Crystallographic observation of nonenzymatic RNA primer extension.

PubMed

Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W

2018-05-31

The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.

ECB deacylase mutants

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Zhao, Huimin; Giver, Lorraine J.

2002-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

1991-02-15

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

Dna Sequencing

DOEpatents

Tabor, Stanley; Richardson, Charles C.

1995-04-25

A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

Technologies in the Whole-Genome Age: MALDI-TOF-Based Genotyping.

PubMed

Vogel, Nicolas; Schiebel, Katrin; Humeny, Andreas

2009-01-01

With the decipherment of the human genome, new questions have moved into the focus of today's research. One key aspect represents the discovery of DNA variations capable to influence gene transcription, RNA splicing, or regulating processes, and their link to pathology. Matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF-MS) is a powerful tool for the qualitative investigation and relative quantification of variations like single nucleotide polymorphisms, DNA methylation, microsatellite instability, or loss of heterozygosity. After its introduction into proteomics, efforts were made to adopt this technique to DNA analysis. Initially intended for peptide/protein analysis, it held several difficulties for application to nucleic acids. Today, MALDI-TOF-MS has reached worldwide acceptance and application in nucleic acid research, with a wide spectrum of methods being available. One of the most versatile approaches relies on primer extension to genotype single alleles, microsatellite repeat lengths or the methylation status of a given cytosine. Optimized methods comprising intelligent primer design and proper nucleotide selection for primer extension enabled multiplexing of reactions, rendering the analysis more economic due to parallel genotyping of several alleles in a single experiment. Laboratories equipped with MALDI-TOF-MS possess a universal technical platform for the analysis of a large variety of different molecules.

Antibacterial Effect and Tensile Bond Strength of Self-etching Adhesive Resins with and without Methacryloyloxydodecylpyridinium Bromide: An in vitro Study.

PubMed

Krishnamurthy, Madhuram; Kumar, V Naveen; Leburu, Ashok; Dhanavel, Chakravarthy; Selvendran, Kasiswamy E; Praveen, Nehrudhas

2018-04-01

Aim: The aim of the present study was to compare the antibacterial activity of a self-etching primer containing antibacterial monomer methacryloyloxydodecylpyridinium bromide (MDPB) (Clearfil protect bond) with a conventional self-etching primer without MDPB (Clearfil SE bond) against Streptococcus mutans and the effect of incorporation of MDPB on the tensile bond strength of the experimental self-etching primer (Clearfil protect bond). Materials and methods: The antibacterial activity of the self-etching primers was assessed using agar disk diffusion method and the diameters of the zones of inhibition were measured and ranked. For tensile bond strength testing, 20 noncarious human molars were selected and randomly divided into two groups comprising 10 teeth in each group. Group I specimens were treated with Clearfil SE bond (without MDPB). Group II specimens were treated with Clearfil protect bond (with MDPB). Composite material was placed incrementally and cured for 40 seconds in all the specimens. Tensile bond strength was estimated using the Instron Universal testing machine at a crosshead speed of 1 mm/min. Results: The addition of MDPB into a self-etching primer exerts potential antibacterial effect against S. mutans. The tensile bond strength of MDPB containing self-etching primer was slightly lower than that of the conventional self-etching Clearfil protect bond primer, but the difference was not statistically significant. Conclusion: Thus, a self-etching primer containing MDPB will be a boon to adhesive dentistry as it has bactericidal property with adequate tensile bond strength. Clinical significance: The concept of prevention of extension in adhesive dentistry would result in micro/nanoleakage due to the presence of residual bacteria in the cavity. Self-etching primers with MDPB would improve the longevity of such restorations by providing adequate antibacterial activity without compromising the bond strength. Keywords: Antibacterial property, Methacryloyloxydodecy-lpyridinium bromide, Self-etching primers, Tensile bond strength.

Labeled Nucleoside Triphosphates with Reversibly Terminating Aminoalkoxyl Groups

PubMed Central

Hutter, Daniel; Kim, Myong-Jung; Karalkar, Nilesh; Leal, Nicole A.; Chen, Fei; Guggenheim, Evan; Visalakshi, Visa; Olejnik, Jerzy; Gordon, Steven; Benner, Steven A.

2013-01-01

Nucleoside triphosphates having a 3′-ONH2 blocking group have been prepared with and without fluorescent tags on their nucleobases. DNA polymerases were identified that accepted these, adding a single nucleotide to the 3′-end of a primer in a template-directed extension reaction that then stops. Nitrite chemistry was developed to cleave the 3′-ONH2 group under mild conditions to allow continued primer extension. Extension-cleavage-extension cycles in solution were demonstrated with untagged nucleotides and mixtures of tagged and untagged nucleotides. Multiple extension-cleavage-extension cycles were demonstrated on an Intelligent Bio-Systems Sequencer, showing the potential of the 3′-ONH2 blocking group in “next generation sequencing”. PMID:21128174

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

PubMed

Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

1997-05-02

Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

PubMed Central

Huang, M M; Arnheim, N; Goodman, M F

1992-01-01

Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

DNA sequencing with pyrophosphatase

DOEpatents

Tabor, S.; Richardson, C.C.

1996-03-12

A kit or solution is disclosed for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule and having a second single-stranded region homologous to the first single-stranded region. The first agent is able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture. The second agent is able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

DNA sequencing with pyrophosphatase

DOEpatents

Tabor, Stanley; Richardson, Charles C.

1996-03-12

A kit or solution for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule having a second single-stranded region homologous to the first single-stranded region, comprising a first agent able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture, and a second agent able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

PubMed Central

Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

2001-01-01

A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

Chemical Fingerprinting of Materials Developed Due to Environmental Issues

NASA Technical Reports Server (NTRS)

Smith, Doris A.; McCool, A. (Technical Monitor)

2000-01-01

Instrumental chemical analysis methods are developed and used to chemically fingerprint new and modified External Tank materials made necessary by changing environmental requirements. Chemical fingerprinting can detect and diagnose variations in material composition. To chemically characterize each material, fingerprint methods are selected from an extensive toolbox based on the material's chemistry and the ability of the specific methods to detect the material's critical ingredients. Fingerprint methods have been developed for a variety of materials including Thermal Protection System foams, adhesives, primers, and composites.

Highly sensitive electrochemical detection of human telomerase activity based on bio-barcode method.

PubMed

Li, Ying; Liu, Bangwei; Li, Xia; Wei, Qingli

2010-07-15

In the present study, an electrochemical method for highly sensitive detection of human telomerase activity was developed based on bio-barcode amplification assay. Telomerase was extracted from HeLa cells, then the extract was mixed with telomerase substrate (TS) primer to perform extension reaction. The extension product was hybridized with the capture DNA immobilized on the Au electrode and then reacted with the signal DNA on Au nanoparticles to form a sandwich hybridization mode. Electrochemical signals were generated by chronocoulometric interrogation of [Ru(NH(3))(6)](3+) that quantitatively binds to the DNA on Au nanoparticles via electrostatic interaction. This method can detect the telomerase activity from as little as 10 cultured cancer cells without the polymerase chain reaction (PCR) amplification of telomerase extension product. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Evaluation of (GTG)5-PCR for identification of Enterococcus spp.

PubMed

Svec, Pavel; Vancanneyt, Marc; Seman, Milan; Snauwaert, Cindy; Lefebvre, Karen; Sedlácek, Ivo; Swings, Jean

2005-06-01

A set of reference strains and a group of previously unidentified enterococci were analysed by rep-PCR with the (GTG)(5) primer to evaluate the discriminatory power and suitability of this method for typing and identification of enterococcal species. A total of 49 strains representing all validly described species were obtained from bacterial collections. For more extensive evaluation of this identification approach 112 well-defined and identified enterococci isolated from bryndza cheese were tested. The (GTG)(5)-PCR fingerprinting assigned all strains into well-differentiated clusters representing individual species. Subsequently, a group including 44 unidentified enterococci isolated from surface waters was analysed to evaluate this method for identification of unknown isolates. Obtained band patterns allowed us to identify all the strains clearly to the species level. This study proved that rep-PCR with (GTG)(5) primer is a reliable and fast method for species identification of enterococci.

Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene.

PubMed

Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee

2007-01-01

Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.

Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

PubMed Central

Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

2015-01-01

The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

Translesion synthesis past equine estrogen-derived 2'-deoxycytidine DNA adducts by human DNA polymerases eta and kappa.

PubMed

Suzuki, Naomi; Yasui, Manabu; Santosh Laxmi, Y R; Ohmori, Haruo; Hanaoka, Fumio; Shibutani, Shinya

2004-09-07

Estrogen replacement therapy (ERT), composed of equilenin, is associated with increased risk of breast, ovarian, and endometrial cancers. Several diastereoisomers of unique dC and dA DNA adducts were derived from 4-hydroxyequilenin (4-OHEN), a metabolite of equilenin, and have been detected in women receiving ERT. To explore the miscoding property of 4-OHEN-dC adduct, site-specifically modified oligodeoxynucleotides (Pk-1, Pk-2, Pk-3, and Pk-4) containing a single diastereoisomer of 4-OHEN-dC were prepared by a postsynthetic method. Among them, major 4-OHEN-dC-modified oligodeoxynucleotides (Pk-3 and Pk-4) were used to prepare the templates for primer extension reactions catalyzed by DNA polymerase (pol) alpha, pol eta, and pol kappa. Primer extension was retarded one base prior to the lesion and opposite the lesion; stronger blockage was observed with pol alpha, while with human pol eta or pol kappa, a fraction of the primers was extended past the lesion. Steady-state kinetic studies showed that both pol kappa and pol eta inserted dCMP and dAMP opposite the 4-OHEN-dC and extended past the lesion. Never or less-frequently, dGMP, the correct base, was inserted opposite the lesion. The relative bypass frequency past the 4-OHEN-dC lesion with pol eta was at least 3 orders of magnitude higher than that for pol kappa, as observed for primer extension reactions. The bypass frequency past the dA.4-OHEN-dC adduct in Pk-4 was 2 orders of magnitude more efficient than that past the adduct in Pk-3. Thus, 4-OHEN-dC is a highly miscoding lesion capable of generating C --> T transitions and C --> G transversions. The miscoding frequency and specificity of 4-OHEN-dC were strikingly influenced by the adduct stereochemistry and DNA polymerase used.

A Review of Methods for Detection of Hepatozoon Infection in Carnivores and Arthropod Vectors.

PubMed

Modrý, David; Beck, Relja; Hrazdilová, Kristýna; Baneth, Gad

2017-01-01

Vector-borne protists of the genus Hepatozoon belong to the apicomplexan suborder Adeleorina. The taxonomy of Hepatozoon is unsettled and different phylogenetic clades probably represent evolutionary units deserving the status of separate genera. Throughout our review, we focus on the monophyletic assemblage of Hepatozoon spp. from carnivores, classified as Hepatozoon sensu stricto that includes important pathogens of domestic and free-ranging canine and feline hosts. We provide an overview of diagnostic methods and approaches from classical detection in biological materials, through serological tests to nucleic acid amplification tests (NAATs). Critical review of used primers for the 18S rDNA is provided, together with information on individual primer pairs. Extension of used NAATs target to cover also mitochondrial genes is suggested as a key step in understanding the diversity and molecular epidemiology of Hepatozoon infections in mammals.

Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

PubMed

Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

2011-01-31

Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

Detection of different South American hantaviruses.

PubMed

Guterres, Alexandro; de Oliveira, Renata Carvalho; Fernandes, Jorlan; Schrago, Carlos Guerra; de Lemos, Elba Regina Sampaio

2015-12-02

Hantaviruses are the etiologic agents of Hemorrhagic Fever with Renal Syndrome (HFRS) in Old World, and Hantavirus Pulmonary Syndrome (HPS)/Hantavirus Cardiopulmonary Syndrome (HCPS), in the New World. Serological methods are the most common approach used for laboratory diagnosis of HCPS, however theses methods do not allow the characterization of viral genotypes. The polymerase chain reaction (PCR) has been extensively used for diagnosis of viral infections, including those caused by hantaviruses, enabling detection of few target sequence copies in the sample. However, most studies proposed methods of PCR with species-specific primers. This study developed a simple and reliable diagnostic system by RT-PCR for different hantavirus detection. Using new primers set, we evaluated human and rodent hantavirus positive samples of various regions from Brazil. Besides, we performed computational analyzes to evaluate the detection of other South American hantaviruses. The diagnostic system by PCR proved to be a sensible and simple assay, allowing amplification of Juquitiba virus, Araraquara virus, Laguna Negra virus, Rio Mamore virus and Jabora virus, beyond of the possibility of the detecting Andes, Anajatuba, Bermejo, Choclo, Cano Delgadito, Lechiguanas, Maciel, Oran, Pergamino and Rio Mearim viruses. The primers sets designed in this study can detect hantaviruses from almost all known genetics lineages in Brazil and from others South America countries and also increases the possibility to detect new hantaviruses. These primers could easily be used both in diagnosis of suspected hantavirus infections in humans and also in studies with animals reservoirs. Copyright © 2015 Elsevier B.V. All rights reserved.

A Primer on Value-Added Models: Towards a Better Understanding of the Quantitative Analysis of Student Achievement

ERIC Educational Resources Information Center

Nakamura, Yugo

2013-01-01

Value-added models (VAMs) have received considerable attention as a tool to transform our public education system. However, as VAMs are studied by researchers from a broad range of academic disciplines who remain divided over the best methods in analyzing the models and stakeholders without the extensive statistical background have been excluded…

PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

PubMed

Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

2017-01-24

The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

Linear elastic fracture mechanics primer

NASA Technical Reports Server (NTRS)

Wilson, Christopher D.

1992-01-01

This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

PubMed

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina

2008-10-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs

PubMed Central

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina

2008-01-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880

Nanotechnology: A Policy Primer

DTIC Science & Technology

2013-06-24

National Science Foundation (NSF), Department of Energy (DOE), National Aeronautics and Space Administration ( NASA ), Department of Commerce (DOC...and Extension Service, Department of Agriculture ( USDA ); (continued...) Nanotechnology: A Policy Primer Congressional Research Service 6 NSET...State; Department of Transportation; Department of the Treasury; EPA; Food and Drug Administration; Forest Service, USDA ; Intelligence Technology

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Multiplex primer extension reaction screening and oxidative challenge of glucose-6-phosphate dehydrogenase mutants in hemizygous and heterozygous subjects.

PubMed

Ko, Chun Hay; Yung, Edmund; Li, Karen; Li, Chung Leung; Ng, Pak Cheung; Fung, Kwok Pui; Wong, Raymond Pui-On; Chui, Kit Man; Gu, Goldie Jia-Shi; Fok, Tai Fai

2006-01-01

The primary objective of our study was to provide a simple and reliable assay for identifying the majority of G6PD genetic variants in the Chinese population. We optimized the multiplex primer extension reaction (MPER) assay for simultaneous screening of 14-point mutations in 98 G6PD-deficient subjects. Our data demonstrated that this method is precise, cost-effective and has successfully identified mutations in 97 out of 98 subjects, including all heterozygous mutants. We also detected a relatively high incidence (12.3%) of c.871G > A, and all of them harbored the silent mutation c.1311C > T. Apart from the screening program, the pharmacogenetic relationship between G6PD level and residual reduced glutathione (GSH) level was studied upon oxidative challenge by alpha-naphthol. The GSH levels were correlated with their status of G6PD deficiency, but no significant difference was observed between individual G6PD-deficient groups. Our data demonstrated the potentials of the MPER assay for characterization of G6PD deficiency and other genetic diseases.

