in terms of healthcare professions. These aspects are characteristic of contemporary capitalism and post-Fordist work organization. In this context, the state under sponsorship cripples the very existence of an effective human resources policy, creating a favorable environment for outsourcing and flexibility of employment bonds among healthcare workers. Relacionar a estrutura organizativa dos hospitais como núcleo de uma rede de serviços subcontratados e a flexibilização dos vínculos contratuais dos profissionais de saúde no contexto de capitalismo financeirizado, analisando os regimes de trabalho condicionados centralmente pelo vínculo empregatício. Pesquisa qualitativa através de etnografia, realização de entrevistas, análise de dados e utilização de estudo de caso. Os estudos de caso concentram-se em três hospitais localizados Região Metropolitana de São Paulo com gestões distintas: administração pública; administração terceirizada para Organização Social de Saúde (OSS); e administração privada. Destacamos a tendência da terceirização, do desmonte do emprego estável e a conformação de relações trabalhistas assimétricas para as profissões em saúde. Esses aspectos são característicos do período do capitalismo contemporâneo e da organização pós-fordista do trabalho. Nesse contexto, o subfinanciamento do Estado inviabiliza uma política de recursos humanos efetiva, configurando o ambiente propício para as terceirizações e flexibilidade do vínculo empregatício para os trabalhadores de saúde.

  18. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

    2016-01-01

    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

  19. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Foco Nasmyth para el telescopio 2,15mts. de CASLEO

    NASA Astrophysics Data System (ADS)

    Casagrande, A. R.

    En principio, este proyecto intenta lograr el mayor aprovechamiento posible del instrumental que se dispone, buscando la manera de optimizar y hacer más eficiente el servicio que brinda el CASLEO a la comunidad astronómica. El mismo consiste en utilizar dispositivos ya existentes en el telescopio, y darle una utilidad. Tal es el caso del camino óptico destinado al foco Coude. Si tenemos en cuenta que disponemos de un tercer espejo Coude, con todos sus mecanismos automatizados, (actualmente sin uso), una distancia apropiada del plano focal, el espacio y el lugar físico necesario para instalar un periférico, es posible la habilitación de un foco Nasmyth en el telescopio 2,15mts. El hecho de contar con este nuevo foco, redundará en importantes beneficios. En primer lugar, posibilitará la observación, casi simultánea, con dos instrumentos. Otro aspecto a tener en cuenta, es que disminuirá el frecuente cambio del instrumental periférico, motivo este que degrada su ideal puesta a punto. Por último, también de interés, es de destacar su escaso costo de ejecución.

  1. Design of primers and probes for quantitative real-time PCR methods.

    PubMed

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  2. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  3. Accidentes laborales asociados al desánimo de médicos SERUMS para laborar en el primer nivel de atención de Lima, Perú

    PubMed Central

    Mejia, Christian R.; Valladares-Garrido, Mario J.; Romero, Brian M.; Valladares-Garrido, Danai; Linares-Reyes, Edgardo

    2018-01-01

    Introducción la retención laboral es un tema de suma importancia, porque se requiere de profesionales en el primer nivel de atención (PNA). El objetivo fue determinar si los accidentes laborales se asociaron al desánimo de los médicos para trabajar en el PNA de Lima, Perú. Métodos estudio transversal analítico de datos secundarios de una base de datos generada de una encuesta a médicos que realizaron su Servicio Rural y Urbano-Marginal en Salud (SERUMS). Se incluyó solo a los médicos que manifestaron al inicio del SERUMS que podían trabajar en el PNA de Lima. Se definió como cambio de intención de trabajo en el PNA a los que finalizando el SERUMS refirieron que ya no deseaban laborar en Lima. Esto se asoció según si tuvieron un accidente laboral y se ajustó por otras variables. Resultados de los 124 médicos el 63% fueron hombres (78). La mediana de edad fue de 26 años (rango intercuartílico: 25-27 años). Después de su SERUMS, el 12% (15) manifestó que cambió su interés y que deseaba trabajar en la capital. En el análisis multivariado, haber tenido un accidente laboral disminuyó la frecuencia del cambio de intención de trabajo en el PNA (RPa: 0.28, IC 95%: 0.14-0.54, p < 0,001), ajustado por ocho variables. Conclusiones en un estudio previo los accidentes laborales disminuyeron la frecuencia de trabajar en provincias, pero nuestro estudio dice lo contrario, posiblemente por la percepción de que un trabajo en la capital del país permite estar más cerca de los servicios para ser atendido en caso de cualquier emergencia. PMID:29190859

  4. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    PubMed

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  5. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  6. Calcium-containing scaffolds induce bone regeneration by regulating mesenchymal stem cell differentiation and migration.

    PubMed

    Aquino-Martínez, Rubén; Angelo, Alcira P; Pujol, Francesc Ventura

    2017-11-16

    Osteoinduction and subsequent bone formation rely on efficient mesenchymal stem cell (MSC) recruitment. It is also known that migration is induced by gradients of growth factors and cytokines. Degradation of Ca 2+ -containing biomaterials mimics the bone remodeling compartment producing a localized calcium-rich osteoinductive microenvironment. The aim of our study was to determine the effect of calcium sulfate (CaSO 4 ) on MSC migration. In addition, to evaluate the influence of CaSO 4 on MSC differentiation and the potential molecular mechanisms involved. A circular calvarial bone defect (5 mm diameter) was created in the parietal bone of 35 Balb-C mice. We prepared and implanted a cell-free agarose/gelatin scaffold alone or in combination with different CaSO 4 concentrations into the bone defects. After 7 weeks, we determined the new bone regenerated by micro-CT and histological analysis. In vitro, we evaluated the CaSO 4 effects on MSC migration by both wound healing and agarose spot assays. Osteoblastic gene expression after BMP-2 and CaSO 4 treatment was also evaluated by qPCR. CaSO 4 increased MSC migration and bone formation in a concentration-dependent manner. Micro-CT analysis showed that the addition of CaSO 4 significantly enhanced bone regeneration compared to the scaffold alone. The histological evaluation confirmed an increased number of endogenous cells recruited into the cell-free CaSO 4 -containing scaffolds. Furthermore, MSC migration in vitro and active AKT levels were attenuated when CaSO 4 and BMP-2 were in combination. Addition of LY294002 and Wortmannin abrogated the CaSO 4 effects on MSC migration. Specific CaSO 4 concentrations induce bone regeneration of calvarial defects in part by acting on the host's undifferentiated MSCs and promoting their migration. Progenitor cell recruitment is followed by a gradual increment in osteoblast gene expression. Moreover, CaSO 4 regulates BMP-2-induced MSC migration by differentially activating the PI3K/AKT pathway. Altogether, these results suggest that CaSO 4 scaffolds could have potential applications for bone regeneration.

  7. Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.

    PubMed

    Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya

    2012-01-01

    This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.

  8. Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

    PubMed Central

    Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

  9. The binary system K2SO4CaSO4

    USGS Publications Warehouse

    Rowe, J.J.; Morey, G.W.; Hansen, I.D.

    1965-01-01

    The binary system K2SO4CaSO4 was studied by means of heating-cooling curves, differential thermal analysis, high-temperature quenching technique and by means of a heating stage mounted on an X-ray diffractometer. Compositions and quench products were identified optically and by X-ray. Limited solid solution of CaSO4 in K2SO4 was found. There is a eutectic at 875??C and 34 wt. per cent CaSO4. Calcium langbeinite melts incongruently at 1011??C. The melting-point of CaSO4 (1462??C) was determined by the quenching technique using sealed platinum tubes. The only intermediate crystalline phase found in the system is K2SO4??2CaSO4 (calcium langbeinite). ?? 1965.

  10. Sex Stereotyping in Mexican Reading Primers.

    ERIC Educational Resources Information Center

    Heathcote, Olivia

    A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…

  11. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  12. PRISE2: software for designing sequence-selective PCR primers and probes.

    PubMed

    Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

    2014-09-25

    PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

  13. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  14. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  15. SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

    PubMed Central

    Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

    2006-01-01

    Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

  16. SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

    PubMed

    Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

    2006-07-01

    Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

  17. A PCR primer bank for quantitative gene expression analysis.

    PubMed

    Wang, Xiaowei; Seed, Brian

    2003-12-15

    Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

  18. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    PubMed Central

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  19. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...

  20. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...

  1. Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

    PubMed Central

    Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

    2005-01-01

    Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

  2. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    PubMed Central

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  3. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

    PubMed

    Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

    2018-01-01

    Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

  4. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

    PubMed Central

    2018-01-01

    Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

  5. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  6. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    PubMed

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. A 22-mer primer enhances discriminatory power of AP-PCR fingerprinting technique in characterization of leptospires.

    PubMed

    Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C

    2004-11-01

    To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.

  8. Experimental Comparison of Calcium Sulfate (CaSO(4)) Scale Deposition on Coated Carbon Steel and Titanium Surfaces

    NASA Astrophysics Data System (ADS)

    Al-Otaibi, Dhawi AbdulRahman

    Calcium Sulfate (CaSO4) deposit reduces heat exchange in heat transfer equipment which adversely affects the equipment performance and plant production. This experimental study was conducted by using the Rotating Cylinder Electrode (RCE) equipment available in the university's Center for Engineering Research (CER/RI) to study and compare the effect of solution hydrodynamics on Calcium Sulfate (CaSO4) scale deposition on coated carbon steel and titanium surfaces. In addition, the Scanning Electron Microscopic was used to examine the morphology and distribution of Calcium Sulfate (CaSO 4) crystals deposited on titanium metal surfaces. In this study, the rotational speed was varied from 100 to 2000 RPM to study the behavior of Calcium Sulfate (CaSO4) accumulation on both materials. Based on the experimental results, Calcium Sulfate (CaSO4) scale obtained in the present study was almost constant on coated carbon steel in which the rate of scale deposition is equal to the rate of scale removal. However, the deposition of Calcium Sulfate (CaSO4) observed on titanium material was increased as the speed increased.

  9. Output testing of small-arms primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.

    1991-01-01

    The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

  10. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    PubMed

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  11. Value for money assessment for public-private partnerships : a primer.

    DOT National Transportation Integrated Search

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.

  12. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

    PubMed Central

    Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

    1996-01-01

    In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

  13. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

    PubMed Central

    2013-01-01

    Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

  14. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-08

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Effect of sulfation on the surface activity of CaO for N2O decomposition

    NASA Astrophysics Data System (ADS)

    Wu, Lingnan; Hu, Xiaoying; Qin, Wu; Dong, Changqing; Yang, Yongping

    2015-12-01

    Limestone addition to circulating fluidized bed boilers for sulfur removal affects nitrous oxide (N2O) emission at the same time, but mechanism of how sulfation process influences the surface activity of CaO for N2O decomposition remains unclear. In this paper, we investigated the effect of sulfation on the surface properties and catalytic activity of CaO for N2O decomposition using density functional theory calculations. Sulfation of CaO (1 0 0) surface by the adsorption of a single gaseous SO2 or SO3 molecule forms stable local CaSO3 or CaSO4 on the CaO (1 0 0) surface with strong hybridization between the S atom of SOx and the surface O anion. The formed local CaSO3 increases the barrier energy of N2O decomposition from 0.989 eV (on the CaO (1 0 0) surface) to 1.340 eV, and further sulfation into local CaSO4 remarkably increases the barrier energy to 2.967 eV. Sulfation from CaSO3 into CaSO4 is therefore the crucial step for deactivating the surface activity for N2O decomposition. Completely sulfated CaSO4 (0 0 1) and (0 1 0) surfaces further validate the negligible catalytic ability of CaSO4 for N2O decomposition.

  16. CaSO4:DY,Mn: A new and highly sensitive thermoluminescence phosphor for versatile dosimetry

    NASA Astrophysics Data System (ADS)

    Bahl, Shaila; Lochab, S. P.; Kumar, Pratik

    2016-02-01

    With the advent of newer techniques for dose reduction coupled with the development of more sensitive detectors, the radiation doses in radiological medical investigation are decreasing. Nevertheless, keeping the tenet in mind that all radiation doses could entail risk, there is a need to develop more sensitive dosimeters capable of measuring low doses. This paper gives the account of the development of a new and sensitive phosphor CaSO4:Dy,Mn and its characterization. The standard production procedure based on the recrystallization method was used to prepare CaSO4:Dy,Mn. The Thermoluminescence (TL) studies were carried out by exposing it with gamma radiation (Cs-137) from 10 μGy to 100 Gy. The theoretical studies to determine the number of peaks and kinetic parameters related to the TL glow peaks in CaSO4:Dy,Mn was performed using the Computerized Glow Curve Deconvolution (CGCD) method. Experiments were performed to determine optimum concentration of the dopants Dysprosium (Dy) and Mangnese (Mn) in the host CaSO4 so that maximum sensitivity of the phosphor may be achieved. The optimum dopant concentration turned out to be 0.1 mol%. As there were two dopants Dy and Mn their relative ratio were varied in steps of 0.025 keeping the concentration of total dopant (Dy and Mn) 0.1 mol% always. The maximum TL intensity was seen in the CaSO4:Dy(0.025),Mn(0.075) combination. The TL sensitivity of this phosphor was found to be about 2 and 1.8 times higher than that of popular phosphor CaSO4:Dy and LiF:Mg,Cu,P (TLD-700H) respectively. This new phosphor CaSO4:Dy,Mn showed fading of 11% which is similar to that of the standard phosphor CaSO4:Dy. The paper concludes that the new, highly sensitive TL phosphor CaSO4:Dy,Mn has shown higher sensitivity and hence the potential to replace commonly used CaSO4:Dy.

  17. Microsatellite markers for Vellozia gigantea (Velloziaceae), a narrowly endemic species to the Brazilian campos rupestres.

    PubMed

    Martins, Ana Paula V; Proite, Karina; Kalapothakis, Evanguedes; Santos, Fabrício R; Chaves, Anderson V; Borba, Eduardo L

    2012-07-01

    Microsatellite primers were developed for the first time in Velloziaceae, in the endangered species Vellozia gigantea. Using two different protocols, seven primer sets were characterized in three populations of V. gigantea. The primers amplified di- and trinucleotide repeats with six to 12 alleles per locus. These revealed high levels of genetic variation, presenting an average observed heterozygosity of 0.508 in V. gigantea. The seven primers were tested for cross-amplification in three Vellozia species. All primers successfully amplified in V. auriculata. Six primers amplified in V. compacta and three in V. hirsuta. The new marker set described here will be useful for studies of population genetics of V. gigantea. The cross-amplification results indicate the utility of primers for studies in other Vellozia species.

  18. FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

    PubMed Central

    Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

    2013-01-01

    The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

  19. A tool for design of primers for microRNA-specific quantitative RT-qPCR.

    PubMed

    Busk, Peter K

    2014-01-28

    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  20. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  1. The removal of RNA primers from DNA synthesized by the reverse transcriptase of the retrotransposon Tf1 is stimulated by Tf1 integrase.

    PubMed

    Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon

    2012-06-01

    The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.

  2. The Removal of RNA Primers from DNA Synthesized by the Reverse Transcriptase of the Retrotransposon Tf1 Is Stimulated by Tf1 Integrase

    PubMed Central

    Herzig, Eytan; Voronin, Nickolay

    2012-01-01

    The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446

  3. URPD: a specific product primer design tool.

    PubMed

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  4. Hybrid Materials for Thermal Management in Thin Films and Bulk Composites

    DTIC Science & Technology

    2012-02-01

    enamel  that  cures  via  oxidative...polymerization   in   air  ( Enamel ),  a  waterborne  flat   latex  that  cures  by  coalescing  while  air  drying  (Flat...Wood   Bare   Primer   Primer   +  KPF6     Bare   Primer   Primer   +  KPF6     Bare   Primer   Enamel  

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

    ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

  6. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

  7. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    PubMed Central

    Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

    2007-01-01

    Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

  8. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  9. Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.

    PubMed

    Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon

    2017-03-01

    To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.

  10. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  11. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

    DOE PAGES

    Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

    2018-03-27

    Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

  12. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

    Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

  13. The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  14. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  15. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  16. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  17. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  18. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  19. Direct role for the RNA polymerase domain of T7 primase in primer delivery

    PubMed Central

    Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

    2010-01-01

    Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755

  20. Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

    USGS Publications Warehouse

    Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

    2010-01-01

    A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

  1. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  2. Plastid primers for angiosperm phylogenetics and phylogeography.

    PubMed

    Prince, Linda M

    2015-06-01

    PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

  3. Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

    PubMed

    Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

    2017-03-22

    Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

  4. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.

    2013-01-01

    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  5. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    PubMed

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Improved Performance of Loop-Mediated Isothermal Amplification Assays via Swarm Priming.

    PubMed

    Martineau, Rhett L; Murray, Sarah A; Ci, Shufang; Gao, Weimin; Chao, Shih-Hui; Meldrum, Deirdre R

    2017-01-03

    This work describes an enhancement to the loop-mediated isothermal amplification (LAMP) reaction which results in improved performance. Enhancement is achieved by adding a new set of primers to conventional LAMP reactions. These primers are termed "swarm primers" based on their relatively high concentration and their ability to create new amplicons despite the theoretical lack of single-stranded annealing sites. The primers target a region upstream of the FIP/BIP primer recognition sequences on opposite strands, substantially overlapping F1/B1 sites. Thus, despite the addition of a new primer set to an already complex assay, no significant increase in assay complexity is incurred. Swarm priming is presented for three DNA templates: Lambda phage, Synechocystis sp. PCC 6803 rbcL gene, and human HFE. The results of adding swarm primers to conventional LAMP reactions include increased amplification speed, increased indicator contrast, and increased reaction products. For at least one template, minor improvements in assay repeatability are also shown. In addition, swarm priming is shown to be effective at increasing the reaction speed for RNA amplification via RT-LAMP. Collectively, these results suggest that the addition of swarm primers will likely benefit most if not all existing LAMP assays based on state-of-the-art, six-primer reactions.

  7. Bond strength of self-etch adhesives after saliva contamination at different application steps.

    PubMed

    Cobanoglu, N; Unlu, N; Ozer, F F; Blatz, M B

    2013-01-01

    This study evaluated and compared the effect of saliva contamination and possible decontamination methods on bond strengths of two self-etching adhesive systems (Clearfil SE Bond [CSE], Optibond Solo Plus SE [OSE]). Flat occlusal dentin surfaces were created on 180 extracted human molar teeth. The two bonding systems and corresponding composite resins (Clearfil AP-X, Kerr Point 4) were bonded to the dentin under six surface conditions (n=15/group): group 1 (control): primer/bonding/composite; group 2: saliva/drying/primer/bonding/composite; group 3: primer/saliva/rinsing/drying/primer/bonding/composite; group 4: primer/saliva/rinsing/drying/bonding/composite; group 5: primer/bonding (cured)/saliva/rinsing/drying/primer/bonding/composite; group 6: primer/bonding (cured)/saliva/removing contaminated layer with a bur/rinsing/drying/primer/bonding/composite. Shear bond strength was tested after specimens were stored in distilled water at 37°C for 24 hours. One-way analysis of variance and Tukey post hoc tests were used for statistical analyses. For CSE, groups 2, 3, and 4 and for OSE, groups 6, 2, and 4 showed significantly lower bond strengths than the control group (p<0.05). CSE groups 5 and 6 and OSE groups 3 and 5 revealed bond strengths similar to the control. When saliva contamination occurred after light polymerization of the bonding agent, repeating the bonding procedure recovered the bonding capacity of both self-etch adhesives. However, saliva contamination before or after primer application negatively affected their bond strength.

  8. Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

    PubMed

    Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

    2018-03-09

    Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  9. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    PubMed

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

    PubMed

    Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

    2016-07-01

    To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

  11. An innovative SNP genotyping method adapting to multiple platforms and throughputs.

    PubMed

    Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

    2017-03-01

    An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

  12. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    NASA Astrophysics Data System (ADS)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  13. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

  14. Novel ITS1 Fungal Primers for Characterization of the Mycobiome

    PubMed Central

    Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

    2017-01-01

    ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

  15. Chemical and mechanical aspects of HMR primer in relationship to wood bonding

    Treesearch

    Alfred W. Christiansen

    2005-01-01

    The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...

  16. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  17. Progress in the Development of a Multiphase Turbulent Model of the Gas/Particle Flow in a Small-Caliber Ammunition Primer

    DTIC Science & Technology

    2006-08-01

    Maneuver Ammunition Systems is acknowledged for continued support of this effort. This research was performed while the first author held a National...the ignition system (i.e., the primer in small-caliber guns, the primer and flashtube in medium-caliber guns, and the primer and igniter-tube in large...primer model that is compatible with the ARL- NGEN3 IB code is the subject of this report. The conventional ignition system for a large-caliber (120 mm

  18. An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.

    1997-01-01

    To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

  19. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    PubMed

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  20. Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

    PubMed

    Chen, Huaihai; Yu, Fangbo; Shi, Wei

    2016-12-01

    Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  1. Comparison of PCR primer-based strategies for characterization of ammonia oxidizer communities in environmental samples.

    PubMed

    Mahmood, Shahid; Freitag, Thomas E; Prosser, James I

    2006-06-01

    PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.

  2. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    PubMed

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  3. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

    PubMed Central

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

  4. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    PubMed

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  5. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    PubMed

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  6. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    PubMed Central

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  7. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  8. Effect of surface preparation on service life of top-coats applied to weathered primer paint

    Treesearch

    R. Sam Williams; Mark Knaebe; Peter Sotos

    2008-01-01

    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  9. Escleroterapia de safena associada a enxerto de pele no tratamento de úlceras venosas

    PubMed Central

    de Oliveira, Alexandre Faraco; de Oliveira, Horácio

    2017-01-01

    Resumo Contexto Úlceras são a resultante final de varizes associadas a refluxo de veias safenas. Objetivo Demonstrar a possibilidade de associar dois procedimentos, a escleroterapia com espuma de veias safenas e o enxerto de pele parcial, para o tratamento de pacientes com úlceras venosas relacionadas a refluxo de veias safenas. Métodos Foram tratados 20 membros em 20 pacientes, todos com ulcerações relacionadas a refluxo de veias safenas. Realizamos o enxerto de pele expandida, seguido da escleroterapia ecoguiada com espuma de polidocanol nas veias associadas às úlceras, através de punção ou dissecção da veia. Resultados Em todos os casos, houve melhora dos sintomas relacionados à úlcera e cicatrização da lesão. Em 11 casos, obtivemos a viabilidade do enxerto de pele por completo; em quatro casos, houve cicatrização de cerca de 50% da lesão; e nos cinco casos restantes, houve cicatrização de aproximadamente 75% da lesão. A primeira ultrassonografia de controle revelou esclerose completa dos vasos tratados em 19 dos 20 casos e esclerose parcial sem refluxo detectável em um caso. Na segunda ultrassonografia, realizada após 45 dias, observamos esclerose completa de 15 casos; em cinco casos, houve esclerose parcial, dos quais três sem refluxo detectável e dois com refluxo em segmentos isolados associados a varizes. A complicação mais frequente foi a pigmentação nos trajetos venosos, observada em 13 pacientes. Um caso apresentou trombose assintomática de veias musculares da perna. Conclusão Essa associação de procedimentos consiste em uma opção válida com potencial para promover um tratamento mais breve e de menor custo. PMID:29930660

  10. Simple sequence repeat marker loci discovery using SSR primer.

    PubMed

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  11. Insights into water-mediated ion clustering in aqueous CaSO4 solutions: pre-nucleation cluster characteristics studied by ab initio calculations and molecular dynamics simulations.

