A PMB Primer.

ERIC Educational Resources Information Center

Whetstone, B. D.; Yates, Benny

This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…

PRISE2: software for designing sequence-selective PCR primers and probes.

PubMed

Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

2014-09-25

PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

UniPrime2: a web service providing easier Universal Primer design.

PubMed

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

PD5: a general purpose library for primer design software.

PubMed

Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

2013-01-01

Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

An optoelectronic detecting based environment perception experiment for primer students using multiple-layer laser scanner

NASA Astrophysics Data System (ADS)

Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei

2017-08-01

One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.

Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism

USDA-ARS?s Scientific Manuscript database

Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

PubMed

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

DOE PAGES

Yoon, Hyejin; Leitner, Thomas

2014-12-17

Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

S-genotype identification based on allele-specific PCR in Japanese pear

PubMed Central

Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya

2015-01-01

Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617

PrimerZ: streamlined primer design for promoters, exons and human SNPs.

PubMed

Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

2007-07-01

PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

PubMed Central

Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

2018-01-01

MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

Evaluation of a computer-based approach to teaching acid/base physiology.

PubMed

Rawson, Richard E; Quinlan, Kathleen M

2002-12-01

Because acid/base physiology is a difficult subject for most medical and veterinary students, the first author designed a software program, Acid/Base Primer, that would help students with this topic. The Acid/Base Primer was designed and evaluated within a conceptual framework of basic educational principles. Seventy-five first-year veterinary students (of 81; 93% response rate) participated in this study. Students took both a pre- and posttest of content understanding. After completing the Acid/Base Primer in pairs, each student filled out a survey evaluating the features of the program and describing his/her use and experience of it. Four pairs of students participated in interviews that elaborated on the surveys. Scores improved from 53 +/- 2% on the pretest to 74 +/- 1% on an immediate posttest. On surveys and in interviews, students reported that the program helped them construct their own understanding of acid/base physiology and prompted discussions in pairs of students when individual understandings differed. The case-based format provided anchors and a high degree of relevance. Repetition of concepts helped students develop a more complex network of understanding. Questions in the program served to scaffold the learning process by providing direction, accentuating the relevant features of the cases, and provoking discussion. Guidelines for software development were generated on the basis of the findings and relevant educational literature.

Sex identification of four penguin species using locus-specific PCR.

PubMed

Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

2013-01-01

Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

PubMed Central

O’Halloran, Damien M.

2016-01-01

Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

PubMed

Pauthenier, Cyrille; Faulon, Jean-Loup

2014-07-01

PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Nuclear Reactions Primer with Computers.

ERIC Educational Resources Information Center

Calle, Carlos I.; Roach, Jennifer A.

1987-01-01

Described is a microcomputer software program NUCLEAR REACTIONS designed for college level students and in use at Sweet Briar College (Sweet Briar, VA). The program is written in Microsoft Basic Version 2.1 for the Apple Macintosh Microcomputer. It introduces two conservation principles: (1) conservation of charge; and (2) conservation of nucleon…

Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

PubMed

Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

2014-06-03

Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR

PubMed Central

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.

Mississippi School Library Media Programs: A Guide for Management. A Competency Based Handbook for Certified Library Media Specialists, Administrators, and Evaluators.

ERIC Educational Resources Information Center

Mississippi State Dept. of Education, Jackson.

This new publication, which replaces A Primer for Mississippi School Librarians published in 1967, is designed for use in planning, implementing, and evaluating school library media programs. For the administrator, there are competencies which must be met to develop the library media program as an integral part of the total instructional program.…

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

PubMed

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

PubMed Central

2013-01-01

Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

PubMed Central

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-01-01

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-01-01

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

The Annual Report of the National Shipbuilding Research Program (The Naval Shipbuilding Research Program)

DTIC Science & Technology

1986-08-29

Abrasives Work Planning for Shipyard SP&C Training Overcoating of Zinc Primers Citric Acid Cleaning - Phase II - Waterborne Coatings Economics of...members workout organizational problems with minimum government involvement a set of strong, committed, and sometimes fiercely independent panels and...01 Manual of Welding Planning and Design Guidelines - Phase III PANEL SP-3 Ship Design Considerations: Adaptation of Japanese Pre - 7 9 79 81 82 83 83

Military Role in Space Control: A Primer

DTIC Science & Technology

2004-09-23

on the KEAsat program, NFIRE , and other space control activities, see CRS Issue Brief IB92011, U.S. Space Programs: Civilian, Military and Commercial...Missile Defense Agency’s (MDA’s) Near Field Infrared Experiment ( NFIRE ) to study exhaust plumes from rockets to assist in the design of sensors for...other MDA systems. NFIRE is designed to carry one sensor on the main NFIRE spacecraft, and a second sensor on a “Kinetic Kill Vehicle” (KKV) that

Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

PubMed Central

Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

2013-01-01

We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

One-Tube-Only Standardized Site-Directed Mutagenesis: An Alternative Approach to Generate Amino Acid Substitution Collections

PubMed Central

Mingo, Janire; Erramuzpe, Asier; Luna, Sandra; Aurtenetxe, Olaia; Amo, Laura; Diez, Ibai; Schepens, Jan T. G.; Hendriks, Wiljan J. A. J.; Cortés, Jesús M.; Pulido, Rafael

2016-01-01

Site-directed mutagenesis (SDM) is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis. PMID:27548698

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

PubMed

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-07-08

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

PubMed

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-11-16

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR

PubMed Central

Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209

RUCS: rapid identification of PCR primers for unique core sequences.

PubMed

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

2017-12-15

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Amplification of the Gp41 gene for detection of mutations conferring resistance to HIV-1 fusion inhibitors on genotypic assay

NASA Astrophysics Data System (ADS)

Tanumihardja, J.; Bela, B.

2017-08-01

Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

The Planning, Programming and Budgeting System (PPBS). A Primer

DTIC Science & Technology

1987-01-01

Commands input through the JCS as well The DRB reviews and resolves major issues , as required, prior t.o final DG publication . DG is designed to...Air Staff action officer, and takes you through a complete PPBS cycle as an aid to better understanding the overall process. You will find that it...JPAM) 34 -- ISSUES 35 -- THE PROGRAM DECISION MEMORANDUM (PDM) 36 - THE BUDGET ESTIMATE SUBMISSION (BES) 37 o BUDGETING 38 - BUDGET REVIEW - PROGRAM

pelB gene in isolates of Colletotrichum gloeosporioides from several hosts.

PubMed

Medeiros, L V; Maciel, D B; Medeiros, V V; Houllou Kido, L M; Oliveira, N T

2010-04-13

Colletotrichum gloeosporioides is an important pathogen for a great number of economically important crops. During the necrotrophic phase of infection by Colletotrichum spp, the degradative enzymes of plant cell walls, such as pectate lyase, clearly increase. A gene pelB that expresses a pectate lyase was identified in isolates of C. gloeosporioides in avocado pathogens. Various molecular studies have identified a kind of specialization of C. gloeosporioides isolates with specific hosts; however, there have been no studies of this gene in isolates from hosts other than avocado. The same is true for other species of Colletotrichum. We examined genetic variability in order to design primers that would amplify pelB gene fragments and compared the products of this amplification in C. gloeosporioides isolates from different hosts. Genetic variability was assessed using ISSR primers; the resultant data were grouped based on the UPGMA clustering method. Primers for the pelB gene were designed from selected GenBank sequences using the Primer 3 program at an annealing temperature of 60 degrees C and product amplification of nearly 600 bp. The ISSR primers were efficient in demonstrating the genetic variability of the Colletotrichum isolates and in distinguishing C. gloeosporioides, C. acutatum and C. sublineolum species. The gene pelB was found in C. gloeosporioides, C. acutatum and C. sublineolum. Amplified restriction fragments using MspI did not reveal differences in pelB gene structure in isolates from the three different host species that we investigated.

Development and validation of microsatellite markers for Brachiaria ruziziensis obtained by partial genome assembly of Illumina single-end reads

PubMed Central

2013-01-01

Background Brachiaria ruziziensis is one of the most important forage species planted in the tropics. The application of genomic tools to aid the selection of superior genotypes can provide support to B. ruziziensis breeding programs. However, there is a complete lack of information about the B. ruziziensis genome. Also, the availability of genomic tools, such as molecular markers, to support B. ruziziensis breeding programs is rather limited. Recently, next-generation sequencing technologies have been applied to generate sequence data for the identification of microsatellite regions and primer design. In this study, we present a first validated set of SSR markers for Brachiaria ruziziensis, selected from a de novo partial genome assembly of single-end Illumina reads. Results A total of 85,567 perfect microsatellite loci were detected in contigs with a minimum 10X coverage. We selected a set of 500 microsatellite loci identified in contigs with minimum 100X coverage for primer design and synthesis, and tested a subset of 269 primer pairs, 198 of which were polymorphic on 11 representative B. ruziziensis accessions. Descriptive statistics for these primer pairs are presented, as well as estimates of marker transferability to other relevant brachiaria species. Finally, a set of 11 multiplex panels containing the 30 most informative markers was validated and proposed for B. ruziziensis genetic analysis. Conclusions We show that the detection and development of microsatellite markers from genome assembled Illumina single-end DNA sequences is highly efficient. The developed markers are readily suitable for genetic analysis and marker assisted selection of Brachiaria ruziziensis. The use of this approach for microsatellite marker development is promising for species with limited genomic information, whose breeding programs would benefit from the use of genomic tools. To our knowledge, this is the first set of microsatellite markers developed for this important species. PMID:23324172

GSP: A web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

A rapid method for differentiating Saccharomyces sensu stricto strains from other yeast species in an enological environment.

PubMed

Nardi, Tiziana; Carlot, Milena; De Bortoli, Elena; Corich, Viviana; Giacomini, Alessio

2006-11-01

During programs for the selection of enological yeasts, several hundred natural isolates are usually screened. The scope of these operations is to isolate strains possessing good fermentative properties without necessarily arriving at a precise species designation: in other words, to detect strains belonging to the Saccharomyces sensu stricto complex. In the present study, a pair of primers, designed within the variable D1/D2 region of the 26S subunit of ribosomal yeast RNA, have been constructed. These generate an amplification fragment of 471 bp that is specific for the seven Saccharomyces sensu stricto species, while no signal was obtained for Saccharomyces sensu lato strains (17 species) or for another 18 selected species commonly found in enological environments. A second pair of primers was also constructed, within the 18S rRNA gene, composed of perfectly conserved sequences common for all 42 yeast species examined, which generate a 900 bp (c.) band for all strains. This was used as a positive experimental control in multiplex PCR analysis using all four primers.

Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

PubMed

Robertson, Amber L; Phillips, Allison R

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

Real-time PCR (qPCR) primer design using free online software.

PubMed

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

PubMed

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

PubMed Central

Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

2006-01-01

PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

The natural space environment: Effects on spacecraft

NASA Technical Reports Server (NTRS)

James, Bonnie F.; Norton, O. W. (Compiler); Alexander, Margaret B. (Editor)

1994-01-01

The effects of the natural space environments on spacecraft design, development, and operation are the topic of a series of NASA Reference Publications currently being developed by the Electromagnetics and Environments Branch, Systems Analysis and Integration Laboratory, Marshall Space Flight Center. This primer provides an overview of the natural space environments and their effect on spacecraft design, development, and operations, and also highlights some of the new developments in science and technology for each space environment. It is hoped that a better understanding of the space environment and its effect on spacecraft will enable program management to more effectively minimize program risks and costs, optimize design quality, and successfully achieve mission objectives.

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Designing for transportation management and operations : a primer.

DOT National Transportation Integrated Search

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

STITCHER 2.0: primer design for overlapping PCR applications

PubMed Central

O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

2017-01-01

Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

STITCHER 2.0: primer design for overlapping PCR applications.

PubMed

O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

2017-03-30

Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

Measuring the Impact of Employment-Related Social Programs. A Primer on the Evaluation of Employment and Training, Vocational Education, Vocational Rehabilitation, and Other Job-Oriented Programs.

ERIC Educational Resources Information Center

Borus, Michael E.

An approach and methodology for the systematic measurement of the impact of employment-related social programs is presented in this primer. Chapter 1 focuses on evaluation as the third step (the first two being planning and operation) in the process of program implementation. Chapter 2 examines the impacts of social programs. Topics include…

Accelerated bridge paint test program.

DOT National Transportation Integrated Search

2011-07-06

The accelerated bridge paint (AB-Paint) program evaluated a new Sherwin-Williams two-coat, : fast-curing paint system. The system is comprised of an organic zinc-rich primer (SW Corothane I : Galvapac One-Pack Zinc-Rich Primer B65 G11) and a polyurea...

Design of a Percussion and Electric Primer Gun Firing Power Supply

DTIC Science & Technology

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Study Of Genetic Diversity Between Grasspea Landraces Using Morphological And Molecular Marker

NASA Astrophysics Data System (ADS)

Sedehi, Abbasali Vahabi; Lotfi, Asefeh; Solooki, Mahmood

2008-01-01

Grass pea is a beneficial crop to Iran since it has some major advantageous such as high grain and forage quality, high drought tolerance and medium level of salinity tolerance and a good native germplasm variation which accessible for breeding programs. This study was carried out to evaluate morphological traits of the grass pea landraces using a randomized complete block design with 3 replications at Research Farm of Isfahan University of Technology. To evaluate genetic diversity of 14 grass pea landraces from various locations in Iran were investigated using 32 RAPD & ISJ primers at Biocenter of University of Zabol. Analysis of variance indicated a highly significant differences among 14 grass pea landrace for the morphological traits. Average of polymorphism percentage of RAPD primer was 73.9%. Among used primer, 12 random primers showed polymorphism and a total of 56 different bands were observed in the genotypes. Jafar-abad and Sar-chahan genotypes with similarity coefficient of 66% and Khoram-abad 2 and Khoram-abad 7 genotypes with similarity coefficient of 3% were the most related and the most distinct genotypes, respectively. Fourteen primers out of 17 semi random primers produced 70 polymorphic bands which included 56% of the total 126 produced bands. Genetic relatedness among population was investigated using Jacard coefficient and unweighted pair group mean analysis (UPGMA) algorithm. The result of this research verified possibility of use of RAPD & ISJ markers for estimation of genetic diversity, management of genetic resources and determination of repetitive accessions in grass pea.

Intrageneric Primer Design: Bringing Bioinformatics Tools to the Class

ERIC Educational Resources Information Center

Lima, Andre O. S.; Garces, Sergio P. S.

2006-01-01

Bioinformatics is one of the fastest growing scientific areas over the last decade. It focuses on the use of informatics tools for the organization and analysis of biological data. An example of their importance is the availability nowadays of dozens of software programs for genomic and proteomic studies. Thus, there is a growing field (private…

Commuter choice primer : an employer's guide to implementing effective commuter choice programs

DOT National Transportation Integrated Search

2003-01-01

The Commuter Choice Primer is intended to be a concise, user-friendly reference guide for employers and transportation professionals to developing and implementing worksite commuter choice programs. It is available on-line in both HTML and PDF format...

Issues Primer. EEE708 Negotiated Study Program.

ERIC Educational Resources Information Center

Jennings, Leonie

This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

Newly developed primers for complete YCF1 amplification in Pinus (Pinaceae) chloroplasts with possible family-wide utility

Treesearch

Matthew Parks; Aaron Liston; Rich Cronn

2011-01-01

Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

DNA barcoding amphibians and reptiles.

PubMed

Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

2012-01-01

Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

PubMed

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Mi Libro: Initial Reading in Spanish--Pre-Reading Workbook, Teacher's Edition.

ERIC Educational Resources Information Center

Sancho, Anthony R.; Bean, Shirley

This workbook was designed to be used during the pre-reading stage of the "Initial Reading in Spanish" program. It may serve as a practice book, an initial primer, and a coloring book. The lessons emphasize two main areas of development: motor skills and the understanding of concepts such as color, size, shapes, numbers, and emotions. Muscular…

Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

PubMed Central

Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

2014-01-01

For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

Integrative Pre-Service Elementary Teacher Training: The Role of Interdisciplinary Collaborative Mathematics

ERIC Educational Resources Information Center

Chiatula, Victoria Oliaku

2015-01-01

This primer summarizes interdisciplinary collaborative mathematics as an integrative approach to train pre-service elementary teachers to teach math utilizing Junior Achievement USA (JA) educational programs within an elementary Math Methods course. The primer provides a JA historical background/program overview, summarizes the interdisciplinary…

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Treesearch

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

GST-PRIME: an algorithm for genome-wide primer design.

PubMed

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

A method for predicting service life of zinc rich primers on carbon steel

NASA Technical Reports Server (NTRS)

Hoppesch, C. W.

1986-01-01

The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

PubMed

Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

2012-01-01

An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.

Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

PubMed

Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

2014-11-01

To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Primer Modification Improves Rapid and Sensitive In Vitro and Field-Deployable Assays for Detection of High Plains Virus Variants

PubMed Central

Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.

2014-01-01

A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

Identification of Pork Adulteration in Processed Meat Products Using the Developed Mitochondrial DNA-Based Primers

PubMed Central

Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan

2017-01-01

The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitochondrial DNA D-loop region was selected as the pig target DNA sequence and appropriate primers were designed using the MUSCLE program. To evaluate primer sensitivity, pork-beef-chicken mixtures were prepared as follows: i) 0% pork-50% beef-50% chicken, ii) 1% pork-49.5% beef-49.5% chicken, iii) 2% pork-49% beef-49% chicken, iv) 5% pork-47.5% beef-47.5% chicken, v) 10% pork-45% beef-45% chicken, and vi) 100% pork-0% beef-0% chicken. In addition, a total of 35 commercially packaged products, including patties, nuggets, meatballs, and sausages containing processed chicken, beef, or a mixture of various meats, were purchased from commercial markets. The primers developed in our study were able to detect as little as 1% pork in the heat treated pork-beef-chicken mixtures. Of the 35 processed products, three samples were pork positive despite being labeled as beef or chicken only or as a beef-chicken mix. These results indicate that the developed primers could be used to detect pork adulteration in various processed meat products for application in safeguarding religious food ethics, detecting allergens, and preventing food adulteration. PMID:28747833

Quick spacecraft charging primer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, Brian Arthur

2014-03-12

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

DTIC Science & Technology

2015-08-01

preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally

Multiplex primer prediction software for divergent targets

PubMed Central

Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

2009-01-01

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

PubMed

Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

2015-03-20

USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Developing Educational Resources to Advance Umbilical Cord Blood Banking and Research: A Canadian Perspective.

PubMed

Beak, Carla Pereira; Chargé, Sophie B; Isasi, Rosario; Knoppers, Bartha M

2015-05-01

In 2013 Canadian Blood Services (CBS) launched the National Public Cord Blood Bank (NPCBB), a program to collect, process, test, and store cord blood units donated for use in transplantation. A key component of the creation of the NPCBB is the establishment of a program that enables cord blood not suitable for banking or transplantation to be used for biomedical research purposes. Along with the development of processes and policies to manage the NPCBB and the cord blood research program, CBS-in collaboration with researchers from the Stem Cell Network-have also developed educational tools to provide relevant information for target audiences to aid implementation and operation. We describe here one of these tools, the REB Primer on Research and Cord Blood Donation (the Primer), which highlights key ethical and legal considerations and identifies Canadian documents that are relevant to the use of cord blood in biomedical research. The Primer also introduces the NPCBB and describes the systems CBS is implementing to address ethical issues. The Primer is intended to assist research ethics boards in evaluating the ethical acceptability of research protocols, to facilitate harmonized decision-making by providing a common reference, and to highlight the role of research ethics boards in governance frameworks. With the Primer we hope to illustrate how the development of such educational tools can facilitate the ethical implementation and governance of programs related to stem cell research in Canada and abroad.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

PubMed

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

PubMed Central

2018-01-01

Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

PubMed Central

Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

2003-01-01

A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

Congestion pricing : a primer : overview

DOT National Transportation Integrated Search

2008-10-01

This Overview primer was produced to explain the concept of congestion pricing and its benefits, to present examples of congestion-pricing approaches implemented in the United States and abroad, and to briefly discuss federal-aid policy and programs ...

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

Nanotechnology: A Policy Primer

DTIC Science & Technology

2010-06-02

States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

PubMed

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

Primer on Molecular Genetics; DOE Human Genome Program

DOE R&D Accomplishments Database

1992-04-01

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

TipMT: Identification of PCR-based taxon-specific markers.

PubMed

Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

2017-02-11

Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

PubMed Central

Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

PubMed

Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

Data in support of qPCR primer design and verification in a Pink1 -/- rat model of Parkinson disease.

PubMed

Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R

2016-09-01

Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

PubMed Central

2012-01-01

Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

PubMed

Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed

2012-08-10

Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Alignment-Free Design of Highly Discriminatory Diagnostic Primer Sets for Escherichia coli O104:H4 Outbreak Strains

PubMed Central

Bielaszewska, Martina; Karch, Helge; Toth, Ian K.

2012-01-01

Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820

Development of Genomic Microsatellite Markers in Carthamus tinctorius L. (Safflower) Using Next Generation Sequencing and Assessment of Their Cross-Species Transferability and Utility for Diversity Analysis

PubMed Central

Variath, Murali Tottekkad; Joshi, Gopal; Bali, Sapinder; Agarwal, Manu; Kumar, Amar; Jagannath, Arun; Goel, Shailendra

2015-01-01

Background Safflower (Carthamus tinctorius L.), an Asteraceae member, yields high quality edible oil rich in unsaturated fatty acids and is resilient to dry conditions. The crop holds tremendous potential for improvement through concerted molecular breeding programs due to the availability of significant genetic and phenotypic diversity. Genomic resources that could facilitate such breeding programs remain largely underdeveloped in the crop. The present study was initiated to develop a large set of novel microsatellite markers for safflower using next generation sequencing. Principal Findings Low throughput genome sequencing of safflower was performed using Illumina paired end technology providing ~3.5X coverage of the genome. Analysis of sequencing data allowed identification of 23,067 regions harboring perfect microsatellite loci. The safflower genome was found to be rich in dinucleotide repeats followed by tri-, tetra-, penta- and hexa-nucleotides. Primer pairs were designed for 5,716 novel microsatellite sequences with repeat length ≥ 20 bases and optimal flanking regions. A subset of 325 microsatellite loci was tested for amplification, of which 294 loci produced robust amplification. The validated primers were used for assessment of 23 safflower accessions belonging to diverse agro-climatic zones of the world leading to identification of 93 polymorphic primers (31.6%). The numbers of observed alleles at each locus ranged from two to four and mean polymorphism information content was found to be 0.3075. The polymorphic primers were tested for cross-species transferability on nine wild relatives of cultivated safflower. All primers except one showed amplification in at least two wild species while 25 primers amplified across all the nine species. The UPGMA dendrogram clustered C. tinctorius accessions and wild species separately into two major groups. The proposed progenitor species of safflower, C. oxyacantha and C. palaestinus were genetically closer to cultivated safflower and formed a distinct cluster. The cluster analysis also distinguished diploid and tetraploid wild species of safflower. Conclusion Next generation sequencing of safflower genome generated a large set of microsatellite markers. The novel markers developed in this study will add to the existing repertoire of markers and can be used for diversity analysis, synteny studies, construction of linkage maps and marker-assisted selection. PMID:26287743

Making the connection: advancing traffic incident management in transportation planning : a primer.