Translesion synthesis past equine estrogen-derived 2'-deoxyadenosine DNA adducts by human DNA polymerases eta and kappa.

PubMed

Yasui, Manabu; Laxmi, Y R Santosh; Ananthoju, Sreenivasa R; Suzuki, Naomi; Kim, Sung Yeon; Shibutani, Shinya

2006-05-16

Hormone replacement therapy (HRT) increases the risk of developing breast, ovarian, and endometrial cancers. Equilin and equilenin are the major components of the widely prescribed drug used for HRT. 4-Hydroxyequilenin (4-OHEN), a major metabolite of equilin and equilenin, promotes 4-OHEN-modified dC, dA, and dG DNA adducts. These DNA adducts were detected in breast tumor and adjacent normal tissues of several patients receiving HRT. We have recently found that the 4-OHEN-dC DNA adduct is a highly miscoding lesion generating C --> T transitions and C --> G transversions. To explore the mutagenic potential of another major 4-OHEN-dA adduct, site-specifically modified oligodeoxynucleotides containing a single diastereoisomer of 4-OHEN-dA (Pk-1, Pk-2, and Pk-3) were prepared by a postsynthetic method and used as DNA templates for primer extension reactions catalyzed by human DNA polymerase (pol) eta and kappa that are highly expressed in the reproductive organs. Primer extension catalyzed by pol eta or pol kappa occurred rapidly on the unmodified template to form fully extended products. With the major 4-OHEN-dA-modified templates (Pk-2 and Pk-3), primer extension was retarded prior to the lesion and opposite the lesion; a fraction of the primers was extended past the lesion. Steady-state kinetic studies with pol eta and pol kappa indicated that dTMP, the correct base, was preferentially incorporated opposite the 4-OHEN-dA lesion. In addition, pol eta and pol kappa bypassed the lesion by incorporating dAMP and dCMP, respectively, opposite the lesion and extended past the lesion. The relative bypass frequency past the 4-OHEN-dA lesion with pol eta was at least 2 orders of magnitude higher than that observed with pol kappa. The bypass frequency past Pk-2 was more efficient than that past Pk-3. Thus, 4-OHEN-dA is a miscoding lesion generating A --> T transversions and A --> G transitions. The miscoding frequency and specificity of 4-OHEN-dA varied depending on the stereoisomer of the 4-OHEN-dA adduct and DNA polymerase used.

Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

PubMed Central

Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

2015-01-01

The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930

Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification.

PubMed

Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun

2015-07-08

We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.

Inaccurate DNA Synthesis in Cell Extracts of Yeast Producing Active Human DNA Polymerase Iota

PubMed Central

Makarova, Alena V.; Grabow, Corinn; Gening, Leonid V.; Tarantul, Vyacheslav Z.; Tahirov, Tahir H.; Bessho, Tadayoshi; Pavlov, Youri I.

2011-01-01

Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn2+ ions, can bypass some DNA lesions and misincorporates “G” opposite template “T” more frequently than incorporates the correct “A.” We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of “G” versus “A” method of Gening, abbreviated as “misGvA”). We provide unambiguous proof of the “misGvA” approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The “misGvA” activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts. PMID:21304950

Unusual isothermal multimerization and amplification by the strand-displacing DNA polymerases with reverse transcription activities.

PubMed

Wang, Guoping; Ding, Xiong; Hu, Jiumei; Wu, Wenshuai; Sun, Jingjing; Mu, Ying

2017-10-24

Existing isothermal nucleic acid amplification (INAA) relying on the strand displacement activity of DNA polymerase usually requires at least two primers. However, in this paper, we report an unusual isothermal multimerization and amplification (UIMA) which only needs one primer and is efficiently initiated by the strand-displacing DNA polymerases with reverse transcription activities. On electrophoresis, the products of UIMA present a cascade-shape band and they are confirmed to be multimeric DNAs with repeated target sequences. In contrast to current methods, UIMA is simple to product multimeric DNA, due to the independent of multiple primers and rolling circle structures. Through assaying the synthesized single-stranded DNA targets, UIMA performs high sensitivity and specificity, as well as the universality. In addition, a plausible mechanism of UIMA is proposed, involving short DNA bending, mismatch extension, and template slippage. UIMA is a good explanation for why nonspecific amplification easily happens in existing INAAs. As the simplest INAA till now, UIMA provides a new insight for deeply understanding INAA and opens a new avenue for thoroughly addressing nonspecific amplification.

A Public Policy Primer: How to Get off the Sidelines and into the Game

ERIC Educational Resources Information Center

Hollister, David C.

2007-01-01

This Primer is intended to help individual citizens and community leaders and organizers (1) better understand the complex nature of decision making in democracy and (2) identify strategies for having a larger voice and impact. This publication is predicated and draws upon the author's 40 years of extensive and hands-on experiences in varied…

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

PubMed

Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

2014-09-01

PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

PubMed Central

Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

2016-01-01

Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

PubMed Central

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-01-01

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

A tool for design of primers for microRNA-specific quantitative RT-qPCR.

PubMed

Busk, Peter K

2014-01-28

MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.

DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less

Clones identification of Sequoia sempervirens (D. Don) Endl. in Chile by using PCR-RAPDs technique.

PubMed

Toral Ibañez, Manuel; Caru, Margarita; Herrera, Miguel A; Gonzalez, Luis; Martin, Luis M; Miranda, Jorge; Navarro-Cerrillo, Rafael M

2009-02-01

A protocol of polymerase chain reaction-random amplified polymorphic DNAs (PCR-RAPDs) was established to analyse the gene diversity and genotype identification for clones of Sequoia sempervirens (D. Don) Endl. in Chile. Ten (out of 34) clones from introduction trial located in Voipir-Villarrica, Chile, were studied. The PCR-RAPDs technique and a modified hexadecyltrimethylammonium bromide (CTAB) protocol were used for genomic DNA extraction. The PCR tests were carried out employing 10-mer random primers. The amplification products were detected by electrophoresis in agarose gels. Forty nine polymorphic bands were obtained with the selected primers (BG04, BF07, BF12, BF13, and BF14) and were ordered according to their molecular size. The genetic similarity between samples was calculated by the Jaccard index and a dendrogram was constructed using a cluster analysis of unweighted pair group method using arithmetic averages (UPGMA). Of the primers tested, 5 (out of 60) RAPD primers were selected for their reproducibility and high polymorphism. A total of 49 polymorphic RAPD bands were detected out of 252 bands. The genetic similarity analysis demonstrates an extensive genetic variability between the tested clones and the dendrogram depicts the genetic relationships among the clones, suggesting a geographic relationship. The results indicate that the RAPD markers permitted the identification of the assayed clones, although they are derived from the same geographic origin.

Clones identification of Sequoia sempervirens (D. Don) Endl. in Chile by using PCR-RAPDs technique*

PubMed Central

Toral Ibañez, Manuel; Caru, Margarita; Herrera, Miguel A.; Gonzalez, Luis; Martin, Luis M.; Miranda, Jorge; Navarro-Cerrillo, Rafael M.

2009-01-01

A protocol of polymerase chain reaction-random amplified polymorphic DNAs (PCR-RAPDs) was established to analyse the gene diversity and genotype identification for clones of Sequoia sempervirens (D. Don) Endl. in Chile. Ten (out of 34) clones from introduction trial located in Voipir-Villarrica, Chile, were studied. The PCR-RAPDs technique and a modified hexadecyltrimethylammonium bromide (CTAB) protocol were used for genomic DNA extraction. The PCR tests were carried out employing 10-mer random primers. The amplification products were detected by electrophoresis in agarose gels. Forty nine polymorphic bands were obtained with the selected primers (BG04, BF07, BF12, BF13, and BF14) and were ordered according to their molecular size. The genetic similarity between samples was calculated by the Jaccard index and a dendrogram was constructed using a cluster analysis of unweighted pair group method using arithmetic averages (UPGMA). Of the primers tested, 5 (out of 60) RAPD primers were selected for their reproducibility and high polymorphism. A total of 49 polymorphic RAPD bands were detected out of 252 bands. The genetic similarity analysis demonstrates an extensive genetic variability between the tested clones and the dendrogram depicts the genetic relationships among the clones, suggesting a geographic relationship. The results indicate that the RAPD markers permitted the identification of the assayed clones, although they are derived from the same geographic origin. PMID:19235269

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

PubMed

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-11-16

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Evaluation of (GTG)5-PCR for rapid identification of Streptococcus mutans.

PubMed

Svec, Pavel; Nováková, Dana; Zácková, Lenka; Kukletová, Martina; Sedlácek, Ivo

2008-11-01

Repetitive sequence-based polymerase chain reaction (PCR) fingerprinting using the (GTG)(5) primer was applied for fast screening of bacterial strains isolated from dental plaque of early childhood caries (ECC)-affected children. A group of 29 Gram-positive bacteria was separated into a homogeneous cluster together with Streptococcus mutans reference strains and constituted an aberrant branch after the numerical analysis of (GTG)(5)-PCR fingerprints. Automated ribotyping with EcoRI restriction enzyme (RiboPrinter microbial characterization system) revealed high genetic heterogeneity among the tested group and proved to be a good tool for strain-typing purposes. Further characterization of the studied strains was achieved by extensive phenotyping and whole-cell protein fingerprinting and confirmed all the strains as S. mutans representatives. Obtained results showed rep-PCR fingerprinting with the (GTG)(5) primer to be a fast and reliable method for identification of S. mutans.

Exploring target-specific primer extension in combination with a bead-based suspension array for multiplexed detection and typing using Streptococcus suis as a model pathogen

PubMed Central

van der Wal, Fimme J.; Achterberg, René P.; van Solt-Smits, Conny; Bergervoet, Jan H. W.; de Weerdt, Marjanne; Wisselink, Henk J.

2017-01-01

We investigated the feasibility of an assay based on target-specific primer extension, combined with a suspension array, for the multiplexed detection and typing of a veterinary pathogen in animal samples, using Streptococcus suis as a model pathogen. A procedure was established for simultaneous detection of 6 S. suis targets in pig tonsil samples (i.e., 4 genes associated with serotype 1, 2, 7, or 9, the generic S. suis glutamate dehydrogenase gene [gdh], and the gene encoding the extracellular protein factor [epf]). The procedure was set up as a combination of protocols: DNA isolation from porcine tonsils, a multiplex PCR, a multiplex target-specific primer extension, and finally a suspension array as the readout. The resulting assay was compared with a panel of conventional PCR assays. The proposed multiplex assay can correctly identify the serotype of isolates and is capable of simultaneous detection of multiple targets in porcine tonsillar samples. The assay is not as sensitive as the current conventional PCR assays, but with the correct sampling strategy, the assay can be useful for screening pig herds to establish which S. suis serotypes are circulating in a pig population. PMID:28980519

Enhanced Reliability and Accuracy for Field Deployable Bioforensic Detection and Discrimination of Xylella fastidiosa subsp. pauca, Causal Agent of Citrus Variegated Chlorosis Using Razor Ex Technology and TaqMan Quantitative PCR

PubMed Central

Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333

Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

PubMed

Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice

PubMed Central

Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain

2013-01-01

Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695

miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

PubMed Central

Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

2018-01-01

MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

Durable Hybrid Coatings Annual Performance Report (2009)

DTIC Science & Technology

2009-10-01

results based on lengths of cracks on different topcoat/primer combinations. Non- topcoated High gloss Low gloss White enamel 0 5 10 15 20 25 30...SR-285, showed extensive cracking and delamination upon cure and, thus, were eliminated from further investigation. Figure 3.15 shows the viscosity...solids polyurethane gloss enamel (AKZO NOBEL 646-58-7925 with AKZO NOBEL X- 501 curing component) and a Mg-rich primer developed at NDSU.16 In this

Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

PubMed

Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

2015-10-01

Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

PubMed

Gonzales, J L; Loza, A; Chacon, E

2006-03-15

There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

Output testing of small-arms primers

NASA Technical Reports Server (NTRS)

Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.

1991-01-01

The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Lee, H.K.; Flanders, D.J.

The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

Optimized mtDNA Control Region Primer Extension Capture Analysis for Forensically Relevant Samples and Highly Compromised mtDNA of Different Age and Origin

PubMed Central

Eduardoff, Mayra; Xavier, Catarina; Strobl, Christina; Casas-Vargas, Andrea; Parson, Walther

2017-01-01

The analysis of mitochondrial DNA (mtDNA) has proven useful in forensic genetics and ancient DNA (aDNA) studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR) is commonly sequenced using established Sanger-type Sequencing (STS) protocols involving fragment sizes down to approximately 150 base pairs (bp). Recent developments include Massively Parallel Sequencing (MPS) of (multiplex) PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC) methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less), and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples), and tested challenging forensic samples (n = 2) as well as compromised solid tissue samples (n = 15) up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS method for final implementation in forensic genetic laboratories. PMID:28934125

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

PubMed

Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

2007-01-01

Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

PubMed Central

Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

2013-01-01

We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

PubMed Central

Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

2003-01-01

A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

Efficient synthesis of supercoiled M13 DNA molecule containing a site specifically placed psoralen adduct and its use as a substrate for DNA replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kodadek, T.; Gamper, H.

The authors report a simple method for the in vitro synthesis of large quantities of site specifically modified DNA. The protocol involves extension of an oligonucleotide primer annealed to M13 single-stranded DNA using part of the T4 DNA polymerase holoenzyme. The resulting nicked double-stranded circles are ligated and supercoiled in the same tube, producing good yields of form I DNA. When the oligonucleotide primer is chemically modified, the resultant product contains a site-specific lesion. In this study, they report the synthesis of an M13 mp19 form I DNA which contains a psoralen monoadduct or cross-link at the KpnI site. Theymore » demonstrate the utility of these modified substrates by assessing the ability of the bacteriophage T4 DNA replication complex to bypass the damage and show that the psoralen monoadduct poses a severe block to the holoenzyme when attached to the template strand.« less

In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

PubMed

Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

2017-01-01

The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

Affiliative stimuli as primers to prosocial predispositions.

PubMed

Souza, Gabriela Guerra Leal; Pereira, Mirtes Garcia; Vila, Jaime; Oliveira, Leticia; Volchan, Eliane

2012-03-01

Affiliative stimuli are pleasant and highly biologically relevant. Affiliative cues are thought to elicit a prosocial predisposition. Here affiliative and neutral pictures were exposed prior to a reaction time task which consisted in responding to a visual target. Half the participants responded with finger-flexion, a movement frequently involved in prosocial activities. The other half responded with finger extension, a less prosocially compatible movement. Results showed that under the exposure to affiliative pictures, as compared to neutral ones, participants who used finger flexion were faster, while those using finger extension were slower. Performance benefits to the task, when flexing the finger, together with performance costs, when extending it, indicate the relevance of movement compatibility to the context. These findings put forward a possible link between affiliative primers and motor preparation to facilitate a repertoire of movements related to prosocial predispositions including finger flexion.

Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

PubMed

Paul, Philip; Apgar, Josh

2005-04-01

Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.

PubMed

Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin

2015-05-15

The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity. Copyright © 2014 Elsevier B.V. All rights reserved.

Gunshot residue particles formed by using ammunitions that have mercury fulminate based primers.