    PubMed

    Li, Hui-Ji; Yan, Dan; Cai, Hou-Qin; Yi, Hai-Bo; Min, Xiao-Bo; Xia, Fei-Fei

    2017-05-10

    The molecular structure of growth units building crystals is a fundamental issue in the crystallization processes from aqueous solutions. In this work, a systematic investigation of pre-nucleation clusters and their hydration characteristics in aqueous CaSO 4 solutions was performed using ab initio calculations and molecular dynamics (MD) simulations. The results of ab initio calculations and MD simulations indicate that the dominant species in aqueous CaSO 4 solutions are monodentate ion-associated structures. Compared with charged ion clusters, neutral clusters are more likely to be present in an aqueous CaSO 4 solution. Neutral (CaSO 4 ) m clusters are probably the growth units involved in the pre-nucleation or crystallization processes. Meanwhile, hydration behavior around ion associated species in aqueous CaSO 4 solutions plays an important role in related phase/polymorphism selections. Upon ion clustering, the residence of some water molecules around Ca 2+ in ion-associated species is weakened while that of some bridging waters is enhanced due to dual interaction by Ca 2+ and SO 4 2- . Some phase/polymorphism selections can be achieved in aqueous CaSO 4 solutions by controlling the hydration around pre-nucleation clusters. Moreover, the association trend between calcium and sulfate is found to be relatively strong, which hints at the low solubility of calcium sulfate in water.

  12. Nucleic acid amplification using modular branched primers

    DOEpatents

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  13. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    PubMed Central

    Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

    2006-01-01

    Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

  14. A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

    NASA Astrophysics Data System (ADS)

    Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

    2017-08-01

    The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

  15. Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

    PubMed

    Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

    2016-01-01

    The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

  16. Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

    PubMed

    Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

    2014-06-03

    Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

  17. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

  18. Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.

    PubMed

    Tirumalai, R S; Modak, M J

    1991-07-02

    We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.

  19. Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

    PubMed

    Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

    2018-06-06

    Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Lee, H.K.; Flanders, D.J.

    The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

  1. Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

    PubMed

    Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

    2009-08-01

    Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

  2. Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.

    PubMed

    Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan

    2015-09-01

    The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.

  3. [Effect of a chemical primer on the bond strength of a zirconia ceramic with self-adhesive resin cement].

    PubMed

    Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng

    2015-10-01

    To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (P<0.05). Primer treatment can improve the primary resin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.

  4. Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Wiesner, G.; Laken, S.

    The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

  5. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  6. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  7. De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

    PubMed Central

    Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

    2012-01-01

    Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

  8. Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification

    PubMed Central

    Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo

    2018-01-01

    Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604

  9. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  10. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. Identification of the gene encoding the major capsid protein of fish lymphocystis disease virus.

    PubMed

    Schnitzler, P; Darai, G

    1993-10-01

    The gene encoding the major capsid protein (MCP) of fish lymphocystis disease virus (flounder isolate; FLCDV-f) has been identified by PCR using oligonucleotide primers corresponding to different regions of the MCP of Tipula iridescent virus (TIV), iridescent virus 22 (IV22) and Chilo iridescent virus (CIV). DNA fragments of 0.4 kbp, 0.5 kbp and 0.27 kbp in size were amplified using oligonucleotide primers corresponding to amino acids (aa) 146 to 153 (primer 1) and 274 to 268 (primer 6), or aa 146 to 153 (primer 1) and 313 to 304 (primer 8), or aa 304 to 312 (primer 7) and 385 to 381 (primer 9) of the MCP of TIV, respectively. The PCR products were used as hybridization probes for screening the gene library of FLCDV-f. The MCP gene of FLCDV-f(1377 bp; 459 aa; 51.4K) was identified within the DNA sequence of the EcoRI FLCDV-f DNA fragment C (11.2 kbp; 0.611 to 0.718 map units). A high degree of aa sequence identity/similarity was detected between the MCP of FLCDV-f and TIV (50.3%/33.8%), IV22 (49.1%/34.2%). CIV (53%/29.5%) and African swine fever virus (16%/38.1%).

  12. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE PAGES

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

    2014-01-01

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  13. Feasibility study of CaSO4:Tb,Yb as a thermoluminescent dosimeter

    NASA Astrophysics Data System (ADS)

    Junot, Danilo O.; Santos, Max A.; Chagas, Marcos A. P.; Couto dos Santos, Marcos A.; Nunes, Luiz A. O.; Souza, Divanizia N.

    2014-02-01

    A new composite based on CaSO4, using terbium as dopant and ytterbium as co-dopant (CaSO4:Tb,Yb), was developed for employment as a thermoluminescent (TL) dosimeter. The crystals used in this work were grown using a production route based on the Yamashita method (Yamashita et al., 1968). Crystal powder was calcined at 600 °C for 1 h. Pellets were made by adding commercial and colorless glass to improve physical resistance and sintered at 700 °C for 6 h. All samples were irradiated by a beta source (90Sr/90Y) and received doses from 1 Gy to 5 Gy. TL analyses have been performed and characteristics such as sensitivity, reproducibility, linearity, and fading have been studied. The CaSO4:Tb,Yb pellets glow curves presented two peaks, the first at around 115 °C, and the second at around 200 °C. The highest intensity was shown for CaSO4:Tb,Yb with a concentration of 0.1 mol% of Tb and Yb together. In all the samples the TL response was proportional to the absorbed dose. Therefore, the CaSO4:Tb,Yb has potential to be used as a thermoluminescent dosimeter.

  14. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  15. Immunological properties of the primer-independent glucosyltransferase of Streptococcus mutans serotypes d and g.

    PubMed

    Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T

    1988-05-01

    Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.

  16. Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

    PubMed

    Gonzales, J L; Loza, A; Chacon, E

    2006-03-15

    There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

  17. CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

    PubMed Central

    Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

    2003-01-01

    We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

  18. UniPrime2: a web service providing easier Universal Primer design.

    PubMed

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  19. Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.

    PubMed

    Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca

    2017-11-23

    DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.

  20. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  1. Economics : pricing, demand, and economic efficiency : a primer.

    DOT National Transportation Integrated Search

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  2. Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

    DOEpatents

    McKinney, Nancy

    2002-01-01

    PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

  3. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  4. Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

    PubMed

    Campos, Maria Jorge; Quesada, Alberto

    2017-01-01

    PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

  5. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae)

    PubMed Central

    2010-01-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499

  6. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

    PubMed

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

    2010-04-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  7. Molecular method for determining sex of walruses

    USGS Publications Warehouse

    Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

    2008-01-01

    We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

  8. Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

    PubMed Central

    Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

    1984-01-01

    Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

  9. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    PubMed Central

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  10. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    PubMed

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  11. Studying CaSO4:Eu as an OSL phosphor

    NASA Astrophysics Data System (ADS)

    Guckan, Veysi; Altunal, Volkan; Nur, Necmettin; Depci, Tolga; Ozdemir, Adnan; Kurt, Kasim; Yu, Yan; Yegingil, Ihami; Yegingil, Zehra

    2017-09-01

    This study was carried out to investigate the properties of the OSL signal from Eu-doped calcium sulfate (CaSO4:Eu) phosphor and study on its thermal behavior as a function of temperature under a series of luminescence experiments. The suitability of its usage as an optically stimulated luminescence (OSL) dosimeter was also checked. CaSO4:Eu was synthesized using the precipitation method and prepared in pellet form. The dopant concentration value was performed as 0.1 mol%. The synthesized CaSO4:Eu was analyzed by X-ray diffraction (XRD) method to confirm the product. To have an idea about the crystallography and microstructure morphology of the material, scanning electron microscope (SEM) analysis were carried out. It was found that the OSL signal is a resultant signal having three components and exhibits thermal quenching above 150 °C. The excitation spectrum of CaSO4:Eu showed different peaks in the region 220-360 nm with the highest one at 269 nm. Thermoluminescence (TL) signals of CaSO4:Eu pellets were obtained and compared with the TL signals obtained after OSL measurements of the same pellets by blue light stimulation. The low temperature peak near 180 °C did not show any significant change in TL after OSL measurement whereas the high temperature peak at 240 °C was bleached with the blue light illumination and might be responsible for the observed OSL signal. The dosimetric properties such as dose response, minimum detectable dose, energy response, reusability, fading properties, thermal stability and effect of reading temperatures on OSL signals were examined. OSL signals of CaSO4:Eu pellets were decreased by approximately 8% at the end of the 24 h and by about 7% at the end of 28 days when compared with the first readout. The thermal stability of the ∼240 °C TL peak and OSL signal using isothermal decay measurements were used to determine the trap parameters. The CaSO4:Eu OSL dosimeter in accordance with the presented study allows a high-sensitivity OSL phosphor whose host material was previously known as conventional synthetic CaSO4 TLD material.

  12. Elastoplasticidad anisotropa de metales en grandes deformaciones

    NASA Astrophysics Data System (ADS)

    Caminero Torija, Miguel Angel

    El objetivo de este trabajo es el desarrollo de modelos y algoritmos numericos que simulen el comportamiento del material bajo estas condiciones en el contexto de programas de elementos finitos, dando como resultado predicciones mas precisas de los procesos de conformado y deformacion plastica en general. Para lograr este objetivo se han desarrollado diversas tareas destinadas a mejorar las predicciones en tres aspectos fundamentales. El primer aspecto consiste en la mejora de la descripcion del endurecimiento cinematico anisotropo en pequenas deformaciones, lo cual se ha realizado a traves de modelos y algoritmos implicitos de superficies multiples. Ha sido estudiada la consistencia de este tipo de modelos tanto si estan basados en una regla implicita similar a la de Mroz o en la regla de Prager. Ademas se han simulado los ensayos de Lamba y Sidebottom, obteniendo, en contra de la creencia general, muy buenas predicciones con la regla de Prager. Dichos modelos podrian ser extendidos de forma relativamente facil para considerar grandes deformaciones a traves de procedimientos en deformaciones logaritmicas, similares a los desarrollados en esta tesis y detallados a continuacion. El segundo aspecto consiste en la descripcion de la anisotropia elastoplastica inicial. Esto se ha conseguido mediante el desarrollo de modelos y algoritmos para plasticidad anisotropa en grandes deformaciones, bien ignorando la posible anisotropia elastica, bien considerandola simultaneamente con la anisotropia plastica. Para ello ha sido necesario desarrollar primero un nuevo algoritmo de elastoplasticidad anisotropa en pequenas deformaciones consistentemente linealizado y sin despreciar ningun termino, de tal forma que se conserve la convergencia cuadratica de los metodos de Newton. Este algoritmo en pequenas deformaciones ha servido para realizar la correccion plastica de dos algoritmos en grandes deformaciones. El primero de estos algoritmos es una variacion del clasico algoritmo de Eterovic y Bathe para incluir la posibilidad de plasticidad anisotropa con endurecimiento mixto. Este primer algoritmo esta restringido a casos de isotropia elastica. La isotropia elastica es una hipotesis bastante habitual en plasticidad anisotropa y tiene la ventaja de que permite el uso de formulaciones mixtas u/p. El segundo algoritmo, mas complejo y general, incluye la posibilidad de elasticidad anisotropa, plasticidad anisotropa y endurecimiento mixto. Este algoritmo supone una contribucion importante ya que esta basado en hipotesis comunmente aceptadas y utilizadas en elastoplasticidad isotropa: descomposicion multiplicativa del gradiente de deformaciones en parte elastica y parte plastica, descripcion hiperelastica sencilla en funcion de deformaciones logaritmicas e integracion exponencial que conserva el volumen. Ademas, la estructura final del algoritmo es modular y relativamente sencilla, consistiendo en un pre- y un postprocesador geometrico y una correccion plastica realizada en pequenas deformaciones. El algoritmo esta consistentemente linealizado para conservar la convergencia cuadratica asintotica de los metodos de Newton y la forma final que toma dicha linealizacion es similar al caso de isotropia elastoplastica implementado; consiste en el modulo tangente algoritmico de pequenas deformaciones sobre el que se aplica una transformacion para convertirlo en el de grandes deformaciones. Todos estos modelos han sido implementados en un codigo propio de elementos finitos denominado DULCINEA, el cual tiene formulaciones lagrangianas totales y actualizadas para grandes deformaciones. Una de las tareas necesarias para poder realizar las simulaciones, ha sido el estudio e implementacion de diferentes elementos que no sufran el bloqueo volumetrico severo que se observa en formulaciones estandar basadas en desplazamientos. Este bloqueo se debe a la condicion de quasi-incompresibilidad que imponen los modelos de plasticidad desviadores y consiste en una respuesta exageradamente rigida de la solucion obtenida por el metodo de los elementos finitos estandar. Entre los elementos implementados cabe destacar el basado en la formulacion mixta u/p, que contiene una interpolacion adicional de grados de libertad de presion. Estos grados de libertad adicionales habitualmente son internos al elemento en mecanica de solidos. En este trabajo se ha desarrollado e implementado en DULCINEA una familia de elementos tridimensionales mixtos en grandes deformaciones que incluye el caso particular BMIX 27/27/4, basado en la formulacion u/p, constituido por 27 nudos, con 27 puntos de integracion estandar y 4 grados de libertad de presiones, y que pasa la condicion Inf-Sup o de Babuska-Brezzi. Sin embargo, se ha observado que la formulacion u/p presenta ciertas limitaciones bajo las hipotesis conjuntas de anisotropia elastica y anisotropia plastica. (Abstract shortened by UMI.)

  13. Development cooperation in water and sanitation: is it based on the human rights framework?

    PubMed

    Brown, Colin; Heller, Léo

    2017-07-01

    The water and sanitation sector is verifiably receiving increased attention and funding through international development cooperation. Not least because of the way that it affects incentives and institutions in partner countries, development cooperation can have either positive or negative effects on human rights though. The consolidated frameworks for the human rights to water and sanitation is becoming linked to the international community's coordinated development efforts, as evidenced notably in the 2030 Agenda for Sustainable Development. However, a review of major funders' official policies for development cooperation in the sector suggests that many only partially endorse the frameworks for the human rights to water and sanitation. An observation of development cooperation flows to the sector allows the hypothesis to be advanced that worldwide inequalities in access to these services may be reduced through a full and clear application of the human rights framework in development cooperation activities. The article presents findings of this research and explores key stakes for development cooperation in the water and sanitation sector that are relevant for their ability to either negatively or positively contribute to the realization of human rights. Resumen El sector de agua y saneamiento ha recibido creciente atención y financiación a través de la cooperación internacional para el desarrollo. La cooperación para el desarrollo puede tener efectos tanto positivos cuanto negativos sobre los derechos humanos. El hito que consolida los derechos humanos al agua y al saneamiento están articulados a esfuerzos de cooperación para el desarrollo promovidos por la comunidad internacional, como se evidencia en la Agenda 2030 para el Desarrollo Sostenible. Sin embargo, una revisión de las políticas oficiales de los principales financiadores del sector sugiere que muchos de ellos aprueban solo parcialmente los hitos de los derechos humanos al agua y el saneamiento. La observación de los flujos de esta cooperación para el sector permite formular la hipótesis de que las desigualdades en el acceso a estos servicios en diferentes partes del mundo pueden reducirse con la aplicación completa y clara del marco de los derechos humanos en las actividades de cooperación para el desarrollo. El artículo presenta los resultados de esta investigación y explora los desafíos de la cooperación para el desarrollo del sector de agua y aguas residuales que son relevantes para impactar tanto negativamente cuanto positivamente a los derechos humanos.

  14. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    PubMed

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  15. Identification of Calcium Sulphoaluminate Formation between Alunite and Limestone

    PubMed Central

    Kim, Hyung-Seok; Han, Gi-Chun; Ahn, Ji-Whan; Cho, Kye-Hong; Cho, Hee-Chan

    2009-01-01

    This study was carried out to identify the conditions of formation of calcium sulphoaluminate (3CaO·3Al2O3·CaSO4) by the sintering of a limestone (CaCO3) and alunite [K2SO4·Al2(SO4)3·4Al(OH)3] mixture with the following reagents: K2SO4, CaCO3, Al(OH)3, CaSO4·2H2O, and SiO2. When K2SO4, CaCO3, Al(OH)3, CaSO4·2H2O were mixed in molar ratios of 1:3:6:3 and sintered at 1,200∼1,300 °C, only 3CaO·3Al2O3·CaSO4 and calcium langbeinite (2CaSO4·K2SO4) were generated. With an amount of CaO that is less than the stoichiometric molar ratio, 3CaO·3Al2O3·CaSO4 was formed and anhydrite (CaSO4) did not react and remained behind. With the amount of CaSO4 that is less than the stoichiometric molar ratio, the amounts of 3CaO·3Al2O3·CaSO4 and 2CaSO4·K2SO4 decreased, and that of CaO·Al2O3 increased. In the K2SO4-CaO-Al2O3-CaSO4-SiO2 system, to stabilize the formation of 3CaO·3Al2O3·CaSO4, 2CaSO4·K2SO4, and β-2CaO·SiO2, the molar ratios of CaO: Al2O3: CaSO4 must be kept at 3:3:1 and that of CaO/SiO2, over 2.0; otherwise, the generated amount of 3CaO·3Al2O3·CaSO4 decreased and that of gehlenite (2CaO·Al2O3·SiO2) with no hydration increased quantitatively. Therefore, if all SO3(g) generated by the thermal decomposition of alunite reacts with CaCO3 (or CaO, the thermal decomposition product of limestone) to form CaSO4 in an alunite- limestone system, 1 mol of pure alunite reacts with 6 mol of limestone to form 1 mol of 3CaO·3Al2O3·CaSO4 and 1 mol of 2CaSO4·K2SO4. PMID:22346687

  16. Electro-Deposited Primer Development and Low-Polluting Primer Evaluation

    DTIC Science & Technology

    1989-08-01

    in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oD𔃺t- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V

  17. Design of a Percussion and Electric Primer Gun Firing Power Supply

    DTIC Science & Technology

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  18. ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

    PubMed

    Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

    2017-10-01

    ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    PubMed

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  20. Aluminum Rich Epoxy Primer for Ground and Air Vehicles

    DTIC Science & Technology

    2017-03-01

    UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements

  1. A primer on safety performance measures for the transportation planning process

    DOT National Transportation Integrated Search

    2009-09-01

    This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...

  2. Primer on consumer marketing research : procedures, methods, and tools

    DOT National Transportation Integrated Search

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  3. Kinetics Study on the Effect of NaCl on the CaSO4 Dissolution Behavior

    NASA Astrophysics Data System (ADS)

    Song, Jingyao; Shi, Peiyang; Wang, Yeguang; Jiang, Maofa

    2018-01-01

    The study of the dissolution kinetics of CaSO4 is essential for the control of the dissolution and recrystallization behavior of CaSO4. In this work, the kinetic behavior of CaSO4 dissolved in NaCl solution was investigated by means of conductivity meter. The results show that with the increase of concentration of NaCl, the temperature rise and the time prolonged, the dissolution rate of dihydrate CaSO4 gradually increases, and the dissolved apparent activation energy is gradually decreased. When the NaCl concentration is 1.8%, the dissolution kinetic equation is 1-(1-α) 1/3=5.46*10-4exp (-9147/RT) t; When the NaCl concentration is 3.0%, the dissolution kinetic equation is 1-(1-α) 1/3=2.81×10-4 exp (-6753/RT)t; When the NaCl concentration is 3.6%, the dissolution kinetic equation is 1-(1-α) 1/3=3.07×l0-4exp(-6103/RT)t.

  4. Antibacterial Effect and Tensile Bond Strength of Self-etching Adhesive Resins with and without Methacryloyloxydodecylpyridinium Bromide: An in vitro Study.

    PubMed

    Krishnamurthy, Madhuram; Kumar, V Naveen; Leburu, Ashok; Dhanavel, Chakravarthy; Selvendran, Kasiswamy E; Praveen, Nehrudhas

    2018-04-01

    Aim: The aim of the present study was to compare the antibacterial activity of a self-etching primer containing antibacterial monomer methacryloyloxydodecylpyridinium bromide (MDPB) (Clearfil protect bond) with a conventional self-etching primer without MDPB (Clearfil SE bond) against Streptococcus mutans and the effect of incorporation of MDPB on the tensile bond strength of the experimental self-etching primer (Clearfil protect bond). Materials and methods: The antibacterial activity of the self-etching primers was assessed using agar disk diffusion method and the diameters of the zones of inhibition were measured and ranked. For tensile bond strength testing, 20 noncarious human molars were selected and randomly divided into two groups comprising 10 teeth in each group. Group I specimens were treated with Clearfil SE bond (without MDPB). Group II specimens were treated with Clearfil protect bond (with MDPB). Composite material was placed incrementally and cured for 40 seconds in all the specimens. Tensile bond strength was estimated using the Instron Universal testing machine at a crosshead speed of 1 mm/min. Results: The addition of MDPB into a self-etching primer exerts potential antibacterial effect against S. mutans. The tensile bond strength of MDPB containing self-etching primer was slightly lower than that of the conventional self-etching Clearfil protect bond primer, but the difference was not statistically significant. Conclusion: Thus, a self-etching primer containing MDPB will be a boon to adhesive dentistry as it has bactericidal property with adequate tensile bond strength. Clinical significance: The concept of prevention of extension in adhesive dentistry would result in micro/nanoleakage due to the presence of residual bacteria in the cavity. Self-etching primers with MDPB would improve the longevity of such restorations by providing adequate antibacterial activity without compromising the bond strength. Keywords: Antibacterial property, Methacryloyloxydodecy-lpyridinium bromide, Self-etching primers, Tensile bond strength.

  5. Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

    PubMed

    Lee, Chang Soo; Lee, Jiyoung

    2010-09-01

    A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

  6. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

  7. Primer design for a prokaryotic differential display RT-PCR.

    PubMed Central

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-01-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

  8. Primer design for a prokaryotic differential display RT-PCR.

    PubMed

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  9. Primer and platform effects on 16S rRNA tag sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tremblay, Julien; Singh, Kanwar; Fern, Alison

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  10. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  11. Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

    PubMed

    Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

    2006-01-01

    A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

  12. Considerations for high occupancy vehicle (HOV) to high occupancy toll (HOT) lanes conversions primer.

    DOT National Transportation Integrated Search

    2007-09-01

    This primer presents key issues and challenges related to the conversion of high occupancy vehicle (HOV) lanes to high occupancy toll (HOT) lanes. The primer is intended for community leaders, administrators, : the public, and other stakeholders resp...

  13. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.; Mowrey, C.; Reis, E.

    1985-01-01

    Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

  14. Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

    PubMed Central

    Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

    2007-01-01

    Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

  15. A method for predicting service life of zinc rich primers on carbon steel

    NASA Technical Reports Server (NTRS)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  16. The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.