DOT National Transportation Integrated Search

2013-07-01

"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

PubMed

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-09-29

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

A multiplex primer design algorithm for target amplification of continuous genomic regions.

PubMed

Ozturk, Ahmet Rasit; Can, Tolga

2017-06-19

Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

Reading Assessment: A Primer for Teachers and Tutors.

ERIC Educational Resources Information Center

Caldwell, JoAnne Schudt

This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

Murrinh Nganki (Our Language), 1.

ERIC Educational Resources Information Center

Street, Chester; And Others

This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

GSP: a web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

ERIC Educational Resources Information Center

Schubert, Sandra; Zelinsky, Benjamin

Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

Limited-life cartridge primers

DOEpatents

Makowiecki, Daniel M.; Rosen, Robert S.

1998-01-01

A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

Limited-life cartridge primers

DOEpatents

Makowiecki, Daniel M.; Rosen, Robert S.

2005-04-19

A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

USDA-ARS?s Scientific Manuscript database

Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

Innovative Comparison of Transient Ignition Temperature at the Booster Interface, New Stainless Steel Pyrovalve Primer Chamber Assembly "V" (PCA) Design Versus the Current Aluminum "Y" PCA Design

NASA Technical Reports Server (NTRS)

Saulsberry, Regor L.; McDougle, Stephen H.; Garcia,Roberto; Johnson, Kenneth L.; Sipes, William; Rickman, Steven; Hosangadi, Ashvin

2011-01-01

An assessment of four spacecraft pyrovalve anomalies that occurred during ground testing was conducted by the NASA Engineering & Safety Center (NESC) in 2008. In all four cases, a common aluminum (Al) primer chamber assembly (PCA) was used with dual NASA Standard Initiators (NSIs) and the nearly simultaneous (separated by less than 80 microseconds) firing of both initiators failed to ignite the booster charge. The results of the assessment and associated test program were reported in AIAA Paper AIAA-2008-4798, NESC Independent Assessment of Pyrovalve Ground Test Anomalies. As a result of the four Al PCA anomalies, and the test results and findings of the NESC assessment, the Mars Science Laboratory (MSL) project team decided to make changes to the PCA. The material for the PCA body was changed from aluminum (Al) to stainless steel (SS) to avoid melting, distortion, and potential leakage of the NSI flow passages when the device functioned. The flow passages, which were interconnected in a Y-shaped configuration (Y-PCA) in the original design, were changed to a V-shaped configuration (V-PCA). The V-shape was used to more efficiently transfer energy from the NSIs to the booster. Development and qualification testing of the new design clearly demonstrated faster booster ignition times compared to the legacy AL Y-PCA design. However, the final NESC assessment report recommended that the SS V-PCA be experimentally characterized and quantitatively compared to the Al Y-PCA design. This data was deemed important for properly evaluating the design options for future NASA projects. This test program has successfully quantified the improvement of the SS V-PCA over the Al Y-PCA. A phase B of the project was also conducted and evaluated the effect of firing command skew and enlargement of flame channels to further assist spacecraft applications.

Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

PubMed

Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

2007-10-01

Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.

Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

PubMed

Gell, I; Cubero, J; Melgarejo, P

2007-12-01

To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

PubMed

Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

PubMed Central

Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

Genome-wide characterization and selection of expressed sequence tag simple sequence repeat primers for optimized marker distribution and reliability in peach

USDA-ARS?s Scientific Manuscript database

Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...

BchY-based degenerate primers target all types of anoxygenic photosynthetic bacteria in a single PCR.

PubMed

Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded

2009-12-01

To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

PubMed

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

PubMed

Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

2009-01-01

* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

A New Primer to Amplify pmoA Gene From NC10 Bacteria in the Sediments of Dongchang Lake and Dongping Lake.

PubMed

Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu

2017-08-01

Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.

Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

PubMed Central

Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander

2012-01-01

The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

PubMed

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Limited-life cartridge primers

DOEpatents

Makowiecki, D.M.; Rosen, R.S.

1998-06-30

A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

A Web-Based Adaptive Tutor to Teach PCR Primer Design

ERIC Educational Resources Information Center

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

PubMed Central

Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

1996-01-01

In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

Consensus-Degenerate Hybrid Oligonucleotide Primers for Amplification of Priming Glycosyltransferase Genes of the Exopolysaccharide Locus in Strains of the Lactobacillus casei Group

PubMed Central

Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis

2003-01-01

A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729

Isolation and characterization of novel microsatellite markers from the sika deer (Cervus nippon) genome.

PubMed

Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H

2015-09-28

Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.

PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

PubMed Central

Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

2015-01-01

The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

Overview of Marshall Space Flight Center Activities for the Combustion Stability Tool Development Program

NASA Technical Reports Server (NTRS)

Kenny, R. J.; Greene, W. D.

2016-01-01

This presentation covers the overall scope, schedule, and activities associated with the NASA - Marshall Space Flight Center (MSFC) involvement with the Combustion Stability Tool Development (CSTD) program. The CSTD program is funded by the Air Force Space & Missile Systems Center; it is approximately two years in duration and; and it is sponsoring MSFC to: design, fabricate, & execute multi-element hardware testing, support Air Force Research Laboratory (AFRL) single element testing, and execute testing of a small-scale, multi-element combustion chamber. Specific MSFC Engineering Directorate involvement, per CSTD-sponsored task, will be outlined. This presentation serves a primer for the corresponding works that provide details of the technical work performed by individual groups within MSFC.

PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S. N.

2013-08-08

Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

Building Information Modeling (BIM) Primer. Report 1: Facility Life-Cycle Process and Technology Innovation

DTIC Science & Technology

2012-08-01

Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology Innovation In fo...is unlimited. ERDC/ITL TR-12-2 August 2012 Building Information Modeling ( BIM ) Primer Report 1: Facility Life-cycle Process and Technology...and to enhance the quality of projects through the design, construction, and handover phases. Building Information Modeling ( BIM ) is a

Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

PubMed

Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

2010-08-01

To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

Molecular diagnostic development for begomovirus-betasatellite complexes undergoing diversification: A case study.

PubMed

Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad

2017-09-15

At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.

Gemi: PCR Primers Prediction from Multiple Alignments

PubMed Central

Sobhy, Haitham; Colson, Philippe

2012-01-01

Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

NASA Astrophysics Data System (ADS)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

New generic primer system targeting mucosal/genital and cutaneous human papillomaviruses leads to the characterization of HPV 115, a novel Beta-papillomavirus species 3

PubMed Central

Chouhy, Diego; Gorosito, Mario; Sánchez, Adriana; Serra, Esteban C; Bergero, Adriana; Bussy, Ramón Fernandez; Giri, Adriana A

2009-01-01

We explored the cutaneotropic HPV genetic diversity in 71 subjects from Argentina. New generic primers (CUT) targeting 88 mucosal/cutaneous HPV were designed and compared to FAP primers. Overall, 69 different HPV types/putative types were identified, being 17 of them novel putative types. Phylogenetic analysis of partial L1 sequences grouped 2 novel putative types in the Beta-PV, 14 in the Gamma-PV and 1 in the Mu-PV genera. CUT primers showed broader capacity than FAP primers in detecting different genera/species and novel putative types (p<0.01). Using overlapping PCR, the full-length genome of a Beta-PV putative type was amplified and cloned. The new virus, designated HPV 115, encodes 5 early genes and 2 late genes. Phylogenetic analysis indicated HPV 115 as the most divergent type within the genus Beta-PV species 3. This report is the first providing data on cutaneous HPVs circulating in South America and expands our knowledge of the Papillomaviridae family. PMID:19948351

Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

PubMed

Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

2016-07-01

The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

Plastid primers for angiosperm phylogenetics and phylogeography.

PubMed

Prince, Linda M

2015-06-01

PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

40 CFR Table 1 to Subpart E of... - Product-Weighted Reactivity Limits by Coating Category

Code of Federal Regulations, 2011 CFR

2011-07-01

... AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL VOLATILE ORGANIC COMPOUND EMISSION STANDARDS FOR CONSUMER AND COMMERCIAL PRODUCTS National Volatile Organic Compound Emission Standards for Aerosol Coatings... primers ABP 1.55 Automotive Bumper and Trim Products ABT 1.75 Aviation or Marine Primers AMP 2.00 Aviation...

Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

PubMed

Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M; McClean, Phillip E

2014-01-01

Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate.

Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

PubMed Central

Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M.; McClean, Phillip E.

2013-01-01

Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate. PMID:24860578

25MM Plastic Telescoped Cartridge Case Development Program

DTIC Science & Technology

1975-01-01

Mat’ I____ Projectile: 0wq. No. 30033;7,Rev, A, Platic "Band, 3000 Grain. Primer: Type .SmL. , Lot No.,, , Ne. . Flash Tubet.l3TSpe 1ell Project l...8217 _ ’_"__ Projectile: Dwg. No. 300347, Ray. A, Platic Biand, 3000 Graln. Primer: Type P-SIT.ML , Lot No. . No, Flash Tube:c<# 7’Tr-pecla1, Projectile Rot ntlo...Case: N ,o Rev. ___, Mati:.l, ILt Dwg. No,._____ Rev. M Nt l______Projectile: Dwg, No. 300347, ev • A, Platic ’ t -and, 3000 Grain, Primers Type , Lot

Information theory-based algorithm for in silico prediction of PCR products with whole genomic sequences as templates.

PubMed

Cao, Youfang; Wang, Lianjie; Xu, Kexue; Kou, Chunhai; Zhang, Yulei; Wei, Guifang; He, Junjian; Wang, Yunfang; Zhao, Liping

2005-07-26

A new algorithm for assessing similarity between primer and template has been developed based on the hypothesis that annealing of primer to template is an information transfer process. Primer sequence is converted to a vector of the full potential hydrogen numbers (3 for G or C, 2 for A or T), while template sequence is converted to a vector of the actual hydrogen bond numbers formed after primer annealing. The former is considered as source information and the latter destination information. An information coefficient is calculated as a measure for fidelity of this information transfer process and thus a measure of similarity between primer and potential annealing site on template. Successful prediction of PCR products from whole genomic sequences with a computer program based on the algorithm demonstrated the potential of this new algorithm in areas like in silico PCR and gene finding.

40 CFR 63.821 - Designation of affected sources.

Code of Federal Regulations, 2013 CFR

2013-07-01

... presses and all related equipment, including proof presses, cylinder and parts cleaners, ink and solvent... mass of inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other... inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other materials...

40 CFR 63.821 - Designation of affected sources.

Code of Federal Regulations, 2012 CFR

2012-07-01

... presses and all related equipment, including proof presses, cylinder and parts cleaners, ink and solvent... mass of inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other... inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other materials...

40 CFR 63.821 - Designation of affected sources.

Code of Federal Regulations, 2014 CFR

2014-07-01

... presses and all related equipment, including proof presses, cylinder and parts cleaners, ink and solvent... mass of inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other... inks, coatings, varnishes, adhesives, primers, solvents, thinners, reducers, and other materials...

Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

PubMed

Campos, Maria Jorge; Quesada, Alberto

2017-01-01

PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae)

PubMed Central

2010-01-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

PubMed

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

PubMed Central

Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

2006-01-01

Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

ERIC Educational Resources Information Center

Elkins, Kelly M.; Kadunc, Raelynn E.

2012-01-01

In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers

PubMed Central

Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.

2006-01-01

Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964

Constructing STR multiplex assays.

PubMed

Butler, John M

2005-01-01

Multiplex polymerase chain reaction (PCR) refers to the simultaneous amplification of multiple regions of deoxyribonucleic acid (DNA) using PCR. Commercial short tandem repeat (STR) assays that can coamplify as many as 16 different loci have become widely used in forensic DNA typing. This chapter will focus on some of the aspects of constructing robust STR multiplex assays, including careful design and quality control of PCR primers. Examples from the development of a cat STR 12plex and a human Y chromosome STR 20plex are used to illustrate the importance of various parts of the protocol. Primer design parameters and Internet-accessible resources are discussed, as are solutions to problems with residual dye artifacts that result from impure primers.

Shuffle Optimizer: A Program to Optimize DNA Shuffling for Protein Engineering.

PubMed

Milligan, John N; Garry, Daniel J

2017-01-01

DNA shuffling is a powerful tool to develop libraries of variants for protein engineering. Here, we present a protocol to use our freely available and easy-to-use computer program, Shuffle Optimizer. Shuffle Optimizer is written in the Python computer language and increases the nucleotide homology between two pieces of DNA desired to be shuffled together without changing the amino acid sequence. In addition we also include sections on optimal primer design for DNA shuffling and library construction, a small-volume ultrasonicator method to create sheared DNA, and finally a method to reassemble the sheared fragments and recover and clone the library. The Shuffle Optimizer program and these protocols will be useful to anyone desiring to perform any of the nucleotide homology-dependent shuffling methods.

FindGDPs: fast identification of primers for labeling microbial transcriptomes for DNA microarray analysis

PubMed Central

Blick, Robert J.; Revel, Andrew T.; Hansen, Eric J.

2008-01-01

Summary FindGDPs is a program that uses a greedy algorithm to quickly identify a set of genome-directed primers that specifically anneal to all of the open reading frames in a genome and that do not exhibit full-length complementarity to the members of another user-supplied set of nucleotide sequences. Availability The program code is distributed under the GNU General Public License at http://www8.utsouthwestern.edu/utsw/cda/dept131456/files/159331.html Contact eric.hansen@utsouthwestern.edu PMID:15593406

BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"

EPA Science Inventory

This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

Oligo Design: a computer program for development of probes for oligonucleotide microarrays.

PubMed

Herold, Keith E; Rasooly, Avraham

2003-12-01

Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.

Key Concepts and Terminology in Online Instruction: A Primer for School Psychology Programs

ERIC Educational Resources Information Center

Moy, Gregory; Robbins, Stacey; Fischer, Aaron

2018-01-01

The aim of this article is to provide a primer on the key concepts and terminology of online instruction to faculty considering the adoption of online instructional practices to increase accessibility to graduate students. These concepts and terms are neither specific to school psychology training nor to graduate education. This article is second…

Planning for climate change on the National Wildlife Refuge System

Treesearch

B. Czech; S. Covington; T. M. Crimmins; J. A. Ericson; C. Flather; M. Gale; K. Gerst; M. Higgins; M. Kaib; E. Marino; T. Moran; J. Morton; N. Niemuth; H. Peckett; D. Savignano; L. Saperstein; S. Skorupa; E. Wagener; B. Wilen; B. Wolfe

2014-01-01

This document originated in 2008 as a collaborative project of the U.S. Fish and Wildlife Service (FWS) and the University of Maryland's Graduate Program in Sustainable Development and Conservation Biology. The original title was A Primer on Climate Change for the National Wildlife Refuge System. The Primer has evolved into Planning for Climate Change on the...

A Music Teachers' Primer to Reading. Supplemental Material for RDG 467, RDG 480, RDG 507 and RDG 544.

ERIC Educational Resources Information Center

Parrish, Bert, Ed.; And Others

This primer was developed to help secondary school music teachers to encourage and promote reading in their curricular programs. Guidelines and suggestions are offered on ways teachers can stimulate student reading by capitalizing on student interests and on ways teachers can reinforce vocabulary and comprehension skills. The manual's first…

Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

PubMed Central

2014-01-01

Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

PubMed Central

Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

2006-01-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

PubMed

Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

2006-12-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

Multiplexing Short Primers for Viral Family PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S N; Hiddessen, A L; Hara, C A

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

Rapid identification of red-flesh loquat cultivars using EST-SSR markers based on manual cultivar identification diagram strategy.

PubMed

Li, X Y; Xu, H X; Chen, J W

2014-04-29

Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.

Comparison of the Chromium Distribution in New Super Koropon Primer to 30 Year Old Super Koropon Using Focused Ion Beam/Scanning Electron Microscopy

NASA Technical Reports Server (NTRS)

Lomness, Janice K.; Calle, Luz Marina

2006-01-01

Super Koropon primer (MB0125-055) plays a significant role in the corrosion protection of areas throughout the Orbiter. Because the Shuttle Program relies so heavily upon the performance of the Koropon primer, it is necessary to fully understand all aspects of the behavior of the coating. One area where little understanding of the Koropon primer still exists is the level of risk associated with age related degradation. Recently, efforts were undertaken to better understand the age life of the Koropon primer and to gain some insight into the aging process of this coating. In that study, an aluminum access panel from the Orbiter Enterprise was used to investigate the performance of the old Koropon film. A control panel was also used to study the performance of new Koropon coating. Preliminary investigations into the performance of aged Super Koropon primer indicated a significant decrease in corrosion protection. This investigation serves as an example of how Focused Ion Beam/Scanning Microscopy can be used to characterize the changes that occur as coatings age.

Universal primers for amplification of the complete mitochondrial control region in marine fish species.

PubMed

Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

2012-01-01

Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

Microsatellite primers for red drum (Sciaenops ocellatus)

USDA-ARS?s Scientific Manuscript database

In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

A Hearing Aid Primer 1

ERIC Educational Resources Information Center

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

PubMed Central

Bokulich, Nicholas A.

2013-01-01

Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

PubMed

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

PubMed Central

2014-01-01

Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

Development of Species-Specific Primers for Agronomical Thrips and Multiplex Assay for Quarantine Identification of Western Flower Thrips.

PubMed

Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

2014-10-01

While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.

Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

PubMed Central

Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

2005-01-01

A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

Massively Parallel Sequencing Detected a Mutation in the MFN2 Gene Missed by Sanger Sequencing Due to a Primer Mismatch on an SNP Site.

PubMed

Neupauerová, Jana; Grečmalová, Dagmar; Seeman, Pavel; Laššuthová, Petra

2016-05-01

We describe a patient with early onset severe axonal Charcot-Marie-Tooth disease (CMT2) with dominant inheritance, in whom Sanger sequencing failed to detect a mutation in the mitofusin 2 (MFN2) gene because of a single nucleotide polymorphism (rs2236057) under the PCR primer sequence. The severe early onset phenotype and the family history with severely affected mother (died after delivery) was very suggestive of CMT2A and this suspicion was finally confirmed by a MFN2 mutation. The mutation p.His361Tyr was later detected in the patient by massively parallel sequencing with a gene panel for hereditary neuropathies. According to this information, new primers for amplification and sequencing were designed which bind away from the polymorphic sites of the patient's DNA. Sanger sequencing with these new primers then confirmed the heterozygous mutation in the MFN2 gene in this patient. This case report shows that massively parallel sequencing may in some rare cases be more sensitive than Sanger sequencing and highlights the importance of accurate primer design which requires special attention. © 2016 John Wiley & Sons Ltd/University College London.

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

PubMed Central

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-01-01

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

PubMed

Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

2015-07-01

Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

PubMed

Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

2014-09-01

Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

PubMed

Gonzales, J L; Loza, A; Chacon, E

2006-03-15

There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

DNA authentication of animal-derived concentrated Chinese medicine granules.

PubMed

Jiang, Li-Li; Lo, Yat-Tung; Chen, Wei-Ting; Shaw, Pang-Chui

2016-09-10

Concentrated Chinese medicine granules (CCMG) offer patients a convenient option for traditional therapy. However with morphological and microscopic characteristics lost, it is difficult to authenticate and control the quality of these medicinal products. This study is the first to examine the feasibility of using DNA techniques to authenticate animal-derived CCMG, which has so far lacking of effective means for authentication. Primers targeting amplicons of different sizes were designed to determine the presence of PCR-amplifiable DNA fragments in two types of CCMG, namely Zaocys and Scorpio. Species-specific primers were designed to differentiate the genuine drugs from their adulterants. The specificity of the designed primers was evaluated in crude drugs (including genuine and adulterant) and CCMG. Results showed that by using species-specific primers, DNA fragments of less than 200bp could be isolated from the CCMG and the concerned source materials. This study demonstrated the presence of small size DNA in animal-derived CCMG and the DNA is effective in species identification. The work has extended the application of DNA techniques in herbal medicine and this approach may be further developed for quality control and regulatory compliance in the CCMG industry. Copyright © 2016 Elsevier B.V. All rights reserved.

Primer on the Highway Safety Improvement Program (HSIP)

DOT National Transportation Integrated Search

2014-09-16

The Highway Safety Improvement Program (HSIP) is a core Federal-aid program for State Departments of Transportation (State DOTs) administered by the Federal Highway Administration (FHWA). This is a major source of funding for safety projects on the n...

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowman, Stephen M

2008-09-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

PubMed

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

A guide to State programs for the reclamation of surface mined areas

USGS Publications Warehouse

Imhoff, Edgar A.; Friz, Thomas O.; LaFevers, James R.

1976-01-01

During 1975 inquiries of agencies in each State and review of State statutes and related administrative codes revealed that 38 States have established programs requiring the reclamation of surface mined lands. Results of analyses of those programs and ancillary data are presented in : (1) A table (matrix) which has been designed for the notation and elaboration of information pertaining to the mined-area reclamation programs of the 50 States; (2) a primer on surface mining activities and related reclamation practices and problems; and (3) a listing of types of non-Federal governmental controls applicable to reclamation. Interpretations of the status and content of State programs suggest that although a common thread runs through State statutory language, administrative requirements vary from State to State in order to meet different natural, economic, social, and political considerations. A general trend is seen in State programs toward the requiring of an integration of landuse planning and mine planning, with increased local governmental involvement.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

PubMed

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements

PubMed Central

Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.