PubMed

Zeichner, A; Levin, N; Dvorachek, M

1992-11-01

Ammunition having mercury fulminate-based primers are commonly manufactured by Eastern Bloc countries and used extensively in the Middle East. Gunshot residue (GSR) particles formed by firing these types of ammunition were examined. It was observed that much lower percentage of mercury-containing GSR particles were found in samples taken from a shooter as compared to the percentage of such particles in samples from cartridge cases. This fact must therefore be taken into account when interpreting case results. A plausible explanation for the results described is proposed.

An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

NASA Technical Reports Server (NTRS)

Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.

1997-01-01

To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

Primer3_masker: integrating masking of template sequence with primer design software.

PubMed

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

MethPrimer: designing primers for methylation PCRs.

PubMed

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Dynamics of Leading-strand Lesion Skipping by the Replisome

PubMed Central

Yeeles, Joseph T.P.; Marians, Kenneth J.

2013-01-01

SUMMARY The E. coli replisome stalls transiently when it encounters a lesion in the leading-strand template, skipping over the damage by reinitiating replication at a new primer synthesized downstream by the primase. We report here that template unwinding and lagging-strand synthesis continue downstream of the lesion at a reduced rate after replisome stalling, that one replisome is capable of skipping multiple lesions, and that the rate limiting steps of replication restart involve the synthesis and activation of the new primer downstream. We also find little support for the concept that polymerase uncoupling, where extensive lagging-strand synthesis proceeds downstream in the absence of leading-strand synthesis, involves physical separation of the leading-strand polymerase from the replisome. Instead, our data indicate that extensive uncoupled replication likely results from a failure of the leading-strand polymerase still associated with the DNA helicase and the lagging-strand polymerase that are proceeding downstream to reinitiate synthesis. PMID:24268579

Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

PubMed

Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

2009-06-15

DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

PubMed

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

ITS1: a DNA barcode better than ITS2 in eukaryotes?

PubMed

Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin

2015-05-01

A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species. © 2014 John Wiley & Sons Ltd.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.

1995-01-01

The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

Enzymatic synthesis of polymers containing nicotinamide mononucleotide

NASA Technical Reports Server (NTRS)

Liu, Rihe

1995-01-01

Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

Enzymatic Synthesis of Polymers Containing Nicotinamide Mononucleotide

NASA Technical Reports Server (NTRS)

Liu, Rihe; Orgel, Leslie E.

1995-01-01

Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

Genetic polymorphisms in the formaldehyde dehydrogenase gene and their biological significance.

PubMed

Just, Walter; Zeller, Jasmin; Riegert, Clarissa; Speit, Günter

2011-11-30

The GSH-dependent formaldehyde dehydrogenase (FDH) is the most important enzyme for the metabolic inactivation of formaldehyde. We studied three polymorphisms of this gene with the intention to elucidate their relevance for inter-individual differences in the protection against the (geno-)toxicity of FA. The first polymorphism (rs11568816) was investigated using real-time PCR and restriction fragment analysis in 150 subjects. However, we did not find the polymorphic sequence in any of the subjects. We studied a second polymorphism (rs17028487), representing a base exchange (c.*114A>G) in exon 9 of the FDH gene. We analyzed 70 subjects with the SNaPshot Primer Extension method and subsequent analysis in a ABI PRISM 3100, but no variant allele was identified. A third polymorphism, rs13832 in exon 9 (c.*493G>T), was studied in a group of 105 subjects by the SNaPshot Primer Extension method. 43 of the subjects were heterozygous for the polymorphism (G/T), 46 homozygous for the T allele, and 16 were homozygous for the G-allele. Real-time RT-PCR measurements of FDH mRNA did not indicate a significant difference in transcript levels between the heterozygous and the homozygous groups. The in vitro comet assay after FA exposure of blood samples obtained from 5 homozygous GG and 3 homozygous TT subjects did not lead to a significant difference between these two groups. Altogether, our study did not identify biologically relevant polymorphisms in transcribed regions of the FDH gene, which may lead to inter-individual differences in the metabolic inactivation of FA. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Effect of surface preparation on service life of top-coats applied to weathered primer paint

Treesearch

R. Sam Williams; Mark Knaebe; Peter Sotos

2008-01-01

Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

Chapter 17. Extension of endogenous primers as a tool to detect micro-RNA targets.

PubMed

Vatolin, Sergei; Weil, Robert J

2008-01-01

Mammalian cells express a large number of small, noncoding RNAs, including micro-RNAs (miRNAs), that can regulate both the level of a target mRNA and the protein produced by the target mRNA. Recognition of miRNA targets is a complicated process, as a single target mRNA may be regulated by several miRNAs. The potential for combinatorial miRNA-mediated regulation of miRNA targets complicates diagnostic and therapeutic applications of miRNAs. Despite significant progress in understanding the biology of miRNAs and advances in computational predictions of miRNA targets, methods that permit direct physical identification of miRNA-mRNA complexes in eukaryotic cells are still required. Several groups have utilized coimmunoprecipitation of RNA associated with a protein(s) that is part of the RNA silencing macromolecular complex. This chapter describes a detailed but straightforward strategy that identifies miRNA targets based on the assumption that small RNAs base paired with a complementary target mRNA can be used as a primer to synthesize cDNA that may be used for cloning, identification, and functional analysis.

Near-Field Microwave Detection of Corrosion Precursor Pitting under Thin Dielectric Coatings in Metallic Substrate

NASA Astrophysics Data System (ADS)

Hughes, D.; Zoughi, R.; Austin, R.; Wood, N.; Engelbart, R.

2003-03-01

Detection of corrosion precursor pitting on metallic surfaces under various coatings and on bare metal is of keen interest in evaluation of aircraft fuselage. Near-field microwave nondestructive testing methods, utilizing open-ended rectangular waveguides and coaxial probes, have been used extensively for detection of surface flaws in metals, both on bare metal and under a dielectric coating. This paper presents the preliminary results of using microwave techniques to detect corrosion precursor pitting under paint and primer, applique and on bare metal. Machined pits of 500 μm diameter were detected using open-ended rectangular waveguides at V-Band under paint and primer and applique, and on bare metal. Using coaxial probes, machined pits with diameters down to 150 μm on bare metal were also detected. Relative pit size and density were shown on a corrosion-pitted sample using open-ended rectangular waveguides at frequencies of 35 GHz to 70 GHz. The use of Boeing's MAUS™ scanning systems provided improved results by alleviating standoff variation and scanning artifact. Typical results of this investigation are also presented.

Modelling mid-course corrections for optimality conditions along interplanetary transfers

NASA Astrophysics Data System (ADS)

Iorfida, Elisabetta; Palmer, Phil; Roberts, Mark

2014-12-01

Within the field of trajectory optimisation, Lawden developed the primer vector theory, which defines a set of necessary conditions to characterise whether a transfer trajectory, in the two-body problem context, is optimum with respect to propellant usage. If the conditions are not satisfied, a region of the transfer trajectory is identified in which one or more potential intermediate impulses are performed in order to lower the overall cost. The method is computationally complex owing to having to solve a boundary value problem. In this paper is presented a new propagator that reduces the mathematical complexity and the computational cost of the problem, in particular it exploits a separation between the in-plane and out-of-plane components of the primer vector along the transfer trajectory. Using this propagator, the optimality of the transfer arc has been investigated, varying the departure and arrival orbits. In particular, keeping fixed the transfer trajectory, the optimality has been extensively analysed varying both the initial and final positions on the orbit, together with the directions of the initial and final thrust impulses.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Sensory reception of the primer pheromone ethyl oleate

NASA Astrophysics Data System (ADS)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

Primer on consumer marketing research : procedures, methods, and tools

DOT National Transportation Integrated Search

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

PubMed Central

2012-01-01

Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. Keywords: single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit PMID:22594601

High-throughput real-time quantitative reverse transcription PCR.

PubMed

Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F

2006-02-01

Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.

Method to amplify variable sequences without imposing primer sequences

DOEpatents

Bradbury, Andrew M.; Zeytun, Ahmet

2006-11-14

The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Identification of forensic samples by using an infrared-based automatic DNA sequencer.

PubMed

Ricci, Ugo; Sani, Ilaria; Klintschar, Michael; Cerri, Nicoletta; De Ferrari, Francesco; Giovannucci Uzielli, Maria Luisa

2003-06-01

We have recently introduced a new protocol for analyzing all core loci of the Federal Bureau of Investigation's (FBI) Combined DNA Index System (CODIS) with an infrared (IR) automatic DNA sequencer (LI-COR 4200). The amplicons were labeled with forward oligonucleotide primers, covalently linked to a new infrared fluorescent molecule (IRDye 800). The alleles were displayed as familiar autoradiogram-like images with real-time detection. This protocol was employed for paternity testing, population studies, and identification of degraded forensic samples. We extensively analyzed some simulated forensic samples and mixed stains (blood, semen, saliva, bones, and fixed archival embedded tissues), comparing the results with donor samples. Sensitivity studies were also performed for the four multiplex systems. Our results show the efficiency, reliability, and accuracy of the IR system for the analysis of forensic samples. We also compared the efficiency of the multiplex protocol with ultraviolet (UV) technology. Paternity tests, undegraded DNA samples, and real forensic samples were analyzed with this approach based on IR technology and with UV-based automatic sequencers in combination with commercially-available kits. The comparability of the results with the widespread UV methods suggests that it is possible to exchange data between laboratories using the same core group of markers but different primer sets and detection methods.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, H.U.G.; Gray, J.W.

1995-06-27

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, Heinz-Ulrich G.; Gray, Joe W.

1995-01-01

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

PubMed

Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2013-01-01

Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

Effect of Co-Solutes on Template-Directed Nonenzymatic Copying of RNA

NASA Astrophysics Data System (ADS)

Bapat, N. V.; Rajamani, S.

2017-07-01

Given the heterogeneous nature of the prebiotic milieu, we report here, the effect of presence of lipid vesicles and Polyethylene Glycol (PEG) as co-solutes on the rate and accuracy of enzyme-free template-directed RNA primer extension reactions.

Nucleocapsid Protein Annealing of a Primer-Template Enhances (+)-Strand DNA Synthesis and Fidelity by HIV-1 Reverse Transcriptase†

PubMed Central

Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.

2012-01-01

Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155

Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification

PubMed Central

Guo, Xu-Guang; Zhou, Shan

2014-01-01

Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360

Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

PubMed

Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

2015-06-01

Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

PubMed

Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

2012-05-17

The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit.

Design of primers and probes for quantitative real-time PCR methods.

PubMed

Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

2015-01-01

Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Identification of a synonymous polymorphism within the cytochrome P4502C9 gene that interferes with identification of the CYP2C9*2 allele.

PubMed

Womack, Edward P; Reynolds, Kristen K; Valdes, Roland; Linder, Mark W

2007-10-01

Cytochrome P450 2C9 (CYP4502C9) genotyping is useful in dosage adjustments for several critical drug therapies, including warfarin. Potential interference compromising these genotyping results could lead to inappropriate dose adjustments that may result in adverse drug reactions. During routine clinical CYP4502C9 genotyping using multiplex allele-specific primer extension, an ambiguous result was obtained for determination of the CYP2C9 430C>T substitution, which defines the CYP2C9*2 allele. In this one patient sample submitted for CYP2C9 genotyping, the ratio for the variant 430T allele signal to the total signal (C+T alleles) was 0.29. This is above the expected ratio to be classified as wild-type (<0.15) and below the minimum expected ratio (>0.3) when the genotype is heterozygous at the 430 position. The mean fluorescence intensity for the 430C allele was consistent with that observed in subjects who are heterozygous at this nucleotide position. However, the corresponding signal for the 430T allele indicated the absence of the CYP2C9*2 allele. This suggests the assay was not able to determine the correct nucleotide at position 430 for one of the two alleles in this patient. Subsequent sequencing to investigate the allele-specific primer extension failure revealed the presence of a rare C>T nucleotide substitution at position 429. We tested this subject's CYP2C9 genotype using AvaII restriction endonuclease digestion and found that this rare substitution causes false-positive identification of the CYP2C9*2 allele when using this method. We developed a DpnII endonuclease digestion assay to specifically detect the CYP2C9 429C>T substitution and tested 100 randomly selected samples obtained from unrelated individuals. The 429C>T polymorphism was not identified in this sample set, which indicates an allele frequency of less than 2.0% (95% confidence interval, 0.0-1.8%) in the general population. Despite the rarity of this polymorphism, it has important implications for the accuracy of assays using allele-specific primers and the Ava II restriction endonuclease, when it occurs, which are two common methods currently applied for detecting the presence of the CYP2C9*2 allele.

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Nucleic acid amplification using modular branched primers

DOEpatents

Ulanovsky, Levy; Raja, Mugasimangalam C.

2001-01-01

Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

A complex structure in the mRNA of Tf1 is recognized and cleaved to generate the primer of reverse transcription.

PubMed

Lin, J H; Levin, H L

1997-01-15

All retroviruses and LTR-containing retrotransposons are thought to require specific tRNA molecules to serve as primers of reverse transcription. An exception is the LTR-containing retrotransposon Tf1, isolated from Schizosaccharomyces pombe. Instead of requiring a tRNA, the reverse transcriptase of Tf1 uses the first 11 bases of the Tf1 transcript as the primer for reverse transcription. The primer is generated by a cleavage that occurs between bases 11 and 12 of the Tf1 mRNA. Sequence analysis of the 5' untranslated region of the Tf1 mRNA resulted in the identification of a region with the potential to form an RNA structure of 89 bases that included the primer binding site and the first 11 bases of the Tf1 mRNA. Systematic mutagenesis of this region revealed 34 single-point mutants in the structure that resulted in reduced transposition activity. The defects in transposition correlated with reduced level of Tf1 reverse transcripts as determined by DNA blot analysis. Evidence that the RNA structure did form in vivo included the result that strains with second site mutations that restored complementarity resulted in increased levels of reverse transcripts and Tf1 transposition. The majority of the mutants defective for reverse transcription were unable to cleave the Tf1 mRNA between bases 11 and 12. These data indicate that formation of an extensive RNA structure was required for the cleavage reaction that generated the primer for Tf1 reverse transcription.

Murrinh Nganki (Our Language), 1.

ERIC Educational Resources Information Center

Street, Chester; And Others

This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

Effects of dual antibacterial agents MDPB and nano-silver in primer on microcosm biofilm, cytotoxicity and dentin bond properties

PubMed Central

Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.

2013-01-01

Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

PubMed

Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

2009-08-01

Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

PubMed Central

2009-01-01

Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

A method for predicting service life of zinc rich primers on carbon steel

NASA Technical Reports Server (NTRS)

Hoppesch, C. W.

1986-01-01

The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

PubMed

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-11-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

PubMed Central

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-01-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F. William

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F.W.

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

swga: a primer design toolkit for selective whole genome amplification.

PubMed

Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

2017-07-15

Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

PubMed Central

2013-01-01

Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

Analytical Approach to the Fuel Optimal Impulsive Transfer Problem Using Primer Vector Method

NASA Astrophysics Data System (ADS)

Fitrianingsih, E.; Armellin, R.