    PubMed

    Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore

    2018-01-01

    To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

    PubMed Central

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

    2014-01-01

    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

  18. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  19. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    PubMed

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  20. The self primer of the long terminal repeat retrotransposon Tf1 is not removed during reverse transcription.

    PubMed

    Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L

    2006-08-01

    The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.

  1. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  2. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    NASA Astrophysics Data System (ADS)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  4. Multiplex primer prediction software for divergent targets

    PubMed Central

    Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

    2009-01-01

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

  5. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    PubMed

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  6. Shear bond strengths of an indirect composite layering material to a tribochemically silica-coated zirconia framework material.

    PubMed

    Iwasaki, Taro; Komine, Futoshi; Fushiki, Ryosuke; Kubochi, Kei; Shinohara, Mitsuyo; Matsumura, Hideo

    2016-01-01

    This study evaluated shear bond strengths of a layering indirect composite material to a zirconia framework material treated with tribochemical silica coating. Zirconia disks were divided into two groups: ZR-PRE (airborne-particle abrasion) and ZR-PLU (tribochemical silica coating). Indirect composite was bonded to zirconia treated with one of the following primers: Clearfil Ceramic Primer (CCP), Clearfil Mega Bond Primer with Clearfil Porcelain Bond Activator (MGP+Act), ESPE-Sil (SIL), Estenia Opaque Primer, MR. Bond, Super-Bond PZ Primer Liquid A with Liquid B (PZA+PZB), and Super-Bond PZ Primer Liquid B (PZB), or no treatment. Shear bond testing was performed at 0 and 20,000 thermocycles. Post-thermocycling shear bond strengths of ZR-PLU were higher than those of ZR-PRE in CCP, MGP+Act, SIL, PZA+PZB, and PZB groups. Application of silane yielded better durable bond strengths of a layering indirect composite material to a tribochemically silica-coated zirconia framework material.

  7. Do we need primer for orthodontic bonding? A randomized controlled trial.

    PubMed

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice. Also this study was powered to ascertain if there was no difference between the 2 groups up to 5%, however orthodontists may consider a change in the bracket failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown statistically to be non-inferior to bonding with primer (P =0.08). There was no significant difference in bond-up times. Bond failure was more likely to happen at the composite-enamel interface when bonded without a primer. No conflict of interest for all authors. No funding sources were used. Study was not registered on external databases. © The Author 2014. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  8. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    USGS Publications Warehouse

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  9. Innovations in bonding to zirconia-based materials. Part II: Focusing on chemical interactions.

    PubMed

    Aboushelib, Moustafa N; Mirmohamadi, Hesam; Matinlinna, Jukka P; Kukk, Edwin; Ounsi, Hani F; Salameh, Ziad

    2009-08-01

    The zirconia-resin bond strength was enhanced using novel engineered zirconia primers in combination with selective infiltration etching as a surface pre-treatment. The aim of this study was to evaluate the effect of artificial aging on the chemical stability of the established bond and to understand the activation mechanism of the used primers. Selective infiltration etched zirconia discs (Procera; NobelBiocare) were coated with one of four novel engineered zirconia primers containing reactive monomers and were bonded to resin-composite discs (Panavia F2.0). Fourier transform infrared spectroscopy (FT-IR) was carried out to examine the chemical activation of zirconia primers from mixing time and up to 60min. The bilayered specimens were cut into microbars (1mm(2) in cross-section area) and zirconia-resin microtensile bond strength (MTBS) was evaluated immediately and after 90 days of water storage at 37 degrees C. Scanning electron microscopy (SEM) was used to analyze the fracture surface. There was a significant drop in MTBS values after 90 days of water storage for all tested zirconia primers from ca. 28-41MPa to ca. 15-18MPa after completion of artificial aging. SEM revealed increase in percentage of interfacial failure after water storage. FTIR spectra suggested adequate activation of the experimental zirconia primers within 1h of mixing time. The novel engineered zirconia primers produced initially high bond strength values which were significantly reduced after water storage. Long-term bond stability requires developing more stable primers.

  10. PD5: a general purpose library for primer design software.

    PubMed

    Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

  11. Shop primer as part of the corrosion protective coating for submerged steel structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bjordal, M.; Steinsmo, U.

    In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less

  12. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  13. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  14. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  15. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  16. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  17. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    EPA Science Inventory

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  18. A Primer on Sampling for Statewide Assessment.

    ERIC Educational Resources Information Center

    Jaeger, Richard M.

    This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

  19. GSP: A web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  20. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  1. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  2. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.

    1985-01-01

    Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.

  3. Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

    PubMed Central

    Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

    2006-01-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

  4. The Self Primer of the Long Terminal Repeat Retrotransposon Tf1 Is Not Removed during Reverse Transcription

    PubMed Central

    Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.

    2006-01-01

    The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283

  5. Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

    PubMed

    Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

    2006-12-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

  6. Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).

    PubMed

    Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K

    2012-06-01

    Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals.

  7. Multiplexing Short Primers for Viral Family PCR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S N; Hiddessen, A L; Hara, C A

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

  8. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  9. swga: a primer design toolkit for selective whole genome amplification.

    PubMed

    Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

    2017-07-15

    Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  10. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    PubMed

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  11. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  12. Molecular Tools for the Detection of Nitrogen Cycling Archaea

    PubMed Central

    Rusch, Antje

    2013-01-01

    Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

  13. Comparison of the antibacterial activity of different self-etching primers and adhesives.

    PubMed

    Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray

    2008-11-01

    The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other adhesive systems, Clearfil Protect Bond Primer (containing MDPB) showed a high antibacterial effect against all microorganizms tested. Two-step, self-etching primer/adhesive system Clearfil Protect Bond might be a suitable choice under minimally invasive restorations. The recently developed one-step, self-etching system Clearfil Tri S Bond showed no antibacterial effect against microorgazims tested.

  14. Bonding to new CAD/CAM resin composites: influence of air abrasion and conditioning agents as pretreatment strategy.

    PubMed

    Reymus, Marcel; Roos, Malgorzata; Eichberger, Marlis; Edelhoff, Daniel; Hickel, Reinhard; Stawarczyk, Bogna

    2018-04-27

    Because of their industrially standardized process of manufacturing, CAD/CAM resin composites show a high degree of conversion, making a reliable bond difficult to achieve. The purpose of this experiment was to investigate the tensile bond strength (TBS) of luting composite to CAD/CAM resin composite materials as influenced by air abrasion and pretreatment strategies. The treatment factors of the present study were (1) brand of the CAD/CAM resin composite (Brilliant Crios [Coltene/Whaledent], Cerasmart [GC Europe], Shofu Block HC [Shofu], and Lava Ultimate [3M]); (2) air abrasion vs. no air abrasion; and (3) pretreatment using a silane primer (Clearfil Ceramic Primer, Kuraray) vs. a resin primer (One Coat 7 Universal, Coltene/Whaledent). Subsequently, luting composite (DuoCem, Coltene/Whaledent) was polymerized onto the substrate surface using a mold. For each combination of the levels of the three treatment factors (4 (materials) × 2 (air abrasion vs. no air abrasion; resin) × 2 (primer vs. silane primer)), n = 15, specimens were prepared. After 24 h of water storage at 37 °C and 5000 thermo-cycles (5/55 °C), TBS was measured and failure types were examined. The resulting data was analyzed using Kaplan-Meier estimates of the cumulative failure distribution function with Breslow-Gehan tests and non-parametric ANOVA (Kruskal-Wallis test) followed by the multiple pairwise Mann-Whitney U test with α-error adjustment using the Benjamini-Hochberg procedure and chi-square test (p < 0.05). The additional air abrasion step increased TBS values and lowered failure rates. Specimens pretreated using a resin primer showed significantly higher TBS and lower failure rates than those pretreated using a silane primer. The highest failure rates were observed for groups pretreated with a silane primer. Within the Shofu Block HC group, all specimens without air abrasion and pretreatment with a silane primer debonded during the aging procedure. Before fixation of CAD/CAM resin composites, the restorations should be air abraded and pretreated using a resin primer containing methyl-methacrylate to successfully bond to the luting composite. The pretreatment of the CAD/CAM resin composite using merely a silane primer results in deficient adhesion. For a reliable bond of CAD/CAM resin composites to the luting composite, air abrasion and a special pretreatment strategy are necessary in order to achieve promising long-term results.

  15. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

  16. Towards a C2 Poly-Visualization Tool: Leveraging the Power of Social-Network Analysis and GIS

    DTIC Science & Technology

    2011-06-01

    from Magsino.14 AutoMap, a product of CASOS at Carnegie Mellon University, is a text-mining tool that enables the extraction of network data from...enables community leaders to prepare for biological attacks using computational models. BioWar is a CASOS package that combines many factors into a...models, demographically accurate agent modes, wind dispersion models, and an error-diagnostic model. Construct, also developed by CASOS , is a

  17. Impulsive excitation of mechanoluminescence in gamma-irradiated CaSO4:Eu phosphors

    NASA Astrophysics Data System (ADS)

    Kher, R. S.; Dhoble, S. J.; Pandey, R. K.; Upadhyay, A. K.; Khokhar, M. S. K.

    2011-01-01

    The mechanoluminescence (ML) and thermoluminescence (TL) of γ-irradiated CaSO4:Eu phosphor have been studied. CaSO4 samples having different concentrations of Eu were prepared by dissolving CaSO4.2H2O in sulphuric acid and evaporating the excess acid around 300 °C. ML was excited impulsively by dropping a load onto the sample. Three distinct peaks have been observed in the ML intensity versus time curve. The ML intensity increases with the increasing concentration of the dopant. The effect of temperature on the shape and peak of ML intensity was also recorded. Growth, saturation and broadening in an ML peak were observed. TL glow curves of CaSO4:Eu phosphors at different concentrations contain two TL peaks: the first peak was observed at around 110 °C and the other at 210 °C. Experimental results suggest that the ML excitation is related to the movement of dislocation with defect centres, the increase in ML with temperature is due to the enhancement in dislocation capture probability, and the reduction is due to the thermal bleaching of defect centres.

  18. Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

    PubMed Central

    Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

    2003-01-01

    A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

  19. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes - EPA 910-C-12-001

    EPA Science Inventory

    This primer provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entities in implementing the E...

  20. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  1. Reading Assessment: A Primer for Teachers and Tutors.

    ERIC Educational Resources Information Center

    Caldwell, JoAnne Schudt

    This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

  2. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    USDA-ARS?s Scientific Manuscript database

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  3. 40 CFR 63.3091 - What emission limits must I meet for an existing affected source?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... bonding primer, and glass bonding adhesive operations plus all coatings and thinners, except for deadener materials and for adhesive and sealer materials that are not components of glass bonding systems, used in... from primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive...

  4. Murrinh Nganki (Our Language), 1.

    ERIC Educational Resources Information Center

    Street, Chester; And Others

    This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

  5. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    ERIC Educational Resources Information Center

    Pine, Daniel S.

    2006-01-01

    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  6. Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

    PubMed

    Robertson, Amber L; Phillips, Allison R

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

  7. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    PubMed Central

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  8. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  9. Identification of cultivars and validation of genetic relationships in Mangifera indica L. using RAPD markers.

    PubMed

    Schnell, R J; Ronning, C M; Knight, R J

    1995-02-01

    Twenty-five accessions of mango were examined for random amplified polymorphic DNA (RAPD) genetic markers with 80 10-mer random primers. Of the 80 primers screened, 33 did not amplify, 19 were monomorphic, and 28 gave reproducible, polymorphic DNA amplification patterns. Eleven primers were selected from the 28 for the study. The number of bands generated was primer- and genotype-dependent, and ranged from 1 to 10. No primer gave unique banding patterns for each of the 25 accessions; however, ten different combinations of 2 primer banding patterns produced unique fingerprints for each accession. A maternal half-sib (MHS) family was included among the 25 accessions to see if genetic relationships could be detected. RAPD data were used to generate simple matching coefficients, which were analyzed phenetically and by means of principal coordinate analysis (PCA). The MHS clustered together in both the phenetic and the PCA while the randomly selected accessions were scattered with no apparent pattern. The uses of RAPD analysis for Mangifera germ plasm classification and clonal identification are discussed.

  10. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    PubMed

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  11. Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

    PubMed Central

    Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

    2017-01-01

    Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

  12. Rapid identification of red-flesh loquat cultivars using EST-SSR markers based on manual cultivar identification diagram strategy.

    PubMed

    Li, X Y; Xu, H X; Chen, J W

    2014-04-29

    Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.

  13. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    PubMed Central

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-01-01

    Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

  14. Effect of thione primers on adhesive bonding between an indirect composite material and Ag-Pd-Cu-Au alloy.

    PubMed

    Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki

    2014-01-01

    The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.

  15. Comparison of the Chromium Distribution in New Super Koropon Primer to 30 Year Old Super Koropon Using Focused Ion Beam/Scanning Electron Microscopy

    NASA Technical Reports Server (NTRS)

    Lomness, Janice K.; Calle, Luz Marina

    2006-01-01

    Super Koropon primer (MB0125-055) plays a significant role in the corrosion protection of areas throughout the Orbiter. Because the Shuttle Program relies so heavily upon the performance of the Koropon primer, it is necessary to fully understand all aspects of the behavior of the coating. One area where little understanding of the Koropon primer still exists is the level of risk associated with age related degradation. Recently, efforts were undertaken to better understand the age life of the Koropon primer and to gain some insight into the aging process of this coating. In that study, an aluminum access panel from the Orbiter Enterprise was used to investigate the performance of the old Koropon film. A control panel was also used to study the performance of new Koropon coating. Preliminary investigations into the performance of aged Super Koropon primer indicated a significant decrease in corrosion protection. This investigation serves as an example of how Focused Ion Beam/Scanning Microscopy can be used to characterize the changes that occur as coatings age.

  16. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matamala, G.; Droguett, G.; Smeltzer, W.

    1994-04-01

    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less

  17. The Choice of PCR Primers Has Great Impact on Assessments of Bacterial Community Diversity and Dynamics in a Wastewater Treatment Plant

    PubMed Central

    Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie

    2013-01-01

    Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498

  18. Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

    PubMed

    Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

    2014-11-01

    In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. DNA polymerase preference determines PCR priming efficiency.

    PubMed

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

  20. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    PubMed

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  1. Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

    PubMed

    Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

    1997-05-02

    Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

  2. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  3. Planificación Neuroquirúrgica con Software Osirix

    PubMed Central

    Jaimovich, Sebastián Gastón; Guevara, Martin; Pampin, Sergio; Jaimovich, Roberto; Gardella, Javier Luis

    2014-01-01

    Introducción: La individualidad anatómica es clave para reducir el trauma quirúrgico y obtener un mejor resultado. Actualmente, el avance en las neuroimágenes ha permitido objetivar esa individualidad anatómica, permitiendo planificar la intervención quirúrgica. Con este objetivo, presentamos nuestra experiencia con el software Osirix. Descripción de la técnica: Se presentan 3 casos ejemplificadores de 40 realizados. Caso 1: Paciente con meningioma de la convexidad parasagital izquierda en área premotora; Caso 2: Paciente con macroadenoma hipofisario, operada previamente por vía transeptoesfenoidal en otra institución con una resección parcial; Caso 3: Paciente con lesiones en pedúnculo cerebeloso medio bilateral. Se realizó la planificación prequirúrgica con el software OsiriX, fusionando y reconstruyendo en 3D las imágenes de TC e IRM, para analizar relaciones anatómicas, medir distancias, coordenadas y trayectorias, entre otras funciones. Discusión: El software OsiriX de acceso libre y gratuito permite al cirujano, mediante la fusión y reconstrucción en 3D de imágenes, analizar la anatomía individual del paciente y planificar de forma rápida, simple, segura y económica cirugías de alta complejidad. En el Caso 1 se pudo analizar las relaciones del tumor con las estructuras adyacentes para minimizar el abordaje. En el Caso 2 permitió comprender la anatomía post-operatoria previa del paciente, para determinar la trayectoria del abordaje transnasal endoscópico y la necesidad de ampliar su exposición, logrando la resección tumoral completa. En el Caso 3 permitió obtener las coordenadas estereotáxicas y trayectoria de una lesión sin representación tomográfica. Conclusión: En casos de no contar con costosos sistemas de neuronavegación o estereotáxia el software OsiriX es una alternativa a la hora de planificar la cirugía, con el objetivo de disminuir el trauma y la morbilidad operatoria. PMID:25165617

  4. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  5. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    PubMed Central

    Raji, S. Hamid; Ghorbanipour, Reza; Majdzade, Fateme

    2011-01-01

    Background: The aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride-releasing self-etch primer (clearfil protect bond) and compare it with transbond plus self-etch primer and conventional acid etching and priming system. Materials and Methods: Forty-eight extracted human premolars were divided randomly to three groups. In group 1, the teeth were bonded with conventional acid etching and priming method. In group 2, the teeth were bonded with clearfil protect bond self-etch primer, and transbond plus self-etch primer was used to bond the teeth in group 3. The samples were stored in 37°C distilled water and thermocycled. Then, the SBS of the sample was evaluated with Zwick testing machine. Descriptive statistics and the analysis of variances (ANOVA) and Tukey's test and Kruskal-Wallis were used to analyze the data. Results: The results of the ANOVA showed that the mean of group 3 was significantly lower than that of other groups. Most of the sample showed a pattern of failure within the adhesive resin. Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel. PMID:23372605

  6. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  7. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    ERIC Educational Resources Information Center

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  8. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-03-12

    clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  9. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-01-04

    clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  10. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  11. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Treesearch

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  12. Newly developed primers for complete YCF1 amplification in Pinus (Pinaceae) chloroplasts with possible family-wide utility

    Treesearch

    Matthew Parks; Aaron Liston; Rich Cronn

    2011-01-01

    Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...

  13. The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

    ERIC Educational Resources Information Center

    Schubert, Sandra; Zelinsky, Benjamin

    Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

  14. Primer ID Validates Template Sampling Depth and Greatly Reduces the Error Rate of Next-Generation Sequencing of HIV-1 Genomic RNA Populations

    PubMed Central

    Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr

    2015-01-01

    ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299

  15. X-ray absorption spectroscopy and X-ray photoelectron spectroscopy studies of CaSO 4:Dy thermoluminescent phosphors

    NASA Astrophysics Data System (ADS)

    Bakshi, A. K.; Jha, S. N.; Olivi, L.; Phase, D. M.; Kher, R. K.; Bhattacharyya, D.

    2007-11-01

    Extended X-ray absorption fine structure (EXAFS) measurements have been carried out on CaSO4:Dy phosphor samples at the Dy L3 edge with synchrotron radiation. Measurements were carried out on a set of samples which were subjected to post-preparation annealing at different temperatures and for different cycles. The EXAFS data have been analysed to find the Dy-S and Dy-O bond lengths in the neighbourhood of the Dy atoms in a CaSO4 matrix. The observations from EXAFS measurements were verified with XANES and XPS techniques. On the basis of these measurements, efforts were made to explain the loss of thermoluminescence sensitivity of CaSO4:Dy phosphors after repeated cycles of annealing at 400 °C in air for 1 h.

  16. Effects of Partial Substitutions of NaCl with KCl, CaSO4 and MgSO4 on the Quality and Sensorial Properties of Pork Patties.

    PubMed

    Davaatseren, Munkhtugs; Chun, Ji-Yeon; Cho, Hyung-Yong; Min, Sang-Gi; Choi, Mi-Jung

    2014-01-01

    This study investigated the effects of NaCl replacers (KCl, CaSO4, and MgSO4) on the quality and sensorial properties of pork patty. In the characteristics of spray-dried salt particles, KCl showed the largest particle size with low viscosity in solution. Meanwhile CaSO4 treatment resulted in the smallest particle size and the highest viscosity (p<0.05). In comparison of the qualities of pork patties manufactured by varying level of Na replacers, MgSO4 treatment exhibited low cooking loss comparing to control (p<0.05). Textural properties of KCl and MgSO4 treatments showed similar pattern, i.e., low level of the replacers caused harder and less adhesive texture than those of control (p<0.05), whereas the hardness of these products was not different with control when the replacers were added more than 1.0%. The addition of CaSO4 also manifested harder and less adhesive than control (p<0.05), but the textural properties of CaSO4 treatment was not affected by level of Ca-salt. Eventually, sensorial properties indicated that KCl and CaSO4 influenced negative effects on pork patties. In contrast, MgSO4 showed better sensorial properties in juiciness intensity, tenderness intensity as well as overall acceptability than control, reflecting that MgSO4 was an effective Na-replacer in meat product formulation.

  17. Spatial distribution of tuberculosis in a municipality in the interior of São Paulo, 2008-2013.

    PubMed

    Fusco, Alcione Pereira Biffi; Arcêncio, Ricardo Alexandre; Yamamura, Mellina; Palha, Pedro Fredemir; Reis, Amanda Alessandra Dos; Alecrim, Tatiana Ferraz de Araújo; Protti, Simone Teresinha

    2017-06-05

    to describe the epidemiological clinical profile of tuberculosis and analyze the spatial distribution of cases in a municipality in the state of São Paulo. descriptive and ecological study of cases of tuberculosis through the records in an information system. Descriptive statistics were used to calculate central tendency (mean) and chi-square test, with Yates correction or Fisher exact test, when necessary. The Kernel technique was also used to calculate the occurrence densities of tuberculosis cases, using a radius of 1000 meters. Type I error was set at 5%. 299 cases of tuberculosis were identified, with 290 (96.98%) being geocoded. The majority of these were male (n = 212; 70.91%), median age 40 years, and the pulmonary clinical form was predominant (n = 244, 81.60%). The distribution occurred in a non-random manner, observing important areas of the municipality with a higher density of cases of the disease. the study evidenced an epidemiological profile of tuberculosis cases similar to those in the literature; however, their distribution does not occur in a random manner, pointing to specific population groups that require greater management and planning of health services for the control of tuberculosis. caracterizar o perfil clínico epidemiológico da tuberculose (TB) e analisar a distribuição espacial dos casos em município paulista. estudo descritivo e ecológico dos casos de tuberculose registrados em um sistema de informação. Recorreu-se à estatística descritiva com cálculo de medidas de tendência central (média) e aplicação do teste qui-quadrado, com correção de Yates ou teste exato de Fisher, quando necessários. Aplicou-se ainda a técnica de Kernel para o cálculo das densidades de ocorrência dos casos da TB, utilizando um raio de 1000 metros. Fixou-se o erro tipo I em 5%. identificou-se 299 casos de TB, sendo geocodificados 290 (96,98%). A maioria destes foi do sexo masculino (n=212; 70,91%), idade mediana 40 anos, sendo a forma clínica pulmonar predominante (n=244; 81,60%). A distribuição ocorreu de forma não aleatória, observando-se áreas importantes do município com maior densidade de casos da doença. o estudo evidenciou perfil epidemiológico dos casos de tuberculose semelhante ao da literatura, no entanto, a distribuição dos mesmos não ocorre de forma aleatória, apontando grupos específicos da população que necessitam de maior gestão e planejamento dos serviços de saúde para o controle da tuberculose. caracterizar el perfil epidemiológico clínico de tuberculosis y analizar la distribución espacial de casos en un municipio paulista. Estudio descriptivo y ecológico de casos de tuberculosis registrados en un sistema de información. Se utilizó estadística descriptiva con medidas de tendencia central (media) y aplicación de chi-cuadrado, con correlación de Yates o prueba exacta de Fisher según necesidad. Para el calcular la densidad en la ocurrencia de casos de tuberculosis, se aplicó la técnica uniforme Kernel utilizando una distancia de 1000 metros. El error de tipo I fue fijado en 5%. Se identificaron 299 casos de tuberculosis, siendo geocodificados 290 (96.98%). La mayoría de los casos fueron de sexo masculino (n=212; 70,91%), con edad mediana de 40 años, siendo la forma pulmonar la más predominante (n=244; 81,60%). La distribución de casos fue forma no aleatoria, identificando áreas del municipio con mayor densidad de casos con esta patología. el perfil epidemiológico de casos de tuberculosis observado fue similar a lo observado en la literatura, aunque la distribución de estos no ocurre de manera aleatoria, identificando grupos específicos de la población los cuales requieren de mayores gestión y planificación en los servicios de salud para el control de la tuberculosis.