2010-01-01

Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612

An Introduction to Programming for Bioscientists: A Python-Based Primer

PubMed Central

Mura, Cameron

2016-01-01

Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i) its straightforward semantics and clean syntax make it a readily accessible first language; (ii) it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii) the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.). This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language’s usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a “variable,” the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences. PMID:27271528

An Introduction to Programming for Bioscientists: A Python-Based Primer.

PubMed

Ekmekci, Berk; McAnany, Charles E; Mura, Cameron

2016-06-01

Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i) its straightforward semantics and clean syntax make it a readily accessible first language; (ii) it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii) the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.). This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.

WebSat--a web software for microsatellite marker development.

PubMed

Martins, Wellington Santos; Lucas, Divino César Soares; Neves, Kelligton Fabricio de Souza; Bertioli, David John

2009-01-01

Simple sequence repeats (SSR), also known as microsatellites, have been extensively used as molecular markers due to their abundance and high degree of polymorphism. We have developed a simple to use web software, called WebSat, for microsatellite molecular marker prediction and development. WebSat is accessible through the Internet, requiring no program installation. Although a web solution, it makes use of Ajax techniques, providing a rich, responsive user interface. WebSat allows the submission of sequences, visualization of microsatellites and the design of primers suitable for their amplification. The program allows full control of parameters and the easy export of the resulting data, thus facilitating the development of microsatellite markers. The web tool may be accessed at http://purl.oclc.org/NET/websat/

Theoretical Backgrounds: Internet for Training Teachers and the Development of the HyperCard Internet Primer.

ERIC Educational Resources Information Center

Anderson, Daniel K.

1996-01-01

Discusses theoretical backgrounds for training teachers to use the Internet, including: a history of the Internet, education reform, technology and education, teacher training, affective domains, learning styles, and evaluation. Instructional design considerations are described for developing the HyperCard Internet Primer, software introducing…

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S-23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide.

PubMed

Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X

2003-01-01

The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.

Recent sequence variation in probe binding site affected detection of respiratory syncytial virus group B by real-time RT-PCR.

PubMed

Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James

2017-03-01

Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

PubMed

Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

2000-12-01

Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

PubMed

Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

2007-01-01

Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

Technical note: development of a quantitative PCR method for monitoring strain dynamics during yogurt manufacture.

PubMed

Miller, D M; Dudley, E G; Roberts, R F

2012-09-01

Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

PubMed Central

Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

2012-01-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223

j5 v2.8.4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillson, Nathan

j5 automates and optimizes the design of the molecular biological process of cloning/constructing DNA. j5 enables users to benefit from (combinatorial) multi-part scar-less SLIC, Gibson, CPEC, Golden Gate assembly, or variants thereof, for which automation software does not currently exist, without the intense labor currently associated with the process. j5 inputs a list of the DNA sequences to be assembled, along with a Genbank, FASTA, jbei-seq, or SBOL v1.1 format sequence file for each DNA source. Given the list of DNA sequences to be assembled, j5 first determines the cost-minimizing assembly strategy for each part (direct synthesis, PCR/SOE, or oligo-embedding),more » designs DNA oligos with Primer3, adds flanking homology sequences (SLIC, Gibson, and CPEC; optimized with Primer3 for CPEC) or optimized overhang sequences (Golden Gate) to the oligos and direct synthesis pieces, and utilizes BLAST to check against oligo mis-priming and assembly piece incompatibility events. After identifying DNA oligos that are already contained within a local collection for reuse, the program estimates the total cost of direct synthesis and new oligos to be ordered. In the instance that j5 identifies putative assembly piece incompatibilities (multiple pieces with high flanking sequence homology), the program suggests hierarchical subassemblies where possible. The program outputs a comma-separated value (CSV) file, viewable via Excel or other spreadsheet software, that contains assembly design information (such as the PCR/SOE reactions to perform, their anticipated sizes and sequences, etc.) as well as a properly annotated genbank file containing the sequence resulting from the assembly, and appends the local oligo library with the oligos to be ordered j5 condenses multiple independent assembly projects into 96-well format for high-throughput liquid-handling robotics platforms, and generates configuration files for the PR-PR biology-friendly robot programming language. j5 thus provides a new way to design DNA assembly procedures much more productively and efficiently, not only in terms of time, but also in terms of cost. To a large extent, however, j5 does not allow people to do something that could not be done before by hand given enough time and effort. An exception to this is that, since the very act of using j5 to design the DNA assembly process standardizes the experimental details and workflow, j5 enables a single person to concurrently perform the independent DNA construction tasks of an entire group of researchers. Currently, this is not readily possible, since separate researchers employ disparate design strategies and workflows, and furthermore, their designs and workflows are very infrequently fully captured in an electronic format which is conducive to automation.« less

Establishing a public-private partnership program : a primer.

DOT National Transportation Integrated Search

2012-11-01

Establishing a Public-Private Partnership (P3) program within a public agency involves issues from enabling legislation through identification, evaluation, negotiation and management of P3 projects. Public agencies will need: A legal framework to...

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

PubMed

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

PubMed Central

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-01-01

Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

Gene Polymorphism Studies in a Teaching Laboratory

NASA Astrophysics Data System (ADS)

Shultz, Jeffry

2009-02-01

I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this example, students used genes annotated for the steroid biosynthesis pathway in soybean. The authoritative Kyoto encyclopedia of genes and genomes (KEGG) interactive database and other online resources were used to design primers based first on soybean expressed sequence tags (ESTs), then on ESTs from an alternate organism if soybean sequence was unavailable. Students designed a total of 50 gene-based primer pairs (37 soybean, 13 alternative) and tested these for polymorphism state and similarity between two soybean and two pea lines. Student assessment was based on acquisition of laboratory skills and successful project completion. This simple procedure illustrates conservation of genes and is not limited to soybean or pea. Cost per student estimates are included, along with a detailed protocol and flow diagram of the procedure.

Interactive optimization approach for optimal impulsive rendezvous using primer vector and evolutionary algorithms

NASA Astrophysics Data System (ADS)

Luo, Ya-Zhong; Zhang, Jin; Li, Hai-yang; Tang, Guo-Jin

2010-08-01

In this paper, a new optimization approach combining primer vector theory and evolutionary algorithms for fuel-optimal non-linear impulsive rendezvous is proposed. The optimization approach is designed to seek the optimal number of impulses as well as the optimal impulse vectors. In this optimization approach, adding a midcourse impulse is determined by an interactive method, i.e. observing the primer-magnitude time history. An improved version of simulated annealing is employed to optimize the rendezvous trajectory with the fixed-number of impulses. This interactive approach is evaluated by three test cases: coplanar circle-to-circle rendezvous, same-circle rendezvous and non-coplanar rendezvous. The results show that the interactive approach is effective and efficient in fuel-optimal non-linear rendezvous design. It can guarantee solutions, which satisfy the Lawden's necessary optimality conditions.

A Home Computer Primer.

ERIC Educational Resources Information Center

Stone, Antonia

1982-01-01

Provides general information on currently available microcomputers, computer programs (software), hardware requirements, software sources, costs, computer games, and programing. Includes a list of popular microcomputers, providing price category, model, list price, software (cassette, tape, disk), monitor specifications, amount of random access…

Application of myostatin in sheep breeding programs: A review

PubMed Central

Miar, Younes; Salehi, Abdolreza; Kolbehdari, Davood; Aleyasin, Seyed Ahmad

2014-01-01

Plasma membrane H+-ATPase is a major integral membrane protein with a role in various physiological processes including abiotic stress response. To study the effect of NaCl on the expression pattern of a gene encoding the plasma membrane H+-ATPase, an experiment was carried out in a completely random design with three replications. A pair of specific primers was designed based on the sequence of the gene encoding plasma membrane H+-ATPase in Aeluropus littoralis to amplify a 259 bp fragment from the target gene by PCR. A gene encoding actin was used as reference gene to normalize the expression level of the target gene. A pair of specific primers was designed to amplify a 157 bp fragment from the actin gene by PCR. Plants were treated with different concentrations of NaCl, 0, 50, 100, 150, 200, 250, 500 and 1000 mM, for two days. Our results showed that the expression level of the plasma membrane H+-ATPase gene increased dramatically at 500 mM and then decreased with increasing concentrations of NaCl. The results also indicated that the leaves of plants, were treated with high concentrations of NaCl changed morphologically, but those grown under low concentrations of NaCl as well as the control plants did not show morphological changes in their leaves. Our results suggest a relation between morphological changes of treated plants and the expression level of the plasma membrane H+-ATPase gene in Aeluropus littoralis. PMID:27843975

MAJIQ-SPEL: Web-tool to interrogate classical and complex splicing variations from RNA-Seq data.

PubMed

Green, Christopher J; Gazzara, Matthew R; Barash, Yoseph

2017-09-11

Analysis of RNA sequencing (RNA-Seq) data have highlighted the fact that most genes undergo alternative splicing (AS) and that these patterns are tightly regulated. Many of these events are complex, resulting in numerous possible isoforms that quickly become difficult to visualize, interpret, and experimentally validate. To address these challenges we developed MAJIQ-SPEL, a web-tool that takes as input local splicing variations (LSVs) quantified from RNA-Seq data and provides users with visualization and quantification of gene isoforms associated with those. Importantly, MAJIQ-SPEL is able to handle both classical (binary) and complex, non-binary, splicing variations. Using a matching primer design algorithm it also suggests users possible primers for experimental validation by RT-PCR and displays those, along with the matching protein domains affected by the LSV, on UCSC Genome Browser for further downstream analysis. Program and code will be available at http://majiq.biociphers.org/majiq-spel. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

[SSR loci information analysis in transcriptome of Andrographis paniculata].

PubMed

Li, Jun-Ren; Chen, Xiu-Zhen; Tang, Xiao-Ting; He, Rui; Zhan, Ruo-Ting

2018-06-01

To study the SSR loci information and develop molecular markers, a total of 43 683 Unigenes in transcriptome of Andrographis paniculata were used to explore SSR. The distribution frequency of SSR and the basic characteristics of repeat motifs were analyzed using MicroSAtellite software, SSR primers were designed by Primer 3.0 software and then validated by PCR. Moreover, the gene function analysis of SSR Unigene was obtained by Blast. The results showed that 14 135 SSR loci were found in the transcriptome of A. paniculata, which distributed in 9 973 Unigenes with a distribution frequency of 32.36%. Di-nucleotide and Tri-nucleotide repeat were the main types, accounted for 75.54% of all SSRs. The repeat motifs of AT/AT and CCG/CGG were the predominant repeat types of Di-nucleotide and Tri-nucleotide, respectively. A total of 4 740 pairs of SSR primers with the potential to produce polymorphism were designed for maker development. Ten pairs of primers in 20 pairs of randomly picked primers produced fragments with expected molecular size. The gene function of Unigenes containing SSR were mostly related to the basic metabolism function of A. paniculata. The SSR markers in transcriptome of A. paniculata show rich type, strong specificity and high potential of polymorphism, which will benefit the candidate gene mining and marker-assisted breeding. Copyright© by the Chinese Pharmaceutical Association.

Development of PCR protocols for specific identification of Clostridium spiroforme and detection of sas and sbs genes.

PubMed

Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio

2008-10-15

Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.

WebSat ‐ A web software for microsatellite marker development

PubMed Central

Martins, Wellington Santos; Soares Lucas, Divino César; de Souza Neves, Kelligton Fabricio; Bertioli, David John

2009-01-01

Simple sequence repeats (SSR), also known as microsatellites, have been extensively used as molecular markers due to their abundance and high degree of polymorphism. We have developed a simple to use web software, called WebSat, for microsatellite molecular marker prediction and development. WebSat is accessible through the Internet, requiring no program installation. Although a web solution, it makes use of Ajax techniques, providing a rich, responsive user interface. WebSat allows the submission of sequences, visualization of microsatellites and the design of primers suitable for their amplification. The program allows full control of parameters and the easy export of the resulting data, thus facilitating the development of microsatellite markers. Availability The web tool may be accessed at http://purl.oclc.org/NET/websat/ PMID:19255650

Sight Word Recognition among Young Children At-Risk: Picture-Supported vs. Word-Only

ERIC Educational Resources Information Center

Meadan, Hedda; Stoner, Julia B.; Parette, Howard P.

2008-01-01

A quasi-experimental design was used to investigate the impact of Picture Communication Symbols (PCS) on sight word recognition by young children identified as "at risk" for academic and social-behavior difficulties. Ten pre-primer and 10 primer Dolch words were presented to 23 students in the intervention group and 8 students in the…

Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

USDA-ARS?s Scientific Manuscript database

Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

Assessing the Nation's Literacy: A State Policy Primer.

ERIC Educational Resources Information Center

National Governors' Association, Washington, DC.

This primer is designed to provide a step-by-step guide for state policymakers and state agency officials interested in assessing the literacy skills of the people of their state. Chapter 1 describes the importance of assessing the literacy skills in each state. Literacy is discussed as an economic necessity, a requirement for a healthy democracy,…

A Primer on Fresh Water: The Environmental Citizenship Series.

ERIC Educational Resources Information Center

Environment Canada, Ottawa (Ontario).

Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

Transcriptional Analysis of In vivo Plasmodium yoelii Liver Stage Gene Expression

DTIC Science & Technology

2005-04-26

reaction was added to a PCR master mix with one of several oligonucleotide primer pairs (Table S6). The primers were designed and the specific conditions ...Koonin EV. Using the COG database to improve gene recognition in complete genomes. Genetica 2000;108:9–17. 26] Florens L, Washburn MP, Raine JD, et al

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

Designer proton-channel transgenic algae for photobiological hydrogen production

DOEpatents

Lee, James Weifu [Knoxville, TN

2011-04-26

A designer proton-channel transgenic alga for photobiological hydrogen production that is specifically designed for production of molecular hydrogen (H.sub.2) through photosynthetic water splitting. The designer transgenic alga includes proton-conductive channels that are expressed to produce such uncoupler proteins in an amount sufficient to increase the algal H.sub.2 productivity. In one embodiment the designer proton-channel transgene is a nucleic acid construct (300) including a PCR forward primer (302), an externally inducible promoter (304), a transit targeting sequence (306), a designer proton-channel encoding sequence (308), a transcription and translation terminator (310), and a PCR reverse primer (312). In various embodiments, the designer proton-channel transgenic algae are used with a gas-separation system (500) and a gas-products-separation and utilization system (600) for photobiological H.sub.2 production.

A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

PubMed

Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

1996-04-15

A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

PubMed

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Molecular diagnosis of group B coltiviruses infections.

PubMed

Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X

1999-08-01

The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.

Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

PubMed Central

Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

2005-01-01

Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

NASA Technical Reports Server (NTRS)

Bill, R. C.; Sovey, J.; Allen, G. P.

1981-01-01

The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

Competitive amplification of differentially melting amplicons (CADMA) enables sensitive and direct detection of all mutation types by high-resolution melting analysis.

PubMed

Kristensen, Lasse S; Andersen, Gitte B; Hager, Henrik; Hansen, Lise Lotte

2012-01-01

Sensitive and specific mutation detection is of particular importance in cancer diagnostics, prognostics, and individualized patient treatment. However, the majority of molecular methodologies that have been developed with the aim of increasing the sensitivity of mutation testing have drawbacks in terms of specificity, convenience, or costs. Here, we have established a new method, Competitive Amplification of Differentially Melting Amplicons (CADMA), which allows very sensitive and specific detection of all mutation types. The principle of the method is to amplify wild-type and mutated sequences simultaneously using a three-primer system. A mutation-specific primer is designed to introduce melting temperature decreasing mutations in the resulting mutated amplicon, while a second overlapping primer is designed to amplify both wild-type and mutated sequences. When combined with a third common primer very sensitive mutation detection becomes possible, when using high-resolution melting (HRM) as detection platform. The introduction of melting temperature decreasing mutations in the mutated amplicon also allows for further mutation enrichment by fast coamplification at lower denaturation temperature PCR (COLD-PCR). For proof-of-concept, we have designed CADMA assays for clinically relevant BRAF, EGFR, KRAS, and PIK3CA mutations, which are sensitive to, between 0.025% and 0.25%, mutated alleles in a wild-type background. In conclusion, CADMA enables highly sensitive and specific mutation detection by HRM analysis. © 2011 Wiley Periodicals, Inc.

PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

PubMed Central

Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2014-01-01

Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the discovery of complex patterns in gene expression of soil fungal communities. PMID:25545363

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

PubMed Central

Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

2003-01-01

Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

PubMed

van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

2008-09-01

To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

With Heat You Never Have to Ask Directions. An Energy Primer for Minnesota Teachers.

ERIC Educational Resources Information Center

Minnesota State Dept. of Natural Resources, St. Paul. Environmental Education Board.

This four-part primer is designed to: (1) help Minnesota teachers acquire some familiarity with basic energy structure and language; (2) provide a capsule summary of Minnesota's energy picture; and (3) demonstrate that it is relatively easy to participate in energy education. Part 1 discusses: the fossil fuel age; kinds and forms of energy; energy…

Developing new microsatellite markers in walnut (Juglans regia L.) from Juglans nigra genomic GA enriched library

Treesearch

Hayat Topcu; Nergiz Coban; Keith Woeste; Mehmet Sutyemez; Salih Kafkas

2015-01-01

We attempted to develop new polymorphic SSR primer pairs in walnut using sequences derived from Juglans nigra L. genomic enriched library with GA repeat. The designed 94 SSR primer pairs were subjected to gradient PCR in 12 walnut cultivars to determine their optimum annealing temperatures and to determine whether they produce bands. Then, the...

Practically Speaking: Community College Practices That Help (Re)define Student Success. A Practitioner Primer. Spring 2014

ERIC Educational Resources Information Center

Cooper, Darla; Rodriguez-Kiino, Diane; Scharper, Alice; Karandjeff, Kelley; Chaplot, Priyadarshini; Schiorring, Eva

2014-01-01

This primer introduces 23 practices designed to support students inside and outside of the classroom and increase their community college success. These case studies illustrate the five themes for effective student support that emerged from Student Support (Re)defined--a multi-year study performed by the Research and Planning Group for California…

Microsatellite analysis in the genome of Acanthaceae: An in silico approach.

PubMed

Kaliswamy, Priyadharsini; Vellingiri, Srividhya; Nathan, Bharathi; Selvaraj, Saravanakumar

2015-01-01

Acanthaceae is one of the advanced and specialized families with conventionally used medicinal plants. Simple sequence repeats (SSRs) play a major role as molecular markers for genome analysis and plant breeding. The microsatellites existing in the complete genome sequences would help to attain a direct role in the genome organization, recombination, gene regulation, quantitative genetic variation, and evolution of genes. The current study reports the frequency of microsatellites and appropriate markers for the Acanthaceae family genome sequences. The whole nucleotide sequences of Acanthaceae species were obtained from National Center for Biotechnology Information database and screened for the presence of SSRs. SSR Locator tool was used to predict the microsatellites and inbuilt Primer3 module was used for primer designing. Totally 110 repeats from 108 sequences of Acanthaceae family plant genomes were identified, and the occurrence of dinucleotide repeats was found to be abundant in the genome sequences. The essential amino acid isoleucine was found rich in all the sequences. We also designed the SSR-based primers/markers for 59 sequences of this family that contains microsatellite repeats in their genome. The identified microsatellites and primers might be useful for breeding and genetic studies of plants that belong to Acanthaceae family in the future.

Identifying krill eggs in the central California current using novel multiplex PCR primers: Applications and limitations

NASA Astrophysics Data System (ADS)

Carrion, C. N.; Slesinger, E.; Marinovic, B.

2016-02-01

Euphausiids, otherwise known as krill, are an important link between primary producers and higher trophic levels within the central California current upwelling system. Euphausia pacifica and Thysanoessa spinifera, two of the most common euphausiid species along the central California coast, are both broadcast spawners and have some overlap in habitat, e.g. near marine life hotspots like the Monterey Bay and Gulf of Farallones. Species composition of euphausiid egg population within these regions is currently unknown. Distinct morphological differences between their eggs are lost once the egg dies or is preserved via formalin, alcohol, or freezing. In this project we designed genus specific DNA primers (mtCOI) for use in a multiplex PCR to distinguish among spawned euphausiid eggs of Euphausia spp. and Thysanoessa spp. in central California current surface waters. Effective and ineffective application of primers in a multiplex versus single-plex PCR is discussed, with an emphasis on primer design limitations in reference to the available barcoded regions of mitochondrial cytochrome oxidase subunit I (mtCOI) for each species in GenBank. This new protocol expands current monitoring efforts into sampling a non-swimming portion of the population which has the potential to improve euphausiid biomass estimates.

Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

PubMed

Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

2018-02-01

The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

NASA Astrophysics Data System (ADS)

Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

2015-12-01

Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

Medicaid: A Primer - Key Information on the Nation's Health Coverage Program for Low-Income People

MedlinePlus

... nearly 40% of all Medicaid spending. Through the economic downturn, the main driver of Medicaid spending was ... Medicaid is a countercyclical program that expands during economic downturns, when states’ fiscal capacity is also most ...

PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity.

PubMed

Dwivedi, Bhakti; Schmieder, Robert; Goldsmith, Dawn B; Edwards, Robert A; Breitbart, Mya

2012-03-04

Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.

PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity

PubMed Central

2012-01-01

Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976

A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.

PubMed

Murata, C; Ogura, G; Kuroiwa, A

2011-03-01

To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.

Integrating the Full Range of Security Cooperation Programs into Air Force Planning: An Analytic Primer

DTIC Science & Technology

2011-01-01

Exchange Program ( IEP ) Authority 10 U.S.C. §2358, “Research and development projects” Processes and agreements IEP agreements with the...2015.4, “Defense Research, Development, Test and Evaluation (RDT&E) Information Exchange Program ( IEP )”; DoDD 5134.1, “Under Secretary of Defense for

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

PubMed

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

A novel archaeal group in the phylum Crenarchaeota found unexpectedly in an eukaryotic survey in the Cariaco Basin.