2018-04-01

One of the objectives of mission design is selecting an optimum orbital transfer which often translated as a transfer which requires minimum propellant consumption. In order to assure the selected trajectory meets the requirement, the optimality of transfer should first be analyzed either by directly calculating the ΔV of the candidate trajectories and select the one that gives a minimum value or by evaluating the trajectory according to certain criteria of optimality. The second method is performed by analyzing the profile of the modulus of the thrust direction vector which is known as primer vector. Both methods come with their own advantages and disadvantages. However, it is possible to use the primer vector method to verify if the result from the direct method is truly optimal or if the ΔV can be reduced further by implementing correction maneuver to the reference trajectory. In addition to its capability to evaluate the transfer optimality without the need to calculate the transfer ΔV, primer vector also enables us to identify the time and position to apply correction maneuver in order to optimize a non-optimum transfer. This paper will present the analytical approach to the fuel optimal impulsive transfer using primer vector method. The validity of the method is confirmed by comparing the result to those from the numerical method. The investigation of the optimality of direct transfer is used to give an example of the application of the method. The case under study is the prograde elliptic transfers from Earth to Mars. The study enables us to identify the optimality of all the possible transfers.

Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

PubMed Central

Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

2005-01-01

Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

Single step PCR for detection of allelic variation of MDR1 gene (P-glycoprotein) among three ethnic groups in Malaysia.

PubMed

Teh, L K; Lee, W L; Amir, J; Salleh, M Z; Ismail, R

2007-06-01

P-glycoprotein (PgP) is the most extensively studied ATP-binding cassette (ABC) coded by MDR1 gene. To date, 29 single nucleotide polymorphisms (SNPs) have been identified; but only SNP C3435T has been correlated with intestinal PgP expression levels and shown to influence the absorption of orally taken drugs that are PgP substrates. Individuals homozygous for the T allele have more than fourfold lower PgP expression compared with C/C individuals. We developed a one step primer based allele specific PCR method to detect SNP at C3435T to investigate the distribution of this genotype in the local population. DNA was extracted from 5 mL of whole blood using standard salting-out method. Primers were designed specific to 3' end which amplify the variants of C3435T. The method was validated by direct DNA sequencing. Seven hundred and sixty-three healthy blood donors comprising of three major ethnic groups in Malaysia were recruited and DNA subjected to genotyping of C3435T using this method. The method was found to be robust and reproducible in detecting SNP of C3435T. Interethnic variations in genotype and allele frequency were observed in PgP among the ethnic groups. In comparison to both the Caucasians and the other Asian countries, the Malay and Chinese showed a higher frequency of allele C (50-60%); while the Indian exhibits a lower frequency (40%), similar to other Indian populations. Using a new simple method to investigate the distribution of C3435T, we found that the allele frequency of MDR1 showed variablity between the different ethnic groups within the Malaysian population.

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

PubMed

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

A Primer on An Approach to Planning and Production Control for the Smaller Shipyard

DTIC Science & Technology

1983-12-01

experienced estimators. ● Hours are allocated to individual jobs within a project for larger projects only. Return costs are then reviewed against these... UNIVERSELLES ANALYSIER SYSTEMS 4-17 h. Published Literature There are extensive standard data available quantities of engineered in published form. The

Financial Management for Transit: A Handbook.

ERIC Educational Resources Information Center

Heaselden, Mark; And Others

This handbook is primarily intended to serve as a primer for transit system managers who have not had any formal financial education through college classes, professional development programs, or extensive on-the-job programs. The following topics are covered: financial planning techniques for transit (beginning the financial planning process,…

Short Communication: Analysis of Minor Populations of Human Immunodeficiency Virus by Primer Identification and Insertion-Deletion and Carry Forward Correction Pipelines.

PubMed

Hughes, Paul; Deng, Wenjie; Olson, Scott C; Coombs, Robert W; Chung, Michael H; Frenkel, Lisa M

2016-03-01

Accurate analysis of minor populations of drug-resistant HIV requires analysis of a sufficient number of viral templates. We assessed the effect of experimental conditions on the analysis of HIV pol 454 pyrosequences generated from plasma using (1) the "Insertion-deletion (indel) and Carry Forward Correction" (ICC) pipeline, which clusters sequence reads using a nonsubstitution approach and can correct for indels and carry forward errors, and (2) the "Primer Identification (ID)" method, which facilitates construction of a consensus sequence to correct for sequencing errors and allelic skewing. The Primer ID and ICC methods produced similar estimates of viral diversity, but differed in the number of sequence variants generated. Sequence preparation for ICC was comparably simple, but was limited by an inability to assess the number of templates analyzed and allelic skewing. The more costly Primer ID method corrected for allelic skewing and provided the number of viral templates analyzed, which revealed that amplifiable HIV templates varied across specimens and did not correlate with clinical viral load. This latter observation highlights the value of the Primer ID method, which by determining the number of templates amplified, enables more accurate assessment of minority species in the virus population, which may be relevant to prescribing effective antiretroviral therapy.

Rapid diagnosis of common deletional α-thalassemia in the Chinese population by qPCR based on identical primer homologous fragments.

PubMed

Long, Ju

2016-05-01

In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.

A multiplex primer design algorithm for target amplification of continuous genomic regions.

PubMed

Ozturk, Ahmet Rasit; Can, Tolga

2017-06-19

Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

PubMed

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

PubMed Central

Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.

2014-01-01

New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428

A method for automatically extracting infectious disease-related primers and probes from the literature

PubMed Central

2010-01-01

Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041

Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

PubMed Central

Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

2005-01-01

A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

Genetic diversity analysis of tree peony germplasm using iPBS markers.

PubMed

Duan, Y B; Guo, D L; Guo, L L; Wei, D F; Hou, X G

2015-07-06

We examined the genetic diversity of 10 wild species (populations) and 55 varieties of tree peony using inter-primer binding site (iPBS) markers. From a total of 36 iPBS primers, 16 were selected based on polymorphic amplification. The number of bands amplified by each primer ranged from 9 to 19, with an average of 12.88 bands per primer. The length of bands ranged from 100 to 2000 bp, concentrated at 200 to 1800 bp. Sixteen primers amplified 206 bands in total, of which 173 bands were polymorphic with a polymorphism ratio of 83.98%. Each primer amplified 10.81 polymorphic bands on average. The data were then used to construct a phylogenetic tree using unweighted pair group method with arithmetic mean methods. Clustering analysis showed that the genetic relationships among the varieties were not only related to the genetic background or geographic origin, but also to the flowering phase, flower color, and flower type. Our data also indicated that iPBS markers were useful tools for classifying tree peony germplasms and for tree peony breeding, and the specific bands were helpful for molecular identification of tree peony varieties.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

PubMed

Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

PubMed Central

Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE PAGES

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...

2016-07-15

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

NASA Astrophysics Data System (ADS)

Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

2015-12-01

Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

Factors That Affect Large Subunit Ribosomal DNA Amplicon Sequencing Studies of Fungal Communities: Classification Method, Primer Choice, and Error

PubMed Central

Porter, Teresita M.; Golding, G. Brian

2012-01-01

Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1) a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN); 2) a composition-based method (Ribosomal Database Project naïve Bayesian classifier, NBC); and, 3) a phylogeny-based method (Statistical Assignment Package, SAP). We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50–100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys. PMID:22558215

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-01-01

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

PubMed Central

Raji, S. Hamid; Ghorbanipour, Reza; Majdzade, Fateme

2011-01-01

Background: The aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride-releasing self-etch primer (clearfil protect bond) and compare it with transbond plus self-etch primer and conventional acid etching and priming system. Materials and Methods: Forty-eight extracted human premolars were divided randomly to three groups. In group 1, the teeth were bonded with conventional acid etching and priming method. In group 2, the teeth were bonded with clearfil protect bond self-etch primer, and transbond plus self-etch primer was used to bond the teeth in group 3. The samples were stored in 37°C distilled water and thermocycled. Then, the SBS of the sample was evaluated with Zwick testing machine. Descriptive statistics and the analysis of variances (ANOVA) and Tukey's test and Kruskal-Wallis were used to analyze the data. Results: The results of the ANOVA showed that the mean of group 3 was significantly lower than that of other groups. Most of the sample showed a pattern of failure within the adhesive resin. Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel. PMID:23372605

A tailing genome walking method suitable for genomes with high local GC content.

PubMed

Liu, Taian; Fang, Yongxiang; Yao, Wenjuan; Guan, Qisai; Bai, Gang; Jing, Zhizhong

2013-10-15

The tailing genome walking strategies are simple and efficient. However, they sometimes can be restricted due to the low stringency of homo-oligomeric primers. Here we modified their conventional tailing step by adding polythymidine and polyguanine to the target single-stranded DNA (ssDNA). The tailed ssDNA was then amplified exponentially with a specific primer in the known region and a primer comprising 5' polycytosine and 3' polyadenosine. The successful application of this novel method for identifying integration sites mediated by φC31 integrase in goat genome indicates that the method is more suitable for genomes with high complexity and local GC content. Copyright © 2013 Elsevier Inc. All rights reserved.

Development of a rapid SNP-typing assay to differentiate Bifidobacterium animalis ssp. lactis strains used in probiotic-supplemented dairy products.

PubMed

Lomonaco, Sara; Furumoto, Emily J; Loquasto, Joseph R; Morra, Patrizia; Grassi, Ausilia; Roberts, Robert F

2015-02-01

Identification at the genus, species, and strain levels is desirable when a probiotic microorganism is added to foods. Strains of Bifidobacterium animalis ssp. lactis (BAL) are commonly used worldwide in dairy products supplemented with probiotic strains. However, strain discrimination is difficult because of the high degree of genome identity (99.975%) between different genomes of this subspecies. Typing of monomorphic species can be carried out efficiently by targeting informative single nucleotide polymorphisms (SNP). Findings from a previous study analyzing both reference and commercial strains of BAL identified SNP that could be used to discriminate common strains into 8 groups. This paper describes development of a minisequencing assay based on the primer extension reaction (PER) targeting multiple SNP that can allow strain differentiation of BAL. Based on previous data, 6 informative SNP were selected for further testing, and a multiplex preliminary PCR was optimized to amplify the DNA regions containing the selected SNP. Extension primers (EP) annealing immediately adjacent to the selected SNP were developed and tested in simplex and multiplex PER to evaluate their performance. Twenty-five strains belonging to 9 distinct genomic clusters of B. animalis ssp. lactis were selected and analyzed using the developed minisequencing assay, simultaneously targeting the 6 selected SNP. Fragment analysis was subsequently carried out in duplicate and demonstrated that the assay yielded 8 specific profiles separating the most commonly used commercial strains. This novel multiplex PER approach provides a simple, rapid, flexible SNP-based subtyping method for proper characterization and identification of commercial probiotic strains of BAL from fermented dairy products. To assess the usefulness of this method, DNA was extracted from yogurt manufactured with and without the addition of B. animalis ssp. lactis BB-12. Extracted DNA was then subjected to the minisequencing protocol, resulting in a SNP profile matching the profile for the strain BB-12. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

An Efficient Strategy for Broad-Range Detection of Low Abundance Bacteria without DNA Decontamination of PCR Reagents

PubMed Central

Chang, Shy-Shin; Hsu, Hsung-Ling; Cheng, Ju-Chien; Tseng, Ching-Ping

2011-01-01

Background Bacterial DNA contamination in PCR reagents has been a long standing problem that hampers the adoption of broad-range PCR in clinical and applied microbiology, particularly in detection of low abundance bacteria. Although several DNA decontamination protocols have been reported, they all suffer from compromised PCR efficiency or detection limits. To date, no satisfactory solution has been found. Methodology/Principal Findings We herein describe a method that solves this long standing problem by employing a broad-range primer extension-PCR (PE-PCR) strategy that obviates the need for DNA decontamination. In this method, we first devise a fusion probe having a 3′-end complementary to the template bacterial sequence and a 5′-end non-bacterial tag sequence. We then hybridize the probes to template DNA, carry out primer extension and remove the excess probes using an optimized enzyme mix of Klenow DNA polymerase and exonuclease I. This strategy allows the templates to be distinguished from the PCR reagent contaminants and selectively amplified by PCR. To prove the concept, we spiked the PCR reagents with Staphylococcus aureus genomic DNA and applied PE-PCR to amplify template bacterial DNA. The spiking DNA neither interfered with template DNA amplification nor caused false positive of the reaction. Broad-range PE-PCR amplification of the 16S rRNA gene was also validated and minute quantities of template DNA (10–100 fg) were detectable without false positives. When adapting to real-time and high-resolution melting (HRM) analytical platforms, the unique melting profiles for the PE-PCR product can be used as the molecular fingerprints to further identify individual bacterial species. Conclusions/Significance Broad-range PE-PCR is simple, efficient, and completely obviates the need to decontaminate PCR reagents. When coupling with real-time and HRM analyses, it offers a new avenue for bacterial species identification with a limited source of bacterial DNA, making it suitable for use in clinical and applied microbiology laboratories. PMID:21637859

Two methods for increased specificity and sensitivity in loop-mediated isothermal amplification

USDA-ARS?s Scientific Manuscript database

The technique of loop-mediated isothermal amplification (LAMP) utilizes 4 (or 6) primers targeting 6 (or 8) regions within a fairly small segment of a genome for amplification, with concentration higher than that used in traditional PCR methods. The high concentrations of primers used leads to an in...

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

PubMed Central

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

Effects of antibacterial primers with quaternary ammonium and nano-silver on S. mutans impregnated in human dentin blocks

PubMed Central

Cheng, Lei; Zhang, Ke; Weir, Michael D.; Liu, Huaibing; Zhou, Xuedong; Xu, Hockin H. K.

2013-01-01

Objectives Recent studies developed antibacterial bonding agents and composites containing a quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg). The objectives of this study were to investigate: (1) the effect of antibacterial primers containing QADM and NAg on the inhibition of Streptococcus mutans (S. mutans) impregnated into dentin blocks for the first time, and (2) the effect of QADM or NAg alone or in combination, and the effect of NAg mass fraction, on S. mutans viability in dentin. Methods Scotchbond Multi-Purpose (SBMP) bonding agent was used. QADM and NAg were incorporated into SBMP primer. Six primers were tested: SBMP primer control, control + 10% QADM (mass %), control + 0.05% NAg, control + 10% QADM + 0.05% NAg, control + 0.1% NAg, and control + 10% QADM + 0.1% NAg. S. mutans were impregnated into dentin blocks, then a primer was applied. The viable colony-forming units (CFU) were then measured by harvesting the bacteria in dentin using a sonication method. Results Control + 10% QADM + 0.1% NAg had bacteria inhibition zone 8-fold that of control (p < 0.05). The sonication method successfully harvested bacteria from dentin blocks. Control + 10% QADM + 0.1% NAg inhibited S. mutans in dentin blocks, reducing the viable CFU in dentin by three orders of magnitude, compared to control dentin without primer. Using QADM+NAg was more effective than QADM alone. Higher NAg content increased the potency. Dentin shear bond strength was similar for all groups (p > 0.1). Significance Antibacterial primer with QADM and NAg were shown to inhibit the S. mutans impregnated into dentin blocks for the first time. Bonding agent containing QADM and NAg is promising to eradicate bacteria in tooth cavity and inhibit caries. The QADM and NAg may have applicability to other adhesives, cements, sealants and composites. PMID:23422420

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

RUCS: rapid identification of PCR primers for unique core sequences.