  18. Effects of dual antibacterial agents MDPB and nano-silver in primer on microcosm biofilm, cytotoxicity and dentin bond properties

    PubMed Central

    Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.

    2013-01-01

    Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889

  19. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    PubMed Central

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  20. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-09-29

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

  1. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  2. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  4. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  5. Genetic diversity of Palestine landraces of faba bean (Vicia faba) based on RAPD markers.

    PubMed

    Basheer-Salimia, R; Shtaya, M; Awad, M; Abdallah, J; Hamdan, Y

    2013-09-03

    Until now, neither phenotypic nor molecular approaches have been used to characterize the landraces of Palestine faba beans (Vicia faba). We used PCR-based RAPD markers to determine the genetic diversity and relatedness among 26 Palestinian faba bean landraces (traditional farmers' varieties) from 8 localities in the West Bank, Palestine. In tests with 37 primers, 14 generated no polymorphic bands, 12 exhibited weak and unclear products, and 11 primers produced good amplification products with high intensity and pattern stability. Ninety-four DNA fragments (loci) were detected, with an average of 8.54 loci per primer and size ranging from 160 to 1370 bp. A minimum of 4 and a maximum of 14 DNA fragments were obtained using (OPA-05 and OPA-09) and (BC-261) primers, respectively. The maximum percentage of polymorphic markers was 71.4 (BC-298) and the minimum was 50.0 (OPA-05, -09, -16). The 11 primers exhibited relatively high collective resolving power (Rp) values of 26.316, and varied from 0.154 for the OPA-09 primer to 5.236 for the BC-261, with an overall mean of 2.392. The primers BC-261, -322, and -298 were found to be the most useful RAPD primers to assess the genetic diversity of Palestinian faba beans, as they revealed relatively high Rp rates (5.236, 3.618, and 3.150, respectively). Based on the Jaccard coefficient, the genetic distance ranged from 0.358 to 0.069, with a mean of 0.213. We conclude that the RAPD technique is useful for determining genetic diversity and for developing suitable fingerprints for faba bean landraces grown in Palestine.

  6. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  7. Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

    PubMed

    Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

    2007-01-01

    Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

  8. Information theory-based algorithm for in silico prediction of PCR products with whole genomic sequences as templates.

    PubMed

    Cao, Youfang; Wang, Lianjie; Xu, Kexue; Kou, Chunhai; Zhang, Yulei; Wei, Guifang; He, Junjian; Wang, Yunfang; Zhao, Liping

    2005-07-26

    A new algorithm for assessing similarity between primer and template has been developed based on the hypothesis that annealing of primer to template is an information transfer process. Primer sequence is converted to a vector of the full potential hydrogen numbers (3 for G or C, 2 for A or T), while template sequence is converted to a vector of the actual hydrogen bond numbers formed after primer annealing. The former is considered as source information and the latter destination information. An information coefficient is calculated as a measure for fidelity of this information transfer process and thus a measure of similarity between primer and potential annealing site on template. Successful prediction of PCR products from whole genomic sequences with a computer program based on the algorithm demonstrated the potential of this new algorithm in areas like in silico PCR and gene finding.

  9. Hexavalent Chromium IV-Free Primer Development

    NASA Technical Reports Server (NTRS)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  10. Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

    PubMed

    Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

    2005-12-01

    Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

  11. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  12. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  13. In vitro cytotoxicity of orthodontic primers.

    PubMed

    D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa

    2009-01-01

    The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.

  14. Defense Primer: A Guide for New Members

    DTIC Science & Technology

    2017-03-03

    1 President’s Constitutional Authority with Regard to the Armed Forces ................................... 1 The Department of Defense ...primers to give Members of Congress an overview of key aspects of the Department of Defense and how Congress exercises authority over it. A consolidated...for New Members Congressional Research Service 2 The Department of Defense CRS In Focus IF10543, Defense Primer: The Department of Defense , by

  15. Genome-wide characterization and selection of expressed sequence tag simple sequence repeat primers for optimized marker distribution and reliability in peach

    USDA-ARS?s Scientific Manuscript database

    Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...

  16. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  17. 40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi= solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

  18. 40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi= solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

  19. 40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi = solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

  20. Metastable Intermolecular Composites (MIC) Primers for Small Caliber Cartridges and Cartridge Actuated Devices

    DTIC Science & Technology

    2009-07-01

    24 iii ACRONYMS AND ABBREVIATIONS ATF Armaments Technology Facility ATK Alliant Techsystems, Inc. ARDEC Armament Research...Technology Facility ( ATF ) firings there, and was instrumental in producing the primers and loading the cartridges needed for the supplemental...and CADs known as the percussion primer. The novel properties associated with nanostructure materials have resulted in the development of thermite

  1. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  2. Molecular Genetic Studies of Bone Mechanical Strain and of Pedigrees with Very High Bone Density

    DTIC Science & Technology

    2009-11-01

    mice. We used Cre-recombinase primer (F- TTA GCA CCA CGG CAG CAG GAG GTT and R-CAG GCC AGA TCT CCT GTG CAG CAT) and loxp primer (Primer 1, AGT GAT...Leprdb heterozygotes during breeding. Three types of littermates are produced from breeding these heterozygotes: the misty gray homozygote (m +/m +), the

  3. BchY-based degenerate primers target all types of anoxygenic photosynthetic bacteria in a single PCR.

    PubMed

    Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded

    2009-12-01

    To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.

  4. Electrocoat Process for Non-Chromate Primers in DoD Manufacturing

    DTIC Science & Technology

    2011-02-01

    requirements are uniquely  suited for aerospace  aluminum. ↑ O2 ↑ H2 Anode (+) Cathode (-) Deposited Film Alkaline  clean Rinse ElectrocoatSurface...Objectives ● Demonstration and validation of a novel, non‐chromated,  environmentally friendly,  electrodeposited  primer. ● The primers will be

  5. Universal primers for amplification of the complete mitochondrial control region in marine fish species.

    PubMed

    Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

    2012-01-01

    Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

  6. FUNGAL BIOGEOGRAPHY. Response to Comment on "Global diversity and geography of soil fungi".

    PubMed

    Tedersoo, Leho; Bahram, Mohammad; Põlme, Sergei; Anslan, Sten; Riit, Taavi; Kõljalg, Urmas; Nilsson, R Henrik; Hildebrand, Falk; Abarenkov, Kessy

    2015-08-28

    Schadt and Rosling (Technical Comment, 26 June 2015, p. 1438) argue that primer-template mismatches neglected the fungal class Archaeorhizomycetes in a global soil survey. Amplicon-based metabarcoding of nine barcode-primer pair combinations and polymerase chain reaction (PCR)-free shotgun metagenomics revealed that barcode and primer choice and PCR bias drive the diversity and composition of microorganisms in general, but the Archaeorhizomycetes were little affected in the global study. We urge that careful choice of DNA markers and primers is essential for ecological studies using high-throughput sequencing for identification. Copyright © 2015, American Association for the Advancement of Science.

  7. Primer on spontaneous heating and pyrophoricity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardousmore » material training.« less

  8. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  9. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    PubMed

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  10. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  11. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    USGS Publications Warehouse

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  12. DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

    PubMed

    Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

    2009-01-01

    * At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

  13. Genetic diversity analysis of tree peony germplasm using iPBS markers.

    PubMed

    Duan, Y B; Guo, D L; Guo, L L; Wei, D F; Hou, X G

    2015-07-06

    We examined the genetic diversity of 10 wild species (populations) and 55 varieties of tree peony using inter-primer binding site (iPBS) markers. From a total of 36 iPBS primers, 16 were selected based on polymorphic amplification. The number of bands amplified by each primer ranged from 9 to 19, with an average of 12.88 bands per primer. The length of bands ranged from 100 to 2000 bp, concentrated at 200 to 1800 bp. Sixteen primers amplified 206 bands in total, of which 173 bands were polymorphic with a polymorphism ratio of 83.98%. Each primer amplified 10.81 polymorphic bands on average. The data were then used to construct a phylogenetic tree using unweighted pair group method with arithmetic mean methods. Clustering analysis showed that the genetic relationships among the varieties were not only related to the genetic background or geographic origin, but also to the flowering phase, flower color, and flower type. Our data also indicated that iPBS markers were useful tools for classifying tree peony germplasms and for tree peony breeding, and the specific bands were helpful for molecular identification of tree peony varieties.

  14. A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

    PubMed Central

    Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

    2015-01-01

    High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

  15. Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

    PubMed

    Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

    2018-02-07

    We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

  16. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

    PubMed

    Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

  17. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    PubMed Central

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  18. A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

    PubMed

    van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

    2008-09-01

    To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

  19. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    NASA Astrophysics Data System (ADS)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  20. A New Primer to Amplify pmoA Gene From NC10 Bacteria in the Sediments of Dongchang Lake and Dongping Lake.

    PubMed

    Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu

    2017-08-01

    Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.

  1. Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

    PubMed Central

    Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander

    2012-01-01

    The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135

  2. Novel priming and crosslinking systems for use with isocyanatomethacrylate dental adhesives.

    PubMed

    Chappelow, C C; Power, M D; Bowles, C Q; Miller, R G; Pinzino, C S; Eick, J D

    2000-11-01

    (a) to design, formulate and evaluate prototype primers and a crosslinking agent for use with isocyanatomethacrylate-based comonomer adhesives and (b) to establish correlations between bond strength and solubility parameter differences between the adhesives and etched dentin, and the permeability coefficients of the adhesives. Equimolar mixtures of 2-isocyanatoethyl methacrylate (IEM) and a methacrylate comonomer were formulated with tri-n-butyl borane oxide (TBBO) as the free radical initiator to have cure times of 6-10 min. Shear bond strengths to dentin were determined for each adhesive mixture (n = 7) using standard testing protocols. Shear bond strengths for the three systems were also determined after application of "reactive primers" to the dentin surface. The "reactive primers" contained 10-20 parts by weight of the respective comonomer mixture and 3.5 parts by weight TBBO in acetone. Solubility parameters difference values (delta delta) and permeability coefficients (P) were approximated for each adhesive system and correlated with shear bond strength values. Additionally, a crosslinking agent was prepared by bulk reaction of an equimolar mixture containing IEM and a methacrylate comonomer. The effects of crosslinker addition on: (a) the setting time of IEM; and (b) the setting times and initiator requirements of selected IEM/comonomer mixtures were determined. Shear bond strength values (MPa): IEM/HEMA 13.6 +/- 2.0 (no primer), 20.1 +/- 2.0 (with primer); IEM/HETMA 9.3 +/- 3.3 (no primer), 20.8 +/- 8.1 (with primer); IEM/AAEMA 13.6 +/- 1.9 (no primer), 17.3 +/- 3.2 (with primer). Also, approximated permeability coefficients showed a significant correlation (r = +0.867, p < 0.001) with shear bond strength values. Crosslinker addition studies with IEM/4-META: (a) at 5-9 mol% reduced the setting time of IEM polymerization by 79%; and (b) at 6 mol% reduced initiator level requirements 60-70% to achieve a comparable setting time, and decreased setting times by ca. 75% for a given initiator level with selected IEM/methacrylate adhesive systems. The shear bond strengths of isocyanatomethacrylate-based dental adhesives can be enhanced by using reactive primers; their setting times and initiator requirements can be improved using a dimethacrylate crosslinker. Approximated permeability coefficients may be useful as indicators of bonding performance for dentin adhesive systems.

  3. Long distance PCR in detection of inversion mutations of F8C gene in hemophilia A patients.

    PubMed

    Poláková, H; Zmetáková, I; Kádasi, L'

    2003-06-01

    In the present paper, the experience with detection of intron 22 inversion of F8C gene in severe hemophilia A patients using a recently described long-distance PCR (LD-PCR) method was reported. To test the sensitivity and the specifity of the LD-PCR, analysis of 46 DNA samples of patients and their family members, previously tested by Southern hybridization, was performed. In addition, 16 DNA samples of severe hemophilia A patients in which causative mutation was unknown, were included in analysis. Four-primers, P, Q, A&B, which are able to differentiate between the affected males with or without the inversion, and in female carriers, were used in LD-PCR. Two primers, P&Q, are located within the F8C gene flanking int22h1. Two further primers, A&B, flank int22h2 and int22h3, extragene homologs of int22h1. Nine combinations of four primers were used to identify the optimal one. Four-primers (P, Q, A&B), three-primers (P,Q & B;P, A & B; A, B & Q;P, Q & A) and two-primers (A & B; P & Q; A & Q; P & B) PCR amplifications were performed in the hemophilia A patients as well as in obligate carriers DNA samples. Successful amplification required introduction of some modifications of the original protocol. The most reproducible and uniform results were obtained using two-primers PCR, performed in four single reactions. Thus, a total of 46 DNA samples, 22 were hemizygous for inversion, 6 without the inversion, 14 carriers and 4 non-carriers of inversion. Perfect correlation between genotypes determined using Southern hybridization and LD-PCR was achieved. The optimalized two-primers LD-PCR protocol was used for analysis of 16 DNA samples of severe hemophilia A patients with unknown mutation. Ten cases of inversions and six cases without them were detected. Thus in additional 10 severe hemophilic patients DNA diagnosis was completed. The most successful and reproducible results were obtained performing four single LD-PCR reactions with combinations of two-primers A & B; P & Q; A&Q, and P&B in each DNA sample and this approach is recommended for routine using in clinical practice.

  4. Treinamento de anastomoses vasculares de baixo custo: o cirurgião vai à feira

    PubMed Central

    Grahem, Hícaro Donato; Teixeira, Renan Kleber Costa; Feijó, Daniel Haber; Yamaki, Vitor Nagai; Valente, André Lopes; Feitosa, Denilson José Silva; dos Reis, José Maciel Calda; de Barros, Rui Sérgio Monteiro

    2017-01-01

    Resumo Anastomoses vasculares são procedimentos comuns realizados por grande parte dos cirurgiões e cujo treinamento ocorre principalmente em seres humanos, contrariando os princípios éticos vigentes. Esse fato se deve, sobretudo, à carência e ao alto custo relacionados aos atuais modelos de treinamento. Assim, este estudo visa avaliar a viabilidade de três vegetais para a realização de anastomoses vasculares. Foram utilizadas cinco unidades de cebolinha, vagem e feijão-verde. Em cada uma tentou-se realizar uma anastomose término-terminal. Conseguiu-se a realização da anastomose apenas na vagem e no feijão-verde. Contudo, por apresentar uma menor espessura, o feijão-verde assemelhou-se mais aos vasos humanos. PMID:29930658

  5. Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

    PubMed

    Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

    2015-10-01

    Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.

  6. The measurement of sulfate mineral solubilities in the Na-K-Ca-Cl-SO 4-H 2O system at temperatures of 100, 150 and 200°C

    NASA Astrophysics Data System (ADS)

    Freyer, Daniela; Voigt, Wolfgang

    2004-01-01

    At T > 100°C development of thermodynamic models suffers from missing experimental data, particularly for solubilities of sulfate minerals in mixed solutions. Solubilities in Na +-K +-Ca 2+-Cl --SO 42-/H 2O subsystems were investigated at 150, 200°C and at selected compositions at 100°C. The apparatus used to examine solid-liquid phase equilibria under hydrothermal conditions has been described. In the system NaCl-CaSO 4-H 2O the missing anhydrite (CaSO 4) solubilities at high NaCl concentrations up to halite saturation have been determined. In the system Na 2SO 4-CaSO 4-H 2O the observed glauberite (Na 2SO 4 · CaSO 4) solubility is higher than that predicted by the high temperature model of Greenberg and Møller (1989), especially at 200°C. At high salt concentrations, solubilities of both anhydrite and glauberite increase with increasing temperature. Stability fields of the minerals syngenite (K 2SO 4 · CaSO 4 · H 2O) and goergeyite (K 2SO 4 · 5 CaSO 4 · H 2O) were determined, and a new phase was found at 200°C in the K 2SO 4-CaSO 4-H 2O system. Chemical and single crystal structure analysis give the formula K 2SO 4 · CaSO 4. The structure is isostructural with palmierite (K 2SO 4 · PbSO 4). The glaserite ("3 K 2SO 4 · Na 2SO 4") appears as solid solution in the system Na 2SO 4-K 2SO 4-H 2O. Its solubility and stoichiometry was determined as a function of solution composition.

  7. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-06-02

    States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  8. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2008-05-20

    of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a

  9. Building Information Modeling (BIM) Primer. Report 1: Facility Life-Cycle Process and Technology Innovation

    DTIC Science & Technology

    2012-08-01

    Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a

  10. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    PubMed

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

  11. Development and molecular characterization of genic molecular markers for grain protein and calcium content in finger millet (Eleusine coracana (L.) Gaertn.).

    PubMed

    Nirgude, M; Babu, B Kalyana; Shambhavi, Y; Singh, U M; Upadhyaya, H D; Kumar, Anil

    2014-03-01

    Finger millet (Eleusine coracana (L.) Gaertn), holds immense agricultural and economic importance for its high nutraceuticals quality. Finger millets seeds are rich source of calcium and its proteins are good source of essential amino acids. In the present study, we developed 36 EST-SSR primers for the opaque2 modifiers and 20 anchored-SSR primers for calcium transporters and calmodulin for analysis of the genetic diversity of 103 finger millet genotypes for grain protein and calcium contents. Out of the 36 opaque2 modifiers primers, 15 were found polymorphic and were used for the diversity analysis. The highest PIC value was observed with the primer FMO2E33 (0.26), while the lowest was observed FMO2E27 (0.023) with an average value of 0.17. The gene diversity was highest for the primer FMO2E33 (0.33), however it was lowest for FMO2E27 (0.024) at average value of 0.29. The percentage polymorphism shown by opaque2 modifiers primers was 68.23%. The diversity analysis by calcium transporters and calmodulin based anchored SSR loci revealed that the highest PIC was observed with the primer FMCA8 (0.30) and the lowest was observed for FMCA5 (0.023) with an average value of 0.18. The highest gene diversity was observed for primer FMCA8 (0.37), while lowest for FMCA5 (0.024) at an average of 0.21. The opaque2 modifiers specific EST-SSRs could able to differentiate the finger millet genotypes into high, medium and low protein containing genotypes. However, calcium dependent candidate gene based EST-SSRs could broadly differentiate the genotypes based on the calcium content with a few exceptions. A significant negative correlation between calcium and protein content was observed. The present study resulted in identification of highly polymorphic primers (FMO2E30, FMO2E33, FMO2-18 and FMO2-14) based on the parameters such as percentage of polymorphism, PIC values, gene diversity and number of alleles.

  12. Effects of bond primers on bending strength and bonding of glass fibers in fiber-embedded maxillofacial silicone prostheses.

    PubMed

    Hatamleh, Muhanad M; Watts, David C

    2011-02-01

    To evaluate the effect of three commonly used bond primers on the bending strength of glass fibers and their bond strength to maxillofacial silicone elastomer after 360 hours of accelerated daylight aging. Eighty specimens were fabricated by embedding resin-impregnated fiber bundles (1.5-mm diameter, 20-mm long) into maxillofacial silicone elastomer M511 (Cosmesil). Twenty fiber bundles served as control and did not receive surface treatment with primers, whereas the remaining 60 fibers were treated with three primers (n = 20): G611 (Principality Medical), A-304 (Factor II), and A-330-Gold (Factor II). Forty specimens were dry stored at room temperature (23 ± 1°C) for 24 hours, and the remaining specimens were aged using an environmental chamber under accelerated exposure to artificial daylight for 360 hours. The aging cycle included continuous exposure to quartz-filtered visible daylight (irradiance 760 W/m(2) ) under an alternating weathering cycle (wet for 18 minutes, dry for 102 minutes). Pull-out tests were performed to evaluate bond strength between fiber bundles and silicone using a universal testing machine at 1 mm/min crosshead speed. A 3-point bending test was performed to evaluate the bending strength of the fiber bundles. One-way Analysis of Variance (ANOVA), Bonferroni post hoc test, and an independent t-test were carried out to detect statistical significances (p < 0.05). Mean (SD) values of maximum pull-out forces (N) before aging for groups: no primer, G611, A-304, A-330-G were: 13.63 (7.45), 20.44 (2.99), 22.06 (6.69), and 57.91 (10.15), respectively. All primers increased bond strength in comparison to control specimens (p < 0.05). Primer A-330-G showed the greatest increase among all primers (p < 0.05); however, bonding degraded after aging (p < 0.05), and pull-out forces were 13.58 (2.61), 6.17 (2.89), 6.95 (2.61), and 11.72 (3.03). Maximum bending strengths of fiber bundles at baseline increased after treatment with primers and light aging in comparison with control specimens (p < 0.05), and were in the range of 917.72 to 1095.25 and 1124.06 to 1596.68 MPa at both baseline and after 360 hours aging (p < 0.05). The use of A-330-G primer in conjunction with silicone Cosmesil M511 produced the greatest bond strength for silicone-glass fiber surfaces at baseline; however, bond strength was significantly degraded after accelerated daylight aging. Treatment with primer and accelerated daylight aging increased bending strength of glass fibers. © 2011 by The American College of Prosthodontists.

  13. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

    PubMed

    Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

    2016-01-01

    Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

  14. A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

    PubMed

    Nishitani, Goh; Yoshida, Masaki

    2018-06-01

    This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

  15. Profitability primer: a guide to profitability analysis in the electric power industry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to variousmore » functions and how revenues are collected and allocated.« less

  16. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  17. Microsatellite loci in Vallisneria natans (Hydrocharitaceae) and cross-reactivity with V. spinulosa and V. denseserrulata.