PubMed

Jeon, Sun-Ok; Ahn, Tae-Seok; Hong, Sun-Hee

2008-02-01

Archaea have been found in many more diverse habitats than previously believed due in part to modern molecular approaches to discovering microbial diversity. We report here an unexpected expansion of the habitat diversity of the Archaea in the Cariaco Basin we found using a primer set designed for 18S eukaryotic rDNA sequence analysis. The results presented here expand the originally identified 9 archaeal clones reported in this environment using bacterial/archaeal primers to 152 archaeal clones: 67 (18 OTU) of these clones were found at a depth of 900 m of station A while 71 (9 OTU) of them were at a depth of between 300 approximately 335 m of station B&C depending upon which location the samples were taken. We used three phylogenetic analysis methods and detected 20 phylotypes belonging to a single previously unreported group distantly related to the Crenarchaeota. Also, we determined that the original nine sequences did not fall into any of the known phyla of the Archaea suggesting that they may represent a novel group within the Kingdom Archaea. Thus, from these two studies, we suggest that Archaea in the Cariaco Basin could be unique; however, further studies using archaeal-specific primers and the design of new primers as well as the systematic use of several different primer combinations may improve the chances of understanding the archeal diversity in the Cariaco Basin.

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1990-01-30

bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

Comparison of the Booster Interface Temperature in Stainless Steel (SS) V-Channel Versus the Aluminum (Al) Y-Channel Primer Chamber Assemblies (PCAs). Volume 2; Appendices

NASA Technical Reports Server (NTRS)

Garcia, Roberto; Saulsberry, Regor L.

2011-01-01

NASA's Technical Fellow for Propulsion, requested a technical assessment of the performance improvement achieved by the introduction of the stainless steel (SS) V-channel compared to the aluminum (Al) Y-channel Primer Chamber Assembly (PCA) design. The SS V-channel PCA was developed for NASA's Mars Science Laboratory (MSL) Project. The principle focus of the assessment was to measure the transient temperature at the booster interface with both designs. This document contains the Appendices to the Volume I main report.

Comparison of the Booster Interface Temperature in Stainless Steel (SS) V-Channel versus the Aluminum (Al) Y-Channel Primer Chamber Assemblies (PCAs). Volume 1; Technical Assessment Report

NASA Technical Reports Server (NTRS)

Garcia, Roberto; Saulsberry, Regor L.

2011-01-01

NASA's Technical Fellow for Propulsion, requested a technical assessment of the performance improvement achieved by the introduction of the stainless steel (SS) V-channel compared to the aluminum (Al) Y-channel Primer Chamber Assembly (PCA) design. The SS V-channel PCA was developed for NASA's Mars Science Laboratory (MSL) Project. The principle focus of the assessment was to measure the transient temperature at the booster interface with both designs. This document contains the findings of the assessment.

[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

PubMed

Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

2013-10-18

To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

An efficient method to find potentially universal population genetic markers, applied to metazoans

PubMed Central

2010-01-01

Background Despite the impressive growth of sequence databases, the limited availability of nuclear markers that are sufficiently polymorphic for population genetics and phylogeography and applicable across various phyla restricts many potential studies, particularly in non-model organisms. Numerous introns have invariant positions among kingdoms, providing a potential source for such markers. Unfortunately, most of the few known EPIC (Exon Primed Intron Crossing) loci are restricted to vertebrates or belong to multigenic families. Results In order to develop markers with broad applicability, we designed a bioinformatic approach aimed at avoiding multigenic families while identifying intron positions conserved across metazoan phyla. We developed a program facilitating the identification of EPIC loci which allowed slight variation in intron position. From the Homolens databases we selected 29 gene families which contained 52 promising introns for which we designed 93 primer pairs. PCR tests were performed on several ascidians, echinoderms, bivalves and cnidarians. On average, 24 different introns per genus were amplified in bilaterians. Remarkably, five of the introns successfully amplified in all of the metazoan genera tested (a dozen genera, including cnidarians). The influence of several factors on amplification success was investigated. Success rate was not related to the phylogenetic relatedness of a taxon to the groups that most influenced primer design, showing that these EPIC markers are extremely conserved in animals. Conclusions Our new method now makes it possible to (i) rapidly isolate a set of EPIC markers for any phylum, even outside the animal kingdom, and thus, (ii) compare genetic diversity at potentially homologous polymorphic loci between divergent taxa. PMID:20836842

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

PubMed

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

PubMed Central

Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A.; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C. M.; Osorio, F.; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed. PMID:26421306

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

PubMed

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

PubMed Central

Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

2014-01-01

A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene.

PubMed

Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee

2007-01-01

Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.

Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens

PubMed Central

Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.

2012-01-01

Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or negative. We evaluated two conventional primer pairs in common use and a new primer pair based on the dual priming oligonucleotide (DPO) principle. Cross-reactivity was observed when both conventional primer pairs were used, resulting in interpretation difficulties. No cross-reactivity was observed using the DPOs even in specimens with a high ratio of human to bacterial DNA. In addition to reducing cross-reactivity, the DPO principle also offers a high degree of flexibility in the design of primers and should be considered for any PCR assay intended for detection and identification of pathogens directly from human clinical specimens. PMID:22278843

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

PubMed

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-11-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

PubMed Central

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-01-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Reading and Writing of First-Grade Students in a Restructured Chapter 1 Program.

ERIC Educational Resources Information Center

Hiebert, Elfrieda H.; And Others

1992-01-01

Effects of a restructured Chapter 1 program (RCP) on 45 first graders' literacy were examined. RCP students could read a primer fluently and performed better than comparison groups (students in the regular Chapter 1 program and classroom peers). Improvement was particularly apparent for those with the lowest initial readiness scores. (SLD)

Part-Time Public Relations with Full-Time Results: A PR Primer for Libraries.

ERIC Educational Resources Information Center

Karp, Rashelle S., Ed.

The purpose of library public relations is to develop ongoing programs of contact between the librarians and the population groups that they serve. This book is a guide to creating a library public relations program or for improving an existing program. The information is divided into six sections, and sources of additional information are…

Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

USGS Publications Warehouse

Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

1999-01-01

We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.

PubMed

Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo

2017-05-28

Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

PubMed Central

David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

2017-01-01

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

PubMed

Kokosková, B; Mráz, I; Fousek, J

2010-05-01

Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

Novel ITS1 Fungal Primers for Characterization of the Mycobiome

PubMed Central

Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

2017-01-01

ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

A Practical School Public Relations Research Primer

ERIC Educational Resources Information Center

Moore, Edward H.

2010-01-01

Advances in communication technology have created many new tools for school communicators--as well as increasing complexities for their programs. As a result, solid school communication research programs offering practical research insights for planning, tracking, and assessing school communication efforts are more important than ever. Still, many…

DNA polymorphism identity determination using flow cytometry

DOEpatents

Nolan, John P.; White, P. Scott; Cai, Hong

2001-01-01

DNA polymorphism identity determination using flow cytometry. Primers designed to be immobilized on microspheres are allowed to anneal to the DNA strand under investigation, and are extended by either DNA polymerase using fluorescent dideoxynucleotides or ligated by DNA ligase to fluorescent reporter oligonucleotides. The fluorescence of either the dideoxynucleotide or the reporter oligonucleotide attached to the immobilized primer is measured by flow cytometry, thereby identifying the nucleotide polymorphism on the DNA strand.

In vitro selection using a dual RNA library that allows primerless selection

PubMed Central

Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

2006-01-01

High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

Detection and identification of genetically modified EE-1 brinjal (Solanum melongena) by single, multiplex and SYBR® real-time PCR.

PubMed

Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R

2013-01-01

Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.

Microsatellite analysis in the genome of Acanthaceae: An in silico approach

PubMed Central

Kaliswamy, Priyadharsini; Vellingiri, Srividhya; Nathan, Bharathi; Selvaraj, Saravanakumar

2015-01-01

Background: Acanthaceae is one of the advanced and specialized families with conventionally used medicinal plants. Simple sequence repeats (SSRs) play a major role as molecular markers for genome analysis and plant breeding. The microsatellites existing in the complete genome sequences would help to attain a direct role in the genome organization, recombination, gene regulation, quantitative genetic variation, and evolution of genes. Objective: The current study reports the frequency of microsatellites and appropriate markers for the Acanthaceae family genome sequences. Materials and Methods: The whole nucleotide sequences of Acanthaceae species were obtained from National Center for Biotechnology Information database and screened for the presence of SSRs. SSR Locator tool was used to predict the microsatellites and inbuilt Primer3 module was used for primer designing. Results: Totally 110 repeats from 108 sequences of Acanthaceae family plant genomes were identified, and the occurrence of dinucleotide repeats was found to be abundant in the genome sequences. The essential amino acid isoleucine was found rich in all the sequences. We also designed the SSR-based primers/markers for 59 sequences of this family that contains microsatellite repeats in their genome. Conclusion: The identified microsatellites and primers might be useful for breeding and genetic studies of plants that belong to Acanthaceae family in the future. PMID:25709226

Application of Partial Internal Transcribed Spacer Sequences for the Discrimination of Artemisia capillaris from Other Artemisia Species

PubMed Central

Doh, Eui Jeong; Paek, Seung-Ho; Lee, Guemsan; Lee, Mi-Young; Oh, Seung-Eun

2016-01-01

Several Artemisia species are used as herbal medicines including the dried aerial parts of Artemisia capillaris, which are used as Artemisiae Capillaris Herba (known as “Injinho” in Korean medicinal terminology and “Yin Chen Hao” in Chinese). In this study, we developed tools for distinguishing between A. capillaris and 11 other Artemisia species that grow and/or are cultured in China, Japan, and Korea. Based on partial nucleotide sequences in the internal transcribed spacer (ITS) that differ between the species, we designed primers to amplify a DNA marker for A. capillaris. In addition, to detect other Artemisia species that are contaminants of A. capillaris, we designed primers to amplify DNA markers of A. japonica, A. annua, A. apiacea, and A. anomala. Moreover, based on random amplified polymorphic DNA analysis, we confirmed that primers developed in a previous study could be used to identify Artemisia species that are sources of Artemisiae Argyi Folium and Artemisiae Iwayomogii Herba. By using these primers, we found that multiplex polymerase chain reaction (PCR) was a reliable tool to distinguish between A. capillaris and other Artemisia species and to identify other Artemisia species as contaminants of A. capillaris in a single PCR. PMID:27313651

New primers for the detection Leishmania species by multiplex polymerase chain reaction.

PubMed

Conter, Carolina Cella; Lonardoni, Maria Valdrinez Campana; Aristides, Sandra Mara Alessi; Cardoso, Rosilene Fressatti; Silveira, Thaís Gomes Verzignassi

2018-02-01

Leishmaniasis is caused by protozoa of the Leishmania genus, which is divided into subgenus Viannia and Leishmania. In humans, the course of infection largely depends on the host-parasite relationship and primarily of the infective species. The objective of the present study was to design specific primers to the identification of Leishmania species using multiplex PCR. Four primers were designed, based on the GenBank sequences of the kDNA minicircle, amplifying 127 bp for subgenus Viannia, 100 bp for L. amazonensis, and 60 bp for Leishmania donovani complex and L. major. None of the primers amplified Trypanosoma cruzi or L. mexicana. The limit of detection of multiplex PCR was 2 × 10 -5 parasites for L. braziliensis, 2 x 10 -3 parasites for L. amazonensis, and 1.4 × 10 -3 parasites for L. infantum. The high sensitivity of multiplex PCR was confirmed by the detection of parasites in different biological samples, including lesion scrapings, spleen imprinting of a hamster, sandflies, and blood. The multiplex PCR that was developed herein presented good performance with regard to detecting and identifying the parasite in different biological samples and may thus be useful for diagnosis, decision making with regard to the proper therapeutic approach, and determining the geographic distribution of Leishmania species.

Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.

PubMed

Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas

2016-06-17

Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome.

Detection of HbsAg and hATIII genetically modified goats (Caprahircus) by loop-mediated isothermal amplification.

PubMed

Tao, Chenyu; Zhang, Qingde; Zhai, Shanli; Liu, Bang

2013-11-01

In this study, sensitive and rapid detection systems were designed using a loop-mediated isothermal amplification (LAMP) method to detect the genetically modified goats. A set of 4 primers were designed for each exogenous nucleic acids HBsAg and hATIII. The DNA samples were first amplified with the outer and inner primers and released a single-stranded DNA,of which both ends were stem-loop structure. Then one inner primer hybridized with the loop, and initiated displacement synthesis in less than 1 h. The result could be visualized by both agarose gel electrophoresis and unaided eyes directly after adding SYBR GREEN 1. The detection limit of LAMP was ten copies of target molecules, indicating that LAMP was tenfold more sensitive than the classical PCR. Furthermore, all the samples of genetically modified goats were tested positively by LAMP, and the results demonstrated that the LAMP was a rapid and sensitive method for detecting the genetically modified organism.

STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

PubMed

O'Halloran, Damien M

2015-06-01

Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesismore » at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.« less

Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

PubMed

Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2013-01-01

Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

Bridges to Accessibility: A Primer for Including Persons with Disabilities in Adventure Curricula.

ERIC Educational Resources Information Center

Havens, Mark D.

This book encourages the inclusion of persons with disabilities in ongoing adventure programs, motivates adventure leaders to learn more about people with disabilities, and assists specialists in advocating for integrated adventure programming. Centered on attitudinal awareness, the book encourages practitioners to want to make their services…

A Primer on the Financial Management of Experiential Learning Assessment Programs.

ERIC Educational Resources Information Center

MacTaggart, Terrence

1983-01-01

The success and failure of experiential learning assessment programs rests not only on their academic quality, but also on their financial management. Types of cost and the meaning of cost-effectiveness are discussed. Break-even analysis, cost-reduction activities, and revenue-enhancement techniques are described. (Author/MLW)

Financial Management for Transit: A Handbook.

ERIC Educational Resources Information Center

Heaselden, Mark; And Others

This handbook is primarily intended to serve as a primer for transit system managers who have not had any formal financial education through college classes, professional development programs, or extensive on-the-job programs. The following topics are covered: financial planning techniques for transit (beginning the financial planning process,…

A Psychiatric Primer for Programs Serving People with Developmental Disabilities. Monograph #101.

ERIC Educational Resources Information Center

Dal Pozzo, Earlene; Bernstein, Gail S.

Intended for personnel in programs serving persons with developmental disabilities, the booklet provides basic information about the major psychiatric disorders and their treatment. Five sections cover: the major disorders; medications--uses and problems; assessment; cooordination of services; and psychiatric emergencies. Major disorders such as…

Beam shaping for laser initiated optical primers

NASA Astrophysics Data System (ADS)

Lizotte, Todd E.

2008-08-01

Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

PubMed

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

Crystalline Silica Primer

USGS Publications Warehouse

,

1992-01-01

substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

Multiplex Detection of Toxigenic Penicillium Species.

PubMed

Rodríguez, Alicia; Córdoba, Juan J; Rodríguez, Mar; Andrade, María J

2017-01-01

Multiplex PCR-based methods for simultaneous detection and quantification of different mycotoxin-producing Penicillia are useful tools to be used in food safety programs. These rapid and sensitive techniques allow taking corrective actions during food processing or storage for avoiding accumulation of mycotoxins in them. In this chapter, three multiplex PCR-based methods to detect at least patulin- and ochratoxin A-producing Penicillia are detailed. Two of them are different multiplex real-time PCR suitable for monitoring and quantifying toxigenic Penicillium using the nonspecific dye SYBR Green and specific hydrolysis probes (TaqMan). All of them successfully use the same target genes involved in the biosynthesis of such mycotoxins for designing primers and/or probes.

Development of a molecular approach to describe the composition of Trichoderma communities.

PubMed

Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele

2010-01-01

Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

PubMed

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Development of highly polymorphic EST-SSR markers and segregation in F₁ hybrid population of Vitis vinifera L.

PubMed

Kayesh, E; Zhang, Y Y; Liu, G S; Bilkish, N; Sun, X; Leng, X P; Fang, J G

2013-09-23

The objectives of this investigation were to develop and validate the expressed sequence tag (EST)-simple sequence repeat (SSR) markers from large EST sequences, and to study the segregation and distribution of SSRs within two grapevine parental lines. In total, 94 F₁ lines crossed between "Early Rose" and "Red Globe" were studied. Approximately 2100 EST-SSR sequences of Vitis vinifera L. were searched for SSRs and analyzed for the design of polymerase chain reaction (PCR) primers amplifying the SSR-rich regions. Trinucleotide repeats were found to be the most abundant, followed by other nucleotide repeats. A total of 182 SSR primer pairs were first developed for the study on the parental polymorphism. Among the 182 SSR primers, 142 primer pairs (78%) could amplify the anticipated PCR products, among which only 52 primer pairs (36.62%) showed polymorphism between the two parents. These polymorphic bands were further surveyed among the 94 F₁ lines, and the results showed that a total of 162 bands were amplified, and 98 of them were polymorphic in both parents (60.86% polymorphism), with an average of 1.88 polymorphic DNA bands for each primer pair. After testing with the chi-square test, 33 of the clearly amplified polymorphic bands followed a 3:1 ratio, and 37 followed a 1:1 ratio. The rest showed distorted segregation ratios.

Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

PubMed Central

Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

2017-01-01

Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

PubMed

David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

2017-01-04

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

PubMed

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

PubMed Central

Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.

2014-01-01

New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428

Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

PubMed Central

Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

2016-01-01

Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

Forensic strategy to ensure the quality of sequencing data of mitochondrial DNA in highly degraded samples.

PubMed

Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki

2014-01-01

Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

PubMed

Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

2016-10-01

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

Alelle number and heterozigosity for microsatellite loci in different stingless bee species (Hymenoptera: Apidae, Meliponini).

PubMed

Francisco, Flávio de O; Brito, Rute M; Arias, Maria C

2006-01-01

In the present study we compare genetic characteristics (allele diversity and observed heterozygosity) of microsatellite loci, from three stingless bee species (Plebeia remota Holmberg, Partamona mulata Moure In Camargo and Partamona helleri Friese), amplified by using heterospecific primers originally designed for Melipona bicolor Lepeletier and Scaptotrigona postica Latreille. We analyzed 360 individuals of P. remota from 72 nests, 58 individuals of R. mulata from 58 nests, and 47 individuals of P. helleri from 47 nests. The three species studied showed low level of polymorphism for the loci amplified with primers derived from M. bicolor. However, for the loci amplified with primers derived from S. postica, only P. remota presented low level of polymorphism.

Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

PubMed Central

Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

2013-01-01

Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone

DTIC Science & Technology

2013-10-01

and 5’‐GCC AAA TGC AGT TTA AGC TCT GCT‐3’ (antisense). The gene‐specific primers for mouse b‐actin were 5’‐GGC CGT ACC ACT GGC ATC GTG ATG‐ 3...cycles. The gene‐specific primers for CYP24A1 mRNA were 5’‐CGG GTG GAC CAT TTA CAA CTC GG‐3’ (sense) and 5’‐CTC AAC AGG CTC ATT GTC TGT GG‐3’ (antisense...The gene specific designing primers for b‐actinwere 5’‐ GTG CGT GAC ATC AAA GAG‐3’ (sense) and 5’‐GCC ACA GGA TTC CAT ACC‐3’ (antisense). The

Characterization of 10 new nuclear microsatellite markers in Acca sellowiana (Myrtaceae).

PubMed

Klabunde, Gustavo H F; Olkoski, Denise; Vilperte, Vinicius; Zucchi, Maria I; Nodari, Rubens O

2014-06-01

Microsatellite primers were identified and characterized in Acca sellowiana in order to expand the limited number of pre-existing polymorphic markers for use in population genetic studies for conservation, phylogeography, breeding, and domestication. • A total of 10 polymorphic microsatellite primers were designed from clones obtained from a simple sequence repeat (SSR)-enriched genomic library. The primers amplified di- and trinucleotide repeats with four to 27 alleles per locus. In all tested populations, the observed heterozygosity ranged from 0.269 to 1.0. • These new polymorphic SSR markers will allow future genetic studies to be denser, either for genetic structure characterization of natural populations or for studies involving genetic breeding and domestication process in A. sellowiana.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

PubMed

Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

2007-10-01

Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

PubMed

Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

2014-07-01

In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.

PubMed

Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin

2015-05-15

The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity. Copyright © 2014 Elsevier B.V. All rights reserved.

Helicase-Dependent Isothermal Amplification of DNA and RNA by Using Self-Avoiding Molecular Recognition Systems.

PubMed

Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M; Hoshika, Shuichi; Frye, Carole B; Benner, Steven A

2015-06-15

Assays that detect DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low-resource environments, and requires equipment and power that might not be available in these environments. Isothermal procedures, which avoid thermal cycling, are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a "self avoiding molecular recognition system" (SAMRS) eliminates these artifacts and gives clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3'-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, difficult to achieve with HDA using standard primers. Thus, SAMRS-HDA is a more versatile approach than standard HDA, with a broader applicability for xNA-targeted diagnostics and research. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Helicase Dependent Isothermal Amplification of DNA and RNA using Self-Avoiding Molecular Recognition Systems

PubMed Central

Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M.; Hoshika, Shuichi; Frye, Carole; Benner, Steven A.

2015-01-01

Assays that target DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low resource environments, requiring equipment and power that may not be available in these environments. However, isothermal procedures that avoid thermal cycling are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a “self avoiding molecular recognition system” (SAMRS) eliminates these artifacts to give clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3′-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, something difficult to achieve with HDA using standard primers. This shows that SAMRS-HDA is a more versatile approach than standard HDA with a broader applicability for xNA-targeted diagnostics and research. PMID:25953623

The PIC Youth Primer: Improving JTPA Programs for Youth.

ERIC Educational Resources Information Center

Snedeker, Bonnie; And Others

This guide for Private Industry Council (PIC) officers, members, and staff is written to assist in planning and overseeing effective programs for youth at risk in the local labor market using resources allocated under the Job Training Partnership Act (JTPA). Section I takes a broad view of the problem of building effective employability…

Get Involved in the Job Opportunities and Basic Skills Training Program (JOBS). What Local Areas Need To Know.