PubMed

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

2017-12-15

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko

Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less

Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

PubMed

Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

2009-01-01

PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

PubMed Central

2014-01-01

Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena

trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPsmore » to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N{sub 2}-dGuo lesion remained in the ring-closed conformation at the active site. The incoming dNTP, either dGTP or dATP, was positioned with Watson-Crick pairing opposite the template 5'-neighbor base, dCyt or dThy, respectively. In contrast, for the 18-mer:14-mer template-primers with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, ring opening of the adduct to the corresponding N{sub 2}-dGuo aldehyde species occurred. This allowed Watson-Crick base pairing at the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair.« less

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

PubMed

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-07-08

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

PubMed

Kokosková, B; Mráz, I; Fousek, J

2010-05-01

Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

Evaluation of a Campylobacter fetus subspecies venerealis real-time quantitative polymerase chain reaction for direct analysis of bovine preputial samples

PubMed Central

Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.

2012-01-01

The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694

Sequetyping: Serotyping Streptococcus pneumoniae by a Single PCR Sequencing Strategy

PubMed Central

Leung, Marcus H.; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Gillespie, Stephen H.

2012-01-01

The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future. PMID:22553238

A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

PubMed

Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

2015-02-01

A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

PubMed

Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

2007-08-31

Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

PubMed

Carter-Harris, Lisa

2016-11-01

Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.

Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

Longitudinal study of a heteroplasmic 3460 Leber hereditary optic neuropathy family by multiplexed primer-extension analysis and nucleotide sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, S.S.; Fahy, E.; Bodis-Wollner, I.

1996-02-01

Nucleotide-sequencing and multiplexed primer-extension assays have been used to quantitate the mutant-allele frequency in 14 maternal relatives, spanning three generations, from a family that is heteroplasmic for the primary Leber hereditary optic neuropathy (LHON) mutation at nucleotide 3460 of the mitochondrial genome. There was excellent agreement between the values that were obtained with the two different methods. The longitudinal study shows that the mutant-allele frequency was constant within individual family members over a sampling period of 3.5 years. Second, although there was an overall increase in the mutant-allele frequency in successive generations, segregation in the direction of the mutant allelemore » was not invariant, and there was one instance in which there was a significant decrease in the frequency from parent to offspring. From these two sets of results, and from previous studies of heteroplasmic LHON families, we conclude that there is no evidence for a marked selective pressure that determines the replication, segregation, or transmission of primary LHON mutations to white blood cells and platelets. Instead, the mtDNA molecules are most likely to replicate and segregate under conditions of random drift at the cellular level. Finally, the pattern of transmission in this maternal lineage is compatible with a developmental bottleneck model in which the number of mitochondrial units of segregation in the female germ line is relatively small in relation to the number of mtDNA molecules within a cell. However, this is not an invariant pattern for humans, and simple models of mitochondrial gene transmission are inappropriate at the present time. 37 refs., 4 figs., 1 tab.« less

Sex determination in the wild: a field application of loop-mediated isothermal amplification successfully determines sex across three raptor species.

PubMed

Centeno-Cuadros, A; Abbasi, I; Nathan, R

2017-03-01

PCR-based methods are the most common technique for sex determination of birds. Although these methods are fast, easy and accurate, they still require special facilities that preclude their application outdoors. Consequently, there is a time lag between sampling and obtaining results that impedes researchers to take decisions in situ and in real time considering individuals' sex. We present an outdoor technique for sex determination of birds based on the amplification of the duplicated sex-chromosome-specific gene Chromo-Helicase-DNA binding protein using a loop-mediated isothermal amplification (LAMP). We tested our method on Griffon Vulture (Gyps fulvus), Egyptian Vulture (Neophron percnopterus) and Black Kite (Milvus migrans) (family Accipitridae). We introduce the first fieldwork procedure for sex determination of animals in the wild, successfully applied to raptor species of three different subfamilies using the same specific LAMP primers. This molecular technique can be deployed directly in sampling areas because it only needs a voltage inverter to adapt a thermo-block to a car lighter and results can be obtained by the unaided eye based on colour change within the reaction tubes. Primers and reagents are prepared in advance to facilitate their storage at room temperature. We provide detailed guidelines how to implement this procedure, which is simpler (no electrophoresis required), cheaper and faster (results in c. 90 min) than PCR-based laboratory methods. Our successful cross-species application across three different raptor subfamilies posits our set of markers as a promising tool for molecular sexing of other raptor families and our field protocol extensible to all bird species. © 2016 John Wiley & Sons Ltd.

Beam shaping for laser initiated optical primers

NASA Astrophysics Data System (ADS)

Lizotte, Todd E.

2008-08-01

Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

A primer on multifactor productivity : description, benefits, and uses

DOT National Transportation Integrated Search

2008-04-01

This primer presents a description of multifactor : productivity (MFP) and its calculation. Productivity : is an important measure of the state of the : economy at various levels: firm, industry, sectoral, : and the macroeconomic. The method describe...

Carborane-linked 2'-deoxyuridine 5'-O-triphosphate as building block for polymerase synthesis of carborane-modified DNA.

PubMed

Balintová, Jana; Simonova, Anna; Białek-Pietras, Magdalena; Olejniczak, Agnieszka; Lesnikowski, Zbigniew J; Hocek, Michal

2017-11-01

5-[(p-Carborane-2-yl)ethynyl]-2'-deoxyuridine 5'-O-triphosphate was synthesized and used as a good substrate in enzymatic construction of carborane-modified DNA or oligonucleotides containing up to 21 carborane moieties in primer extension reactions by DNA polymerases. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications.

PubMed

Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai

2013-11-19

Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA networks, (5) protein-DNA co-assembly structures, and (6) DNA block copolymers including trimers and pentamers. These results affirm that this method can produce a variety of chemical structures and in yields that are tunable. Using PCR-based preparation of DNA-bridged nanostructures, we can program the assembly of the nanoscale blocks through the adjustment of the primer intensity on the assembled units, the number of PCR cycles, or both. The resulting structures are highly complex and diverse and have interesting dynamics and collective properties. Potential applications of these materials include chirooptical materials, probe fabrication, and environmental and biomedical sensors.

Optimal four-impulse rendezvous between coplanar elliptical orbits

NASA Astrophysics Data System (ADS)

Wang, JianXia; Baoyin, HeXi; Li, JunFeng; Sun, FuChun

2011-04-01

Rendezvous in circular or near circular orbits has been investigated in great detail, while rendezvous in arbitrary eccentricity elliptical orbits is not sufficiently explored. Among the various optimization methods proposed for fuel optimal orbital rendezvous, Lawden's primer vector theory is favored by many researchers with its clear physical concept and simplicity in solution. Prussing has applied the primer vector optimization theory to minimum-fuel, multiple-impulse, time-fixed orbital rendezvous in a near circular orbit and achieved great success. Extending Prussing's work, this paper will employ the primer vector theory to study trajectory optimization problems of arbitrary eccentricity elliptical orbit rendezvous. Based on linearized equations of relative motion on elliptical reference orbit (referred to as T-H equations), the primer vector theory is used to deal with time-fixed multiple-impulse optimal rendezvous between two coplanar, coaxial elliptical orbits with arbitrary large eccentricity. A parameter adjustment method is developed for the prime vector to satisfy the Lawden's necessary condition for the optimal solution. Finally, the optimal multiple-impulse rendezvous solution including the time, direction and magnitudes of the impulse is obtained by solving the two-point boundary value problem. The rendezvous error of the linearized equation is also analyzed. The simulation results confirmed the analyzed results that the rendezvous error is small for the small eccentricity case and is large for the higher eccentricity. For better rendezvous accuracy of high eccentricity orbits, a combined method of multiplier penalty function with the simplex search method is used for local optimization. The simplex search method is sensitive to the initial values of optimization variables, but the simulation results show that initial values with the primer vector theory, and the local optimization algorithm can improve the rendezvous accuracy effectively with fast convergence, because the optimal results obtained by the primer vector theory are already very close to the actual optimal solution. If the initial values are taken randomly, it is difficult to converge to the optimal solution.

Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

PubMed

Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

2018-01-01

Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

Digital analysis of the expression levels of multiple colorectal cancer-related genes by multiplexed digital-PCR coupled with hydrogel bead-array.

PubMed

Qi, Zongtai; Ma, Yinjiao; Deng, Lili; Wu, Haiping; Zhou, Guohua; Kajiyama, Tomoharu; Kambara, Hideki

2011-06-07

To digitally analyze expression levels of multiple genes in one reaction, we proposed a method termed as 'MDHB' (Multiplexed Digital-PCR coupled with Hydrogel Bead-array). The template for bead-based emulsion PCR (emPCR) was prepared by reverse transcription using sequence-tagged primers. The beads recovered from emPCR were immobilized with hydrogel to form a single-bead layer on a chip, and then decoded by gene-specific probe hybridization and Cy3-dUTP based primer extension reaction. The specificity of probe hybridization was improved by using electrophoresis to remove mismatched probes on the bead's surface. The number of positive beads reflects the abundance of expressed genes; the expression levels of target genes were normalized to a housekeeping gene and expressed as the number ratio of green beads to red beads. The discrimination limit of MDHB is 0.1% (i.e., one target molecule from 1000 background molecules), and the sensitivity of the method is below 100 cells when using the β-actin gene as the detection target. We have successfully employed MDHB to detect the relative expression levels of four colorectal cancer (CRC)-related genes (c-myc, COX-2, MMP7, and DPEP1) in 8 tissue samples and 9 stool samples from CRC patients, giving the detection rates of 100% and 77%, respectively. The results suggest that MDHB could be a potential tool for early non-invasive diagnosis of CRC.

Surface modification for bonding between amalgam and orthodontic brackets.

PubMed

Wongsamut, Wittawat; Satrawaha, Sirichom; Wayakanon, Kornchanok

2017-01-01

Testing of methods to enhance the shear bond strength (SBS) between orthodontic metal brackets and amalgam by sandblasting and different primers. Three hundred samples of amalgam restorations (KerrAlloy ® ) were prepared in self-cured acrylic blocks, polished, and divided into two groups: nonsandblasted and sandblasted. Each group was divided into five subgroups with different primers used in surface treatment methods, with a control group of bonded brackets on human mandibular incisors. Following the surface treatments, mandibular incisor brackets (Unitek ® ) were bonded on the amalgam with adhesive resin (Transbond XT ® ). The SBS of the samples was tested. The adhesive remnant index (ARI) and failure modes were then determined under a stereo-microscope. Two-way analysis of variance, Chi-square, and Kruskal-Wallis tests were performed to calculate the correlations between and among the SBS and ARI values, the failure modes, and surface roughness results. There were statistically significant differences of SBS among the different adhesive primers and sandblasting methods ( P < 0.05). The sandblasted amalgam with Assure Plus ® showed the highest SBS ( P < 0.001). Samples mainly showed an ARI score = 1 and mix-mode failure. There was a statistically significant difference of surface roughness between nonsandblasted amalgam and sandblasted amalgam ( P < 0.05), but no significant differences among priming agents ( P > 0.05). Using adhesive primers with sandblasting together effectively enhances the SBS between orthodontic metal brackets and amalgam. The two primers with the ingredient methacryloxydecyl dihydrogen phosphate (MDP) monomer, Alloy Primer ® and Assure Plus ® , were the most effective. Including sandblasting in the treatment is essential to achieve the bonding strength required.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

PubMed

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

PubMed Central

2018-01-01

Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

URPD: a specific product primer design tool

PubMed Central

2012-01-01

Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

URPD: a specific product primer design tool.

PubMed

Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

2012-06-19

Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

Modified telomeric repeat amplification protocol: a quantitative radioactive assay for telomerase without using electrophoresis.

PubMed

Szatmari, I; Tókés, S; Dunn, C B; Bardos, T J; Aradi, J

2000-06-15

A polymerase chain reaction (PCR)-based radioactive telomerase assay was developed in our laboratory which is quantitative and does not require electrophoretic evaluation (designated as TP-TRAP; it utilizes two reverse primers). The main steps of the assay include (1) extension of a 20-mer oligonucleotide substrate (MTS) by telomerase, (2) amplification of the telomerase products in the presence of [(3)H]dTTP using the substrate oligonucleotide and two reverse primers (RPC3, 38 mer; RP, 20 mer), (3) isolation of the amplified radioactive dsDNA by precipitation and filtration, (4) determination of the radioactivity of the acid-insoluble DNA. The length of the telomerase products does not increase on amplification. This valuable feature of the assay is achieved by utilization of the two reverse primers and a highly specific PCR protocol. The assay is linear, accurate, and suitable for cell-biological studies where slight quantitative differences in telomerase activity must be detected. The assay is also suitable for screening and characterization of telomerase inhibitors, as shown with a chemically modified oligonucleotide reverse transcriptase inhibitor [(s(4)dU)(35)]. Copyright 2000 Academic Press.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Bond strength of self-etch adhesives after saliva contamination at different application steps.

PubMed

Cobanoglu, N; Unlu, N; Ozer, F F; Blatz, M B

2013-01-01

This study evaluated and compared the effect of saliva contamination and possible decontamination methods on bond strengths of two self-etching adhesive systems (Clearfil SE Bond [CSE], Optibond Solo Plus SE [OSE]). Flat occlusal dentin surfaces were created on 180 extracted human molar teeth. The two bonding systems and corresponding composite resins (Clearfil AP-X, Kerr Point 4) were bonded to the dentin under six surface conditions (n=15/group): group 1 (control): primer/bonding/composite; group 2: saliva/drying/primer/bonding/composite; group 3: primer/saliva/rinsing/drying/primer/bonding/composite; group 4: primer/saliva/rinsing/drying/bonding/composite; group 5: primer/bonding (cured)/saliva/rinsing/drying/primer/bonding/composite; group 6: primer/bonding (cured)/saliva/removing contaminated layer with a bur/rinsing/drying/primer/bonding/composite. Shear bond strength was tested after specimens were stored in distilled water at 37°C for 24 hours. One-way analysis of variance and Tukey post hoc tests were used for statistical analyses. For CSE, groups 2, 3, and 4 and for OSE, groups 6, 2, and 4 showed significantly lower bond strengths than the control group (p<0.05). CSE groups 5 and 6 and OSE groups 3 and 5 revealed bond strengths similar to the control. When saliva contamination occurred after light polymerization of the bonding agent, repeating the bonding procedure recovered the bonding capacity of both self-etch adhesives. However, saliva contamination before or after primer application negatively affected their bond strength.

Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.

PubMed

Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L

2010-01-01

Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

PubMed Central

Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

2016-01-01

Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

Sex identification of four penguin species using locus-specific PCR.

PubMed

Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

2013-01-01

Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

PubMed Central

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Evaluation of the PCR method for identification of Bifidobacterium species.

PubMed

Youn, S Y; Seo, J M; Ji, G E

2008-01-01

Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Event-specific real-time detection and quantification of genetically modified Roundup Ready soybean.

PubMed

Huang, Chia-Chia; Pan, Tzu-Ming

2005-05-18

The event-specific real-time detection and quantification of Roundup Ready soybean (RRS) using an ABI PRISM 7700 sequence detection system with light upon extension (LUX) primer was developed in this study. The event-specific primers were designed, targeting the junction of the RRS 5' integration site and the endogenous gene lectin1. Then, a standard reference plasmid was constructed that carried both of the targeted sequences for quantitative analysis. The detection limit of the LUX real-time PCR system was 0.05 ng of 100% RRS genomic DNA, which was equal to 20.5 copies. The range of quantification was from 0.1 to 100%. The sensitivity and range of quantification successfully met the requirement of the labeling rules in the European Union and Taiwan.

Molecular diagnostic development for begomovirus-betasatellite complexes undergoing diversification: A case study.

PubMed

Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad

2017-09-15

At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.