    PubMed

    Wang, Bin; Liao, Hui; Zhao, Yao; Li, Wei; Song, Zhiping

    2011-03-01

    Microsatellite primers were characterized in Vallisneria natans, a dominant submerged macrophyte occurring in freshwater bodies of tropical and subtropical zones. Using the Microsatellite Sequence Enrichment protocol, 16 novel polymorphic codominant loci were developed and characterized in V. natans. In addition to these, six existing microsatellite loci from V. spinulosa were successfully amplified and characterized for V. natans. These primers amplified di- and trinucleotide repeats with 2-7 alleles per locus. Most primers also amplified successfully in V. spinulosa and V. denseserrulata. These results indicate the utility of primers in V. natans for future studies of population genetic structure, as well as their applicability across the genus.

  18. Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

    PubMed

    Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

    2014-11-01

    To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  19. Crystallographic observation of nonenzymatic RNA primer extension.

    PubMed

    Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W

    2018-05-31

    The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.

  20. Detection and Heterogeneity of Herpesviruses Causing Pacheco's Disease in Parrots

    PubMed Central

    Tomaszewski, Elizabeth; Wilson, Van G.; Wigle, William L.; Phalen, David N.

    2001-01-01

    Pacheco's disease (PD) is a common, often fatal, disease of parrots. We cloned a virus isolate from a parrot that had characteristic lesions of PD. Three viral clones were partially sequenced, demonstrating that this virus was an alphaherpesvirus most closely related to the gallid herpesvirus 1. Five primer sets were developed from these sequences. The primer sets were used with PCR to screen tissues or tissue culture media suspected to contain viruses from 54 outbreaks of PD. The primer sets amplified DNA from all but one sample. Ten amplification patterns were detected, indicating that PD is caused by a genetically heterogeneous population of viruses. A single genetic variant (psittacid herpesvirus variant 1) amplified with all primer sets and was the most common virus variant (62.7%). A single primer set (23F) amplified DNA from all of the positive samples, suggesting that PCR could be used as a rapid postmortem assay for these viruses. PCR was found to be significantly more sensitive than tissue culture for the detection of psittacid herpesviruses. PMID:11158102

  1. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    PubMed

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  2. Mechanism for priming DNA synthesis by yeast DNA Polymerase α

    PubMed Central

    Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca

    2013-01-01

    The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895

  3. Molecular diagnosis of group B coltiviruses infections.

    PubMed

    Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X

    1999-08-01

    The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.

  4. STITCHER 2.0: primer design for overlapping PCR applications

    PubMed Central

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-01-01

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

  5. STITCHER 2.0: primer design for overlapping PCR applications.

    PubMed

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-03-30

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

  6. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, H.U.G.; Gray, J.W.

    1995-06-27

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

  7. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    PubMed

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  8. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

    PubMed Central

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

    2005-01-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

  9. SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

    PubMed Central

    2013-01-01

    Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

  10. Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

    PubMed

    Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

    2017-12-02

    DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

  11. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, Heinz-Ulrich G.; Gray, Joe W.

    1995-01-01

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

  12. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  13. High-Throughput Sequencing of 16S rRNA Gene Amplicons: Effects of Extraction Procedure, Primer Length and Annealing Temperature

    PubMed Central

    Sergeant, Martin J.; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W.; Pallen, Mark J.

    2012-01-01

    The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers. PMID:22666455

  14. TipMT: Identification of PCR-based taxon-specific markers.

    PubMed

    Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

    2017-02-11

    Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

  15. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    NASA Astrophysics Data System (ADS)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  16. High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

    PubMed

    Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

    2012-01-01

    The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

  17. Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.

    PubMed

    Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo

    2017-05-28

    Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

  18. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

    PubMed Central

    David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

    2017-01-01

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

  19. Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

    PubMed

    Kokosková, B; Mráz, I; Fousek, J

    2010-05-01

    Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

  20. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    PubMed

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  1. An alternative method for immediate dose estimation using CaSO4:Dy based TLD badges

    NASA Astrophysics Data System (ADS)

    Singh, A. K.; Menon, S. N.; Dhabekar, Bhushan; Kadam, Sonal; Chougaonkar, M. P.; Babu, D. A. R.

    2014-11-01

    CaSO4:Dy based Thermoluminescence dosimeters (TLDs) are being used in country wide personnel monitoring program in India. The TL glow curve of CaSO4:Dy consists of a dosimetric peak at 220 °C and a low temperature peak at 120 °C which is unstable at room temperature. The TL integral counts in CaSO4:Dy reduces by 15% in seven days after irradiation due to the thermal fading of 120 °C TL peak. As the dosimetric procedure involves total integrated counts for dose conversion, the dosimeters are typically read about a week after receiving. However in the event of a suspected over exposure, where urgent processing is expected, this poses limitation. Post irradiation annealing treatment is used in such cases of immediate readout of cards. In this paper we report a new and easier to use technique based on optical bleaching for the urgent processing of TLD cards. Optical bleaching with green LED (∼555 nm photons) of 25,000 lux for one and half hour removes the low temperature TL peak without affecting the dosimetric peak. This method can be used for immediate dose estimation using CaSO4:Dy based TLD badges.

  2. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

    PubMed Central

    Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

    2016-01-01

    Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

  3. A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

    PubMed

    Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

    2015-07-01

    Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive.

    PubMed

    Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won

    2018-02-01

    The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

  5. Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive

    PubMed Central

    2018-01-01

    Objectives The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Materials and Methods Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al2O3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test (p = 0.05). Results Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 (p < 0.05). Conclusions Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used. PMID:29487838

  6. Forensic strategy to ensure the quality of sequencing data of mitochondrial DNA in highly degraded samples.

    PubMed

    Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki

    2014-01-01

    Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  7. The effect of continuous application of MDP-containing primer and luting resin cement on bond strength to tribochemical silica-coated Y-TZP.

    PubMed

    Lim, Myung-Jin; Yu, Mi-Kyung; Lee, Kwang-Won

    2018-05-01

    This study investigated the effect of continuous application of 10-methacryloyloxydecyldihydrogen phosphate (MDP)-containing primer and luting resin cement on bond strength to tribochemical silica-coated yttria-stabilized tetragonal zirconia polycrystal (Y-TZP). Forty bovine teeth and Y-TZP specimens were prepared. The dentin specimens were embedded in molds, with one side of the dentin exposed for cementation with the zirconia specimen. The Y-TZP specimen was prepared in the form of a cylinder with a diameter of 3 mm and a height of 10 mm. The bonding surface of the Y-TZP specimen was sandblasted with silica-coated aluminium oxide particles. The forty tribochemical silica-coated Y-TZP specimens were cemented to the bovine dentin (4 groups; n = 10) with either an MDP-free primer or an MDP-containing primer and either an MDP-free resin cement or an MDP-containing resin cement. After a shear bond strength (SBS) test, the data were analyzed using 1-way analysis of variance and the Tukey test (α = 0.05). The group with MDP-free primer and resin cement showed significantly lower SBS values than the MDP-containing groups ( p < 0.05). Among the MDP-containing groups, the group with MDP-containing primer and resin cement showed significantly higher SBS values than the other groups ( p < 0.05). The combination of MDP-containing primer and luting cement following tribochemical silica coating to Y-TZP was the best choice among the alternatives tested in this study.

  8. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    PubMed

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

  9. Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

    PubMed Central

    Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

    1999-01-01

    Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307

  10. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    PubMed

    Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

    2012-01-01

    An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.

  11. Effect of quaternary ammonium and silver nanoparticle-containing adhesives on dentin bond strength and dental plaque microcosm biofilms

    PubMed Central

    Zhang, Ke; Melo, Mary Anne S.; Cheng, Lei; Weir, Michael D.; Bai, Yuxing; Xu, Hockin H. K.

    2012-01-01

    Objectives Antibacterial bonding agents are promising to hinder the residual and invading bacteria at the tooth-restoration interfaces. The objectives of this study were to develop an antibacterial bonding agent by incorporation of quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg), and to investigate the effect of QADM-NAg adhesive and primer on dentin bond strength and plaque microcosm biofilm response for the first time. Methods Scotchbond Multi-Purpose adhesive and primer were used as control. Experimental adhesive and primer were made by adding QADM and NAg into control adhesive and primer. Human dentin shear bond strengths were measured (n = 10). A dental plaque microcosm biofilm model with human saliva as inoculum was used to investigate biofilm metabolic activity, colony-forming unit (CFU) counts, lactic acid production, and live/dead staining assay (n = 6). Results Adding QADM and NAg into adhesive and primer did not compromise the dentin shear bond strength which ranged from 30 to 35 MPa (p > 0.1). Scanning electron microscopy (SEM) examinations revealed numerous resin tags, which were similar for the control and the QADM and NAg groups. Adding QADM or NAg markedly reduced the biofilm viability, compared to adhesive control. QADM and NAg together in the adhesive had a much stronger antibacterial effect than using each agent alone (p < 0.05). Adding QADM and NAg in both adhesive and primer had the strongest antibacterial activity, reducing metabolic activity, CFU, and lactic acid by an order of magnitude, compared to control. Significance Without compromising dentin bond strength and resin tag formation, the QADM and NAg containing adhesive and primer achieved strong antibacterial effects against microcosm biofilms for the first time. QADM-NAg adhesive and primer are promising to combat residual bacteria in tooth cavity and invading bacteria at the margins, thereby to inhibit secondary caries. QADM and NAg incorporation may have a wide applicability to other dental bonding systems. PMID:22592165

  12. Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

    PubMed Central

    Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

    2011-01-01

    Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

  13. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    PubMed Central

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  14. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    PubMed Central

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  15. Effects of antibacterial primers with quaternary ammonium and nano-silver on S. mutans impregnated in human dentin blocks

    PubMed Central

    Cheng, Lei; Zhang, Ke; Weir, Michael D.; Liu, Huaibing; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives Recent studies developed antibacterial bonding agents and composites containing a quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg). The objectives of this study were to investigate: (1) the effect of antibacterial primers containing QADM and NAg on the inhibition of Streptococcus mutans (S. mutans) impregnated into dentin blocks for the first time, and (2) the effect of QADM or NAg alone or in combination, and the effect of NAg mass fraction, on S. mutans viability in dentin. Methods Scotchbond Multi-Purpose (SBMP) bonding agent was used. QADM and NAg were incorporated into SBMP primer. Six primers were tested: SBMP primer control, control + 10% QADM (mass %), control + 0.05% NAg, control + 10% QADM + 0.05% NAg, control + 0.1% NAg, and control + 10% QADM + 0.1% NAg. S. mutans were impregnated into dentin blocks, then a primer was applied. The viable colony-forming units (CFU) were then measured by harvesting the bacteria in dentin using a sonication method. Results Control + 10% QADM + 0.1% NAg had bacteria inhibition zone 8-fold that of control (p < 0.05). The sonication method successfully harvested bacteria from dentin blocks. Control + 10% QADM + 0.1% NAg inhibited S. mutans in dentin blocks, reducing the viable CFU in dentin by three orders of magnitude, compared to control dentin without primer. Using QADM+NAg was more effective than QADM alone. Higher NAg content increased the potency. Dentin shear bond strength was similar for all groups (p > 0.1). Significance Antibacterial primer with QADM and NAg were shown to inhibit the S. mutans impregnated into dentin blocks for the first time. Bonding agent containing QADM and NAg is promising to eradicate bacteria in tooth cavity and inhibit caries. The QADM and NAg may have applicability to other adhesives, cements, sealants and composites. PMID:23422420

  16. Effect of quaternary ammonium and silver nanoparticle-containing adhesives on dentin bond strength and dental plaque microcosm biofilms.

    PubMed

    Zhang, Ke; Melo, Mary Anne S; Cheng, Lei; Weir, Michael D; Bai, Yuxing; Xu, Hockin H K

    2012-08-01

    Antibacterial bonding agents are promising to hinder the residual and invading bacteria at the tooth-restoration interfaces. The objectives of this study were to develop an antibacterial bonding agent by incorporation of quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg), and to investigate the effect of QADM-NAg adhesive and primer on dentin bond strength and plaque microcosm biofilm response for the first time. Scotchbond Multi-Purpose adhesive and primer were used as control. Experimental adhesive and primer were made by adding QADM and NAg into control adhesive and primer. Human dentin shear bond strengths were measured (n = 10). A dental plaque microcosm biofilm model with human saliva as inoculum was used to investigate biofilm metabolic activity, colony-forming unit (CFU) counts, lactic acid production, and live/dead staining assay (n = 6). Adding QADM and NAg into adhesive and primer did not compromise the dentin shear bond strength which ranged from 30 to 35MPa (p>0.1). Scanning electron microscopy (SEM) examinations revealed numerous resin tags, which were similar for the control and the QADM and NAg groups. Adding QADM or NAg markedly reduced the biofilm viability, compared to adhesive control. QADM and NAg together in the adhesive had a much stronger antibacterial effect than using each agent alone (p<0.05). Adding QADM and NAg in both adhesive and primer had the strongest antibacterial activity, reducing metabolic activity, CFU, and lactic acid by an order of magnitude, compared to control. Without compromising dentin bond strength and resin tag formation, the QADM and NAg containing adhesive and primer achieved strong antibacterial effects against microcosm biofilms for the first time. QADM-NAg adhesive and primer are promising to combat residual bacteria in tooth cavity and invading bacteria at the margins, thereby to inhibit secondary caries. QADM and NAg incorporation may have a wide applicability to other dental bonding systems. Copyright © 2012 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  17. Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

    PubMed

    Panicker, Gitika; Bej, Asim K

    2005-10-01

    We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

  18. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    NASA Astrophysics Data System (ADS)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and high-schools. We are now producing a second edition, which is an entirely new re-write, and we are making the process of producing the primer a development opportunity in its own right, to strengthen the international community of early-career astrobiologists. We have recruited a large team of writers and editors, 45 people from 11 different countries across North and South America, Europe and Australia. By working together on this joint project we are strengthening links between early-career scientists in these countries. In addition, we have a wider group of early-career astrobiologists who we consulted on the content that the primer should include. We have also recruited early-career scientists from this group, and more widely, to act as 'accessibility reviewers' to check that the primer meets its goal of being clear to people who are not experts in the field. We expect that the primer will be published in 2012, in several different languages. It will be freely available online to all who want it. References 1. Mix LM et al (2006) The Astrobiology Primer : An Outline of General Knowledge - Version 1, 2006 Astrobiology 6(5) : 735-813

  19. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    PubMed

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    ERIC Educational Resources Information Center

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  1. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    DTIC Science & Technology

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  2. Isolation and characterization of microsatellite loci in the common milkweed, Asclepias syriaca (Apocynaceae).

    PubMed

    Kabat, Susan M; Dick, Christopher W; Hunter, Mark D

    2010-05-01

    Microsatellite primers were developed for the common milkweed, Asclepias syriaca L., to assist in genet identification and the analysis of spatial genetic structure. Using an enrichment cloning protocol, eight microsatellite loci were isolated and characterized in a Michigan population of A. syriaca. The primers amplified di- and trinucleotide repeats with 4-13 alleles per locus. The primers will be useful for studies of clonality and gene flow in natural populations.

  3. Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing.

    PubMed

    Li, Yong; Zhang, Weirui

    2015-10-01

    Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker-assisted breeding.

  4. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  5. Introducing a primer for career development and promotion: succeeding as a psychologist in an academic health center.

    PubMed

    Christophersen, Edward; Butt, Zeeshan

    2012-12-01

    Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.

  6. TENDENCIA DE LA TUBERCULOSIS EN LA REGIÓN SANITARIA V DE LA PROVINCIA DE BUENOS AIRES, AÑOS 2000–2011

    PubMed Central

    CHIRICO, CRISTINA; SANJURJO, MYRIAM; IRIBARREN, SARAH; APPENDINO, ANDREA; ZERBINI, ELSA; ETCHEVARRIA, MIRTA

    2016-01-01

    El objetivo del presente trabajo fue analizar la situación epidemiológica de la tuberculosis (TB) en la Región Sanitaria V (RSV), provincia de Buenos Aires. El estudio de tendencia permitió conocer un valor promedio de las variaciones de la tasa de incidencia (TI), calculadas por regresión lineal simple y expresadas como variación anual promedio (VAP). Se analizaron el número de casos notificados y TI por 100 000 habitantes de todas las formas de TB, los casos de TB pulmonar (TBP) y TBP confirmados por bacteriología, total casos por grupos de edad: 0 – 14; 15 – 29 y mayores de 64 años, entre el 1° de enero de 2000 al 31 de diciembre de 2011. La declinación de la TI fue menor al 5% para todas las formas de TB e inferior en las TBP confirmadas bacteriológicamente. Los casos de TBP y TI más elevadas, se concentraron en el grupo de 15 a 29 años, con tendencia estable o ligeramente ascendente de la TI en la TBP bacilífera. El mismo comportamiento presentaron los casos de TBP infantil con confirmación bacteriológica. La mayor velocidad de descenso en la TI de la TBP se produjo en este grupo de edad, mientras que en mayores de 64 años, el descenso fue sostenido en el tiempo. La TB persiste como un riesgo de salud en la RSV, con casos en edades jóvenes, por lo que sigue siendo necesario fortalecer el control de la TB en esta región. PMID:26117604

  7. Recombination luminescence of CaSO4:Tb3+ and CaSO4:Gd3+phosphors

    NASA Astrophysics Data System (ADS)

    Kudryavtseva, Irina; Lushchik, Aleksandr; Maaroos, Aarne; Azmaganbetova, Zhannur; Nurakhmetov, Turlybek; Salikhoja, Zhussupbek

    2012-08-01

    A comparative study of the excitation of luminescence by VUV radiation as well as of thermally and photostimulated luminescence has been carried out for CaSO4:Tb3+ and CaSO4:Gd3+ phosphors, where Na+ or F- ions are used for charge compensation. The distinction in hole processes for the phosphors with Na+ or F- compensators is determined by the differing thermal stability of the holes localized at/near Tb3+Na+ and Gd3+Na+ (up to 100-160 K) or at/near Tb3+F- V Ca and Gd3+F- V Ca centers involving also a cation vacancy (up to 400-550 K). Tunnel luminescence in the pairs of localized electrons and holes nearby Tb3+ or Gd3+ has been detected. The mechanisms of electron-hole, hole-electron and tunnel recombination luminescence as well as a subsequent released energy transfer to RE3+ ions are considered.

  8. Thermoluminescence (TL) properties and x-ray diffraction (XRD) analysis of high purity CaSO4:Dy TL material

    NASA Astrophysics Data System (ADS)

    Kamarudin, Nadira; Abdullah, Wan Saffiey Wan; Hamid, Muhammad Azmi Abdul; Dollah, Mohd Taufik

    2014-09-01

    This paper presents the characterization and TL properties of dysprosium (Dy) doped calcium sulfate (CaSO4) TL material produced by co-precipitation technique with 0.5mol% concentration of dopant. The morphology of the produced TL material was studied using scanning electron microscope (SEM) and the micrograph shows that rectangular parallelepiped shaped crystal with the average of 150 μm in length were produced. The crystallinity of the produced powder was studied using x-ray powder diffraction (XRD). The XRD spectra show that the TL material produced is high purity anhydrite CaSO4 with average crystallite size of 74 nm with orthorhombic crystal system. The TL behavior of produced CaSO4:Dy was studied using a TLD reader after exposure to gamma ray by Co60 source with the doses of 1,5 and 10 Gy. The glow curve shows linear response with glow peak around 230°C which is desired development in the field of radiation dosimetry.

  9. Differences in the clinical-epidemiological profile between new cases of tuberculosis and retreatment cases after default.

    PubMed

    Belchior, Aylana de Souza; Arcêncio, Ricardo Alexandre; Mainbourg, Evelyne Marie Therese

    2016-01-01

    To identify the socioeconomic and clinical-epidemiological factors related to tuberculosis in new cases and retreatment cases. Comparative study with 126 patients, of which 42 were retreatment cases after default attended in a reference center, and 84 were new cases completing the first treatment and treated in Basic Health Units. The collection of primary data was through interview, and of secondary data by records of the Notifiable Diseases Information System. Comparative analysis between the two groups. The new cases differ from retreatment cases regarding educational level. The clinical-epidemiological profile shows a significant difference in relation to performance of the tuberculin skin test, and the HIV test result (positive) in favor of new cases. In relation to performance of sputum culture and the result (positive) of the first sputum smear of the first and second samples, in favor of retreatment cases. The two groups are significantly different in clinical and epidemiological characteristics that show the access to exams. Identificar fatores socioeconômicos e clínico-epidemiológicos associados à tuberculose em casos novos e em casos em retratamento. Estudo comparativo de 126 pacientes, sendo 42 casos em retratamento por abandono atendidos num Centro de Referência e 84 casos novos concluindo o primeiro tratamento, atendidos em Unidades Básicas de Saúde. Levantamento de dados primários por entrevista e dados secundários pela Ficha de Informação de Agravos de Notificação. Análise comparativa entre os dois grupos. Os casos novos diferem dos em retratamento quanto à escolaridade. O perfil clínico-epidemiológico mostra que há diferença significativa quanto à realização do teste tuberculínico e o resultado do teste HIV (positivo) a favor dos casos novos. Quanto à realização da cultura de escarro e o resultado (positivo) da baciloscopia de escarro da primeira e da segunda amostras, a favor dos casos em retratamento. Os dois grupos diferem significativamente por características clínico-epidemiológicas que retratam o acesso a exames.

  10. Healing bone lesion defects using injectable CaSO4 /CaPO4 -TCP bone graft substitute compared to cancellous allograft bone chips in a canine model.

    PubMed

    Hall, Deborah J; Turner, Thomas M; Urban, Robert M

    2018-04-16

    CaSO 4 /CaPO 4 -TCP bone graft substitute has been shown to be effective for treatment of bone lesion defects, but its mechanical, histological, and radiographic characteristics have not been studied in direct comparison with a conventional treatment such as cancellous allograft bone. Thirteen canines had a critical-size axial defect created bilaterally into the proximal humerus. CaSO 4 /CaPO 4 -TCP bone graft substitute (PRO-DENSE™, Wright Medical Technology) was injected into the defect in one humerus, and an equal volume of freeze-dried cancellous allograft bone chips was placed in the contralateral defect. The area fraction of new bone, residual graft, and fibrous tissue and the compressive strength and elastic modulus of bone within the defects were determined after 6, 13, or 26 weeks and correlated with radiographic changes. The data were analyzed using Friedman and Mann-Whitney tests. There was more bone in defects treated with the CaSO 4 /CaPO 4 -TCP bone graft substitute compared to defects treated with cancellous bone allograft at all three time points, and the difference at 13 weeks was significant (p = 0.025). The new bone was significantly stronger and stiffer in defects treated with the CaSO 4 /CaPO 4 -TCP bone graft substitute compared to defects treated with cancellous bone allograft at 13 (p = 0.046) and 26 weeks (p = 0.025). At 26 weeks, all defects treated with CaSO 4 /CaPO 4 -TCP bone graft substitute demonstrated complete healing with new bone, whereas healing was incomplete in all defects treated with cancellous allograft chips. The CaSO 4 /CaPO 4 -TCP bone graft substitute could provide faster and significantly stronger healing of bone lesions compared to the conventional treatment using freeze-dried cancellous allograft bone. © 2018 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 2018. © 2018 Wiley Periodicals, Inc.