ERIC Educational Resources Information Center

JTPA Issues, 1989

1989-01-01

This Job Training Partnership Act (JTPA) Update provides a quick primer of some of the key areas where states have flexibility to develop their own programs and processes in the new Job Opportunities and Basic Skills (JOBS) program. This guide is organized in seven sections that cover the following topics: (1) introduction; (2) why local areas…

Anti-NGF Local Therapy for Autonomic Dysreflexia in Spinal Cord Injury

DTIC Science & Technology

2012-10-01

propyl ]-N,N,N trimethylammonium methylsulfate) were made by thin film hydration method and hydrated with nuclease free water with the final lipid...isolation method (Qiagen, Valencia CA). Synthesis of cDNA was performed as described previously (Takimoto et al., 2002). These primers were designed to...probe synthesis . Primers used for the cloning were as follows: Kv4.1 5’-cacagacgagctaactttcag-3′ and 5′-tcacagggaagagatcttgac-3′ (GenBank ID: 116695

Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

PubMed Central

Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

2005-01-01

Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

Amplification of trace amounts of nucleic acids

DOEpatents

Church, George M [Brookline, MA; Zhang, Kun [Brighton, MA

2008-06-17

Methods of reducing background during amplification of small amounts of nucleic acids employ careful analysis of sources of low level contamination. Ultraviolet light can be used to reduce nucleic acid contaminants in reagents and equipment. "Primer-dimer" background can be reduced by judicious design of primers. We have shown clean signal-to-noise with as little as starting material as one single human cell (.about.6 picogram), E. coli cell (.about.5 femtogram) or Prochlorococcus cell (.about.3 femtogram).

Differentiation of Populus species using chloroplast single nucleotide polymorphism (SNP) markers--essential for comprehensible and reliable poplar breeding.

PubMed

Schroeder, H; Hoeltken, A M; Fladung, M

2012-03-01

Within the genus Populus several species belonging to different sections are cross-compatible. Hence, high numbers of interspecies hybrids occur naturally and, additionally, have been artificially produced in huge breeding programmes during the last 100 years. Therefore, determination of a single poplar species, used for the production of 'multi-species hybrids' is often difficult, and represents a great challenge for the use of molecular markers in species identification. Within this study, over 20 chloroplast regions, both intergenic spacers and coding regions, have been tested for their ability to differentiate different poplar species using 23 already published barcoding primer combinations and 17 newly designed primer combinations. About half of the published barcoding primers yielded amplification products, whereas the new primers designed on the basis of the total sequenced cpDNA genome of Populus trichocarpa Torr. & Gray yielded much higher amplification success. Intergenic spacers were found to be more variable than coding regions within the genus Populus. The highest discrimination power of Populus species was found in the combination of two intergenic spacers (trnG-psbK, psbK-psbl) and the coding region rpoC. In barcoding projects, the coding regions matK and rbcL are often recommended, but within the genus Populus they only show moderate variability and are not efficient in species discrimination. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

Genome-Wide Identification and Transferability of Microsatellite Markers between Palmae Species

PubMed Central

Xiao, Yong; Xia, Wei; Ma, Jianwei; Mason, Annaliese S.; Fan, Haikuo; Shi, Peng; Lei, Xintao; Ma, Zilong; Peng, Ming

2016-01-01

The Palmae family contains 202 genera and approximately 2800 species. Except for Elaeis guineensis and Phoenix dactylifera, almost no genetic and genomic information is available for Palmae species. Therefore, this is an obstacle to the conservation and genetic assessment of Palmae species, especially those that are currently endangered. The study was performed to develop a large number of microsatellite markers which can be used for genetic analysis in different Palmae species. Based on the assembled genome of E. guineensis and P. dactylifera, a total of 814 383 and 371 629 microsatellites were identified. Among these microsatellites identified in E. guineensis, 734 509 primer pairs could be designed from the flanking sequences of these microsatellites. The majority (618 762) of these designed primer pairs had in silico products in the genome of E. guineensis. These 618 762 primer pairs were subsequently used to in silico amplify the genome of P. dactylifera. A total of 7 265 conserved microsatellites were identified between E. guineensis and P. dactylifera. One hundred and thirty-five primer pairs flanking the conserved SSRs were stochastically selected and validated to have high cross-genera transferability, varying from 16.7 to 93.3% with an average of 73.7%. These genome-wide conserved microsatellite markers will provide a useful tool for genetic assessment and conservation of different Palmae species in the future. PMID:27826307

Molecular Diagnostic for Prospecting Polyhydroxyalkanoate-Producing Bacteria.

PubMed

Montenegro, Eduarda Morgana da Silva; Delabary, Gabriela Scholante; Silva, Marcus Adonai Castro da; Andreote, Fernando Dini; Lima, André Oliveira de Souza

2017-05-25

The use of molecular diagnostic techniques for bioprospecting and microbial diversity study purposes has gained more attention thanks to their functionality, low cost and quick results. In this context, ten degenerate primers were designed for the amplification of polyhydroxyalkanoate synthase ( phaC ) gene, which is involved in the production of polyhydroxyalkanoate (PHA)-a biodegradable, renewable biopolymer. Primers were designed based on multiple alignments of phaC gene sequences from 218 species that have their genomes already analyzed and deposited at Biocyc databank. The combination of oligos phaCF3/phaCR1 allowed the amplification of the expected product (PHA synthases families types I and IV) from reference organisms used as positive control (PHA producer). The method was also tested in a multiplex system with two combinations of initiators, using 16 colonies of marine bacteria (pre-characterized for PHA production) as a DNA template. All amplicon positive organisms ( n = 9) were also PHA producers, thus no false positives were observed. Amplified DNA was sequenced ( n = 4), allowing for the confirmation of the pha C gene identity as well its diversity among marine bacteria. Primers were also tested for screening purposes using 37 colonies from six different environments. Almost 30% of the organisms presented the target amplicon. Thus, the proposed primers are an efficient tool for screening bacteria with potential for the production of PHA as well to study PHA genetic diversity.

Molecular Diagnostic for Prospecting Polyhydroxyalkanoate-Producing Bacteria

PubMed Central

Montenegro, Eduarda Morgana da Silva; Delabary, Gabriela Scholante; da Silva, Marcus Adonai Castro; Andreote, Fernando Dini; Lima, André Oliveira de Souza

2017-01-01

The use of molecular diagnostic techniques for bioprospecting and microbial diversity study purposes has gained more attention thanks to their functionality, low cost and quick results. In this context, ten degenerate primers were designed for the amplification of polyhydroxyalkanoate synthase (phaC) gene, which is involved in the production of polyhydroxyalkanoate (PHA)—a biodegradable, renewable biopolymer. Primers were designed based on multiple alignments of phaC gene sequences from 218 species that have their genomes already analyzed and deposited at Biocyc databank. The combination of oligos phaCF3/phaCR1 allowed the amplification of the expected product (PHA synthases families types I and IV) from reference organisms used as positive control (PHA producer). The method was also tested in a multiplex system with two combinations of initiators, using 16 colonies of marine bacteria (pre-characterized for PHA production) as a DNA template. All amplicon positive organisms (n = 9) were also PHA producers, thus no false positives were observed. Amplified DNA was sequenced (n = 4), allowing for the confirmation of the phaC gene identity as well its diversity among marine bacteria. Primers were also tested for screening purposes using 37 colonies from six different environments. Almost 30% of the organisms presented the target amplicon. Thus, the proposed primers are an efficient tool for screening bacteria with potential for the production of PHA as well to study PHA genetic diversity. PMID:28952531

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome

PubMed Central

Sarika; Arora, Vasu; Iquebal, M. A.; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on ‘three-tier architecture’ that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers’ search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/ PMID:23396298

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

PubMed

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities.

PubMed

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-11-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* #

PubMed Central

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-01-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

Genetic diversity in intraspecific hybrid populations of Eucommia ulmoides Oliver evaluated from ISSR and SRAP molecular marker analysis.

PubMed

Yu, J; Wang, Y; Ru, M; Peng, L; Liang, Z S

2015-07-03

Eucommia ulmoides Oliver, the only extant species of Eucommiaceae, is a second-category state-protected endangered plant in China. Evaluation of genetic diversity among some intraspecific hybrid populations of E. ulmoides Oliver is vital for breeding programs and further conservation of this rare species. We studied the genetic diversity of 130 accessions from 13 E. ulmoides intraspecific hybrid populations using inter-simple sequence related (ISSR) and sequence-related amplified polymorphism (SRAP) markers. Of the 100 ISSR primers and 100 SRAP primer combinations screened, eight ISSRs and eight SRAPs were used to evaluate the level of polymorphism and discriminating capacity. A total number of 65 bands were amplified using eight ISSR primers, in which 50 bands (76.9%) were polymorphic, with an average of 8.1 polymorphic fragments per primer. Alternatively, another 244 bands were observed using eight SRAP primer combinations, and 163 (66.8%) of them were polymorphic, with an average of 30.5 polymorphic fragments per primer. The unweighted pair-group method (UPGMA) analysis showed that these 13 populations could be classified into three groups by the ISSR marker and two groups by the SRAP marker. Principal coordinate analysis using SRAP was completely identical to the UPGMA-based clustering, although this was partly confirmed by the results of UPGMA cluster analysis using the ISSR marker. This study provides insights into the genetic background of E. ulmoides intraspecific hybrids. The progenies of the variations "Huazhong-3", "big fruit", "Yanci", and "smooth bark" present high genetic diversity and offer great potential for E. ulmoides breeding and conservation.

A Primer on Experimental and Quasi-experimental Design.

ERIC Educational Resources Information Center

Dawson, Thomas E.

Counseling psychology is a relatively new field that is gaining autonomy and respect. Unfortunately, research efforts in the field may lack an appropriate research design. This paper considers some of the more common types of research design and the associated threats to their validity. An example of each design type is drawn from the counseling…

Detection of West Nile virus and tick-borne encephalitis virus in birds in Slovakia, using a universal primer set.

PubMed

Csank, Tomáš; Bhide, Katarína; Bencúrová, Elena; Dolinská, Saskia; Drzewnioková, Petra; Major, Peter; Korytár, Ľuboš; Bocková, Eva; Bhide, Mangesh; Pistl, Juraj

2016-06-01

West Nile virus (WNV) is a mosquito-borne neurotropic pathogen that presents a major public health concern. Information on WNV prevalence and circulation in Slovakia is insufficient. Oral and cloacal swabs and bird brain samples were tested for flavivirus RNA by RT-PCR using newly designed generic primers. The species designation was confirmed by sequencing. WNV was detected in swab and brain samples, whereas one brain sample was positive for tick-borne encephalitis virus (TBEV). The WNV sequences clustered with lineages 1 and 2. These results confirm the circulation of WNV in birds in Slovakia and emphasize the risk of infection of humans and horses.

Optimum Multi-Impulse Rendezvous Program

NASA Technical Reports Server (NTRS)

Glandorf, D. R.; Onley, A. G.; Rozendaal, H. L.

1970-01-01

OMIRPROGRAM determines optimal n-impulse rendezvous trajectories under the restrictions of two-body motion in free space. Lawden's primer vector theory is applied to determine optimum number of midcourse impulse applications. Global optimality is not guaranteed.

Risk assessment for public–private partnerships : a primer.

DOT National Transportation Integrated Search

2014-01-01

The Federal Highway Administrations (FHWAs) Office of Innovative Program Delivery (IPD) assists States and local governments in developing knowledge, skills, and abilities in innovative finance techniques. Publicprivate partnerships (P3s) ar...

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

PubMed

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

PubMed

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

PubMed Central

Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

2013-01-01

The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

PubMed Central

Ogrean, Christy; Jackson, Ben; Covino, James

2010-01-01

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

A sequence-based genetic map of Medicago truncatula and comparison of marker colinearity with M. sativa.

PubMed Central

Choi, Hong-Kyu; Kim, Dongjin; Uhm, Taesik; Limpens, Eric; Lim, Hyunju; Mun, Jeong-Hwan; Kalo, Peter; Penmetsa, R Varma; Seres, Andrea; Kulikova, Olga; Roe, Bruce A; Bisseling, Ton; Kiss, Gyorgy B; Cook, Douglas R

2004-01-01

A core genetic map of the legume Medicago truncatula has been established by analyzing the segregation of 288 sequence-characterized genetic markers in an F(2) population composed of 93 individuals. These molecular markers correspond to 141 ESTs, 80 BAC end sequence tags, and 67 resistance gene analogs, covering 513 cM. In the case of EST-based markers we used an intron-targeted marker strategy with primers designed to anneal in conserved exon regions and to amplify across intron regions. Polymorphisms were significantly more frequent in intron vs. exon regions, thus providing an efficient mechanism to map transcribed genes. Genetic and cytogenetic analysis produced eight well-resolved linkage groups, which have been previously correlated with eight chromosomes by means of FISH with mapped BAC clones. We anticipated that mapping of conserved coding regions would have utility for comparative mapping among legumes; thus 60 of the EST-based primer pairs were designed to amplify orthologous sequences across a range of legume species. As an initial test of this strategy, we used primers designed against M. truncatula exon sequences to rapidly map genes in M. sativa. The resulting comparative map, which includes 68 bridging markers, indicates that the two Medicago genomes are highly similar and establishes the basis for a Medicago composite map. PMID:15082563

Rapid and accurate identification of Mycobacterium tuberculosis complex and common non-tuberculous mycobacteria by multiplex real-time PCR targeting different housekeeping genes.

PubMed

Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid

2012-11-01

Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.

High efficiency and reliability of inter-simple sequence repeats (ISSR) markers for evaluation of genetic diversity in Brazilian cultivated Jatropha curcas L. accessions.

PubMed

Grativol, Clícia; da Fonseca Lira-Medeiros, Catarina; Hemerly, Adriana Silva; Ferreira, Paulo Cavalcanti Gomes

2011-10-01

Jatropha curcas L. is found in all tropical regions and has garnered lot of attention for its potential as a source of biodiesel. As J. curcas is a plant that is still in the process of being domesticated, interest in improving its agronomic traits has increased in an attempt to select more productive varieties, aiming at sustainable utilization of this plant for biodiesel production. Therefore, the study of genetic diversity in different accessions of J. curcas in Brazil constitutes a necessary first step in genetic programs designed to improve this species. In this study we have used ISSR markers to assess the genetic variability of 332 accessions from eight states in Brazil that produce J. curcas seeds for commercialization. Seven ISSR primers amplified a total of 21,253 bands, of which 19,472 bands (91%) showed polymorphism. Among the polymorphic bands 275 rare bands were identified (present in fewer than 15% of the accessions). Polymorphic information content (PIC), marker index (MI) and resolving power (RP) averaged 0.26, 17.86 and 19.87 per primer, respectively, showing the high efficiency and reliability of the markers used. ISSR markers analyses as number of polymorphic loci, genetic diversity and accession relationships through UPGMA-phenogram and MDS showed that Brazilian accessions are closely related but have a higher level of genetic diversity than accessions from other countries, and the accessions from Natal (RN) are the most diverse, having high value as a source of genetic diversity for breeding programs of J. curcas in the world.

Significant variance in genetic diversity among populations of Schistosoma haematobium detected using microsatellite DNA loci from a genome-wide database.

PubMed

Glenn, Travis C; Lance, Stacey L; McKee, Anna M; Webster, Bonnie L; Emery, Aidan M; Zerlotini, Adhemar; Oliveira, Guilherme; Rollinson, David; Faircloth, Brant C

2013-10-17

Urogenital schistosomiasis caused by Schistosoma haematobium is widely distributed across Africa and is increasingly being targeted for control. Genome sequences and population genetic parameters can give insight into the potential for population- or species-level drug resistance. Microsatellite DNA loci are genetic markers in wide use by Schistosoma researchers, but there are few primers available for S. haematobium. We sequenced 1,058,114 random DNA fragments from clonal cercariae collected from a snail infected with a single Schistosoma haematobium miracidium. We assembled and aligned the S. haematobium sequences to the genomes of S. mansoni and S. japonicum, identifying microsatellite DNA loci across all three species and designing primers to amplify the loci in S. haematobium. To validate our primers, we screened 32 randomly selected primer pairs with population samples of S. haematobium. We designed >13,790 primer pairs to amplify unique microsatellite loci in S. haematobium, (available at http://www.cebio.org/projetos/schistosoma-haematobium-genome). The three Schistosoma genomes contained similar overall frequencies of microsatellites, but the frequency and length distributions of specific motifs differed among species. We identified 15 primer pairs that amplified consistently and were easily scored. We genotyped these 15 loci in S. haematobium individuals from six locations: Zanzibar had the highest levels of diversity; Malawi, Mauritius, Nigeria, and Senegal were nearly as diverse; but the sample from South Africa was much less diverse. About half of the primers in the database of Schistosoma haematobium microsatellite DNA loci should yield amplifiable and easily scored polymorphic markers, thus providing thousands of potential markers. Sequence conservation among S. haematobium, S. japonicum, and S. mansoni is relatively high, thus it should now be possible to identify markers that are universal among Schistosoma species (i.e., using DNA sequences conserved among species), as well as other markers that are specific to species or species-groups (i.e., using DNA sequences that differ among species). Full genome-sequencing of additional species and specimens of S. haematobium, S. japonicum, and S. mansoni is desirable to better characterize differences within and among these species, to develop additional genetic markers, and to examine genes as well as conserved non-coding elements associated with drug resistance.

Hindering the illegal trade in dog and cat furs through a DNA-based protocol for species identification.

PubMed

Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita

2018-01-01

In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.

[Design of primers to DNA of lactic acid bacteria].

PubMed

Lashchevskiĭ, V V; Kovalenko, N K

2003-01-01

Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

PubMed

Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

2013-03-11

Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

PubMed

Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

2009-01-01

PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

Impact of gamma rays on the Phaffia rhodozyma genome revealed by RAPD-PCR.

PubMed

Najafi, N; Hosseini, Ramin; Ahmadi, Ar

2011-12-01

Phaffia rhodozyma is a red yeast which produces astaxanthin as the major carotenoid pigment. Astaxanthin is thought to reduce the incidence of cancer and degenerative diseases in man. It also enhances the immune response and acts as a free-radical quencher, a precursor of vitamin A, or a pigment involved in the visual attraction of animals as mating partners. The impact of gamma irradiation was studied on the Phaffia rhodozyma genome. Ten mutant strains, designated Gam1-Gam10, were obtained using gamma irradiation. Ten decamer random amplified polymorphic DNA (RAPD) primers were employed to assess genetic changes. Nine primers revealed scorable polymorphisms and a total of 95 band positions were scored; amongst which 38 bands (37.5%) were polymorphic. Primer F with 3 bands and primer J20 with 13 bands produced the lowest and the highest number of bands, respectively. Primer A16 produced the highest number of polymorphic bands (70% polymorphism) and primer F showed the lowest number of polymorphic bands (0% polymorphism). Genetic distances were calculated using Jaccard's coefficient and the UPGMA method. A dendrogram was created using SPSS (version 11.5) and the strains were clustered into four groups. RAPD markers could distinguish between the parental and the mutant strains of P. rhodozyma. RAPD technique showed that some changes had occurred in the genome of the mutated strains. This technique demonstrated the capability to differentiate between the parental and the mutant strains.

Evaluation of LSSP-PCR for identification of Leptospira spp. in urine samples of cattle with clinical suspicion of leptospirosis.

PubMed

Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota

2006-12-20

We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

Identification of root rot fungi in nursery seedlings by nested multiplex PCR.

PubMed Central

Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M

1996-01-01

The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993

Dinucleotide repeat polymorphisms in waterfowl (family Anatidae): Characterization of a sex-linked (Z-specific) and 14 autosomal loci

USGS Publications Warehouse

Buchholz, W.G.; Pearce, J.M.; Pierson, B.J.; Scribner, K.T.

1998-01-01

Canada goose (Branta Canadensis) and harlequin duck (Histrionicus histrionicus) DNAs were digested with Sau3AI, and size selected (300-700 bp) fragments were ligated into BamHI-digested pBluscriptII KS+. The enrichment protocol of Ostrander et al.1 was followed. The resulting libraries were screened using a [ƴ-32P]ATP end-labelled (CA)20 oligonucleotides as a hybridization probe. Positive clones were sequenced using cycle-sequencing protocols (Epicentre Technologies, Madison, WI) and primers flanking the inserts. PCR primers were designed to amplify the repeat and yield amplification products of ≈100-200 bp. DNA  samples were screened for variation at these loci using [ƴ-32P]ATP end-labelled primers. The products were resolved using 6% denaturing polyacrylamide gels and autoradiography.

Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

PubMed

Smielewska-Loś, E

2003-01-01

Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

Characterization of 10 new nuclear microsatellite markers in Acca sellowiana (Myrtaceae)1

PubMed Central

Klabunde, Gustavo H. F.; Olkoski, Denise; Vilperte, Vinicius; Zucchi, Maria I.; Nodari, Rubens O.

2014-01-01

• Premise of the study: Microsatellite primers were identified and characterized in Acca sellowiana in order to expand the limited number of pre-existing polymorphic markers for use in population genetic studies for conservation, phylogeography, breeding, and domestication. • Methods and Results: A total of 10 polymorphic microsatellite primers were designed from clones obtained from a simple sequence repeat (SSR)–enriched genomic library. The primers amplified di- and trinucleotide repeats with four to 27 alleles per locus. In all tested populations, the observed heterozygosity ranged from 0.269 to 1.0. • Conclusions: These new polymorphic SSR markers will allow future genetic studies to be denser, either for genetic structure characterization of natural populations or for studies involving genetic breeding and domestication process in A. sellowiana. PMID:25202632

Research and Development wildland fire and fuels accomplishments and outcomes

Treesearch

Matthew Rollins; Carlos Rodriguez-Franco; Tara Haan; Susan Conard

2017-01-01

The Research and Development (R&D) Wildland Fire and Fuels program at the Forest Service, an agency of the U.S. Department of Agriculture, continues to be an internationally renowned program for generating critical and essential data, knowledge, and applications for all phases of wildland fire management and response. This report provides a primer on the...