A Primer for Agent-Based Simulation and Modeling in Transportation Applications

DOT National Transportation Integrated Search

2013-11-01

Agent-based modeling and simulation (ABMS) methods have been applied in a spectrum of research domains. This primer focuses on ABMS in the transportation interdisciplinary domain, describes the basic concepts of ABMS and the recent progress of ABMS i...

Selective 2'-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis.

PubMed

Smola, Matthew J; Rice, Greggory M; Busan, Steven; Siegfried, Nathan A; Weeks, Kevin M

2015-11-01

Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistries exploit small electrophilic reagents that react with 2'-hydroxyl groups to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues by using reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as can be done for simple model RNAs. This protocol describes the experimental steps, implemented over 3 d, that are required to perform SHAPE probing and to construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots and provides useful troubleshooting information. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures and visualize probable and alternative helices, often in under 1 d. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles and entire transcriptomes.

Development of a Multiplex Single Base Extension Assay for Mitochondrial DNA Haplogroup Typing

PubMed Central

Nelson, Tahnee M.; Just, Rebecca S.; Loreille, Odile; Schanfield, Moses S.; Podini, Daniele

2007-01-01

Aim To provide a screening tool to reduce time and sample consumption when attempting mtDNA haplogroup typing. Methods A single base primer extension assay was developed to enable typing, in a single reaction, of twelve mtDNA haplogroup specific polymorphisms. For validation purposes a total of 147 samples were tested including 73 samples successfully haplogroup typed using mtDNA control region (CR) sequence data, 21 samples inconclusively haplogroup typed by CR data, 20 samples previously haplogroup typed using restriction fragment length polymorphism (RFLP) analysis, and 31 samples of known ancestral origin without previous haplogroup typing. Additionally, two highly degraded human bones embalmed and buried in the early 1950s were analyzed using the single nucleotide polymorphisms (SNP) multiplex. Results When the SNP multiplex was used to type the 96 previously CR sequenced specimens, an increase in haplogroup or macrohaplogroup assignment relative to conventional CR sequence analysis was observed. The single base extension assay was also successfully used to assign a haplogroup to decades-old, embalmed skeletal remains dating to World War II. Conclusion The SNP multiplex was successfully used to obtain haplogroup status of highly degraded human bones, and demonstrated the ability to eliminate possible contributors. The SNP multiplex provides a low-cost, high throughput method for typing of mtDNA haplogroups A, B, C, D, E, F, G, H, L1/L2, L3, M, and N that could be useful for screening purposes for human identification efforts and anthropological studies. PMID:17696300

Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

PubMed

Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

2016-09-01

Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

A Descriptive Overview of Japanese Shipbuilding Surface Preparation and Coating Methods

DTIC Science & Technology

1982-09-01

INORGANIC SHOP PRIMER I Materials I Weight BASE PASTE Total Alkyl-silicate Catalyst Alcohol Special organic resin Tinting pigment Anti-sagging agent... Alcohol Zinc powder 32.0 2.0 6.0 0.5 8.0 40.0 100.0 Shop Primer Composition (Courtesy of Chugoku Marine Paints 51 Limited) 4.2.1 Shop Primer...at a pH of 10 is added to minimize the oxydizing reactions which lead to salt formation and adhesion failure. “Galvanite” is the trade name for the

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Detection of small number of Giardia in biological materials prepared from stray dogs.

PubMed

Esmailikia, Leila; Ebrahimzade, Elahe; Shayan, Parviz; Amininia, Narges

2017-12-20

Giardia lamblia is an intestinal protozoa with intermittent and low shedding especially in dogs, and the detection of Giardia is accompanied with problems such as sampling and diagnostic method. The objective of this study was to detection of Giardia in biological materials with low number of parasite using parasitological and molecular methods, and also to determine whether the examined stray dogs harbor known zoonotic genotype of Giardia. For this aim 85 fecal and duodenal samples were studied from which 1 was positive by Trichrome staining of stool, 4 were positive by staining of duodenal samples. The nested PCR analysis with primers derived from 18 SrRNA showed that the specific PCR product could be amplified in 4 stool and 4 duodenal samples. All positive samples in staining analysis were also positive in nested PCR. No amplification could be observed by nested PCR with primers derived from β giardin gene due to the single copy of gene. Interestingly, the extracted DNA from old fixed stained Giardia positive smears could be also amplified with primers derived from 18SrRNA gene. The sequence analysis of nested PCR products showed that they belong to the genotype D. In conclusion, it is to denote that the Trichrome or Giemsa methods were not suitable for the detection of small number of this parasite in stool and the nested PCR with primers derived from 18S rRNA gene can replace the traditional methods successfully. For detection of Giardia in stool, primers derived from β giardin will not be recommended.

Minimum impulse three-body trajectories.

NASA Technical Reports Server (NTRS)

D'Amario, L.; Edelbaum, T. N.

1973-01-01

A rapid and accurate method of calculating optimal impulsive transfers in the restricted problem of three bodies has been developed. The technique combines a multi-conic method of trajectory integration with primer vector theory and an accelerated gradient method of trajectory optimization. A unique feature is that the state transition matrix and the primer vector are found analytical without additional integrations or differentiations. The method has been applied to the determination of optimal two and three impulse transfers between the L2 libration point and circular orbits about both the earth and the moon.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

NASA Technical Reports Server (NTRS)

Mikes, F.

1984-01-01

Silane primers for use as thermal protection on external tanks were subjected to various analytic techniques to determine the most effective testing method for silane lot evaluation. The analytic methods included high performance liquid chromatography, gas chromatography, thermogravimetry (TGA), and fourier transform infrared spectroscopy (FTIR). It is suggested that FTIR be used as the method for silane lot evaluation. Chromatograms, TGA profiles, bar graphs showing IR absorbances, and FTIR spectra are presented.

Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

PubMed

Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

2007-10-01

Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

Technical note: development of a quantitative PCR method for monitoring strain dynamics during yogurt manufacture.

PubMed

Miller, D M; Dudley, E G; Roberts, R F

2012-09-01

Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

In Vitro Lesion Bypass Studies of O(4)-Alkylthymidines with Human DNA Polymerase η.

PubMed

Williams, Nicole L; Wang, Pengcheng; Wu, Jiabin; Wang, Yinsheng

2016-04-18

Environmental exposure and endogenous metabolism can give rise to DNA alkylation. Among alkylated nucleosides, O(4)-alkylthymidine (O(4)-alkyldT) lesions are poorly repaired in mammalian systems and may compromise the efficiency and fidelity of cellular DNA replication. To cope with replication-stalling DNA lesions, cells are equipped with translesion synthesis DNA polymerases that are capable of bypassing various DNA lesions. In this study, we assessed human DNA polymerase η (Pol η)-mediated bypass of various O(4)-alkyldT lesions, with the alkyl group being Me, Et, nPr, iPr, nBu, iBu, (R)-sBu, or (S)-sBu, in template DNA by conducting primer extension and steady-state kinetic assays. Our primer extension assay results revealed that human Pol η, but not human polymerases κ and ι or yeast polymerase ζ, was capable of bypassing all O(4)-alkyldT lesions and extending the primer to generate full-length replication products. Data from steady-state kinetic measurements showed that Pol η preferentially misincorporated dGMP opposite O(4)-alkyldT lesions with a straight-chain alkyl group. The nucleotide misincorporation opposite most lesions with a branched-chain alkyl group was, however, not selective, where dCMP, dGMP, and dTMP were inserted at similar efficiencies opposite O(4)-iPrdT, O(4)-iBudT, and O(4)-(R)-sBudT. These results provide important knowledge about the effects of the length and structure of the alkyl group in O(4)-alkyldT lesions on the fidelity and efficiency of DNA replication mediated by human Pol η.

A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning.

PubMed

Wan, Haisu; Li, Yongwen; Fan, Yu; Meng, Fanrong; Chen, Chen; Zhou, Qinghua

2012-01-15

Site-directed mutagenesis has become routine in molecular biology. However, many mutants can still be very difficult to create. Complicated chimerical mutations, tandem repeats, inverted sequences, GC-rich regions, and/or heavy secondary structures can cause inefficient or incorrect binding of the mutagenic primer to the target sequence and affect the subsequent amplification. In theory, these problems can be avoided by introducing the mutations into the target sequence using mutagenic fragments and so removing the need for primer-template annealing. The cassette mutagenesis uses the mutagenic fragment in its protocol; however, in most cases it needs to perform two rounds of mutagenic primer-based mutagenesis to introduce suitable restriction enzyme sites into templates and is not suitable for routine mutagenesis. Here we describe a highly efficient method in which the template except the region to be mutated is amplified by polymerase chain reaction (PCR) and the type IIs restriction enzyme-digested PCR product is directly ligated with the mutagenic fragment. Our method requires no assistance of mutagenic primers. We have used this method to create various types of difficult-to-make mutants with mutagenic frequencies of nearly 100%. Our protocol has many advantages over the prevalent QuikChange method and is a valuable tool for studies on gene structure and function. Copyright © 2011 Elsevier Inc. All rights reserved.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

PubMed Central

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

PubMed

Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

2012-04-01

Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

PubMed Central

Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

2011-01-01

Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

Real-time PCR method combined with immunomagnetic separation for detecting healthy and heat-injured Salmonella Typhimurium on raw duck wings.

PubMed

Zheng, Qianwang; Mikš-Krajnik, Marta; Yang, Yishan; Xu, Wang; Yuk, Hyun-Gyun

2014-09-01

Conventional culture detection methods are time consuming and labor-intensive. For this reason, an alternative rapid method combining real-time PCR and immunomagnetic separation (IMS) was investigated in this study to detect both healthy and heat-injured Salmonella Typhimurium on raw duck wings. Firstly, the IMS method was optimized by determining the capture efficiency of Dynabeads(®) on Salmonella cells on raw duck wings with different bead incubation (10, 30 and 60 min) and magnetic separation (3, 10 and 30 min) times. Secondly, three Taqman primer sets, Sal, invA and ttr, were evaluated to optimize the real-time PCR protocol by comparing five parameters: inclusivity, exclusivity, PCR efficiency, detection probability and limit of detection (LOD). Thirdly, the optimized real-time PCR, in combination with IMS (PCR-IMS) assay, was compared with a standard ISO and a real-time PCR (PCR) method by analyzing artificially inoculated raw duck wings with healthy and heat-injured Salmonella cells at 10(1) and 10(0) CFU/25 g. Finally, the optimized PCR-IMS assay was validated for Salmonella detection in naturally contaminated raw duck wing samples. Under optimal IMS conditions (30 min bead incubation and 3 min magnetic separation times), approximately 85 and 64% of S. Typhimurium cells were captured by Dynabeads® from pure culture and inoculated raw duck wings, respectively. Although Sal and ttr primers exhibited 100% inclusivity and exclusivity for 16 Salmonella spp. and 36 non-Salmonella strains, the Sal primer showed lower LOD (10(3) CFU/ml) and higher PCR efficiency (94.1%) than the invA and ttr primers. Moreover, for Sal and invA primers, 100% detection probability on raw duck wings suspension was observed at 10(3) and 10(4) CFU/ml with and without IMS, respectively. Thus, the Sal primer was chosen for further experiments. The optimized PCR-IMS method was significantly (P=0.0011) better at detecting healthy Salmonella cells after 7-h enrichment than traditional PCR method. However there was no significant difference between the two methods with longer enrichment time (14 h). The diagnostic accuracy of PCR-IMS was shown to be 98.3% through the validation study. These results indicate that the optimized PCR-IMS method in this study could provide a sensitive, specific and rapid detection method for Salmonella on raw duck wings, enabling 10-h detection. However, a longer enrichment time could be needed for resuscitation and reliable detection of heat-injured cells. Copyright © 2014 Elsevier B.V. All rights reserved.

A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

PubMed

Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

2013-03-11

Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

PubMed

Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

2011-12-01

Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

Use of SCW4 gene primers in PCR methods for the identification of six medically important Aspergillus species.

PubMed

Arancia, Silvia; Sandini, Silvia; De Carolis, Elena; Vella, Antonietta; Sanguinetti, Maurizio; Norelli, Sandro; De Bernardis, Flavia

2016-10-01

Aspergillus species are the cause of invasive mold infections in immunocompromised patients: Aspergillus fumigatus, A. flavus and A. terreus account for most cases of invasive aspergillosis (IA). As certain species are associated with higher mortality and vary in their resistance to antifungal therapy, diagnosis requires increasingly rapid molecular methods that enable sensitive detection and species discrimination. We have developed PCR and Multiplex PCR assays for the detection of six medically important Aspergillus spp. species DNA in bronchoalveolar lavage (BAL) specimens from hematology and intensive care unit (ICU) patients at risk of IA, using different species and genus-specific PCR primers, selected within the SCW4 gene, encoding a cell wall glucanase of A. fumigatus, similar to mannoprotein Mp65 of Candida albicans. The genus-specific PCR primers were able to amplify only Aspergillus DNAs but not that belonging to other fungal genera tested. The species-specific PCR primers allowed differentiation of each Aspergillus species by the amplicon length produced. The methods described in this study are rapid (less than 4 h), reproducible, simple and specific and demonstrate potential application in the clinical laboratory.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Real-time PCR (qPCR) primer design using free online software.

PubMed

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

PubMed

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

PubMed

Vela, J; Vitorica, J; Ruano, D

2001-12-01

We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

Common Methodology Mistakes in Educational Research, Revisited, along with a Primer on Both Effect Sizes and the Bootstrap.

ERIC Educational Resources Information Center

Thompson, Bruce

As an extension of B. Thompson's 1998 invited address to the American Educational Research Association, this paper cites two additional common faux pas in research methodology and explores some research issues for the future. These two errors in methodology are the use of univariate analyses in the presence of multiple outcome variables (with the…

Implementing an Intervention to Assist Certificate IV Students to Transition Successfully to Undergraduate Study within an AAQF Contextualisation: A Case Study

ERIC Educational Resources Information Center

McNaught, Keith

2013-01-01

In response to the poor performance of students in 2007 who had used a Certificate IV to meet minimum entry requirements, The University of Notre Dame Australia, Fremantle campus, developed a specific intervention. A compulsorily-required "primer" course was developed and taught by a staff member with extensive experience in both…

The Human Microbiome and Skin and Soft-Tissue Infections

DTIC Science & Technology

2015-09-23

254   Cell harvesting, RNA extraction, and RT-PCR ...................................................... 257   Primer extension and 5...contribution of the human microbiota to human health is not surprising given that the number of human-associated bacterial cells far exceeds the 37.5 trillion... cells of the human body by a factor of ~10 (27; 266). Additionally, the human 13 Figure 1. Microbiome and disease-related PubMed

[Maturation of Cordyceps sinensis associates with alterations of fungal expressions of multiple Ophiocordyceps sinensis mutants in stroma of Cordyceps sinensis].