  11. RUCS: rapid identification of PCR primers for unique core sequences.

    PubMed

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

    2017-12-15

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  12. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    PubMed Central

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  13. Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

    PubMed

    Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

    2014-01-01

    Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

  14. Composite-composite repair bond strength: effect of different adhesion primers.

    PubMed

    Tezvergil, A; Lassila, L V J; Vallittu, P K

    2003-11-01

    Recently, new products have been introduced to repair composite restorations that may be used as 'one-step' primers or monomers and silane compounds which are used separately as 'multi-step' primers. The aim of this study was to compare the shear bond strength of the new composite resin to aged composite, by using different adhesion primers. The substrates were particulate filler composite (Z250, 3M-ESPE), which was aged by boiling for 8 h and storing at 37 degrees C in water for 3 weeks. The aged substrate surfaces were wet-ground flat with 320-grit silicon carbide paper and subjected randomly (n=8) to either one-step adhesion primer: Compoconnect (CC) (Heraus Kulzer), or multi-step: Clearfil Repair (CF) (Kuraray) or an intermediate resin: Scothchbond Multi-purpose adhesive resin (3M-ESPE) according to the manufacturers' recommendations. Specimens with no surface treatment were used as control (C). New composite resin (Z250) was added to the substrate using 2 mm layer increments and light cured. The specimens were either water stored for 48 h or water stored for 24 h and then thermocycled for 6000 cycles. The shear bond strengths were measured with a crosshead speed of 1.0 mm/min using a universal testing machine. Data were analysed by two-way ANOVA and Tukey's post-hoc tests (p=0.05). All surface treatment methods showed significant difference compared to control (p<0.05). CF showed higher bond strength than CC and MP (p<0.05). Storage condition did not show a significant difference (p>0.05) in bond strength values. It was concluded that multi-step adhesion primer yielded higher bond strength compared to one-step primer or intermediate resin.

  15. Bonding effectiveness to different chemically pre-treated dental zirconia.

    PubMed

    Inokoshi, Masanao; Poitevin, André; De Munck, Jan; Minakuchi, Shunsuke; Van Meerbeek, Bart

    2014-09-01

    The objective of this study was to evaluate the effect of different chemical pre-treatments on the bond durability to dental zirconia. Fully sintered IPS e.max ZirCAD (Ivoclar Vivadent) blocks were subjected to tribochemical silica sandblasting (CoJet, 3M ESPE). The zirconia samples were additionally pre-treated using one of four zirconia primers/adhesives (Clearfil Ceramic Primer, Kuraray Noritake; Monobond Plus, Ivoclar Vivadent; Scotchbond Universal, 3M ESPE; Z-PRIME Plus, Bisco). Finally, two identically pre-treated zirconia blocks were bonded together using composite cement (RelyX Ultimate, 3M ESPE). The specimens were trimmed at the interface to a cylindrical hourglass and stored in distilled water (7 days, 37 °C), after which they were randomly tested as is or subjected to mechanical ageing involving cyclic tensile stress (10 N, 10 Hz, 10,000 cycles). Subsequently, the micro-tensile bond strength was determined, and SEM fractographic analysis performed. Weibull analysis revealed the highest Weibull scale and shape parameters for the 'Clearfil Ceramic Primer/mechanical ageing' combination. Chemical pre-treatment of CoJet (3M ESPE) sandblasted zirconia using Clearfil Ceramic Primer (Kuraray Noritake) and Monobond Plus (Ivoclar Vivadent) revealed a significantly higher bond strength than when Scotchbond Universal (3M ESPE) and Z-PRIME Plus (Bisco) were used. After ageing, Clearfil Ceramic Primer (Kuraray Noritake) revealed the most stable bond durability. Combined mechanical/chemical pre-treatment, the latter with either Clearfil Ceramic Primer (Kuraray Noritake) or Monobond Plus (Ivoclar Vivadent), resulted in the most durable bond to zirconia. As a standard procedure to durably bond zirconia to tooth tissue, the application of a combined 10-methacryloyloxydecyl dihydrogen phosphate/silane ceramic primer to zirconia is clinically highly recommended.

  16. Consensus-Degenerate Hybrid Oligonucleotide Primers for Amplification of Priming Glycosyltransferase Genes of the Exopolysaccharide Locus in Strains of the Lactobacillus casei Group

    PubMed Central

    Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis

    2003-01-01

    A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729

  17. Identification of root rot fungi in nursery seedlings by nested multiplex PCR.

    PubMed Central

    Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M

    1996-01-01

    The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993

  18. The Reverse Transcriptase of the Tf1 Retrotransposon Has a Specific Novel Activity for Generating the RNA Self-Primer That Is Functional in cDNA Synthesis▿

    PubMed Central

    Hizi, Amnon

    2008-01-01

    The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5′ end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3′ end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs. PMID:18753200

  19. The reverse transcriptase of the Tf1 retrotransposon has a specific novel activity for generating the RNA self-primer that is functional in cDNA synthesis.

    PubMed

    Hizi, Amnon

    2008-11-01

    The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5' end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3' end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs.

  20. Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

    PubMed

    Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

    2012-04-01

    Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

  1. Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

    PubMed

    Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

    2013-01-01

    Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

  2. Matrilineage differentiation of the genus Tetragonisca using mitochondrial DNA markers and the polymerase chain reaction-restriction fragment length polymorphism technique.

    PubMed

    Santos, S A; Bronzato, A R; Moreira, B M T; Araujo, K F; Ronqui, L; Mangolin, C A; Toledo, V A A; Ruvolo-Takasusuki, M C C

    2015-10-21

    The Meliponinae are important pollinators of plant species, and one of the most managed species is Tetragonisca angustula. Initially, two subspecies were identified in T. angustula: T. angustula angustula and T. angustula fiebrigi. Subsequently, T. a. fiebrigi was considered a species, based on the coloration of its mesepisternum. The objective of the present study was to obtain genetic markers that could differentiate the two species by amplifying regions of mitochondrial DNA and conducting polymerase chain reaction-restriction fragment length polymorphism analysis. Worker bees were collected in three Brazilian states: Paraná (Maringá, Altônia, and Foz do Iguaçu), São Paulo (Dracena, São Carlos, and Santa Cruz do Rio Pardo), and Rondônia (Ariquemes). Ten pairs of insect heterologous primers were tested and four were used (primer pair 1, ND2 and COI; primer pair 2, COI; primer pair 8, 16S and 12S; and primer pair 9, COII). For the restriction analysis, 13 enzymes were tested: EcoRI, EcoRV, HindIII, HinfI, RsaI, PstI, XbaI, HaeIII, ClaI, XhoI, BglII, PvuII, and ScaI. Markers were obtained (primer pair 8 cleaved with EcoRV and XbaI and primer pair 9 cleaved with HaeIII, RsaI, and XbaI) that enabled matrilineage identification in the nests studied, which confirmed that hybridization could occur between both Tetragonisca species. The beginning of speciation was probably recent, and secondary contact has resulted in crosses between T. angustula females and T. fiebrigi males. Because of this hybridization, it would be appropriate to consider them as two subspecies of T. angustula.

  3. Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S-23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide.

    PubMed

    Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X

    2003-01-01

    The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.

  4. A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

    PubMed

    Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

    2002-12-01

    The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

  5. Nucleocapsid Protein Annealing of a Primer-Template Enhances (+)-Strand DNA Synthesis and Fidelity by HIV-1 Reverse Transcriptase†

    PubMed Central

    Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.

    2012-01-01

    Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155

  6. Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.

    PubMed

    Saetung, Rattika; Ongchai, Siriwan; Charoenkwan, Pimlak; Sanguansermsri, Torpong

    2013-11-01

    Beta thalassemia is a common hereditary hemalogogical disease in Thailand, with a prevalence of 5-8%. In this study, we evaluated the high resolution DNA melting (HRM) assay to identify beta thalassemia mutation in samples from 143 carriers of the beta thalassemia traits in at risk couples. The DNA was isolated from venous blood samples and tested for mutation under a series of 5 PCR-HRM (A, B, C, D and E primers) protocols. The A primers were for detection of beta thalassemia mutations in the HBB promoter region, the B primers for mutations in exon I, the C primers for exon II, the D primers for exon III and the E primers for the 3.4 kb deletion mutation. The mutations were diagnosed by comparing the complete melting curve profiles of a wild type control with those for each mutant sample. With the PCR-HRM technique, fourteen types of beta thalassemia mutations were detected. Each mutation had a unique and specific melting profile. The mutations included 36.4% (52 cases) codon 41/42-CTTT, 26.6% (38 cases) codon 17 A-T, 11.2% (16 cases) IVS1-1 G-T, 8.4% (12 cases) codon 71/72 +A, 8.4% (12 cases) of the 3.4 kb deletion and 3.5% (5 cases) -28 A-G. The remainder included one instance each of -87 C-A, -31 A-C, codon 27/28 +C, codon 30 G-A, IVS1-5 G-C, codon 35 C-A, codon 41-C and IVSII -654 C-T. Of the total cases, 85.8% of the mutations could be detected by primers B and C. The PCR-HRM method provides a rapid, simple and highly feasible strategy for mutation screening of beta thalassemia traits.

  7. Effects of silane- and MDP-based primers application orders on zirconia-resin adhesion-A ToF-SIMS study.

    PubMed

    Chuang, Shu-Fen; Kang, Li-Li; Liu, Yi-Chuan; Lin, Jui-Che; Wang, Ching-Cheng; Chen, Hui-Min; Tai, Cheng-Kun

    2017-08-01

    To evaluate the 3-methacryloyloxypropyltrimethoxysilane (MPS)- and 10-methacryloyloxydecyl-dihydrogen-phosphate (MDP)-base primers, in their single or sequential applications, with regard to modifying zirconia surfaces and improving resin-zirconia adhesion. Zirconia disks received different treatments: without primer (Zr), MPS-base primer (S), MDP-base primer (M), MPS/MDP mixture (SMmix), MPS followed by MDP (SM), and MDP followed by MPS (MS). The compositions and chemical interactions of the coatings to zirconia were analyzed using time-of-flight secondary ion mass spectrometry (ToF-SIMS) and reconstructed 3D ion images. Surface wettability of these coatings to water and resin adhesive was assessed. The shear bond strength (SBS) between resin and the treated zirconia was also examined before and after thermocycling. Groups S and MS presented substantial OH - ions in the coatings and zirconia substrate. PO 2 - and PO 3 - fragments existed in all MDP-treatment groups with various proportions and distributions, while groups M and SM showed higher proportions of PO 3 - and the zirconium phosphate related ions. In 3D ion images, PO 3 - in groups M and SM was denser and segregated to the interface, but was dispersed or overlaid above PO 2 - in SMmix and MS. All the primers increased the surface wettability to water and resin, with M and SM presenting superhydrophilic surfaces. All MDP-treatment groups showed improved SBS before thermocycling, while M and SM retained higher SBS after this. The MDP-base primer shows a relevant function in facilitating POZr bonding and enhancing resin-zirconia bonding. The co-treated MPS impairs the chemical activity of MDP, especially if it is the final coat. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  8. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    PubMed Central

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

    2014-01-01

    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  9. A Field-expedient Method for Detection of Leptospirosis Causative Agents in Rodents

    DTIC Science & Technology

    2012-01-01

    carboxytetramethylrhodamine (TAMRA)) (Roche Molecular Diagnostics, Pleasanton, California).24,25 Polymerase Chain Reaction. Wet reagent LPS PCR assay...City, Utah). Primers and probe were optimized with R.A.P.I.D. wet reagents and the optimum condition was 5 mmol/L MgCl2, 400 nmol/L primers, 100 nmol...for 20 seconds of combined annealing and primer extension. Linearity and Limit of Detection. The linearity of the LPS freeze-dried assay was

  10. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

    DTIC Science & Technology

    2015-08-01

    preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally

  11. Structure and Properties of Polymer Interphases

    DTIC Science & Technology

    1988-09-30

    substrate primed with a dilute aqueous solution of y -aminopropyltriethoxy- silane (’APS), there was little reaction between the primer and adhesive and...of y -aminopropyltriethoxysilane (- Y -APS) at pH 10.4 for one minute, withdrawn, and blown dry with a stream of nitrogen gas. The resulting primer...cm-1 is due to the C= N stretching mode of imine groups formed by oxidation of the amino groups in the primer. The negative peak near 1740 cm𔃻 is due

  12. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    PubMed

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  13. Development of Species-Specific Primers for Agronomical Thrips and Multiplex Assay for Quarantine Identification of Western Flower Thrips.

    PubMed

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2014-10-01

    While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.

  14. Hexavalent chromium exposures during full-aircraft corrosion control.

    PubMed

    Carlton, Gary N

    2003-01-01

    Aluminum alloys used in the construction of modern aircraft are subject to corrosion. The principal means of controlling this corrosion in the U.S. Air Force are organic coatings. The organic coating system consists of a chromate conversion coat, epoxy resin primer, and polyurethane enamel topcoat. Hexavalent chromium (CrVI) is present in the conversion coat in the form of chromic acid and in the primer in the form of strontium chromate. CrVI inhalation exposures can occur when workers spray conversion coat onto bare metal and apply primer to the treated metal surface. In addition, mechanical abrasion of aircraft surfaces can generate particulates that contain chromates from previously applied primers and conversion coats. This study measured CrVI exposures during these corrosion control procedures. Mean time-weighted average (TWA) exposure to chromic acid during conversion coat treatment was 0.48 microg/m(3), below the current American Conference of Governmental Industrial Hygienists (ACGIH) threshold limit value (TLV(R)) TWA of 50 microg/m(3) for water-soluble CrVI compounds. Mean TWA exposures to strontium chromate were 5.33 microg/m(3) during mechanical abrasion and 83.8 microg/m(3) during primer application. These levels are in excess of the current ACGIH TLV-TWA of 0.5 microg/m(3) for strontium chromate. In the absence of a change from chromated to nonchromated conversion coats and primers, additional control measures are needed to reduce these exposures.

  15. Resin-dentin interface of Scotchbond Multi-Purpose dentin adhesive.

    PubMed

    Griffiths, B M; Watson, T F

    1995-08-01

    To evaluate the interface between dentin, Scotchbond Multi-Purpose (SMP), and resin composite (Z100) using confocal fluorescence microscopy. Novel techniques were employed to view and record at video rate the application of the SMP primer and adhesive onto the dentin surface. The subsurface morphology of the dentin/restorative interface was also studied. To facilitate this study, the components of the adhesive system were labeled with fluorescent dyes. In an ideal situation, the primer and adhesive penetrated the dentin tubules, a distinct hybrid zone was formed and a thin layer of adhesive was observed at the interfacial region. However, the primed dentin surface was sensitive to disruption by the adhesive application brush during its placement, so that parts of the primer layer could be incorporated into the adhesive. This disruption could only be seen using confocal microscopy and a fluorescence labeling technique. Delamination of the primer layer was not observed when the adhesive film was thinned by air blowing. The application of an air stream to the cavity surface increased the penetration of the primer and adhesive along the dentin tubules, but also increased the thickness of the adhesive within irregularities on the cavity surface and at the cavity line angle. The cause of the problems in the handling properties of SMP may be the difference in viscosity between the two components (primer and adhesive) at the adhesive interface.

  16. Innovations in bonding to zirconia-based materials: Part I.

    PubMed

    Aboushelib, Moustafa N; Matinlinna, Jukka P; Salameh, Ziad; Ounsi, Hani

    2008-09-01

    Establishing a reliable bond to zirconia-based materials has proven to be difficult which is the major limitation against fabricating adhesive zirconia restorations. This bond could be improved using novel selective infiltration etching conditioning in combination with engineered zirconia primers. Aim of the work was to evaluate resin-to-zirconia bond strength using selective infiltration etching and novel silane-based zirconia primers. Zirconia discs (Procera Zirconia) received selective infiltration etching surface treatment followed by coating with either of five especially engineered experimental zirconia primers. Pre-aged resin-composite discs (Tetric Ivo Ceram) were bonded to the treated surface using an MDP-containing resin-composite (Panavia F 2.0). The bilayered specimens were cut into microbars and the microtensile bond strength (MTBS) was evaluated. 'As-sintered' zirconia discs served as a control (alpha=0.05). The broken microbars were examined using a scanning electron microscope (SEM). The combination of selective infiltration etching with experimental zirconia primers significantly improved (F=3805, P<0.0001) the MTBS values (41+/-5.8 MPa) compared to the 'as-sintered' surface using the same primers which demonstrated spontaneous failure and very low bond strength values (2.6+/-3.1 MPa). SEM analysis revealed that selective infiltration etching surface treatment resulted in a nano-retentive surface where the zirconia primers were able to penetrate and interlock which explained the higher MTBS values observed for the treated specimens.

  17. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    PubMed

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  18. Development of highly polymorphic EST-SSR markers and segregation in F₁ hybrid population of Vitis vinifera L.

    PubMed

    Kayesh, E; Zhang, Y Y; Liu, G S; Bilkish, N; Sun, X; Leng, X P; Fang, J G

    2013-09-23

    The objectives of this investigation were to develop and validate the expressed sequence tag (EST)-simple sequence repeat (SSR) markers from large EST sequences, and to study the segregation and distribution of SSRs within two grapevine parental lines. In total, 94 F₁ lines crossed between "Early Rose" and "Red Globe" were studied. Approximately 2100 EST-SSR sequences of Vitis vinifera L. were searched for SSRs and analyzed for the design of polymerase chain reaction (PCR) primers amplifying the SSR-rich regions. Trinucleotide repeats were found to be the most abundant, followed by other nucleotide repeats. A total of 182 SSR primer pairs were first developed for the study on the parental polymorphism. Among the 182 SSR primers, 142 primer pairs (78%) could amplify the anticipated PCR products, among which only 52 primer pairs (36.62%) showed polymorphism between the two parents. These polymorphic bands were further surveyed among the 94 F₁ lines, and the results showed that a total of 162 bands were amplified, and 98 of them were polymorphic in both parents (60.86% polymorphism), with an average of 1.88 polymorphic DNA bands for each primer pair. After testing with the chi-square test, 33 of the clearly amplified polymorphic bands followed a 3:1 ratio, and 37 followed a 1:1 ratio. The rest showed distorted segregation ratios.

  19. Sex identification of four penguin species using locus-specific PCR.

    PubMed

    Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

    2013-01-01

    Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

  20. Morphological and chemical characterization of the dentin/resin cement interface produced with a self-etching primer.

    PubMed

    Walker, Mary P; Wang, Yong; Spencer, Paulette

    2002-01-01

    The purpose of this study was to analyze a resin cement/dentin interface by comparing the diffusion of a resin cement into dentin surfaces pretreated with a self-etching primer with or without pretreatment by conventional acid etching. Dentin surfaces of 8 unerupted human third molars were treated with a self-etch primer (Panavia 21) with or without conventional phosphoric acid pretreatment. Panavia 21 resin cement was applied according to manufacturer's instructions. Dentin/resin cement interface sections from each tooth were examined with scanning electron microscopy and micro-Raman spectroscopy. When the self-etch primer was used following conventional acid pretreatment, the resin cement did not penetrate to the depth of the zone of demineralized dentin, leaving a substantial area of exposed dentin matrix at the dentin/cement interface. In contrast, there was substantial resin cement diffusion throughout the demineralized dentin when the self-etch primer was used without acid etching pretreatment. The in vitro evaluation of resin cement penetration throughout the zone of demineralized dentin is an important step in identifying sites of exposed dentin matrix that may promote postoperative sensitivity and may leave the dentin/resin cement interface vulnerable to premature degradation under clinical conditions. In this study, the self-etch primer used alone produced substantial resin cement penetration and left no exposed dentin matrix at the dentin/resin cement interface.

  1. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

    PubMed Central

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

    2017-01-01

    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  2. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    PubMed

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

    PubMed

    David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

    2017-01-04

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†

    PubMed Central

    Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

    2000-01-01

    We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

  5. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    PubMed

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Effects of soldier-derived terpenes on soldier caste differentiation in the termite Reticulitermes flavipes.

    PubMed

    Tarver, Matthew R; Schmelz, Eric A; Rocca, James R; Scharf, Michael E

    2009-02-01

    Primer pheromones play key roles in regulating division of labor, which is a fundamental and defining aspect of insect sociality. Primer pheromones are chemical messengers that transmit hormone-like messages among colony members; in recipients, these messages can either induce or suppress phenotypic caste differentiation. Here, we investigated soldier caste-derived chemicals as possible primer pheromones in the lower termite Reticulitermes flavipes, a species for which no primer pheromones have yet been identified. We determined that soldier head extracts (SHE), when provided to totipotent workers along with the insect morphogenetic juvenile hormone (JH), significantly enhanced soldier caste differentiation. When applied alone, however, SHE had no impacts on caste differentiation, survivorship, or any other aspect of worker biology. These findings support a function of soldier chemicals as primer pheromones that enhance the action of the endogenous JH. In accord with previous studies, gamma-cadinene and the corresponding aldehyde, gamma-cadinenal, were identified by gas chromatography-mass spectrometry and nuclear magnetic resonance analyses as the two most abundant components of R. flavipes SHE. Validative bioassays with commercially available cadinene confirmed activity. Several other terpenes, previously identified in R. flavipes soldiers, also were found to be active. These findings reveal a novel primer pheromone-like function for soldier-derived terpenes in termites and further suggest convergent evolution of terpene functions in enhancing JH-dependent soldier caste differentiation.

  7. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

    PubMed Central

    Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.

    2014-01-01

    New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428

  8. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  9. Back to Basics--The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities.

    PubMed

    Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H

    2015-01-01

    DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.

  10. Zoledronate and ion-releasing resins impair dentin collagen degradation.

    PubMed

    Tezvergil-Mutluay, A; Seseogullari-Dirihan, R; Feitosa, V P; Tay, F R; Watson, T F; Pashley, D H; Sauro, S

    2014-10-01

    This study analyzed the amounts of solubilized telopeptides cross-linked carboxyterminal telopeptide of type I collagen (ICTP) and C-terminal crosslinked telopeptide of type I collagen (CTX) derived from matrix-metalloproteinases (MMPs) and cysteine cathepsins (CTPs) subsequent to application of a filler-free (Res.A) or an ion-releasing resin (Res.B) to ethylenediaminetetraacetic acid (EDTA)-demineralized dentin with or without zoledronate-containing primer (Zol-primer) pre-treatment. The chemical modification induced following treatments and artificial saliva (AS) storage was also analyzed through attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR). Totally EDTA-demineralized specimens were infiltrated with Res.A or Res.B with or without Zol-primer pre-treatment, light-cured, and immersed in AS for up to 4 wk. ICTP release was reduced following infiltration with Res.B and further reduced when Res.B was used with Zol-primer; remarkable phosphate mineral uptake was attained after AS storage. CTX release was increased in Res.A- and Res.B-treated dentin. However, when Zol-primer was used with Res.A, the CTX release fell significantly compared to the other tested resin-infiltration methods. In conclusion, zoledronate offers an additional inhibitory effect to the ion-releasing resins in MMP-mediated collagen degradation. However, Zol-primer induces a modest reduction in CTX release only when used with resin-based systems containing no ion-releasing fillers. © International & American Associations for Dental Research.