A primer of nonresponse in the US Forest Inventory and Analysis program

Treesearch

Paul L. Patterson; John W. Coulston; Francis A. Roesch; James A. Westfall; Andrew D. Hill

2012-01-01

Nonresponse caused by denied access and hazardous conditions are a concern for the USDA Forest Service, Forest Inventory and Analysis (FIA) program, whose mission is to quantify status and trends in forest resources across the USA. Any appreciable amount of nonresponse can cause bias in FIA's estimates of population parameters. This paper will quantify the...

Oyster Reef Communities in the Chesapeake Bay: A Brief Primer. VORTEX: Virginia's Oyster Reef Teaching EXperience.

ERIC Educational Resources Information Center

Harding, Juliana M.; Mann, Roger; Clark, Vicki P.

This document introduces Virginia's Oyster Reef Teaching EXperience (VORTEX), which is an interdisciplinary program focusing on the importance of oyster reef communities in the Chesapeake Bay ecosystem. The VORTEX program uses field and laboratory experience supported by multimedia instruction. This document presents an overview on the biology of…

It's Only a Little Planet: A Primer for Ocean Studies.

ERIC Educational Resources Information Center

Meyland, Sarah J.

Developed as part of the Day on the Bay Cruise Program, funded by the National Sea Grant Program, this learner's manual outlines ocean studies conducted on a seven-hour cruise of the Galveston Bay area. A description of the geology and human use of Galveston Bay follows a general introduction to coastal and estuarine ecology. Line drawings…

Financial structuring and assessment for public–private partnerships : a primer.

DOT National Transportation Integrated Search

2013-12-01

The Federal Highway Administrations (FHWAs) Office of Innovative Program Delivery (IPD) assists States and local governments in developing knowledge, skills, and abilities in innovative finance techniques. Publicprivate partnerships (P3s) ar...

1995 Federal Highway Administration Research And Technology Program Highlights

DOT National Transportation Integrated Search

2001-08-01

When carefully planned and properly applied, data integration can bring substantial benefits to any transportation agency. This primer provides information to assist agencies in undertaking a data integration initiative that will support their busine...

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

PubMed Central

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

PubMed

Panicker, Gitika; Bej, Asim K

2005-10-01

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

Relatedness of Indian flax genotypes (Linum usitatissimum L.): an inter-simple sequence repeat (ISSR) primer assay.

PubMed

Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S

2010-06-01

The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations.

Rapid diagnosis of common deletional α-thalassemia in the Chinese population by qPCR based on identical primer homologous fragments.

PubMed

Long, Ju

2016-05-01

In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.

New universal ITS2 primers for high-resolution herbivory analyses using DNA metabarcoding in both tropical and temperate zones.

PubMed

Moorhouse-Gann, Rosemary J; Dunn, Jenny C; de Vere, Natasha; Goder, Martine; Cole, Nik; Hipperson, Helen; Symondson, William O C

2018-06-04

DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187-387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.

Next Generation Loading System for Detonators and Primers

DTIC Science & Technology

Designed , fabricated and installed next generation tooling to provide additional manufacturing capabilities for new detonators and other small...prototype munitions on automated, semi-automated and manual machines. Lead design effort, procured and installed a primary explosive Drying Oven for a pilot...facility. Designed , fabricated and installed a Primary Explosives Waste Treatment System in a pilot environmental processing facility. Designed

DyNAVacS: an integrative tool for optimized DNA vaccine design.

PubMed

Harish, Nagarajan; Gupta, Rekha; Agarwal, Parul; Scaria, Vinod; Pillai, Beena

2006-07-01

DNA vaccines have slowly emerged as keystones in preventive immunology due to their versatility in inducing both cell-mediated as well as humoral immune responses. The design of an efficient DNA vaccine, involves choice of a suitable expression vector, ensuring optimal expression by codon optimization, engineering CpG motifs for enhancing immune responses and providing additional sequence signals for efficient translation. DyNAVacS is a web-based tool created for rapid and easy design of DNA vaccines. It follows a step-wise design flow, which guides the user through the various sequential steps in the design of the vaccine. Further, it allows restriction enzyme mapping, design of primers spanning user specified sequences and provides information regarding the vectors currently used for generation of DNA vaccines. The web version uses Apache HTTP server. The interface was written in HTML and utilizes the Common Gateway Interface scripts written in PERL for functionality. DyNAVacS is an integrated tool consisting of user-friendly programs, which require minimal information from the user. The software is available free of cost, as a web based application at URL: http://miracle.igib.res.in/dynavac/.

In silico mining and characterization of simple sequence repeats from gilthead sea bream (Sparus aurata) expressed sequence tags (EST-SSRs); PCR amplification, polymorphism evaluation and multiplexing and cross-species assays.

PubMed

Vogiatzi, Emmanouella; Lagnel, Jacques; Pakaki, Victoria; Louro, Bruno; Canario, Adelino V M; Reinhardt, Richard; Kotoulas, Georgios; Magoulas, Antonios; Tsigenopoulos, Costas S

2011-06-01

We screened for simple sequence repeats (SSRs) found in ESTs derived from an EST-database development project ('Marine Genomics Europe' Network of Excellence). Different motifs of di-, tri-, tetra-, penta- and hexanucleotide SSRs were evaluated for variation in length and position in the expressed sequences, relative abundance and distribution in gilthead sea bream (Sparus aurata). We found 899 ESTs that harbor 997 SSRs (4.94%). On average, one SSR was found per 2.95 kb of EST sequence and the dinucleotide SSRs are the most abundant accounting for 47.6% of the total number. EST-SSRs were used as template for primer design. 664 primer pairs could be successfully identified and a subset of 206 pairs of primers was synthesized, PCR-tested and visualized on ethidium bromide stained agarose gels. The main objective was to further assess the potential of EST-SSRs as informative markers and investigate their cross-species amplification in sixteen teleost fish species: seven sparid species and nine other species from different families. Approximately 78% of the primer pairs gave PCR products of expected size in gilthead sea bream, and as expected, the rate of successful amplification of sea bream EST-SSRs was higher in sparids, lower in other perciforms and even lower in species of the Clupeiform and Gadiform orders. We finally determined the polymorphism and the heterozygosity of 63 markers in a wild gilthead sea bream population; fifty-eight loci were found to be polymorphic with the expected heterozygosity and the number of alleles ranging from 0.089 to 0.946 and from 2 to 27, respectively. These tools and markers are expected to enhance the available genetic linkage map in gilthead sea bream, to assist comparative mapping and genome analyses for this species and further with other model fish species and finally to help advance genetic analysis for cultivated and wild populations and accelerate breeding programs. Copyright © 2011 Elsevier B.V. All rights reserved.

rpoB Gene Sequence-Based Identification of Aerobic Gram-Positive Cocci of the Genera Streptococcus, Enterococcus, Gemella, Abiotrophia, and Granulicatella

PubMed Central

Drancourt, Michel; Roux, Véronique; Fournier, Pierre-Edouard; Raoult, Didier

2004-01-01

We developed a new molecular tool based on rpoB gene (encoding the beta subunit of RNA polymerase) sequencing to identify streptococci. We first sequenced the complete rpoB gene for Streptococcus anginosus, S. equinus, and Abiotrophia defectiva. Sequences were aligned with these of S. pyogenes, S. agalactiae, and S. pneumoniae available in GenBank. Using an in-house analysis program (SVARAP), we identified a 740-bp variable region surrounded by conserved, 20-bp zones and, by using these conserved zones as PCR primer targets, we amplified and sequenced this variable region in an additional 30 Streptococcus, Enterococcus, Gemella, Granulicatella, and Abiotrophia species. This region exhibited 71.2 to 99.3% interspecies homology. We therefore applied our identification system by PCR amplification and sequencing to a collection of 102 streptococci and 60 bacterial isolates belonging to other genera. Amplicons were obtained in streptococci and Bacillus cereus, and sequencing allowed us to make a correct identification of streptococci. Molecular signatures were determined for the discrimination of closely related species within the S. pneumoniae-S. oralis-S. mitis group and the S. agalactiae-S. difficile group. These signatures allowed us to design a S. pneumoniae-specific PCR and sequencing primer pair. PMID:14766807

Novel priming and crosslinking systems for use with isocyanatomethacrylate dental adhesives.

PubMed

Chappelow, C C; Power, M D; Bowles, C Q; Miller, R G; Pinzino, C S; Eick, J D

2000-11-01

(a) to design, formulate and evaluate prototype primers and a crosslinking agent for use with isocyanatomethacrylate-based comonomer adhesives and (b) to establish correlations between bond strength and solubility parameter differences between the adhesives and etched dentin, and the permeability coefficients of the adhesives. Equimolar mixtures of 2-isocyanatoethyl methacrylate (IEM) and a methacrylate comonomer were formulated with tri-n-butyl borane oxide (TBBO) as the free radical initiator to have cure times of 6-10 min. Shear bond strengths to dentin were determined for each adhesive mixture (n = 7) using standard testing protocols. Shear bond strengths for the three systems were also determined after application of "reactive primers" to the dentin surface. The "reactive primers" contained 10-20 parts by weight of the respective comonomer mixture and 3.5 parts by weight TBBO in acetone. Solubility parameters difference values (delta delta) and permeability coefficients (P) were approximated for each adhesive system and correlated with shear bond strength values. Additionally, a crosslinking agent was prepared by bulk reaction of an equimolar mixture containing IEM and a methacrylate comonomer. The effects of crosslinker addition on: (a) the setting time of IEM; and (b) the setting times and initiator requirements of selected IEM/comonomer mixtures were determined. Shear bond strength values (MPa): IEM/HEMA 13.6 +/- 2.0 (no primer), 20.1 +/- 2.0 (with primer); IEM/HETMA 9.3 +/- 3.3 (no primer), 20.8 +/- 8.1 (with primer); IEM/AAEMA 13.6 +/- 1.9 (no primer), 17.3 +/- 3.2 (with primer). Also, approximated permeability coefficients showed a significant correlation (r = +0.867, p < 0.001) with shear bond strength values. Crosslinker addition studies with IEM/4-META: (a) at 5-9 mol% reduced the setting time of IEM polymerization by 79%; and (b) at 6 mol% reduced initiator level requirements 60-70% to achieve a comparable setting time, and decreased setting times by ca. 75% for a given initiator level with selected IEM/methacrylate adhesive systems. The shear bond strengths of isocyanatomethacrylate-based dental adhesives can be enhanced by using reactive primers; their setting times and initiator requirements can be improved using a dimethacrylate crosslinker. Approximated permeability coefficients may be useful as indicators of bonding performance for dentin adhesive systems.

Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

PubMed

Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

2018-01-01

Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

A blackberry (Rubus L.) expressed sequence tag library for the development of simple sequence repeat markers

PubMed Central

Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P

2008-01-01

Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry. PMID:18570660

Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

PubMed

Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

2009-12-01

The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

Feed-in Tariffs: Good Practices and Design Considerations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cox, Sadie; Esterly, Sean

2016-01-02

In recent years, feed-in tariff (FIT) activity has focused primarily on revisions to current policies, underscoring the need for stable and predictable, yet flexible, policy environments. This policy brief provides a primer on key FIT design elements, lessons from country experience, and support resources to enable more detailed and country-specific FIT policy design.

Applying Instructional Design Theories to Bioinformatics Education in Microarray Analysis and Primer Design Workshops

ERIC Educational Resources Information Center

Shachak, Aviv; Ophir, Ron; Rubin, Eitan

2005-01-01

The need to support bioinformatics training has been widely recognized by scientists, industry, and government institutions. However, the discussion of instructional methods for teaching bioinformatics is only beginning. Here we report on a systematic attempt to design two bioinformatics workshops for graduate biology students on the basis of…

A Primer for Problem Solving Using Artificial Intelligence.

ERIC Educational Resources Information Center

Schell, George P.

1988-01-01

Reviews the development of artificial intelligence systems and the mechanisms used, including knowledge representation, programing languages, and problem processing systems. Eleven books and 6 journals are listed as sources of information on artificial intelligence. (23 references) (CLB)

Biosafety- A Regulatory Primer for DOE/NNSA Sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siegel, Dina Mary

2017-05-04

The objectives of a biological safety program, and this are to ensure that work with biological materials are conducted in compliance with applicable biosafety standards and ensure that protection of workers, facilities, the public, and the environment.

Primer ID Validates Template Sampling Depth and Greatly Reduces the Error Rate of Next-Generation Sequencing of HIV-1 Genomic RNA Populations

PubMed Central

Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr

2015-01-01

ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299

Development of a SCAR marker for male gametophyte of Gracilariopsis lemaneiformis based on AFLP technique

NASA Astrophysics Data System (ADS)

Zhou, Wei; Ding, Hongye; Sui, Zhenghong; Wang, Zhongxia; Wang, Jinguo

2014-05-01

The red alga Gracilariopsis lemaneiformis (Bory) is an economically valuable macroalgae. As a means to identify the sex of immature Gracilariopsis lemaneiformis, the amplified fragment length polymorphism (AFLP) technique was used to search for possible sex- or phase-related markers in male gametophytes, female gametophytes, and tetrasporophytes, respectively. Seven AFLP selective amplification primers were used in this study. The primer combination E-TG/M-CCA detected a specific band linked to male gametophytes. The DNA fragment was recovered and a 402-bp fragment was sequenced. However, no DNA sequence match was found in public databases. Sequence characterized amplified region (SCAR) primers were designed from the sequence to test the repeatability of the relationship to the sex, using 69 male gametophytes, 139 female gametophytes, and 47 tetrasporophytes. The test results demonstrate a good linkage and repeatability of the SCAR marker to sex. The SCAR primers developed in this study could reduce the time required for sex identification of Gracilariopsis lemaneiformis by four to six months. This can reduce both the time investment and number of specimens required in breeding experiments.

Grapevine fleck virus-like viruses in Vitis.

PubMed

Sabanadzovic, S; Abou-Ghanem, N; Castellano, M A; Digiaro, M; Martelli, G P

2000-01-01

Two sets of degenerate primers for the specific amplification of 572-575 nt and 386 nt segments of the methyltransferase and RNA- dependent RNA polymerase cistrons of members of the genera Tymovirus and Marafivirus and of the unassigned virus Grapevine fleck virus (GFkV) were designed on the basis of available sequences. These primers were used for amplifying and subsequent cloning and sequencing part of the open reading frame 1 of the genome of GFkV, Grapevine asteroid mosaic-associated virus (GAMaV) and of another previously unreported virus, for which the name Grapevine red globe virus (GRGV) is proposed. Computer-assisted analysis of the amplified genome portions showed that the three grapevine viruses are phylogenetically related with one another and with sequenced tymoviruses and marafiviruses. The relationships with tymoviruses was confirmed by the type of ultrastructural modifications induced in the host cells. RdRp-specific degenerate primers were successfully used for the aspecific detection of the three viruses in crude grapevine sap extracts. Specific virus identification was obtained with RT-PCR using antisense virus-specific primers.

One Primer To Rule Them All: Universal Primer That Adds BBa_B0034 Ribosomal Binding Site to Any Coding Standard 10 BioBrick

PubMed Central

2015-01-01

Here, we present a universal, simple, efficient, and reliable way to add small BioBrick parts to any BioBrick via PCR that is compatible with BioBrick assembly standard 10. As a proof of principle, we have designed a universal primer, rbs_B0034, that contains a ribosomal binding site (RBS; BBa_B0034) and that can be used in PCR to amplify any coding BioBrick that starts with ATG. We performed test PCRs with rbs_B0034 on 31 different targets and found it to be 93.6% efficient. Moreover, when supplemented with a complementary primer, addition of RBS can be accomplished via whole plasmid site-directed mutagenesis, thus reducing the time required for further assembly of composite parts. The described method brings simplicity to the addition of small parts, such as regulatory elements to existing BioBricks. The final product of the PCR assembly is indistinguishable from the standard or 3A BioBrick assembly. PMID:25524097

Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

PubMed

Cowan, Ashley F; Elkins, Kelly M

2017-12-01

Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

Implementation of a Computerized Maintenance Management System

NASA Technical Reports Server (NTRS)

Shen, Yong-Hong; Askari, Bruce

1994-01-01

A primer Computerized Maintenance Management System (CMMS) has been established for NASA Ames pressure component certification program. The CMMS takes full advantage of the latest computer technology and SQL relational database to perform periodic services for vital pressure components. The Ames certification program is briefly described and the aspects of the CMMS implementation are discussed as they are related to the certification objectives.

Applying Instructional Design Theories to Bioinformatics Education in Microarray Analysis and Primer Design Workshops

PubMed Central

2005-01-01

The need to support bioinformatics training has been widely recognized by scientists, industry, and government institutions. However, the discussion of instructional methods for teaching bioinformatics is only beginning. Here we report on a systematic attempt to design two bioinformatics workshops for graduate biology students on the basis of Gagne's Conditions of Learning instructional design theory. This theory, although first published in the early 1970s, is still fundamental in instructional design and instructional technology. First, top-level as well as prerequisite learning objectives for a microarray analysis workshop and a primer design workshop were defined. Then a hierarchy of objectives for each workshop was created. Hands-on tutorials were designed to meet these objectives. Finally, events of learning proposed by Gagne's theory were incorporated into the hands-on tutorials. The resultant manuals were tested on a small number of trainees, revised, and applied in 1-day bioinformatics workshops. Based on this experience and on observations made during the workshops, we conclude that Gagne's Conditions of Learning instructional design theory provides a useful framework for developing bioinformatics training, but may not be optimal as a method for teaching it. PMID:16220141

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

Switchable photosystem-II designer algae for photobiological hydrogen production

DOEpatents

Lee, James Weifu

2010-01-05

A switchable photosystem-II designer algae for photobiological hydrogen production. The designer transgenic algae includes at least two transgenes for enhanced photobiological H.sub.2 production wherein a first transgene serves as a genetic switch that can controls photosystem II (PSII) oxygen evolution and a second transgene encodes for creation of free proton channels in the algal photosynthetic membrane. In one embodiment, the algae includes a DNA construct having polymerase chain reaction forward primer (302), a inducible promoter (304), a PSII-iRNA sequence (306), a terminator (308), and a PCR reverse primer (310). In other embodiments, the PSII-iRNA sequence (306) is replaced with a CF.sub.1-iRNA sequence (312), a streptomycin-production gene (314), a targeting sequence (316) followed by a proton-channel producing gene (318), or a PSII-producing gene (320). In one embodiment, a photo-bioreactor and gas-product separation and utilization system produce photobiological H.sub.2 from the switchable PSII designer alga.

SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).

PubMed

Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T

2016-09-01

To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.

Technology applications for traffic safety programs : a primer

DOT National Transportation Integrated Search

2008-09-01

This document explores how emerging digital and communications technology can advance safety on the Nations highways. The range of technology described in this report is available or will be available in the near future to improve traffic safety. ...

Transducer Workshop (17th) Held in San Diego, California on June 22-24, 1993

DTIC Science & Technology

1993-06-01

weight in a drop tower, such as the primer tester shown in figure 1. The calibration procedure must be repeated for each lot of copper inserts, and small...force vs. time curve (i.e impulse = area unxer the curve). The FPyF can be used in the primer tester (shown in figure 1) as well as in a weapon...microphones. Plstonphone Output 124 dB, 250 Hz DEAD WEIGHT TESTIER USED AS A PRESSURE RELEASE CALIBRATOR The dead weight tester is designed and most

Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

PubMed

Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

2015-08-14

In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

PubMed

Nomoto, R; Kagawa, H; Yoshida, T

2008-01-01

To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

Multiplex PCR method to discriminate Artemisia iwayomogi from other Artemisia plants.

PubMed

Doh, Eui Jeong; Oh, Seung-Eun

2012-01-01

Some plants in the genus Artemisia have been used for medicinal purposes. Among them, Artemisia iwayomogi, commonly referred to as "Haninjin," is one of the major medicinal materials used in traditional Korean medicine. By contrast, Artemisia capillaris and both Artemisia argyi and Artemisia princeps, referred to as "Injinho" and "Aeyup," respectively, are used to treat diseases different from those for which "Haninjin" is prescribed. Therefore, the development of a reliable method to differentiate each Artemisia herb is necessary. We found that a random amplified polymorphic DNA (RAPD) method can be used to efficiently discriminate a few Artemisia plants from one another. To improve the reliability of RAPD amplification, we designed primer sets based on the nucleotide sequences of RAPD products to amplify a sequence-characterized amplified region (SCAR) marker of A. iwayomogi. In addition, we designed two other primer sets to amplify SCAR markers of "Aeyup" (A. argyi and A. princeps) along with "Injinho" (A. capillaris) and Artemisia japonica, which are also traded in Korean herbal markets. Using these three primer sets, we developed a multiplex PCR method concurrently not only to discriminate A. iwayomogi from other Artemisia plants, but also to identify Artemisia plants using a single PCR process.

Methylation-Sensitive High Resolution Melting (MS-HRM).

PubMed

Hussmann, Dianna; Hansen, Lise Lotte

2018-01-01

Methylation-Sensitive High Resolution Melting (MS-HRM) is an in-tube, PCR-based method to detect methylation levels at specific loci of interest. A unique primer design facilitates a high sensitivity of the assays enabling detection of down to 0.1-1% methylated alleles in an unmethylated background.Primers for MS-HRM assays are designed to be complementary to the methylated allele, and a specific annealing temperature enables these primers to anneal both to the methylated and the unmethylated alleles thereby increasing the sensitivity of the assays. Bisulfite treatment of the DNA prior to performing MS-HRM ensures a different base composition between methylated and unmethylated DNA, which is used to separate the resulting amplicons by high resolution melting.The high sensitivity of MS-HRM has proven useful for detecting cancer biomarkers in a noninvasive manner in urine from bladder cancer patients, in stool from colorectal cancer patients, and in buccal mucosa from breast cancer patients. MS-HRM is a fast method to diagnose imprinted diseases and to clinically validate results from whole-epigenome studies. The ability to detect few copies of methylated DNA makes MS-HRM a key player in the quest for establishing links between environmental exposure, epigenetic changes, and disease.