PubMed

Gao, Ling; Li, Xiao-hong; Zhao, Jian-qing; Lu, Ji-hong; Zhao, Jia-gang; Zhu, Jia-shi

2012-06-18

To examine maturational changes in expressions of Ophiocordyceps sinensis (O.sinensis) transition and transversion mutation genotypes in Cordyceps sinensis (C.sinensis) stroma. MassARRAY single nucleotide polymorphism (SNP) matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrum genotyping was used, and 8 SNP extension primers were designed based on the scattered, multiple point mutations of known sequences for the O.sinensis mutants within their internal transcribed spacer (ITS) segments. Of the extension primers, 5 (not capable of distinguishing between the 2 AT-biased genotypes) located in rDNA ITS1 and ITS2 regions: 067721-211, 067721-240, 067721-477, 067721-531 and 067721-581. The other 3 extension primers located in 5.8S rDNA region: 067740-324, 067740-328 and 067740-360, to distinguish between the 2 AT-biased genotypes. MS chromatograms at the 8 SNP sites showed dynamic alterations of mutant alleles in C.sinensis stroma. The allele for the AT-biased genotypes at 067721-211 site showed higher peak height than its GC-biased counterpart in the premature C.sinensis stroma, but disappeared with C.sinensis maturation. Chromatograms displayed not only the transition mutation alleles, but also transversion mutants. Some of the transversion mutation alleles displayed higher peak heights than those for GC- and AT-biased alleles, but their peak heights and detection rates tended to be decreased with C.sinensis maturation. When distinguishing between the 2 AT-biases, AB067744 and AB067740 genotype alleles co-existed in the premature C.sinensis stroma. The allele peak height for AB067744 genotype was greatly decreased with C.sinensis maturation, while that for AB067740 genotype increased. Co-existence of at least 5 transition and transversion mutant genotypes of O.sinensis and the dynamic changes in their expressions in C.sinensis stroma along with C.sinensis maturation may be of extreme importance in C.sinensis stroma germination and maturation, enabling C.sinensis to complete its life cycle.

Novel multiplex qualitative detection using universal primer-multiplex-PCR combined with pyrosequencing.

PubMed

Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun

2017-12-15

This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.

Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

PubMed

Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

2010-08-01

To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

USDA-ARS?s Scientific Manuscript database

The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

Integrative Pre-Service Elementary Teacher Training: The Role of Interdisciplinary Collaborative Mathematics

ERIC Educational Resources Information Center

Chiatula, Victoria Oliaku

2015-01-01

This primer summarizes interdisciplinary collaborative mathematics as an integrative approach to train pre-service elementary teachers to teach math utilizing Junior Achievement USA (JA) educational programs within an elementary Math Methods course. The primer provides a JA historical background/program overview, summarizes the interdisciplinary…

DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan.

PubMed

Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro

2016-10-11

Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.

Rapid detection of IHNV by molecular padlock recognition and surface-associated isothermal amplification

NASA Astrophysics Data System (ADS)

McCarthy, Erik L.; Egeler, Teressa J.; Bickerstaff, Lee E.; Pereira da Cunha, Mauricio; Millard, Paul J.

2005-11-01

RNA sequences derived from infectious hematopoeitic necrosis virus (IHNV) could be detected using a combination of surface-associated molecular padlock DNA probes (MPP) and rolling circle amplification (RCA) in microcapillary tubes. DNA oligonucleotides with base sequences identical to RNA obtained from IHNV were recognized by MPP. Circularized MPP were then captured on the inner surface of glass microcapillary tubes by immobilized DNA oligonucleotide primers. Extension of the immobilized primers by isothermal RCA gave rise to DNA concatamers, which were in turn bound by the fluorescent reporter SYBR Green II nucleic acid stain, and measured by microfluorimetry. Surface-associated molecular padlock technology, combined with isothermal RCA, exhibited high selectivity and sensitivity without thermal cycling. This technology is applicable to direct RNA and DNA detection, permitting detection of a variety of viral or bacterial pathogens.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

PubMed

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

Development of a Novel Loop-Mediated Isothermal Amplification (LAMP) Assay for the Detection of Rickettsia spp.

PubMed

Hanaoka, Nozomu; Matsutani, Minenosuke; Satoh, Masaaki; Ogawa, Motohiko; Shirai, Mutsunori; Ando, Shuji

2017-01-24

We developed a novel loop-mediated isothermal amplification (LAMP) method to detect Rickettsia spp., including Rickettsia prowazekii and R. typhi. Species-specific LAMP primers were developed for orthologous genes conserved among Rickettsia spp. The selected modified primers could detect all the Rickettsia spp. tested. The LAMP method was successfully used to detect 100 DNA copies of Rickettsia spp. within approximately 60 min at 63℃. Therefore, this method may be an excellent tool for the early diagnosis of rickettsiosis in a laboratory or in the field.

Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

PubMed

Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

2014-06-03

Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

Anti-NGF Local Therapy for Autonomic Dysreflexia in Spinal Cord Injury

DTIC Science & Technology

2012-10-01

propyl ]-N,N,N trimethylammonium methylsulfate) were made by thin film hydration method and hydrated with nuclease free water with the final lipid...isolation method (Qiagen, Valencia CA). Synthesis of cDNA was performed as described previously (Takimoto et al., 2002). These primers were designed to...probe synthesis . Primers used for the cloning were as follows: Kv4.1 5’-cacagacgagctaactttcag-3′ and 5′-tcacagggaagagatcttgac-3′ (GenBank ID: 116695

PD5: a general purpose library for primer design software.

PubMed

Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

2013-01-01

Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

Effects of self-etching primer on shear bond strength of orthodontic brackets at different debond times.

PubMed

Turk, Tamer; Elekdag-Turk, Selma; Isci, Devrim

2007-01-01

To evaluate the effect of a self-etching primer on shear bond strengths (SBS) at the different debond times of 5, 15, 30, and 60 minutes and 24 hours. Brackets were bonded to human premolars with different etching protocols. In the control group (conventional method [CM]) teeth were etched with 37% phosphoric acid. In the study group, a self-etching primer (SEP; Transbond Plus Self Etching Primer; 3M Unitek, Monrovia, Calif) was applied as recommended by the manufacturer. Brackets were bonded with light-cure adhesive paste (Transbond XT; 3M Unitek) and light-cured for 20 seconds in both groups. The shear bond test was performed at the different debond times of 5, 15, 30 and 60 minutes and 24 hours. Lowest SBS was attained with a debond time of 5 minutes for the CM group (9.51 MPa) and the SEP group (8.97 MPa). Highest SBS was obtained with a debond time of 24 hours for the CM group (16.82 MPa) and the SEP group (19.11 MPa). Statistically significant differences between the two groups were not observed for debond times of 5, 15, 30, or 60 minutes. However, the SBS values obtained at 24 hours were significantly different (P < .001). Adequate SBS was obtained with self-etching primer during the first 60 minutes (5, 15, 30 and 60 minutes) when compared with the conventional method. It is reliable to load the bracket 5 minutes after bonding using self-etching primer (Transbond Plus) with the light-cure adhesive (Transbond XT).

Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

USDA-ARS?s Scientific Manuscript database

Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

Primer vector theory and applications

NASA Technical Reports Server (NTRS)

Jezewski, D. J.

1975-01-01

A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

Investigation of Seminal Plasma Hypersensitivity Reactions (AIBS GWI 0046)

DTIC Science & Technology

1999-10-01

Kit (Cat. No. 29304). The sequences for the 20-mer PCR primers for the urease gene off/, urealyticum (termed UU1 and UU2) and PCR methods were adapted...Ureaplasma urealyticum urease primer was unsuccessful. We therefore sent DNA samples of GW and control civilian couples to an outside laboratory to

Apparatus For Tests Of Percussion Primers

NASA Technical Reports Server (NTRS)

Bement, Laurence J.; Bailey, James W.; Schimmel, Morry L.

1991-01-01

Test apparatus and method developed to measure ignition capability of percussion primers. Closely simulates actual conditions and interfaces encountered in such applications as in munitions and rocket motors. Ignitability-testing apparatus is small bomb instrumented with pressure transducers. Sizes, shapes, and positions of bomb components and materials under test selected to obtain quantitative data on ignition.

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing1

PubMed Central

Li, Yong; Zhang, Weirui

2015-01-01

Premise of the study: Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Methods and Results: Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. Conclusions: This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding. PMID:26504683

Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

PubMed

Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

2011-09-01

Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

PubMed

Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

2014-11-01

To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

PubMed

Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

2017-12-02

DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

PubMed

Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

2015-01-01

Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

A Novel Real-Time PCR Assay of microRNAs Using S-Poly(T), a Specific Oligo(dT) Reverse Transcription Primer with Excellent Sensitivity and Specificity

PubMed Central

Kang, Kang; Zhang, Xiaoying; Liu, Hongtao; Wang, Zhiwei; Zhong, Jiasheng; Huang, Zhenting; Peng, Xiao; Zeng, Yan; Wang, Yuna; Yang, Yi; Luo, Jun; Gou, Deming

2012-01-01

Background MicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases. Methodology/Principal Findings A novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518. Conclusions/Significance With excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers. PMID:23152780

Evaluation of DNA extraction methods and their clinical application for direct detection of causative bacteria in continuous ambulatory peritoneal dialysis culture fluids from patients with peritonitis by using broad-range PCR.

PubMed

Kim, Si Hyun; Jeong, Haeng Soon; Kim, Yeong Hoon; Song, Sae Am; Lee, Ja Young; Oh, Seung Hwan; Kim, Hye Ran; Lee, Jeong Nyeo; Kho, Weon-Gyu; Shin, Jeong Hwan

2012-03-01

The aims of this study were to compare several DNA extraction methods and 16S rDNA primers and to evaluate the clinical utility of broad-range PCR in continuous ambulatory peritoneal dialysis (CAPD) culture fluids. Six type strains were used as model organisms in dilutions from 10(8) to 10(0) colony-forming units (CFU)/mL for the evaluation of 5 DNA extraction methods and 5 PCR primer pairs. Broad-range PCR was applied to 100 CAPD culture fluids, and the results were compared with conventional culture results. There were some differences between the various DNA extraction methods and primer sets with regard to the detection limits. The InstaGene Matrix (Bio-Rad Laboratories, USA) and Exgene Clinic SV kits (GeneAll Biotechnology Co. Ltd, Korea) seem to have higher sensitivities than the others. The results of broad-range PCR were concordant with the results from culture in 97% of all cases (97/100). Two culture-positive cases that were broad-range PCR-negative were identified as Candida albicans, and 1 PCR-positive but culture-negative sample was identified as Bacillus circulans by sequencing. Two samples among 54 broad-range PCR-positive products could not be sequenced. There were differences in the analytical sensitivity of various DNA extraction methods and primers for broad-range PCR. The broad-range PCR assay can be used to detect bacterial pathogens in CAPD culture fluid as a supplement to culture methods.

Single nucleotide primer extension (SNuPE) analysis of the G6PD gene in somatic cells and oocytes of a kangaroo (Macropus robustus).

PubMed

Watson, D; Jacombs, A S; Loebel, D A; Robinson, E S; Johnston, P G

2000-06-01

cDNA sequence analysis of the X-linked glucose-6-phosphate dehydrogenase (G6PD) gene has shown a base difference between two subspecies of the kangaroo, Macropus robustus robustus (wallaroo) and M. r. erubescens (euro). A thymine residue in the wallaroo at position 358 in exon 5 has been replaced by a cytosine residue in the euro, which accounts for the previously reported electrophoretic difference between the two subspecies. This base difference allowed use of the Single Nucleotide Primer Extension (SNuPE) technique to study allele-specific expression of G6PD at the transcriptional level. We began by examining G6PD expression in somatic cells and observed complete paternal X inactivation in all somatic tissues of adult female heterozygotes, whereas we found partial paternal allele activity in cultured fibroblasts, thus confirming previous allozyme electrophoresis studies. In late dictyate oocytes from an adult heterozygote, the assay also detected expression of both the maternal and paternal alleles at the G6PD locus, with the maternal allele showing preferential expression. Thus reactivation of the inactive paternally derived X chromosome occurs during oogenesis in M. robustus, although the exact timing of reactivation remains to be determined.

A high-throughput approach to profile RNA structure.

PubMed

Delli Ponti, Riccardo; Marti, Stefanie; Armaos, Alexandros; Tartaglia, Gian Gaetano

2017-03-17

Here we introduce the Computational Recognition of Secondary Structure (CROSS) method to calculate the structural profile of an RNA sequence (single- or double-stranded state) at single-nucleotide resolution and without sequence length restrictions. We trained CROSS using data from high-throughput experiments such as Selective 2΄-Hydroxyl Acylation analyzed by Primer Extension (SHAPE; Mouse and HIV transcriptomes) and Parallel Analysis of RNA Structure (PARS; Human and Yeast transcriptomes) as well as high-quality NMR/X-ray structures (PDB database). The algorithm uses primary structure information alone to predict experimental structural profiles with >80% accuracy, showing high performances on large RNAs such as Xist (17 900 nucleotides; Area Under the ROC Curve AUC of 0.75 on dimethyl sulfate (DMS) experiments). We integrated CROSS in thermodynamics-based methods to predict secondary structure and observed an increase in their predictive power by up to 30%. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Quantitative Understanding of SHAPE Mechanism from RNA Structure and Dynamics Analysis.

PubMed

Hurst, Travis; Xu, Xiaojun; Zhao, Peinan; Chen, Shi-Jie

2018-05-10

The selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) method probes RNA local structural and dynamic information at single nucleotide resolution. To gain quantitative insights into the relationship between nucleotide flexibility, RNA 3D structure, and SHAPE reactivity, we develop a 3D Structure-SHAPE Relationship model (3DSSR) to rebuild SHAPE profiles from 3D structures. The model starts from RNA structures and combines nucleotide interaction strength and conformational propensity, ligand (SHAPE reagent) accessibility, and base-pairing pattern through a composite function to quantify the correlation between SHAPE reactivity and nucleotide conformational stability. The 3DSSR model shows the relationship between SHAPE reactivity and RNA structure and energetics. Comparisons between the 3DSSR-predicted SHAPE profile and the experimental SHAPE data show correlation, suggesting that the extracted analytical function may have captured the key factors that determine the SHAPE reactivity profile. Furthermore, the theory offers an effective method to sieve RNA 3D models and exclude models that are incompatible with experimental SHAPE data.

Detection and identification of genetically modified EE-1 brinjal (Solanum melongena) by single, multiplex and SYBR® real-time PCR.

PubMed

Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R

2013-01-01

Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.

Comparative study of diagnostic accuracy of established PCR assays and in-house developed sdaA PCR method for detection of Mycobacterium tuberculosis in symptomatic patients with pulmonary tuberculosis.

PubMed

Nimesh, Manoj; Joon, Deepali; Pathak, Anil Kumar; Saluja, Daman

2013-11-01

Indian contribution to global burden of tuberculosis is about 26%. In the present study we have developed an in-house PCR assay using primers for sdaA gene of Mycobacterium tuberculosis and evaluated against already established primers devR, IS6110, MPB64, rpoB primers for diagnosis of pulmonary tuberculosis. Using universal sample preparation (USP) method, DNA was extracted from sputum specimens of 412 symptomatic patients from Delhi, India. The DNA so extracted was used as template for PCR amplification using primers targeting sdaA, devR, IS6110, MPB64 and rpoB genes. Out of 412, 149 specimens were considered positive based on composite reference standard (CRS) criteria. The in-house designed sdaA PCR showed high specificity (96.5%), the high positive likelihood ratio (28), the high sensitivity (95.9%), and the very low negative likelihood ratio (0.04) in comparison to CRS. Based on our results, the sdaA PCR assay can be considered as one of the most reliable diagnostic tests in comparison to other PCR based detection methods. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

The use of (GTG)5 oligonucleotide as an RAPD primer to type Campylobacter concisus.