  11. Zoledronate and Ion-releasing Resins Impair Dentin Collagen Degradation

    PubMed Central

    Tezvergil-Mutluay, A.; Seseogullari-Dirihan, R.; Feitosa, V.P.; Tay, F.R.; Watson, T.F.; Pashley, D.H.; Sauro, S.

    2014-01-01

    This study analyzed the amounts of solubilized telopeptides cross-linked carboxyterminal telopeptide of type I collagen (ICTP) and C-terminal crosslinked telopeptide of type I collagen (CTX) derived from matrix-metalloproteinases (MMPs) and cysteine cathepsins (CTPs) subsequent to application of a filler-free (Res.A) or an ion-releasing resin (Res.B) to ethylenediaminetetraacetic acid (EDTA)-demineralized dentin with or without zoledronate-containing primer (Zol-primer) pre-treatment. The chemical modification induced following treatments and artificial saliva (AS) storage was also analyzed through attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR). Totally EDTA-demineralized specimens were infiltrated with Res.A or Res.B with or without Zol-primer pre-treatment, light-cured, and immersed in AS for up to 4 wk. ICTP release was reduced following infiltration with Res.B and further reduced when Res.B was used with Zol-primer; remarkable phosphate mineral uptake was attained after AS storage. CTX release was increased in Res.A- and Res.B-treated dentin. However, when Zol-primer was used with Res.A, the CTX release fell significantly compared to the other tested resin-infiltration methods. In conclusion, zoledronate offers an additional inhibitory effect to the ion-releasing resins in MMP-mediated collagen degradation. However, Zol-primer induces a modest reduction in CTX release only when used with resin-based systems containing no ion-releasing fillers. PMID:25074494

  12. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    NASA Astrophysics Data System (ADS)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  13. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    PubMed

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  14. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

    PubMed Central

    Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A.; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C. M.; Osorio, F.; Gonzalez-Lopez, Jesus

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed. PMID:26421306

  15. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

    PubMed

    Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  16. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    PubMed Central

    Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

    2014-01-01

    A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

  17. Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene.

    PubMed

    Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee

    2007-01-01

    Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.

  18. Characterization of a Methanogenic Community within an Algal Fed Anaerobic Digester

    PubMed Central

    Ellis, Joshua T.; Tramp, Cody; Sims, Ronald C.; Miller, Charles D.

    2012-01-01

    The microbial diversity and metabolic potential of a methanogenic consortium residing in a 3785-liter anaerobic digester, fed with wastewater algae, was analyzed using 454 pyrosequencing technology. DNA was extracted from anaerobic sludge material and used in metagenomic analysis through PCR amplification of the methyl-coenzyme M reductase α subunit (mcrA) gene using primer sets ML, MCR, and ME. The majority of annotated mcrA sequences were assigned taxonomically to the genera Methanosaeta in the order Methanosarcinales. Methanogens from the genus Methanosaeta are obligate acetotrophs, suggesting this genus plays a dominant role in methane production from the analyzed fermentation sample. Numerous analyzed sequences within the algae fed anaerobic digester were unclassified and could not be assigned taxonomically. Relative amplicon frequencies were determined for each primer set to determine the utility of each in pyrosequencing. Primer sets ML and MCR performed better quantitatively (representing the large majority of analyzed sequences) than primer set ME. However, each of these primer sets was shown to provide a quantitatively unique community structure, and thus they are of equal importance in mcrA metagenomic analysis. PMID:23724331

  19. Characterization of (CA)n microsatellite repeats from large-insert clones.

    PubMed

    Litt, M; Browne, D

    2001-05-01

    The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

  20. Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

    PubMed

    Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

    2007-08-31

    Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

  1. S-genotype identification based on allele-specific PCR in Japanese pear

    PubMed Central

    Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya

    2015-01-01

    Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617

  2. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    PubMed

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  3. New generic primer system targeting mucosal/genital and cutaneous human papillomaviruses leads to the characterization of HPV 115, a novel Beta-papillomavirus species 3

    PubMed Central

    Chouhy, Diego; Gorosito, Mario; Sánchez, Adriana; Serra, Esteban C; Bergero, Adriana; Bussy, Ramón Fernandez; Giri, Adriana A

    2009-01-01

    We explored the cutaneotropic HPV genetic diversity in 71 subjects from Argentina. New generic primers (CUT) targeting 88 mucosal/cutaneous HPV were designed and compared to FAP primers. Overall, 69 different HPV types/putative types were identified, being 17 of them novel putative types. Phylogenetic analysis of partial L1 sequences grouped 2 novel putative types in the Beta-PV, 14 in the Gamma-PV and 1 in the Mu-PV genera. CUT primers showed broader capacity than FAP primers in detecting different genera/species and novel putative types (p<0.01). Using overlapping PCR, the full-length genome of a Beta-PV putative type was amplified and cloned. The new virus, designated HPV 115, encodes 5 early genes and 2 late genes. Phylogenetic analysis indicated HPV 115 as the most divergent type within the genus Beta-PV species 3. This report is the first providing data on cutaneous HPVs circulating in South America and expands our knowledge of the Papillomaviridae family. PMID:19948351

  4. Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens

    PubMed Central

    Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.

    2012-01-01

    Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or negative. We evaluated two conventional primer pairs in common use and a new primer pair based on the dual priming oligonucleotide (DPO) principle. Cross-reactivity was observed when both conventional primer pairs were used, resulting in interpretation difficulties. No cross-reactivity was observed using the DPOs even in specimens with a high ratio of human to bacterial DNA. In addition to reducing cross-reactivity, the DPO principle also offers a high degree of flexibility in the design of primers and should be considered for any PCR assay intended for detection and identification of pathogens directly from human clinical specimens. PMID:22278843

  5. Phase relation of CaSO4 at high pressure and temperature up to 90 GPa and 2300 K

    NASA Astrophysics Data System (ADS)

    Fujii, Taku; Ohfuji, Hiroaki; Inoue, Toru

    2016-05-01

    Calcium sulfate (CaSO4), one of the major sulfate minerals in the Earth's crust, is expected to play a major role in sulfur recycling into the deep mantle. Here, we investigated the crystal structure and phase relation of CaSO4 up to ~90 GPa and 2300 K through a series of high-pressure experiments combined with in situ X-ray diffraction. CaSO4 forms three thermodynamically stable polymorphs: anhydrite (stable below 3 GPa), monazite-type phase (stable between 3 and ~13 GPa) and barite-type phase (stable up to at least 93 GPa). Anhydrite to monazite-type phase transition is induced by pressure even at room temperature, while monazite- to barite-type transition requires heating at least to 1500 K at ~20 GPa. The barite-type phase cannot always be quenched from high temperature and is distorted to metastable AgMnO4-type structure or another modified barite structure depending on pressure. We obtained the pressure-volume data and density of anhydrite, monazite- and barite-type phases and found that their densities are lower than those calculated from the PREM model in the studied P-T conditions. This suggests that CaSO4 is gravitationally unstable in the mantle and fluid/melt phase into which sulfur dissolves and/or sulfate-sulfide speciation may play a major role in the sulfur recycling into the deep Earth.

  6. Assessment of novel maleic anhydride copolymers prepared via nitroxide-mediated radical polymerization as CaSO4 crystal growth inhibitors.

    PubMed

    Al-Roomi, Yousef Mohammad; Hussain, Kaneez Fatema

    2017-04-01

    Calcium sulfate is one of the dominant scales which, unlike carbonate scale, are not easily removable by acid. To inhibit CaSO 4 scale formation in artificial cooling water systems, well-defined low molecular weight maleic anhydride and n-alkylacrylamide copolymers (YMR-S series) were synthesized via nitroxide-mediated radical polymerization initiated by benzoyl peroxide in the presence of 2,2,6,6-tetramethyl-1-piperidinyloxy at varying concentrations. These polymerizations exhibit living polymerization characteristics; that is, they show linear growth in chain length as a function of monomer conversion, and have narrow molecular weight distributions. Resultant polymers were characterized by means of 1 H-NMR and 13 C-NMR. The inhibition behavior of these YMR-S series polymers against CaSO 4 was evaluated using the static scale inhibition method and a dynamic tube block test. The inhibition ability on the CaSO 4 scale is 99.5% with 9 ppm dosage level at pH 10.45 and temperature 70°C. Scanning electronic microscope analysis proved the morphological changes of the CaSO 4 scales due to the strong inhibition action of YMR-S polymers. It is also observed that the antiscaling effect of the copolymers greatly depends on the molecular weight, and the optimum range is below 20,000 and approximately in the range 500-2000.

  7. Tetranucleotide microsatellite loci from the black bear (Ursus americanus)

    USGS Publications Warehouse

    Sanderlin, J.S.; Faircloth, B.C.; Shamblin, B.; Conroy, M.J.

    2009-01-01

    We describe primers and polymerase chain reaction conditions to amplify 21 tetranucleotide microsatellite DNA loci in black bears (Ursus americanus). We tested primers using individuals from two populations, one each in Georgia and Florida. Among individuals from Georgia (n = 29), primer pairs yielded an average of 2.9 alleles (range, one to four) and an average observed heterozygosity (HO) of 0.50 (range, 0.00 to 0.79). Among individuals from Florida (n = 19), primer pairs yielded an average of 5.7 alleles (range, one to 14) and an HO of 0.55 (range, 0.00 to 1.00). A comparison of previously developed markers with individuals from Georgia suggests that bear populations in Georgia and Florida have reduced allelic diversity relative to other populations. ?? 2008 The Authors.

  8. Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing1

    PubMed Central

    Li, Yong; Zhang, Weirui

    2015-01-01

    Premise of the study: Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Methods and Results: Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. Conclusions: This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding. PMID:26504683

  9. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    PubMed

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    PubMed

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  11. Best Development Practices: A Primer for Smart Growth

    EPA Pesticide Factsheets

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  12. A Descriptive Overview of Japanese Shipbuilding Surface Preparation and Coating Methods

    DTIC Science & Technology

    1982-09-01

    INORGANIC SHOP PRIMER I Materials I Weight BASE PASTE Total Alkyl-silicate Catalyst Alcohol Special organic resin Tinting pigment Anti-sagging agent... Alcohol Zinc powder 32.0 2.0 6.0 0.5 8.0 40.0 100.0 Shop Primer Composition (Courtesy of Chugoku Marine Paints 51 Limited) 4.2.1 Shop Primer...at a pH of 10 is added to minimize the oxydizing reactions which lead to salt formation and adhesion failure. “Galvanite” is the trade name for the

  13. Combination Antiangiogenic and Immunomodulatory Gene Therapy for Breast Cancer

    DTIC Science & Technology

    2002-06-01

    Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a positive control. The samples were run on a...cultured cells and specific primers for Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a...positive control. Arrows indicate the 500 bp, 410 bp and 109 bp amplified products of Flk-1, endoglin and G3PDH , respectively. Fig 3. Viral replication

  14. Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation

    NASA Technical Reports Server (NTRS)

    Hockridge, R. R.; Thibault, H. G.

    1972-01-01

    The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.

  15. Neural Networks: A Primer

    DTIC Science & Technology

    1991-05-01

    AL-TP-1 991-0011 LA )_ NEURAL NETWORKS : A PRIMER.R • M 1 - T< R Vince L Wiggins 0 RRC, Incorporated N 3833 Texas Avenue, Suite 256 G Bryan, TX 77802T...5.av bln)2FUOTDTEF.-EOTTP NDIN NUMBCOERSD Neural Networks : A Primer C - F41 689-88-D-0251 PE - 62205F PR - 7719 6. AUTHOR(S) TA - 20 Vin~ce L Wiggins...Maximum 200 words) Neural network technology has recently demonstrated capabilities in areas important to personnel research such as statistical analysis

  16. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    EPA Pesticide Factsheets

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  17. Primer on noise.

    DOT National Transportation Integrated Search

    1972-01-01

    This primer was directed to the district and resident engineers of the Virginia Department of Highways, who are responsible for conducting highway public hearings, and to the environmental specialists of the Department's Environmental Quality Divisio...

  18. [RAPD analysis of Aspergilli and its application in brewing industry].

    PubMed

    Pan, Li; Wang, Bin; Guo, Yong

    2007-06-01

    Phylogenetic analysis of sixteen Aspergilli was done by RAPD technology, using Aspergillus oryzae AS3.951, Aspergillus flavus GIM3.18 and Aspergillus sojae AS3.495 as controls. First, genome DNA of the sixteen test strains were prepared by improved extraction method, and their quality was verified by electrophoresis and spectrophotometry. They displayed an identical band (approximately 20 kb) in agarose gel electrophoresis, which conformed to the fact that these strains all belong to Aspergillus. OD260/OD280 of the prepared DNA ranged from 1.80 to 1.90, illustrating that they were good enough to be used as templates in the following RAPD-PCR experiment. Then, three appropriate primers (Primerl, Primer2, Primer5) for RAPD-PCR were screened from nine random primers, and repetitive experiments demonstrated that the RAPD-PCR polymorphic patterns of the sixteen test strains based on these three primers were stable. There were usually 8-14 bands in their RADP-PCR patterns, where the number of the main bands was 4-9 and the secondary bands were abundant. There were totally 181 bands in their RAPD-PCR patterns, where the percentage of polymorphic bands reached to 40.9% (74 bands). The similarity coefficient between the strains was calculated based on their RAPD-PCR patterns, ranging from 8.0% to 96.6%. All these data suggests that the genetic polymorphism of the strains is abundant and they have evident genetic differentiation. The phylogenetic tree of the sixteen test strains was reconstructed according to their RAPD-PCR patterns with Primer1, Primer2 and Primer5. It basically corresponded to traditional morphological taxonomy, demonstrating that the application of RAPD molecular marker in the phylogenetic analysis of these Aspergilli is feasible. Besides, the aflatoxin-producing strains (GIM3.17, CICC2219, CICC2357, CICC2390, CICC2402, CICC2404) could be easily discriminated by RAPD molecular marker, whereas it is difficult to distinguish them by conventional morphological taxonomy. Consequently, RAPD molecular marker provides a novel clue to discriminating aflatoxin-producing strains in brewing industry.

  19. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    PubMed

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter (pitA, pstS) were amplified from 13 respectively 9 distinct microbial orders. Accordingly the introduced primers represent a valuable tool for further analysis of the microbial community involved in the turnover of phosphorus in soils but most likely also in other environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Masking overshoot: Effects of ipsilateral, bilateral and contralateral priming

    NASA Astrophysics Data System (ADS)

    Connington, Maureen Catherine

    This study was concerned with masking overshoot, the elevation of the threshold of a brief signal when it is presented at the onset of a masking noise rather than at its temporal center. More specifically, it was concerned with the release from overshoot (i.e., threshold improvement) produced by priming stimuli, presented ipsilaterally, bilaterally and contralaterally at primer- masker gaps of 20, 40 and 80 msec. The more general purpose of the study was to assess the contributions of peripheral and central factors to the overshoot and overshoot-release phenomena. The primers and masking stimuli consisted of white noise bursts of 200 and 400 msec duration, respectively. The probe signal was a 20 msec 4kHz tone. The tone and masker were always presented in one ear. There were, however, 3 modes of primer presentation: ipsilateral, bilateral (identical waveforms to both ears) and contralateral. Three primer-masker gaps of 20, 40 and 80 msec were used. Five normally hearing adults were tested at primer and masker levels of 80 dB HL. Four of the five subjects exhibited significant masking overshoot, when tested without priming. Ipsilateral priming with 20 and 40 msec gaps produced significant masking release from overshoot. Threshold became poorer, however with increasing gap duration and with increasing distance of the perceived primer from the test ear (i.e. ipsilateral priming produced better thresholds than did bilateral priming and bilateral priming produced better thresholds than contralateral priming). There was significant masking enhancement (i.e. threshold was significantly poorer than in the unprimed probe at onset condition) with the contralateral 80 msec primer. The fact that ipsilateral and bilateral primers performed differently does not support the theory that masking overshoot and its release are solely the results of peripheral adaptation. In fact, the group results support the conclusion that masking overshoot is influenced by central factors. However, there were marked inter-subject differences. It seems possible that masking overshoot and its release are influenced by both peripheral adaptation effects and central processes and that the balance between the two is subject-dependent.

  1. Alignment-Free Design of Highly Discriminatory Diagnostic Primer Sets for Escherichia coli O104:H4 Outbreak Strains

    PubMed Central

    Bielaszewska, Martina; Karch, Helge; Toth, Ian K.

    2012-01-01

    Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820

  2. Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

    PubMed

    Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

    2017-08-01

    Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

  3. Presentación del estudio "Links" de hombres que tienes sexo con hombres en Buenos Aires, Argentina.

    PubMed

    Carballo-Diéguez, Alex; Avila, María M; Balán, Iván C; Marone, Rubén; Pando, María A; Barreda, Victoria

    2011-03-01

    Estudios previos en Buenos Aires reportaron altas prevalencias de HIV entre HSH, con valores que oscilan entre 9 y 14% durante casi 10 años de continuo testeo. El objetivo principal de este estudio fue la evaluación de factores relacionados al comportamiento de alto riesgo para transmisión del HIV entre HSH entre los que se incluyen el conocimiento y factores emocionales, socioculturales y ambientales. Por otro lado se realizó la estimación de prevalencia e incidencia de HIV utilizando RDS (Respondent Driven Sampling), así como la presencia de otras infecciones de transmisión sexual. Por último se evaluaron los hábitos de testeo para HIV indagando que factores facilitan o impiden su realización. El estudio constó de dos fases, en primer lugar una fase cualitativa y posteriormente una fase cuantitativa con una duración total de 4 años y medio. Durante la fase cualitativa se realizaron 44 entrevistas individuales en profundidad, 8 grupos focales y 10 observaciones etnográficas (hoteles, baños públicos ("teteras"), cines pornográficos, fiestas privadas, dark rooms y discotecas). Durante la fase cuantitativa del estudio se realizó el reclutamiento de 500 participantes que provinieron de la Ciudad Autónoma de Buenos Aires, así como del Gran Buenos Aires. El reclutamiento se comenzó con 16 participantes llamados semillas. Se realizó el diagnóstico de infección por HIV, hepatitis B y C (HBV y HCV), Treponema pallidum, Virus Papiloma Humano (HPV) y Chlamidias. La colaboración establecida entre los grupos de trabajo enfocados en áreas diversas posibilitó el abordaje conjunto de nuevas estrategias de investigación antes no exploradas en nuestro país. Los resultados más relevantes de esta investigación serán progresivamente publicados en sucesivos números de Actualizaciones en SIDA.

  4. Designing for transportation management and operations : a primer.

    DOT National Transportation Integrated Search

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  5. Quick spacecraft charging primer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  6. Corrosion-Protection Coatings for Aluminum

    NASA Technical Reports Server (NTRS)

    Higgins, R. H.

    1983-01-01

    Study investigates 21 combinatios of surface treatments, primers and topcoats. Study considers several types of coatings, including primers, enamels, chlorinated rubbers, alkyds, epoxies, vinyls, polyurethanes, waterbased paints, and antifouling paints. 20-page report summarizes the study.

  7. Microsatellite primers for the Pacific Northwest conifer Callitropsis nootkatensis (Cupressaceae)

    Treesearch

    Tar N. Jennings; Brian J. Knaus; Katherine Alderman; Paul E. Hennon; David V. D’Amore; Richard. Cronn

    2013-01-01

    Microsatellite primers were developed for Nootka cypress ( Callitropsis nootkatensis ) to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline.

  8. Selected Transportation Topics : Energy Primer

    DOT National Transportation Integrated Search

    1975-01-01

    Energy involved in transportation has become a critical consideration in recent years. This primer contains ten representative articles of those resulting from government reports, conference papers, etc., on what the current energy situation is, and ...

  9. A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.

    PubMed

    Murata, C; Ogura, G; Kuroiwa, A

    2011-03-01

    To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.

  10. Tetranucleotide microsatellite loci from the black bear (Ursus americanus).

    PubMed

    Sanderlin, Jamie Skvarla; Faircloth, Brant C; Shamblin, Brian; Conroy, Michael J

    2009-01-01

    We describe primers and polymerase chain reaction conditions to amplify 21 tetranucleotide microsatellite DNA loci in black bears (Ursus americanus). We tested primers using individuals from two populations, one each in Georgia and Florida. Among individuals from Georgia (n = 29), primer pairs yielded an average of 2.9 alleles (range, one to four) and an average observed heterozygosity (H(O) ) of 0.50 (range, 0.00 to 0.79). Among individuals from Florida (n = 19), primer pairs yielded an average of 5.7 alleles (range, one to 14) and an H(O) of 0.55 (range, 0.00 to 1.00). A comparison of previously developed markers with individuals from Georgia suggests that bear populations in Georgia and Florida have reduced allelic diversity relative to other populations. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.

  11. Novel microsatellite loci for Agave parryi and cross-amplification in Agave palmeri (Agavaceae).

    PubMed

    Lindsay, Denise L; Edwards, Christine E; Jung, Michael G; Bailey, Pamela; Lance, Richard F

    2012-07-01

    To examine the foraging behavior of nectarivorous bats in southeastern Arizona, we developed microsatellite primers in Agave parryi. These markers were also tested for cross-amplification and applicability to assess patterns of genetic diversity and structure in A. palmeri. Utilizing DNA sequence data from 454 shotgun sequencing, we identified seven novel polymorphic microsatellite loci in A. parryi and screened them for cross-amplification in A. palmeri. These markers were characterized in two populations of 30 individuals each for each species. In A. parryi, all primers were polymorphic and amplified between three and 12 alleles per population. In A. palmeri, all primers amplified, six were polymorphic, and allelic diversity ranged from one to 16 alleles per population. Our results demonstrate the applicability of these microsatellite primers for population genetics studies in both A. parryi and A. palmeri.

  12. Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

    PubMed

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

    2015-03-20

    USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

  13. Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification

    PubMed Central

    Guo, Xu-Guang; Zhou, Shan

    2014-01-01

    Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360

  14. Tensile Bond Strength of So-called Universal Primers and Universal Multimode Adhesives to Zirconia and Lithium Disilicate Ceramics.

    PubMed

    Elsayed, Adham; Younes, Feras; Lehmann, Frank; Kern, Matthias

    2017-01-01

    To test the bond strength and durability after artificial aging of so-called universal primers and universal multimode adhesives to lithium disilicate or zirconia ceramics. A total of 240 ceramic plates, divided into two groups, were produced and conditioned: 120 acid-etched lithium disilicate plates (IPS e.max CAD) and 120 air-abraded zirconia plates (Zenostar T). Each group was divided into five subgroups (n = 24), and a universal restorative primer or multimode universal adhesive was used for each subgroup to bond plexiglas tubes filled with a composite resin to the ceramic plate. The specimens were stored in water at 37°C for 3 days without thermal cycling, or for 30 or 150 days with 7500 or 37,500 thermal cycles between 5°C and 55°C, respectively. All specimens then underwent tensile bond strength testing. Initially, all bonding systems exhibited high TBS, but some showed a significant reduction after 30 and 150 days of storage. After 3, 30, and 150 days, Monobond Plus, which contains silane and phosphate monomer, showed significantly higher bond strengths than the other universal primer and adhesive systems. The bond strength to lithium disilicate and zirconia ceramic is significantly affected by the bonding system used. Using a separate primer containg silane and phosphate monomer provides more durable bonding than do silanes incorporated in universal multimode adhesives. Only one of five so-called universal primers and adhesives provided durable bonding to lithium disilicate and zirconia ceramic.