Experimental Design and Some Threats to Experimental Validity: A Primer

ERIC Educational Resources Information Center

Skidmore, Susan

2008-01-01

Experimental designs are distinguished as the best method to respond to questions involving causality. The purpose of the present paper is to explicate the logic of experimental design and why it is so vital to questions that demand causal conclusions. In addition, types of internal and external validity threats are discussed. To emphasize the…

Guidelines On The Selection And Design Of Messages For Changeable Message Signs

DOT National Transportation Integrated Search

1992-06-01

THIS REPORT PRESENTS GUIDELINES ON THE DESIGN OF CHANGEABLE MESSAGE SIGN (CMS) MESSAGES FOR USE IN FREEWAY CORRIDORS FOR INCIDENT MANAGEMENT AND ROUTE DIVERSION. IT IS A COMPANION TO REPORT NO. FHWA/TX-92/1232-9, WHICH IS A PRIMER ON THE CHARACTERIST...

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

PubMed Central

Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

2005-01-01

Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE PAGES

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

2015-12-09

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan.

PubMed

Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro

2016-10-11

Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.

Development of loop-mediated isothermal amplification (LAMP) assays for the rapid detection of allergic peanut in processed food.

PubMed

Sheu, Shyang-Chwen; Tsou, Po-Chuan; Lien, Yi-Yang; Lee, Meng-Shiou

2018-08-15

Peanut is a widely and common used in many cuisines around the world. However, peanut is also one of the most important food allergen for causing anaphylactic reaction. To prevent allergic reaction, the best way is to avoid the food allergen or food containing allergic ingredient such as peanut before food consuming. Thus, to efficient and precisely detect the allergic ingredient, peanut or related product, is essential and required for maintain consumer's health or their interest. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of allergic peanut using specifically designed primer sets. Two sets of the specific LAMP primers respectively targeted the internal transcribed sequence 1 (ITS1) of nuclear ribosomal DNA sequence regions and the ara h1 gene sequence of Arachia hypogeae (peanut) were used to address the application of LAMP for detecting peanut in processed food or diet. The results demonstrated that the identification of peanut using the newly designed primers for ITS 1 sequence is more sensitive rather than primers for sequence of Ara h1 gene when performing LAMP assay. Besides, the sensitivity of LAMP for detecting peanut is also higher than the traditional PCR method. These LAMP primers sets showed high specificity for the identification of the peanut and had no cross-reaction to other species of nut including walnut, hazelnut, almonds, cashew and macadamia nut. Moreover, when minimal 0.1% peanuts were mixed with other nuts ingredients at different ratios, no any cross-reactivity was evident during performing LAMP. Finally, genomic DNAs extracted from boiled and steamed peanut were used as templates; the detection of peanut by LAMP was not affected and reproducible. As to this established LAMP herein, not only can peanut ingredients be detected but commercial foods containing peanut can also be identified. This assay will be useful and potential for the rapid detection of peanut in practical food markets. Copyright © 2018 Elsevier Ltd. All rights reserved.

Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

PubMed

Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

2002-12-01

The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

Structural Dynamics of Picornaviral RdRP Complexes. Implications for the Design of Antivirals

NASA Astrophysics Data System (ADS)

Verdaguer, Núria; Ferrer-Orta, Cristina; Domingo, Esteban

Genome replication in picornavirus is catalyzed by a virally encoded RNA dependent RNA polymerase, termed 3D. These viruses also use a small protein primer, named VPg to initiate RNA replication. Polymerase 3D also catalyzes the covalent linkage of UMP to a N-terminal tyrosine on VPg. Seven different crystal structures of foot-and-mouth disease virus (FMDV) 3D catalytic complexes have enhanced our understanding of template and primer recognition, VPg uridylylation and rNTP binding and catalysis. In addition, the biochemical and structural analyses of six different FMDV 3D ribavirin resistant mutants provided evidences of three different mechanisms of resistance to this mutagenic nucleoside analogue. Such structural information is providing new insights into the fidelity of RNA replication, and for the design of antiviral compounds.

40 CFR 63.824 - Standards: Publication rotogravure printing.

Code of Federal Regulations, 2010 CFR

2010-07-01

... printing. 63.824 Section 63.824 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES... each ink, coating, varnish, adhesive, primer, solvent, and other material used by the affected source...

40 CFR 63.824 - Standards: Publication rotogravure printing.

Code of Federal Regulations, 2011 CFR

2011-07-01

... printing. 63.824 Section 63.824 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES... each ink, coating, varnish, adhesive, primer, solvent, and other material used by the affected source...

Case studies of market research for three transportation communication products

DOT National Transportation Integrated Search

1994-03-01

This report completes a two-part project in support of the Volpe Center program, Public Acceptance and Markets for Various IVHS Services. The first report, A Primer on Marketing Research, provides an overview of the research approaches an...

ROTONET Primer

NASA Technical Reports Server (NTRS)

Prichard, Devon S.

1996-01-01

This document provides a brief overview of use of the ROTONET rotorcraft system noise prediction capability within the Aircraft Noise Program (ANOPP). Reviews are given on rotorcraft noise, the state-of-the-art of system noise prediction, and methods for using the various ROTONET prediction modules.

Security auditing: a prescription for keeping protection programs healthy.

PubMed

Luizzo, Anthony

2010-01-01

The different aspects of security auditing and the role of the security auditor is explained in detail by the author in this primer for security professionals with specific advice on what should be included in a security audit report.

Expanding transportation systems management and operations (TSM&O) from planning to construction primer.

DOT National Transportation Integrated Search

2015-12-01

The Florida Department of Transportation (FDOT) has initiated business plans to promote the Transportation : Systems Management and Operations (TSM&O) program throughout the State. TSM&O is traditionally managed : by traffic engineers that focus on o...

FEMA’s Disaster Declaration Process: A Primer

DTIC Science & Technology

2009-01-23

welfare programs ( Landis 1999; Landis 1998; Moss 1999). As Michele Landis argues, 5 42...Kestin and Megan O’Matz, “FEMA ruled on disaster before verifying Dade damage,” South Florida Sun- Sentinel, at http://www.sun-sentinel.com/news/sfl

Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

PubMed

Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

2017-08-01

Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

Environmental metabarcodes for insects: in silico PCR reveals potential for taxonomic bias.

PubMed

Clarke, Laurence J; Soubrier, Julien; Weyrich, Laura S; Cooper, Alan

2014-11-01

Studies of insect assemblages are suited to the simultaneous DNA-based identification of multiple taxa known as metabarcoding. To obtain accurate estimates of diversity, metabarcoding markers ideally possess appropriate taxonomic coverage to avoid PCR-amplification bias, as well as sufficient sequence divergence to resolve species. We used in silico PCR to compare the taxonomic coverage and resolution of newly designed insect metabarcodes (targeting 16S) with that of existing markers [16S and cytochrome oxidase c subunit I (COI)] and then compared their efficiency in vitro. Existing metabarcoding primers amplified in silico <75% of insect species with complete mitochondrial genomes available, whereas new primers targeting 16S provided >90% coverage. Furthermore, metabarcodes targeting COI appeared to introduce taxonomic PCR-amplification bias, typically amplifying a greater percentage of Lepidoptera and Diptera species, while failing to amplify certain orders in silico. To test whether bias predicted in silico was observed in vitro, we created an artificial DNA blend containing equal amounts of DNA from 14 species, representing 11 insect orders and one arachnid. We PCR-amplified the blend using five primer sets, targeting either COI or 16S, with high-throughput amplicon sequencing yielding more than 6 million reads. In vitro results typically corresponded to in silico PCR predictions, with newly designed 16S primers detecting 11 insect taxa present, thus providing equivalent or better taxonomic coverage than COI metabarcodes. Our results demonstrate that in silico PCR is a useful tool for predicting taxonomic bias in mixed template PCR and that researchers should be wary of potential bias when selecting metabarcoding markers. © 2014 John Wiley & Sons Ltd.

Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A

PubMed Central

Bueche, Matthieu; Wunderlin, Tina; Roussel-Delif, Ludovic; Junier, Thomas; Sauvain, Loic; Jeanneret, Nicole

2013-01-01

Bacterial endospores are highly specialized cellular forms that allow endospore-forming Firmicutes (EFF) to tolerate harsh environmental conditions. EFF are considered ubiquitous in natural environments, in particular, those subjected to stress conditions. In addition to natural habitats, EFF are often the cause of contamination problems in anthropogenic environments, such as industrial production plants or hospitals. It is therefore desirable to assess their prevalence in environmental and industrial fields. To this end, a high-sensitivity detection method is still needed. The aim of this study was to develop and evaluate an approach based on quantitative PCR (qPCR). For this, the suitability of functional genes specific for and common to all EFF were evaluated. Seven genes were considered, but only spo0A was retained to identify conserved regions for qPCR primer design. An approach based on multivariate analysis was developed for primer design. Two primer sets were obtained and evaluated with 16 pure cultures, including representatives of the genera Bacillus, Paenibacillus, Brevibacillus, Geobacillus, Alicyclobacillus, Sulfobacillus, Clostridium, and Desulfotomaculum, as well as with environmental samples. The primer sets developed gave a reliable quantification when tested on laboratory strains, with the exception of Sulfobacillus and Desulfotomaculum. A test using sediment samples with a diverse EFF community also gave a reliable quantification compared to 16S rRNA gene pyrosequencing. A detection limit of about 104 cells (or spores) per gram of initial material was calculated, indicating this method has a promising potential for the detection of EFF over a wide range of applications. PMID:23811505

Molecular detection of native and invasive marine invertebrate larvae present in ballast and open water environmental samples collected in Puget Sound

USGS Publications Warehouse

Harvey, J.B.J.; Hoy, M.S.; Rodriguez, R.J.

2009-01-01

Non-native marine species have been and continue to be introduced into Puget Sound via several vectors including ship's ballast water. Some non-native species become invasive and negatively impact native species or near shore habitats. We present a new methodology for the development and testing of taxon specific PCR primers designed to assess environmental samples of ocean water for the presence of native and non-native bivalves, crustaceans and algae. The intergenic spacer regions (IGS; ITS1, ITS2 and 5.8S) of the ribosomal DNA were sequenced for adult samples of each taxon studied. We used these data along with those available in Genbank to design taxon and group specific primers and tested their stringency against artificial populations of plasmid constructs containing the entire IGS region for each of the 25 taxa in our study, respectively. Taxon and group specific primer sets were then used to detect the presence or absence of native and non-native planktonic life-history stages (propagules) from environmental samples of ballast water and plankton tow net samples collected in Puget Sound. This methodology provides an inexpensive and efficient way to test the discriminatory ability of taxon specific oligonucleotides (PCR primers) before creating molecular probes or beacons for use in molecular ecological applications such as probe hybridizations or microarray analyses. This work addresses the current need to develop molecular tools capable of diagnosing the presence of planktonic life-history stages from non-native marine species (potential invaders) in ballast water and other environmental samples. ?? 2008 Elsevier B.V.

Optimization of polymerase chain reaction for detection of Clostridium botulinum type C and D in bovine samples.

PubMed

Prévot, V; Tweepenninckx, F; Van Nerom, E; Linden, A; Content, J; Kimpe, A

2007-01-01

Botulism is a rare but serious paralytic illness caused by a nerve toxin that is produced by the bacterium Clostridium botulinum. The economic, medical and alimentary consequences can be catastrophic in case of an epizooty. A polymerase chain reaction (PCR)-based assay was developed for the detection of C. botulinum toxigenic strains type C and D in bovine samples. This assay has proved to be less expensive, faster and simpler to use than the mouse bioassay, the current reference method for diagnosis of C. botulinum toxigenic strains. Three pairs of primers were designed, one for global detection of C. botulinum types C and D (primer pair Y), and two strain-specific pairs specifically designed for types C (primer pair VC) and D (primer pair VD). The PCR amplification conditions were optimized and evaluated on 13 bovine and two duck samples that had been previously tested by the mouse bioassay. In order to assess the impact of sample treatment, both DNA extracted from crude samples and three different enrichment broths (TYG, CMM, CMM followed by TYG) were tested. A 100% sensitivity was observed when samples were enriched for 5 days in CMM followed by 1 day in TYG broth. False-negative results were encountered when C. botulinum was screened for in crude samples. These findings indicate that the current PCR is a reliable method for the detection of C. botulinum toxigenic strains type C and D in bovine samples but only after proper enrichment in CMM and TYG broth.

Improving molecular tools for global surveillance of measles virus⋆

PubMed Central

Bankamp, Bettina; Byrd-Leotis, Lauren A.; Lopareva, Elena N.; Woo, Gibson K.S.; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W.; Ramamurty, Nalini; Mulders, Mick N.; Featherstone, David; Bellini, William J.; Rota, Paul A.

2017-01-01

Background The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. Objectives The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. Study design A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. Results A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. Conclusions These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. PMID:23806666

A primer on stand and forest inventory designs

Treesearch

H. Gyde Lund; Charles E. Thomas

1989-01-01

Covers designs for the inventory of stands and forests in detail and with worked-out examples. For stands, random sampling, line transects, ricochet plot, systematic sampling, single plot, cluster, subjective sampling and complete enumeration are discussed. For forests inventory, the main categories are subjective sampling, inventories without prior stand mapping,...

Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

ERIC Educational Resources Information Center

Robertson, Amber L.; Phillips, Allison R.

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…

Applications of Longitudinal Research to Advance Organizational Theory: A Primer

ERIC Educational Resources Information Center

Newman, David; Newman, Isadore; Hitchcock, John H.

2016-01-01

The purpose of this article is to inform researchers about and encourage the use of longitudinal designs to further understanding of human resource development and organizational theory. This article presents information about a variety of longitudinal research designs, related statistical procedures, and an overview of general data collecting…

Evolutionary principles and their practical application

PubMed Central

Hendry, Andrew P; Kinnison, Michael T; Heino, Mikko; Day, Troy; Smith, Thomas B; Fitt, Gary; Bergstrom, Carl T; Oakeshott, John; Jørgensen, Peter S; Zalucki, Myron P; Gilchrist, George; Southerton, Simon; Sih, Andrew; Strauss, Sharon; Denison, Robert F; Carroll, Scott P

2011-01-01

Evolutionary principles are now routinely incorporated into medicine and agriculture. Examples include the design of treatments that slow the evolution of resistance by weeds, pests, and pathogens, and the design of breeding programs that maximize crop yield or quality. Evolutionary principles are also increasingly incorporated into conservation biology, natural resource management, and environmental science. Examples include the protection of small and isolated populations from inbreeding depression, the identification of key traits involved in adaptation to climate change, the design of harvesting regimes that minimize unwanted life-history evolution, and the setting of conservation priorities based on populations, species, or communities that harbor the greatest evolutionary diversity and potential. The adoption of evolutionary principles has proceeded somewhat independently in these different fields, even though the underlying fundamental concepts are the same. We explore these fundamental concepts under four main themes: variation, selection, connectivity, and eco-evolutionary dynamics. Within each theme, we present several key evolutionary principles and illustrate their use in addressing applied problems. We hope that the resulting primer of evolutionary concepts and their practical utility helps to advance a unified multidisciplinary field of applied evolutionary biology. PMID:25567966

Evolutionary principles and their practical application.

PubMed

Hendry, Andrew P; Kinnison, Michael T; Heino, Mikko; Day, Troy; Smith, Thomas B; Fitt, Gary; Bergstrom, Carl T; Oakeshott, John; Jørgensen, Peter S; Zalucki, Myron P; Gilchrist, George; Southerton, Simon; Sih, Andrew; Strauss, Sharon; Denison, Robert F; Carroll, Scott P

2011-03-01

Evolutionary principles are now routinely incorporated into medicine and agriculture. Examples include the design of treatments that slow the evolution of resistance by weeds, pests, and pathogens, and the design of breeding programs that maximize crop yield or quality. Evolutionary principles are also increasingly incorporated into conservation biology, natural resource management, and environmental science. Examples include the protection of small and isolated populations from inbreeding depression, the identification of key traits involved in adaptation to climate change, the design of harvesting regimes that minimize unwanted life-history evolution, and the setting of conservation priorities based on populations, species, or communities that harbor the greatest evolutionary diversity and potential. The adoption of evolutionary principles has proceeded somewhat independently in these different fields, even though the underlying fundamental concepts are the same. We explore these fundamental concepts under four main themes: variation, selection, connectivity, and eco-evolutionary dynamics. Within each theme, we present several key evolutionary principles and illustrate their use in addressing applied problems. We hope that the resulting primer of evolutionary concepts and their practical utility helps to advance a unified multidisciplinary field of applied evolutionary biology.

Evaluation of the PCR method for identification of Bifidobacterium species.

PubMed

Youn, S Y; Seo, J M; Ji, G E

2008-01-01

Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

PubMed Central

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

Rare Sequence Variation in the Genome Flanking a Short Tandem Repeat Locus Can Lead to a Question of “Nonmaternity”

PubMed Central

Deucher, Anne; Chiang, Tsoyu; Schrijver, Iris

2010-01-01

Typing of STR (short tandem repeat) alleles is used in a variety of applications in clinical molecular pathology, including evaluations for maternal cell contamination. Using a commercially available STR typing assay for maternal cell contamination performed in conjunction with prenatal diagnostic testing, we were posed with apparent nonmaternity when the two fetal samples did not demonstrate the expected maternal allele at one locus. By designing primers external to the region amplified by the primers from the commercial assay and by performing direct sequencing of the resulting amplicon, we were able to determine that a guanine to adenine sequence variation led to primer mismatch and allele dropout. This explained the apparent null allele shared between the maternal and fetal samples. Therefore, although rare, allele dropout must be considered whenever unexplained homozygosity at an STR locus is observed. PMID:20203001

Detection of unculturable bacteria in periodontal health and disease by PCR.

PubMed

Harper-Owen, R; Dymock, D; Booth, V; Weightman, A J; Wade, W G

1999-05-01

Recently developed molecular methods have made it possible to characterize mixed microflora in their entirety, including the substantial numbers of bacteria which do not grow on artificial culture media. In a previous study, molecular analysis of the microflora associated with acute oral infections resulted in the identification of three phylotypes, PUS3.42, PUS9.170, and PUS9.180, representing as-yet-uncultured organisms. The aim of this study was to design and validate specific PCR primers for these phylotypes and to determine their incidences in samples collected from healthy and diseased periodontal tissues. Two specific reverse primers were devised for each phylotype, and these were used in duplex PCRs with universal forward and reverse primers. All three phylotypes were detected in periodontal sites; PUS9.170, related to oral asaccharolytic Eubacterium spp., was significantly associated with disease. This study demonstrates the possibility of using unculturable, and therefore uncharacterized, organisms as markers of disease.

Novel multiplex qualitative detection using universal primer-multiplex-PCR combined with pyrosequencing.

PubMed

Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun

2017-12-15

This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.

Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

PubMed

Wang, Deguo; Liu, Yanhong

2015-05-26

Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

Development and cross-species/genera transferability of microsatellite markers discovered using 454 genome sequencing in chokecherry (Prunus virginiana L.).

PubMed

Wang, Hongxia; Walla, James A; Zhong, Shaobin; Huang, Danqiong; Dai, Wenhao

2012-11-01

Chokecherry (Prunus virginiana L.) (2n = 4x = 32) is a unique Prunus species for both genetics and disease-resistance research due to its tetraploid nature and X-disease resistance. However, no genetic and genomic information on chokecherry is available. A partial chokecherry genome was sequenced using Roche 454 sequencing technology. A total of 145,094 reads covering 4.8 Mbp of the chokecherry genome were generated and 15,113 contigs were assembled, of which 11,675 contigs were larger than 100 bp in size. A total of 481 SSR loci were identified from 234 (out of 11,675) contigs and 246 polymerase chain reaction (PCR) primer pairs were designed. Of 246 primers, 212 (86.2 %) effectively produced amplification from the genomic DNA of chokecherry. All 212 amplifiable chokecherry primers were used to amplify genomic DNA from 11 other rosaceous species (sour cherry, sweet cherry, black cherry, peach, apricot, plum, apple, crabapple, pear, juneberry, and raspberry). Thus, chokecherry SSR primers can be transferable across Prunus species and other rosaceous species. An average of 63.2 and 58.7 % of amplifiable chokecherry primers amplified DNA from cherry and other Prunus species, respectively, while 47.2 % of amplifiable chokecherry primers amplified DNA from other rosaceous species. Using random genome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no sequence information available. Sequence information and confirmed transferability of the identified chokecherry SSRs among species will be valuable for genetic research in Prunus and other rosaceous species. Key message A total of 246 SSR primers were identified from chokecherry genome sequences. Of which, 212 were confirmed amplifiable both in chokecherry and other 11 other rosaceous species.

Managing railcar maintenance : a primer on practices and improvement opportunities for the U.S. transit industry.

DOT National Transportation Integrated Search

2013-09-01

This report surveys the state-of-practice of transit railcar maintenance management and fleet management practices. It emphasizes a lifecycle management approach to fleet management. It also emphasizes the role of performance improvement programs and...

Leadership Abstracts, 2001.

ERIC Educational Resources Information Center

Wilson, Cynthia, Ed.

2001-01-01

This is volume 14 of Leadership Abstracts, a newsletter published by the League for Innovation (California). Issue 1 of February 2001, "Developmental Education: A Policy Primer," discusses developmental programs in the community college. According to the article, community college trustees and presidents would serve their constituents well by…

Selling to NASA

NASA Technical Reports Server (NTRS)

1986-01-01

Prospective contractors are acquainted with the organizational structure of NASA, and the major technical program offices and selected staff offices at the Headquarters level are briefly described. The basic procedures for Federal procurement are covered. A primer is presented on how to market to NASA. While the information is specific to NASA, many of the principles are applicable to other agencies as well. Some of the major programs are introduced which are available to small and disadvantaged businesses. The major research programs and fields of interest at individual NASA centers are summarized.

Use of a Hierarchical Oligonucleotide Primer Extension Approach for Multiplexed Relative Abundance Analysis of Methanogens in Anaerobic Digestion Systems

PubMed Central

Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu

2013-01-01

In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716

Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

PubMed

Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

2015-08-01

Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

PubMed Central

Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

2012-01-01

The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE PAGES

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...

2016-07-15

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Tooth surface treatment strategies for adhesive cementation

PubMed Central

2017-01-01

PURPOSE The aim of this study was to evaluate the effect of tooth surface pre-treatment steps on shear bond strength, which is essential for understanding the adhesive cementation process. MATERIALS AND METHODS Shear bond strengths of different cements with various tooth surface treatments (none, etching, priming, or etching and priming) on enamel and dentin of human teeth were measured using the Swiss shear test design. Three adhesives (Permaflo DC, Panavia F 2.0, and Panavia V5) and one self-adhesive cement (Panavia SA plus) were included in this study. The interface of the cement and the tooth surface with the different pre-treatments was analyzed using SEM. pH values of the cements and primers were measured. RESULTS The highest bond strength values for all cements were achieved with etching and primer on enamel (25.6 ± 5.3 - 32.3 ± 10.4 MPa). On dentin, etching and priming produced the highest bond strength values for all cements (8.6 ± 2.9 - 11.7 ± 3.5 MPa) except for Panavia V5, which achieved significantly higher bond strengths when pre-treated with primer only (15.3 ± 4.1 MPa). Shear bond strength values were correlated with the micro-retentive surface topography of enamel and the tag length on dentin except for Panavia V5, which revealed the highest bond strength with primer application only without etching, resulting in short but sturdy tags. CONCLUSION The highest bond strength can be achieved for Panavia F 2.0, Permaflo DC, and Panavia SA plus when the tooth substrate is previously etched and the respective primer is applied. The new cement Panavia V5 displayed low technique-sensitivity and attained significantly higher adhesion of all tested cements to dentin when only primer was applied. PMID:28435616

Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

PubMed

Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

2016-09-01

Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

PubMed

Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

2015-12-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.

PubMed

Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo

2016-08-30

Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Identification of novel serine proteinase gene transcripts in the midguts of two tropical insect pests, Scirpophaga incertulas (Wk.) and Helicoverpa armigera (Hb.).

PubMed

Mazumdar-Leighton, S; Babu, C R; Bennett, J

2000-01-01

We have used RT PCR and 3'RACE to identify diverse serine proteinase genes expressed in the midguts of the rice yellow stem borer (Scirpophaga incertulas) and Asian corn borer (Helicoverpa armigera). The RT-PCR primers encoded the conserved regions around the active site histidine57 and serine195 of Drosophila melanogaster alpha trypsin, including aspartate189 of the specificity pocket. These primers amplified three transcripts (SiP1-3) from midguts of S. incertulas, and two transcripts (HaP1-2) from midguts of H. armigera. The five RT PCR products were sequenced to permit design of gene-specific forward primers for use with anchored oligo dT primers in 3'RACE. Sequencing of the 3'RACE products indicated that SiP1, SiP2 and HaP1 encoded trypsin-like serine proteinases, while HaP2 encoded a chymotrypsin-like serine proteinases. The SiP3 transcript proved to be an abundant 960 nt mRNA encoding a trypsin-like protein in which the active site serine195 was replaced by aspartate. The possible functions of this unusual protein are discussed.

Identification and authentication of Rosa species through development of species-specific SCAR marker(s).

PubMed

Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M

2014-05-30

Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.

A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts

PubMed Central

Ealba, Erin L.; Schneider, Richard A.

2013-01-01

Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056

The development and mapping of functional markers in Fragaria and their transferability and potential for mapping in other genera.

PubMed

Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R

2007-01-01

We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.

Bridging the Gap: A Manual Primer into Design Computing in the Context of Basic Design Education

ERIC Educational Resources Information Center

Uysal, V. Safak; Topaloglu, Fulden

2017-01-01

Design education is in need of a wider restructuring to accommodate new developments and paradigmatic shifts brought forth by the information age, all of which capitalise a move towards complexity theory, systems science and digital technologies. The intention of this article is to approach one particular aspect of this need: that is, how basic…

A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

PubMed

Bisset, S A; Knight, J S; Bouchet, C L G

2014-02-24

A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

Development of loop-mediated isothermal amplification with Plasmodium falciparum unique genes for molecular diagnosis of human malaria.

PubMed

Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian

2017-07-01

In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a promising tool for diagnosis of P. falciparum infection.

Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

PubMed

Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

2014-01-01

The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

PubMed

Kemp, S J; Maillard, J C; Teale, A J

1993-04-01

A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

Molecular Cloning of Secreted Luciferases from Marine Planktonic Copepods.

PubMed

Takenaka, Yasuhiro; Ikeo, Kazuho; Shigeri, Yasushi

2016-01-01

Secreted luciferases isolated from copepod crustaceans are frequently used for nondisruptive reporter-gene assays, such as the continuous, automated and/or high-throughput monitoring of gene expression in living cells. All known copepod luciferases share highly conserved amino acid residues in two similar, repeated domains in the sequence. The similarity in the domains are ideal nature for designing PCR primers to amplify cDNA fragments of unidentified copepod luciferases from bioluminescent copepod crustaceans. Here, we introduce how to establish a cDNA encoding novel copepod luciferases from a copepod specimen by PCR with degenerated primers.

Outpatient Infection Prevention: A Practical Primer

PubMed Central

Steinkuller, Fozia; Harris, Kristofer; Vigil, Karen J; Ostrosky-Zeichner, Luis

2018-01-01

Abstract As more patients seek care in the outpatient setting, the opportunities for health care–acquired infections and associated outbreaks will increase. Without uptake of core infection prevention and control strategies through formal initiation of infection prevention programs, outbreaks and patient safety issues will surface. This review provides a step-wise approach for implementing an outpatient infection control program, highlighting some of the common pitfalls and high-priority areas. PMID:29740593

Evaluating Active Parental Consent Procedures for School Programming: Addressing the Sensitive Topic of Suicide Prevention.

PubMed

Totura, Christine M Wienke; Kutash, Krista; Labouliere, Christa D; Karver, Marc S

2017-02-01

Suicide is the second leading cause of death for adolescents. Whereas school-based prevention programs are effective, obtaining active consent for youth participation in public health programming concerning sensitive topics is challenging. We explored several active consent procedures for improving participation rates. Five active consent methods (in-person, students taking forms home, mailing, mailing preceded by primers, mailing followed by reminder calls) were compared against passive consent procedures to evaluate recruitment success, as determined by participation (proportion who responded yes) and response (proportion who returned any response) rates. Participation acceptance rates ranged from 38 to 100% depending on consent method implemented. Compared with passive consent, active consent procedures were more variable in response and participation rates. In-person methods provided higher rates than less interpersonal methods, such as mailing or students taking consents home. Mailed primers before or reminder calls after consent forms were mailed increased response but not participation rates. Students taking consents home resulted in the lowest rates. Although passive consent produces the highest student participation, these methods are not always appropriate for programs addressing sensitive topics in schools. In-person active consent procedures may be the best option when prioritizing balance between parental awareness and successful student recruitment. © 2017, American School Health Association.

Natural Resource Damages: A Primer

EPA Pesticide Factsheets

define concepts, terms and discuss topics related to NRD activities such as the authority under which NRD are assessed; definition; role of EPA; designation of Natural Resource Trustees; and conduct of natural resource assessments and restorations.

National Corn Growers Association Clean Water Act and TMDL Program: An Introduction and Basic Desk Reference for Corn Growers

EPA Pesticide Factsheets

The primer from the National Corn Growers Association includes information on the Clean Water Act, TMDLs, a hypothetical TMDL case study and opportunities for the agricultural community's involvement in development and implementation of TMDLs.

Evaluation of formalin-fixed paraffin-embedded tissues from vaccine site-associated sarcomas of cats for polyomavirus DNA and antigen.

PubMed

Kidney, B A; Haines, D M; Ellis, J A; Burnham, M; Jackson, M L

2001-06-01

To determine whether vaccine site-associated sarcomas (VSS) from cats contain polyomavirus antigen or DNA. 50 formalin-fixed paraffin-embedded tissue blocks of VSS from cats. Sections from each tissue block were evaluated for polyomavirus antigen by use of an avidin-biotin-complex immunohistochemical staining method, using rabbit anti-murine polyomavirus polyclonal antiserum as the primary antibody. The DNA was extracted from sections of each tissue block, and a polymerase chain reaction assay was performed, using primers designed to amplify regions of the bovine polyomavirus genome and consensus polyomavirus primers designed to detect unknown polyomaviruses. Polyomavirus antigen and DNA were not detected in any of the VSS. Results suggest that polyomaviruses likely do not have any direct involvement in the pathogenesis of VSS in cats.

Phylogenetic analysis of bacterial and archaeal species in symptomatic and asymptomatic endodontic infections.

PubMed

Vickerman, M M; Brossard, K A; Funk, D B; Jesionowski, A M; Gill, S R

2007-01-01

Phylogenetic analysis of bacterial and archaeal 16S rRNA was used to examine polymicrobial communities within infected root canals of 20 symptomatic and 14 asymptomatic patients. Nucleotide sequences from approximately 750 clones amplified from each patient group with universal bacterial primers were matched to the Ribosomal Database Project II database. Phylotypes from 37 genera representing Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria and Proteobacteria were identified. Results were compared to those obtained with species-specific primers designed to detect Prevotella intermedia, Porphyromonas gingivalis, Porphyromonas endodontalis, Peptostreptococcus micros, Enterococcus sp., Streptococcus sp., Fusobacterium nucleatum, Tannerella forsythensis and Treponema denticola. Since members of the domain Archaea have been implicated in the severity of periodontal disease, and a recent report confirms that archaea are present in endodontic infections, 16S archaeal primers were also used to detect which patients carried these prokaryotes, to determine if their presence correlated with severity of the clinical symptoms. A Methanobrevibacter oralis-like species was detected in one asymptomatic and one symptomatic patient. DNA from root canals of these two patients was further analysed using species-specific primers to determine bacterial cohabitants. Trep. denticola was detected in the asymptomatic but not the symptomatic patient. Conversely, Porph. endodontalis was found in the symptomatic but not the asymptomatic patient. All other species except enterococci were detected with the species-specific primers in both patients. These results confirm the presence of archaea in root canals and provide additional insights into the polymicrobial communities in endodontic infections associated with clinical symptoms.

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

Satellite scheduling considering maximum observation coverage time and minimum orbital transfer fuel cost

NASA Astrophysics Data System (ADS)

Zhu, Kai-Jian; Li, Jun-Feng; Baoyin, He-Xi

2010-01-01

In case of an emergency like the Wenchuan earthquake, it is impossible to observe a given target on earth by immediately launching new satellites. There is an urgent need for efficient satellite scheduling within a limited time period, so we must find a way to reasonably utilize the existing satellites to rapidly image the affected area during a short time period. Generally, the main consideration in orbit design is satellite coverage with the subsatellite nadir point as a standard of reference. Two factors must be taken into consideration simultaneously in orbit design, i.e., the maximum observation coverage time and the minimum orbital transfer fuel cost. The local time of visiting the given observation sites must satisfy the solar radiation requirement. When calculating the operational orbit elements as optimal parameters to be evaluated, we obtain the minimum objective function by comparing the results derived from the primer vector theory with those derived from the Hohmann transfer because the operational orbit for observing the disaster area with impulse maneuvers is considered in this paper. The primer vector theory is utilized to optimize the transfer trajectory with three impulses and the Hohmann transfer is utilized for coplanar and small inclination of non-coplanar cases. Finally, we applied this method in a simulation of the rescue mission at Wenchuan city. The results of optimizing orbit design with a hybrid PSO and DE algorithm show that the primer vector and Hohmann transfer theory proved to be effective methods for multi-object orbit optimization.

A Primer for the Design of Practice Manuals: Four Stages of Development

ERIC Educational Resources Information Center

Galinsky, Maeda J.; Fraser, Mark W.; Day, Steven H.; Richman, Jack M.

2013-01-01

Treatment manuals are increasingly being used to guide interventions with individuals, families, groups, organizations, and communities. However, little is known about best practices in designing manuals. We describe a process that provides for the development of manuals and specifies the means by which manuals can be adapted for practice…

Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food.

PubMed

Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K

2015-09-08

The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.

The largest subunit of RNA polymerase II as a new marker gene to study assemblages of arbuscular mycorrhizal fungi in the field.

PubMed

Stockinger, Herbert; Peyret-Guzzon, Marine; Koegel, Sally; Bouffaud, Marie-Lara; Redecker, Dirk

2014-01-01

Due to the potential of arbuscular mycorrhizal fungi (AMF, Glomeromycota) to improve plant growth and soil quality, the influence of agricultural practice on their diversity continues to be an important research question. Up to now studies of community diversity in AMF have exclusively been based on nuclear ribosomal gene regions, which in AMF show high intra-organism polymorphism, seriously complicating interpretation of these data. We designed specific PCR primers for 454 sequencing of a region of the largest subunit of RNA polymerase II gene, and established a new reference dataset comprising all major AMF lineages. This gene is known to be monomorphic within fungal isolates but shows an excellent barcode gap between species. We designed a primer set to amplify all known lineages of AMF and demonstrated its applicability in combination with high-throughput sequencing in a long-term tillage experiment. The PCR primers showed a specificity of 99.94% for glomeromycotan sequences. We found evidence of significant shifts of the AMF communities caused by soil management and showed that tillage effects on different AMF taxa are clearly more complex than previously thought. The high resolving power of high-throughput sequencing highlights the need for quantitative measurements to efficiently detect these effects.

Species-Specific Detection of Mycosphaerella polygoni-cuspidati as a Biological Control Agent for Fallopia japonica by PCR Assay.

PubMed

Kurose, Daisuke; Furuya, Naruto; Saeki, Tetsuya; Tsuchiya, Kenichi; Tsushima, Seiya; Seier, Marion K

2016-10-01

The ascomycete fungus Mycosphaerella polygoni-cuspidati has been undergoing evaluation as a potential classical biological control agent for the invasive weed Fallopia japonica (Japanese knotweed), which has become troublesome in Europe and North America. In advance of the potential release of a biocontrol agent into a new environment, it is crucial to develop an effective monitoring system to enable the evaluation of agent establishment and dispersal within the target host population, as well as any potential attacks on non-target species. Therefore, a primer pair was designed for direct, rapid, and specific detection of the Japanese knotweed pathogen M. polygoni-cuspidati based on the sequences of the internal transcribed spacer regions including the 5.8S rDNA. A PCR product of approximately 298 bp was obtained only when the DNA extracted from mycelial fragments of M. polygoni-cuspidati was used. The lower limit of detection of the PCR method was 100 fg of genomic DNA. Using the specific primer pair, M. polygoni-cuspidati could be detected from both naturally and artificially infected Japanese knotweed plants. No amplification was observed for other Mycosphaerella spp. or fungal endophytes isolated from F. japonica. The designed primer pair is thus effective for the specific detection of M. polygoni-cuspidati in planta.

Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

PubMed Central

Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.

2015-01-01

The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL. PMID:26371000

MDC-Analyzer: a novel degenerate primer design tool for the construction of intelligent mutagenesis libraries with contiguous sites.

PubMed

Tang, Lixia; Wang, Xiong; Ru, Beibei; Sun, Hengfei; Huang, Jian; Gao, Hui

2014-06-01

Recent computational and bioinformatics advances have enabled the efficient creation of novel biocatalysts by reducing amino acid variability at hot spot regions. To further expand the utility of this strategy, we present here a tool called Multi-site Degenerate Codon Analyzer (MDC-Analyzer) for the automated design of intelligent mutagenesis libraries that can completely cover user-defined randomized sequences, especially when multiple contiguous and/or adjacent sites are targeted. By initially defining an objective function, the possible optimal degenerate PCR primer profiles could be automatically explored using the heuristic approach of Greedy Best-First-Search. Compared to the previously developed DC-Analyzer, MDC-Analyzer allows for the existence of a small amount of undesired sequences as a tradeoff between the number of degenerate primers and the encoded library size while still providing all the benefits of DC-Analyzer with the ability to randomize multiple contiguous sites. MDC-Analyzer was validated using a series of randomly generated mutation schemes and experimental case studies on the evolution of halohydrin dehalogenase, which proved that the MDC methodology is more efficient than other methods and is particularly well-suited to exploring the sequence space of proteins using data-driven protein engineering strategies.

Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

PubMed

Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

2015-07-01

Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes.

PubMed

Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M

2018-02-01

Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.

A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize.

PubMed

Matsuoka, T; Kuribara, H; Akiyama, H; Miura, H; Goda, Y; Kusakabe, Y; Isshiki, K; Toyoda, M; Hino, A

2001-02-01

Seven lines of genetically modified (GM) maize have been authorized in Japan as foods and feeds imported from the USA. We improved a multiplex PCR method described in the previous report in order to distinguish the five lines of GM maize. Genomic DNA was extracted from GM maize with a silica spin column kit, which could reduce experimental time and improve safety in the laboratory and potentially in the environment. We sequenced recombinant DNA (r-DNA) introduced into GM maize, and re-designed new primer pairs to increase the specificity of PCR to distinguish five lines of GM maize by multiplex PCR. A primer pair for the maize intrinsic zein gene (Ze1) was also designed to confirm the presence of amplifiable maize DNA. The lengths of PCR products using these six primer pairs were different. The Ze1 and the r-DNAs from the five lines of GM maize were qualitatively detected in one tube. The specific PCR bands were distinguishable from each other on the basis of the expected length. The r-DNA could be detected from maize samples containing 0.5% of each of the five lines of GM maize. The sensitivity would be acceptable to secure the verification of non-GMO materials and to monitor the reliability of the labeling system.

E-microsatellite markers for Centella asiatica (Gotu Kola) genome: validation and cross-transferability in Apiaceae family for plant omics research and development.

PubMed

Sahu, Jagajjit; Das Talukdar, Anupam; Devi, Kamalakshi; Choudhury, Manabendra Dutta; Barooah, Madhumita; Modi, Mahendra Kumar; Sen, Priyabrata

2015-01-01

Abstract Centella asiatica (Gotu Kola) is a plant that grows in tropical swampy regions of the world and has important medicinal and culinary use. It is often considered as part of Ayurvedic medicine, traditional African medicine, and traditional Chinese medicine. The unavailability of genomics resources is significantly impeding its genetic improvement. To date, no attempt has been made to develop Expressed Sequence Tags (ESTs) derived Simple Sequence Repeat (SSR) markers (eSSRs) from the Centella genome. Hence, the present study aimed to develop eSSRs and their further experimental validation and cross-transferability of these markers in different genera of the Apiaceae family to which Centella belongs. An in-house pipeline was developed for the entire analyses by combining bioinformatics tools and perl scripts. A total of 4443 C. asiatica EST sequences from dbEST were processed, which generated 2617 nonredundant high quality EST sequences consisting 441 contigs and 2176 singletons. Out of 1776.5 kb of examined sequences, 417 (15.9%) ESTs containing 686 SSRs were detected with a density of one SSR per 2.59 kb. The gene ontology study revealed 282 functional domains involved in various processes, components, and functions, out of which 64 ESTs were found to have both SSRs and functional domains. Out of 603 designed EST-SSR primers, 18 pairs of primers were selected for validation based on the optimum parameter value. Reproducible amplification was obtained for six primer pairs in C. asiatica that were further tested for cross-transferability in nine other important genera/species of the Apiaceae family. Cross-transferability of the EST-SSR markers among the species were examined and Centella javanica showed highest transferability (83.3%). The study revealed six highly polymorphic EST-SSR primers with an average PIC value of 0.95. In conclusion, these EST-SSR markers hold a big promise for the genomics analysis of Centella asiatica, to facilitate comparative map-based analyses across other related species within the Apiaceae family, and future marker-assisted breeding programs. To the best of our knowledge, this is the first report of development of EST-SSRs in Centella asiatica by in silico approaches, which offers a veritable potential in further use in plant omics research and development.

Academic Primer Series: Five Key Papers about Study Designs in Medical Education.

PubMed

Gottlieb, Michael; Chan, Teresa M; Fredette, Jenna; Messman, Anne; Robinson, Daniel W; Cooney, Robert; Boysen-Osborn, Megan; Sherbino, Jonathan

2017-06-01

A proper understanding of study design is essential to creating successful studies. This is also important when reading or peer reviewing publications. In this article, we aimed to identify and summarize key papers that would be helpful for faculty members interested in learning more about study design in medical education research. The online discussions of the 2016-2017 Academic Life in Emergency Medicine Faculty Incubator program included a robust and vigorous discussion about education study design, which highlighted a number of papers on that topic. We augmented this list of papers with further suggestions by expert mentors. Via this process, we created a list of 29 papers in total on the topic of medical education study design. After gathering these papers, our authorship group engaged in a modified Delphi approach to build consensus on the papers that were most valuable for the understanding of proper study design in medical education. We selected the top five most highly rated papers on the topic domain of study design as determined by our study group. We subsequently summarized these papers with respect to their relevance to junior faculty members and to faculty developers. This article summarizes five key papers addressing study design in medical education with discussions and applications for junior faculty members and faculty developers. These papers provide a basis upon which junior faculty members might build for developing and analyzing studies.

High degree of genetic diversity among genotypes of the forage grass Brachiaria ruziziensis (Poaceae) detected with ISSR markers.

PubMed

Azevedo, A L S; Costa, P P; Machado, M A; de Paula, C M P; Sobrinho, F S

2011-11-17

The grasses of the genus Brachiaria account for 80% of the cultivated pastures in Brazil. Despite its importance for livestock production, little information is available for breeding purposes. Embrapa has a population of B. ruziziensis from different regions of Brazil, representing most of existing variability. This population was used to initiate an improvement program based on recurrent selection. In order to assist the genetic improvement program, we estimated the molecular variability among 93 genotypes of Embrapa's collection using ISSR (inter-simple sequence repeat) markers. DNA was extracted from the leaves. Twelve ISSR primers generated 89 polymorphic bands in the 93 genotypes. The number of bands identified by each primer ranged from two to 13, with a mean of 7.41. Cluster analysis revealed a clearly distinct group, containing most of the B. ruziziensis genotypes apart from the outgroup genotypes. Genetic similarity coefficients ranged from 0.0 to 0.95, with a mean of 0.50 and analysis of molecular variance indicated higher variation within (73.43%) than among species (26.57%). We conclude that there is a high genetic diversity among these B. ruziziensis genotypes, which could be explored by breeding programs.