  15. Detection of the genetic variation of polygalacturonase-inhibiting protein gene 2 in autotetraploid alfalfa (Medicago sativa) using an improved SSCP technique.

    PubMed

    Gui, Z; Liu, H Q; Wang, Y; Yuan, Q H; Xin, N; Zhang, X; Li, X L; Pi, Y S; Gao, J M

    2014-12-04

    In this study, 2 approaches were adopted to obtain good single-strand conformation polymorphism (SSCP) data for autotetraploid alfalfa; primers were added to PCR products, and fluorescent-labeled primers were utilized. PCR-SSCP conditions for a 331-bp fragment in the coding region of polygalacturonase-inhibiting protein gene 2 in alfalfa (MsPGIP2) were optimized, and the results showed that the best SSCP gel pattern could be obtained when the loading mixture was made by mixing 1 μL PCR products, 0.2 to 0.8 μL unlabeled primers (50 μM) and 4 to 16 μL loading buffer. Furthermore, the use of the fluorescent-labeled primers resulted in 2 separated electrophoresis images from 2 complementary single DNA strands, thus making the determination of alleles and idiotypes a relatively easy task. In addition, the results of sequencing prove that the determination of alleles and idiotypes were accurate based on SSCP analysis. Finally, a total of 9 alleles with 18 SNP sites were identified for MsPGIP2 in the alfalfa variety 'Algonquin'. In conclusion, MsPGIP2 possessed great genetic variation, and the addition of primers to the PCR products in combination with the fluorescent labeling of primers could significantly improve the sensitivity and resolution of SSCP analysis. This technique could be used for genetic diversity detection and marker-assisted breeding of useful genes in autopolyploid species such as alfalfa.

  16. Effect of a metal primer on the bond strength of the resin-metal interface.

    PubMed

    Freitas, Anderson Pinheiro de; Francisconi, Paulo Afonso Silveira

    2004-06-01

    To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD) and a resin cement (Rely X TM) and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes) and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray); Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm²) obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP), regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.

  17. A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

    PubMed

    Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

    2013-03-11

    Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

  18. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    PubMed

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  19. Isolation and characterization of novel microsatellite markers from the sika deer (Cervus nippon) genome.

    PubMed

    Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H

    2015-09-28

    Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.

  20. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    PubMed

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  1. One-Tube-Only Standardized Site-Directed Mutagenesis: An Alternative Approach to Generate Amino Acid Substitution Collections

    PubMed Central

    Mingo, Janire; Erramuzpe, Asier; Luna, Sandra; Aurtenetxe, Olaia; Amo, Laura; Diez, Ibai; Schepens, Jan T. G.; Hendriks, Wiljan J. A. J.; Cortés, Jesús M.; Pulido, Rafael

    2016-01-01

    Site-directed mutagenesis (SDM) is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis. PMID:27548698

  2. Study Of Genetic Diversity Between Grasspea Landraces Using Morphological And Molecular Marker

    NASA Astrophysics Data System (ADS)

    Sedehi, Abbasali Vahabi; Lotfi, Asefeh; Solooki, Mahmood

    2008-01-01

    Grass pea is a beneficial crop to Iran since it has some major advantageous such as high grain and forage quality, high drought tolerance and medium level of salinity tolerance and a good native germplasm variation which accessible for breeding programs. This study was carried out to evaluate morphological traits of the grass pea landraces using a randomized complete block design with 3 replications at Research Farm of Isfahan University of Technology. To evaluate genetic diversity of 14 grass pea landraces from various locations in Iran were investigated using 32 RAPD & ISJ primers at Biocenter of University of Zabol. Analysis of variance indicated a highly significant differences among 14 grass pea landrace for the morphological traits. Average of polymorphism percentage of RAPD primer was 73.9%. Among used primer, 12 random primers showed polymorphism and a total of 56 different bands were observed in the genotypes. Jafar-abad and Sar-chahan genotypes with similarity coefficient of 66% and Khoram-abad 2 and Khoram-abad 7 genotypes with similarity coefficient of 3% were the most related and the most distinct genotypes, respectively. Fourteen primers out of 17 semi random primers produced 70 polymorphic bands which included 56% of the total 126 produced bands. Genetic relatedness among population was investigated using Jacard coefficient and unweighted pair group mean analysis (UPGMA) algorithm. The result of this research verified possibility of use of RAPD & ISJ markers for estimation of genetic diversity, management of genetic resources and determination of repetitive accessions in grass pea.

  3. Impact of gamma rays on the Phaffia rhodozyma genome revealed by RAPD-PCR.

    PubMed

    Najafi, N; Hosseini, Ramin; Ahmadi, Ar

    2011-12-01

    Phaffia rhodozyma is a red yeast which produces astaxanthin as the major carotenoid pigment. Astaxanthin is thought to reduce the incidence of cancer and degenerative diseases in man. It also enhances the immune response and acts as a free-radical quencher, a precursor of vitamin A, or a pigment involved in the visual attraction of animals as mating partners. The impact of gamma irradiation was studied on the Phaffia rhodozyma genome. Ten mutant strains, designated Gam1-Gam10, were obtained using gamma irradiation. Ten decamer random amplified polymorphic DNA (RAPD) primers were employed to assess genetic changes. Nine primers revealed scorable polymorphisms and a total of 95 band positions were scored; amongst which 38 bands (37.5%) were polymorphic. Primer F with 3 bands and primer J20 with 13 bands produced the lowest and the highest number of bands, respectively. Primer A16 produced the highest number of polymorphic bands (70% polymorphism) and primer F showed the lowest number of polymorphic bands (0% polymorphism). Genetic distances were calculated using Jaccard's coefficient and the UPGMA method. A dendrogram was created using SPSS (version 11.5) and the strains were clustered into four groups. RAPD markers could distinguish between the parental and the mutant strains of P. rhodozyma. RAPD technique showed that some changes had occurred in the genome of the mutated strains. This technique demonstrated the capability to differentiate between the parental and the mutant strains.

  4. Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

    PubMed

    Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

    2011-12-01

    Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

  5. Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

    PubMed

    Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

    2013-01-01

    There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

  6. Evaluation of LSSP-PCR for identification of Leptospira spp. in urine samples of cattle with clinical suspicion of leptospirosis.

    PubMed

    Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota

    2006-12-20

    We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.

  7. PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

    PubMed Central

    Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

    2015-01-01

    The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

  8. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  9. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

    PubMed

    Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

    2015-01-01

    This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  10. Comparison of three PCR primer sets for identification of vanB gene carriage in feces and correlation with carriage of vancomycin-resistant enterococci: interference by vanB-containing anaerobic bacilli.

    PubMed

    Ballard, S A; Grabsch, E A; Johnson, P D R; Grayson, M L

    2005-01-01

    We assessed the sensitivities and specificities of three previously described PCR primers on enrichment broth cultures of feces for the accurate detection of fecal carriage of vancomycin-resistant enterococci (VRE). In addition, we investigated specimens that were vanB PCR positive but VRE culture negative for the presence of other vanB-containing pathogens. Feces from 59 patients (12 patients carrying vanB Enterococcus faecium strains and 47 patients negative for VRE carriage) were cultured for 36 h in aerobic brain heart infusion (BHI) broth, anaerobic BHI (AnO(2)BHI) broth, or aerobic Enterococcosel (EC) broth. DNA was extracted from the cultures and tested for the presence of vanB by using the PCR primers of Dutka-Malen et al. (S. Dutka-Malen, S. Evers, and P. Courvalin, J. Clin. Microbiol. 33:24-27, 1995), Bell et al. (J. M. Bell, J. C. Paton, and J. Turnidge, J. Clin. Microbiol. 36:2187-2190, 1998), and Stinear et al. (T. P. Stinear, D. C. Olden, P. D. R. Johnson, J. K. Davies, and M. L. Grayson, Lancet 357:855-856, 2001). The sensitivity (specificity) of PCR compared with the results of culture on BHI, AnO(2)BHI, and EC broths were 67% (96%), 50% (94%), and 17% (100%), respectively, with the primers of Dutka-Malen et al.; 92% (60%), 92% (45%), and 92% (83%), respectively, with the primers of Bell et al.; and 92% (49%), 92% (43%), and 100% (51%) respectively, with the primers of Stinear et al. The primers of both Bell et al. and Stinear et al. were significantly more sensitive than those of Dutka-Malen et al. in EC broth (P = 0.001 and P < 0.001, respectively). The poor specificities for all primer pairs were due in part to the isolation and identification of six anaerobic gram-positive bacilli, Clostridium hathewayi (n = 3), a Clostridium innocuum-like organism (n = 1), Clostridium bolteae (n = 1), and Ruminococcus lactaris-like (n = 1), from five fecal specimens that were vanB positive but VRE culture negative. All six organisms were demonstrated to contain a vanB gene identical to that of VRE. VanB-containing bowel anaerobes may result in false-positive interpretation of PCR-positive fecal enrichment cultures as VRE, regardless of the primers and protocols used.

  11. Evaluation of Primers Targeting the Diazotroph Functional Gene and Development of NifMAP – A Bioinformatics Pipeline for Analyzing nifH Amplicon Data

    PubMed Central

    Angel, Roey; Nepel, Maximilian; Panhölzl, Christopher; Schmidt, Hannes; Herbold, Craig W.; Eichorst, Stephanie A.; Woebken, Dagmar

    2018-01-01

    Diazotrophic microorganisms introduce biologically available nitrogen (N) to the global N cycle through the activity of the nitrogenase enzyme. The genetically conserved dinitrogenase reductase (nifH) gene is phylogenetically distributed across four clusters (I–IV) and is widely used as a marker gene for N2 fixation, permitting investigators to study the genetic diversity of diazotrophs in nature and target potential participants in N2 fixation. To date there have been limited, standardized pipelines for analyzing the nifH functional gene, which is in stark contrast to the 16S rRNA gene. Here we present a bioinformatics pipeline for processing nifH amplicon datasets – NifMAP (“NifH MiSeq Illumina Amplicon Analysis Pipeline”), which as a novel aspect uses Hidden-Markov Models to filter out homologous genes to nifH. By using this pipeline, we evaluated the broadly inclusive primer pairs (Ueda19F–R6, IGK3–DVV, and F2–R6) that target the nifH gene. To evaluate any systematic biases, the nifH gene was amplified with the aforementioned primer pairs in a diverse collection of environmental samples (soils, rhizosphere and roots samples, biological soil crusts and estuarine samples), in addition to a nifH mock community consisting of six phylogenetically diverse members. We noted that all primer pairs co-amplified nifH homologs to varying degrees; up to 90% of the amplicons were nifH homologs with IGK3–DVV in some samples (rhizosphere and roots from tall oat-grass). In regards to specificity, we observed some degree of bias across the primer pairs. For example, primer pair F2–R6 discriminated against cyanobacteria (amongst others), yet captured many sequences from subclusters IIIE and IIIL-N. These aforementioned subclusters were largely missing by the primer pair IGK3–DVV, which also tended to discriminate against Alphaproteobacteria, but amplified sequences within clusters IIIC (affiliated with Clostridia) and clusters IVB and IVC. Primer pair Ueda19F–R6 exhibited the least bias and successfully captured diazotrophs in cluster I and subclusters IIIE, IIIL, IIIM, and IIIN, but tended to discriminate against Firmicutes and subcluster IIIC. Taken together, our newly established bioinformatics pipeline, NifMAP, along with our systematic evaluations of nifH primer pairs permit more robust, high-throughput investigations of diazotrophs in diverse environments. PMID:29760683

  12. New Arsenate Reductase Gene (arrA) PCR Primers for Diversity Assessment and Quantification in Environmental Samples

    PubMed Central

    Sorensen, Darwin L.; Dupont, R. Ryan

    2016-01-01

    ABSTRACT The extent of arsenic contamination in drinking water and its potential threat to human health have resulted in considerable research interest in the microbial species responsible for arsenic reduction. The arsenate reductase gene (arrA), an important component of the microbial arsenate reduction system, has been widely used as a biomarker to study arsenate-reducing microorganisms. A new primer pair was designed and evaluated for quantitative PCR (qPCR) and high-throughput sequencing of the arrA gene, because currently available PCR primers are not suitable for these applications. The primers were evaluated in silico and empirically tested for amplification of arrA genes in clones and for amplification and high-throughput sequencing of arrA genes from soil and groundwater samples. In silico, this primer pair matched (≥90% DNA identity) 86% of arrA gene sequences from GenBank. Empirical evaluation showed successful amplification of arrA gene clones of diverse phylogenetic groups, as well as amplification and high-throughput sequencing of independent soil and groundwater samples without preenrichment, suggesting that these primers are highly specific and can amplify a broad diversity of arrA genes. The arrA gene diversity from soil and groundwater samples from the Cache Valley Basin (CVB) in Utah was greater than anticipated. We observed a significant correlation between arrA gene abundance, quantified through qPCR, and reduced arsenic (AsIII) concentrations in the groundwater samples. Furthermore, we demonstrated that these primers can be useful for studying the diversity of arsenate-reducing microbial communities and the ways in which their relative abundance in groundwater may be associated with different groundwater quality parameters. IMPORTANCE Arsenic is a major drinking water contaminant that threatens the health of millions of people worldwide. The extent of arsenic contamination and its potential threat to human health have resulted in considerable interest in the study of microbial species responsible for the reduction of arsenic, i.e., the conversion of AsV to AsIII. In this study, we developed a new primer pair to evaluate the diversity and abundance of arsenate-reducing microorganisms in soil and groundwater samples from the CVB in Utah. We observed significant arrA gene diversity in the CVB soil and groundwater samples, and arrA gene abundance was significantly correlated with the reduced arsenic (AsIII) concentrations in the groundwater samples. We think that these primers are useful for studying the ecology of arsenate-reducing microorganisms in different environments. PMID:27913413

  13. Determination of self attenuation coefficient and relative TL efficiency of CaSO 4 :Dy, LiF:Mg,Cu,P and LiF:Mg,Ti TLDs - An alternate approach

    NASA Astrophysics Data System (ADS)

    Bakshi, A. K.; Chatterjee, S.; Palani Selvam, T.; Joshi, V. J.; Chougaonkar, M. P.

    2011-10-01

    Self attenuation of TL and relative TL efficiency of polytetra fluoro ethylene (PTFE) embedded CaSO 4:Dy disc, LiF:Mg,Ti (MTS) disc and LiF:Mg,Cu,P (MCP-N) chip were determined in the present study for photons of energy 10-34 keV. The relative TL efficiency was determined using an alternative approach in which ratio of experimental response and corrected theoretical response was used instead of measuring the absolute TL emission in photon counting mode. For CaSO 4:Dy disc, it was found that with increasing the proportion of CaSO 4:Dy phosphor in the disc, the light attenuation coefficient increases. The light attenuation coefficient of MTS disc and MCP-N chip was found to be 23.4 and 45.5 cm -1, respectively. The relative TL efficiency in the photon energy range of 10-34 keV for MTS discs and MCP-N chips, evaluated in the present study matches well with the reported values in the literature.

  14. Linfoma Nasal de Células T/Natural Killer Extranodal Refractario Mal Diagnosticado, Tratado de Manera Exitosa: Informe de Caso.

    PubMed

    Saavedra Ramírez, José Domingo

    2017-01-01

    El linfoma de células T/natural killer extranodal ("extranodal natural killer/T-cell lymphoma", ENKL) nasal es un linfoma no Hodgkin (LNH) agresivo y poco común para el cual no se ha establecido un tratamiento de referencia claro, especialmente en el escenario de la enfermedad recidivante/refractaria. Debido a su rareza, no se han llevado a cabo ensayos aleatorizados específicamente en ENKL nasal; sin embargo, los informes de caso y las series de caso pequeñas ofrecen un conocimiento importante sobre nuevos tratamientos potenciales. Presentamos el informe de caso de un paciente con ENKL nasal (previamente mal diagnosticado como una sinusitis crónica recidivante) en quien la enfermedad progresó durante la quimioterapia con múltiples agentes pero respondió al tratamiento de segunda línea con pralatrexato como agente único. Analizamos opciones de tratamiento para el ENKL nasal recidivante/refractario y sugerimos que el pralatrexato se evalúe más a fondo en este escenario clínico.

  15. Numerical simulation of calcium sulfate (CaSO4) fouling in the plate heat exchanger

    NASA Astrophysics Data System (ADS)

    Xu, Zhiming; Zhao, Yu; Han, Zhimin; Wang, Jingtao

    2018-07-01

    Plate heat exchanger is a widely used apparatus in the industrial production processes. Through a numerical simulation method, this paper calculates the deposition rate of CaSO4 fouling on heat transfer surfaces of the plate heat exchanger under saturation in the bulk. The effects of CaSO4 concentration in the range 0.7 kg/m3 to 1.5 kg/m3, inlet flow velocity under turbulent flow, and the fluid's inlet temperature from 288 K to 328 K on the deposition rate, removal mass rate and fouling resistance are investigated. The simulation results are compared with the experimental results showing similar trend. The simulation results show that the concentration and the flow velocity affect significantly the fouling characteristics in the plate heat exchanger. The deposition mass rate, removal mass rate, and asymptotic value of fouling resistance all increase with the increase in CaSO4 concentration and the inlet temperature of the hot fluid, while the asymptotic value of fouling resistance decreases with the increasing of inlet flow velocity. The influence of the inlet temperature of cold fluid may be negligible.

  16. Linfoma Nasal de Células T/Natural Killer Extranodal Refractario Mal Diagnosticado, Tratado de Manera Exitosa: Informe de Caso

    PubMed Central

    Saavedra Ramírez, José Domingo

    2017-01-01

    El linfoma de células T/natural killer extranodal (“extranodal natural killer/T-cell lymphoma”, ENKL) nasal es un linfoma no Hodgkin (LNH) agresivo y poco común para el cual no se ha establecido un tratamiento de referencia claro, especialmente en el escenario de la enfermedad recidivante/refractaria. Debido a su rareza, no se han llevado a cabo ensayos aleatorizados específicamente en ENKL nasal; sin embargo, los informes de caso y las series de caso pequeñas ofrecen un conocimiento importante sobre nuevos tratamientos potenciales. Presentamos el informe de caso de un paciente con ENKL nasal (previamente mal diagnosticado como una sinusitis crónica recidivante) en quien la enfermedad progresó durante la quimioterapia con múltiples agentes pero respondió al tratamiento de segunda línea con pralatrexato como agente único. Analizamos opciones de tratamiento para el ENKL nasal recidivante/refractario y sugerimos que el pralatrexato se evalúe más a fondo en este escenario clínico. PMID:29430232

  17. Nanophosphor CaSO4:Eu2+ for photoluminescence liquid crystal display (PLLCD)

    NASA Astrophysics Data System (ADS)

    Patle, Anita; Patil, R. R.; Moharil, S. V.

    2018-05-01

    In this work PL enhancement of CaSO4:Eu2+ nanophosphor which was synthesized with 0.01M molarity by co-precipitation method is presented. Synthesized phosphor was characterized by XRD, SEM, TEM and PL measurements. Average particle size is found to be in the range 80-100nm with Hexagonal morphology and PL studies showed emission peaks at 380nm, when samples were excited by 254nm. The observed PL emission is characteristic emission of Eu2+ similar to that observed in bulk CaSO4:Eu2. However under identical condition it is observed that intensity of emission get enhanced for 0.01M size which is doubled to that of 0.1M with similar emission at 380nm. A phosphor with narrow emission band around 390 nm is desirable, since at this wavelength the transmission of standard glass, polarizing plastic, other coating and LCD material is at acceptable level. Strong Eu2+ emission is observed in CaSO4:Eu nanophosphor which finds applications for PLLCD (photoluminescent liquid crystal display).

  18. Effect of moisture on dental enamel in the interaction of two orthodontic bonding systems.

    PubMed

    Bertoz, André Pinheiro de Magalhães; de Oliveira, Derly Tescaro Narcizo; Gimenez, Carla Maria Melleiro; Briso, André Luiz Fraga; Bertoz, Francisco Antonio; Santos, Eduardo César Almada

    2013-01-01

    The purpose of this study was to assess by means of scanning electron microscopy (SEM) the remaining adhesive interface after debonding orthodontic attachments bonded to bovine teeth with the use of hydrophilic and hydrophobic primers under different dental substrate moisture conditions. Twenty mandibular incisors were divided into four groups (n = 5). In Group I, bracket bonding was performed with Transbond MIP hydrophilic primer and Transbond XT adhesive paste applied to moist substrate, and in Group II a bonding system comprising Transbond XT hydrophobic primer and adhesive paste was applied to moist substrate. Brackets were bonded to the specimens in Groups III and IV using the same adhesive systems, but on dry dental enamel. The images were qualitatively assessed by SEM. The absence of moisture in etched enamel enabled better interaction between bonding materials and the adamantine structure. The hydrophobic primer achieved the worst micromechanical interlocking results when applied to a moist dental structure, whereas the hydrophilic system proved versatile, yielding acceptable results in moist conditions and excellent interaction in the absence of contamination. The authors assert that the best condition for the application of primers to dental enamel occurs in the absence of moisture.

  19. A Hamiltonian approach to the planar optimization of mid-course corrections

    NASA Astrophysics Data System (ADS)

    Iorfida, E.; Palmer, P. L.; Roberts, M.

    2016-04-01

    Lawden's primer vector theory gives a set of necessary conditions that characterize the optimality of a transfer orbit, defined accordingly to the possibility of adding mid-course corrections. In this paper a novel approach is proposed where, through a polar coordinates transformation, the primer vector components decouple. Furthermore, the case when transfer, departure and arrival orbits are coplanar is analyzed using a Hamiltonian approach. This procedure leads to approximate analytic solutions for the in-plane components of the primer vector. Moreover, the solution for the circular transfer case is proven to be the Hill's solution. The novel procedure reduces the mathematical and computational complexity of the original case study. It is shown that the primer vector is independent of the semi-major axis of the transfer orbit. The case with a fixed transfer trajectory and variable initial and final thrust impulses is studied. The acquired related optimality maps are presented and analyzed and they express the likelihood of a set of trajectories to be optimal. Furthermore, it is presented which kind of requirements have to be fulfilled by a set of departure and arrival orbits to have the same profile of primer vector.

  20. Development of a molecular approach to describe the composition of Trichoderma communities.

    PubMed

    Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele

    2010-01-01

    Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.

Top