PubMed

Matsheka, M I; Lastovica, A J; Zappe, H; Elisha, B G

2006-06-01

DNA fingerprinting using (GTG)(5) oligonucleotide as a primer in a random amplified polymorphic DNA (RAPD) assay was assessed by typing isolates of Campylobacter concisus strains, collected over a period of 8 years. RAPD analysis using the (GTG)(5) oligonucleotide as a primer was used to type 100 isolates of C. concisus comprising mostly isolates from children with diarrhoea. Using this method, 86% of the isolates were found to be genotypically diverse. Of these heterogeneous isolates, 25 of the strains were also shown to be genetically distinct in a previous study using pulsed field gel electrophoresis. The remaining isolates (14) could be classified into five profile groups based on the DNA fingerprinting patterns. The assay successfully identified epidemiologically linked strains from the unrelated genetically diverse pool of strains. Laboratory RADP typing using the (GTG)(5) primer proved to be useful in distinguishing related strains of C. concisus from a large pool of unrelated strains of this organism. RAPD typing using (GTG)(5) is a simple method that could be used to investigate the epidemiology of C. concisus. The results suggest that homologous lineages of C. concisus may exist within an otherwise heterogeneous species complex. However, these data need to be confirmed using a more robust typing method.

Application of RAPD for molecular characterization of plant species of medicinal value from an arid environment.

PubMed

Arif, I A; Bakir, M A; Khan, H A; Al Farhan, A H; Al Homaidan, A A; Bahkali, A H; Al Sadoon, M; Shobrak, M

2010-11-09

The use of highly discriminatory methods for the identification and characterization of genotypes is essential for plant protection and appropriate use. We utilized the RAPD method for the genetic fingerprinting of 11 plant species of desert origin (seven with known medicinal value). Andrachne telephioides, Zilla spinosa, Caylusea hexagyna, Achillea fragrantissima, Lycium shawii, Moricandia sinaica, Rumex vesicarius, Bassia eriophora, Zygophyllum propinquum subsp migahidii, Withania somnifera, and Sonchus oleraceus were collected from various areas of Saudi Arabia. The five primers used were able to amplify the DNA from all the plant species. The amplified products of the RAPD profiles ranged from 307 to 1772 bp. A total of 164 bands were observed for 11 plant species, using five primers. The number of well-defined and major bands for a single plant species for a single primer ranged from 1 to 10. The highest pair-wise similarities (0.32) were observed between A. fragrantissima and L. shawii, when five primers were combined. The lowest similarities (0) were observed between A. telephioides and Z. spinosa; Z. spinosa and B. eriophora; B. eriophora and Z. propinquum. In conclusion, the RAPD method successfully discriminates among all the plant species, therefore providing an easy and rapid tool for identification, conservation and sustainable use of these plants.

Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

PubMed

Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

2002-12-01

The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

PubMed

van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

2008-09-01

To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

PubMed Central

Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander

2012-01-01

The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

PubMed Central

Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

2005-01-01

Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE PAGES

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

2015-12-09

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

Detection of high-risk mucosal human papillomavirus DNA in human specimens by a novel and sensitive multiplex PCR method combined with DNA microarray.

PubMed

Gheit, Tarik; Tommasino, Massimo

2011-01-01

Epidemiological and functional studies have clearly demonstrated that certain types of human papillomavirus (HPV) from the genus alpha of the HPV phylogenetic tree, referred to as high-risk (HR) types, are the etiological cause of cervical cancer. Several methods for HPV detection and typing have been developed, and their importance in clinical and epidemiological studies has been well demonstrated. However, comparative studies have shown that several assays have different sensitivities for the detection of specific HPV types, particularly in the case of multiple infections. In this chapter, we describe a novel one-shot method for the detection and typing of 19 mucosal HR HPV types (types 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73, and 82). The assay combines the advantages of the multiplex PCR methods, i.e., high sensitivity and the possibility to perform multiple amplifications in a single reaction, with an array primer extension (APEX) assay. The latter method offers the benefits of Sanger dideoxy sequencing with the high-throughput potential of the microarray. Initial studies have revealed that the assay is very sensitive in detecting multiple HPV infections.

Genetic variability of prostaglandin E2 receptor subtype EP4 gene in aspirin-intolerant chronic urticaria.

PubMed

Palikhe, Nami Shrestha; Sin, Hye Jung; Kim, Seung Hyun; Sin, Hyun Jung; Hwang, Eui Kyung; Ye, Young Min; Park, Hae-Sim

2012-08-01

Prostaglandin E2 receptor subtype EP4 (PTGER4) is one of the four subtypes of receptors for prostaglandin E2 (PGE2). Overproduction of cysteinyl leukotriene in mast cells may be related with suppression of PGE2 in patients with aspirin hypersensitivity. Considering the association of PTGER4 in mast cells, urticaria- and aspirin-related disease, we hypothesized the genetic variability of PTGER4 may be associated with aspirin-intolerant chronic urticaria (AICU). The case-control study was performed in 141 with AICU, 153 with aspirin-tolerant chronic urticaria (ATCU) and 174 with normal controls (NCs). PTGER4 promoter single-nucleotide polymorphism was genotyped using a primer extension method with the SNAPshot ddNTP primer extension kit. The functional variability of PTGER4 promoter polymorphism was carried out by dual-luciferase system and electrophoretic mobility shift assay (EMSA) in human mast cells (HMC-1). Furthermore, the effect of aspirin was performed for PTGER4 mRNA expression using real-time PCR, and PGE2 production was checked in HMC-1 cells using ELISA. AICU patients carrying GG genotype at -1254 G>A showed significantly higher frequency compared with NC (P=0.032). Similarly, the minor allele frequency, G allele was significantly higher in AICU compared with NC (P=0.031). In vitro functional study demonstrated that the -1254 G allele had lower luciferase activity (P<0.001) in HMC-1 cells. EMSA finding showed that PTGER4 -1254 G produced a specific band. Significantly decreased PTGER4 expression (P=0.008) and PGE2 production by aspirin exposure was confirmed in in vitro HMC cell line model (P=0.001). The PTGER4 -1254 G allele demonstrated a higher frequency in AICU patients and lower promoter activity with decreased expression of PTGER4 and contributes to the development of AICU.

Authentication of meat from game and domestic species by SNaPshot minisequencing analysis.

PubMed

La Neve, Fabio; Civera, Tiziana; Mucci, Nadia; Bottero, Maria Teresa

2008-10-01

The aim of the present study is to develop an assay for the specific identification of meat from Capreolus capreolus, Cervus elaphus, Capra ibex, Rupicapra rupicapra, targeting sequences of the cytochrome b (cyt b) gene of mitochondrial DNA. The assay is also intended to enable differentiation between meat from these wild species as well as Ovis aries, Capra hircus, Bubalus bubalis, Bos taurus and Sus scrofa domestic species. The primers used in the preliminary PCR were designed in well conserved regions upstream and downstream of the diagnosis sites. They successfully amplified a conserved 232bp region from the cyt b gene of all the species taken into consideration. The sites of diagnosis have been interrogated using a minisequencing reaction and capillary electrophoresis. All the results of the multiplex PER (primer extension reaction) test were confirmed by fragment sequencing. The assay offers the possibility of discriminating nine species at the same time.

Coordinated DNA dynamics during the human telomerase catalytic cycle

NASA Astrophysics Data System (ADS)

Parks, Joseph W.; Stone, Michael D.

2014-06-01

The human telomerase reverse transcriptase (hTERT) utilizes a template within the integral RNA subunit (hTR) to direct extension of telomeres. Telomerase exhibits repeat addition processivity (RAP) and must therefore translocate the nascent DNA product into a new RNA:DNA hybrid register to prime each round of telomere repeat synthesis. Here, we use single-molecule FRET and nuclease protection assays to monitor telomere DNA structure and dynamics during the telomerase catalytic cycle. DNA translocation during RAP proceeds through a previously uncharacterized kinetic substep during which the 3‧-end of the DNA substrate base pairs downstream within the hTR template. The rate constant for DNA primer realignment reveals this step is not rate limiting for RAP, suggesting a second slow conformational change repositions the RNA:DNA hybrid into the telomerase active site and drives the extrusion of the 5‧-end of the DNA primer out of the enzyme complex.

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

PubMed

Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

2015-03-20

USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

Molecular diagnostic for boll weevil (Coleoptera: Curculionidae) based on amplification of three species-specific microsatellites.

PubMed

Kim, Kyung Seok; Szendrei, Zsofia; Rodriguez-Saona, Cesar; Mulder, Phillip G; Sappington, Thomas W

2009-04-01

The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton, Gossypium hirsutum L., in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally the traps collect nontarget weevils that can be misidentified by scouts. For example, the congeneric pepper weevil, Anthonomus eugenii Cano, and other superficially similar weevils are attracted to components of the boll weevil lure or trap color. Although morphologically distinguishable by trained personnel, the potential for misidentification is compounded when captured weevils are dismembered or partially consumed by ants or ground beetles that sometimes feed on them in the traps. Because misidentification can have expensive consequences, a molecular diagnostic tool would be of great value to eradication managers. We demonstrate that a cocktail of three primer pairs in a single polymerase chain reaction (PCR) amplify species-specific microsatellites that unambiguously distinguish the boll weevil from three other weevil species tested, including pepper weevil; cranberry weevil, Anthonomus eugenii musculus Say; and pecan weevil, Curculio caryae Horn. However, it does not distinguish the boll weevil from the subspecific "thurberia" weevil. A universal internal transcribed spacer primer pair included in the cocktail cross-amplifies DNA from all species, serving as a positive control. Furthermore, the diagnostic primers amplified the target microsatellites from various boll weevil adult body parts, indicating that the PCR technology using the primer cocktail is sensitive enough to positively identify a boll weevil even when the body is partly degraded.

Development of a rapid assay to detect the jellyfish Cyanea nozakii using a loop-mediated isothermal amplification method.

PubMed

Liu, Zhongyuan; Dong, Zhijun; Liu, Dongyan

2016-07-01

Blooms of the harmful jellyfish Cyanea nozakii, which are a severe nuisance to fisheries and tourisms, frequently occur in the northern East China Sea, Yellow Sea, and Bohai Sea. To provide early warning of this species, a simple and effective molecular method for identifying C. nozakii was developed using the loop-mediated isothermal amplification method (LAMP). The LAMP assay is highly specific and uses a set of four primers that target six different regions on the mitochondrial cytochrome c oxidase subunit I (COI) gene of C. nozakii. The amplification conditions, including the dNTP and betaine concentrations, the inner primer to outer primer concentration ratio, reaction time and temperature, were optimized. The LAMP assay amplified DNA extracted from tissue samples of C. nozakii but did not amplify DNA from other common scyphozoans and hydrozoans collected in the same region. In addition, the LAMP assay was more sensitive than conventional PCR. Therefore, the established LAMP assay is a sensitive, specific, fast, and easily performed method for detection of C. nozakii at different stages in their life cycle.

Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

PubMed Central

Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

2006-01-01

Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

Primer Modification Improves Rapid and Sensitive In Vitro and Field-Deployable Assays for Detection of High Plains Virus Variants

PubMed Central

Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.

2014-01-01

A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

PubMed

Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

2016-09-01

Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

PubMed

Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

2004-09-01

Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

Simultaneous, specific and real-time detection of biothreat and frequently encountered food-borne pathogens

PubMed Central

Woubit, Abdela Salah; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen

2012-01-01

The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella include important food safety and biothreat agents causing food-related and other human illnesses worldwide. We aimed to develop rapid methods with the capability to simultaneously and differentially detect all six pathogens in one run. Our initial experiments to use previously reported sets of primers revealed non-specificity of some of the sequences when tested against a broader array of pathogens, or proved not optimal for simultaneous detection parameters. By extensive mining of the whole genome and protein databases of diverse closely and distantly related bacterial species and strains, we have identified unique genome regions, which we utilized to develop a detection platform. Twelve of the specific genomic targets we have identified to design the primers in F. tularensis ssp. tularensis, F. tularensis ssp. novicida, S. dysentriae, S. typhimurium, V. cholera, Y. pestis, and Y. pseudotuberculosis contained either hypothetical or putative proteins, the functions of which have not been clearly defined. Corresponding primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in-silico PCR against whole genome sequences of different species, sub-species, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (E.coli O157:H7 strain EDL 933, Shigella dysentriae, Salmonella typhi, Francisella tularensis ssp. tularensis, Vibrio cholera, and Yersinia pestis) and six foodborne pathogens (Salmonella typhimurium, Salmonella saintpaul, Shigella sonnei, Francisella novicida, Vibrio parahemolytica and Yersinia pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed using purified DNA showed the lowest detection limit of 640 fg DNA/µl for F. tularensis. A preliminary test done to detect Shigella organisms in a milk matrix showed that 6–60 colony forming units of the bacterium per milliliter of milk could be detected in about an hour. Therefore, we have developed a platform to simultaneously detect foodborne pathogen and biothreat agents specifically and in real-time. Such a platform could enable rapid detection or confirmation of contamination by these agents. PMID:22488053

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

PubMed

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

A primer for effective organization of professional conferences.

PubMed

Werner, Susan E; Kenefick, Colleen

2005-01-01

The challenge of organizing a successful conference is a tremendous commitment requiring extensive preparation and teamwork. It is tempting but dangerous to underestimate the details needed to coordinate an outstanding event. Conferences follow a natural life cycle from proposal, gaining administrative support, planning, implementing, and then finally evaluating outcomes. These guidelines identify the tasks and areas of responsibilities required including setting objectives, budgeting, selecting a venue, publicity, programming, and working with vendors.

Identification of Malassezia species from pityriasis versicolor lesions with a new multiplex PCR method.

PubMed

Vuran, Emre; Karaarslan, Aydın; Karasartova, Djursun; Turegun, Buse; Sahin, Fikret

2014-02-01

Despite the fact that a range of molecular methods have been developed as tools for the diagnosis of Malassezia species, there are several drawbacks associated with them, such as inefficiency of differentiating all the species, high cost, and questionable reproducibility. In addition, most of the molecular methods require cultivation to enhance sensitivity. Therefore, alternative methods eliminating cultivation and capable of identifying species with high accuracy and reliability are needed. Herein, a multiplex polymerase chain reaction (PCR)-based method was especially developed for the detection of eleven Malassezia species. The multiplex PCR was standardized by incorporating a consensus forward primer, along with Malassezia species-specific reverse primers considering the sizes of the PCR products. In the method, the multiplex-PCR primer content is divided into three parts to circumvent the problem of increased nonspecific background resulting from the use of a large number of primers. DNA extraction protocol described by Harju and colleagues was modified using liquid nitrogen instead of -80 °C to break down the yeast membrane. By a modified extraction procedure followed by multiplex PCR and electrophoresis, the method enables identification and differentiation of Malassezia species from both of the samples obtained directly from skin and yeast colonies grown in culture. Fifty-five patients who were confirmed with pityriasis versicolor were enrolled in the study. Multiplex PCR detected and differentiated all 55 samples obtained directly from the patients' skin. However, 50 out of 55 samples yielded Malassezia colony in the culture. In addition, eight of 50 colonies were misdiagnosed or not completely differentiated by conventional methods based on the sequence analysis of eight colonies. The method is capable of identifying species with high accuracy and reliability. In addition, it is simple, quick, and cost-effective. More importantly, the method works efficiently for the diagnosis of Malassezia species obtained directly from patient samples.

Sebacinales are associates of the leafy liverwort Lophozia excisa in the southern maritime Antarctic.

PubMed

Newsham, Kevin K; Bridge, Paul D

2010-06-01

The leafy liverwort Lophozia excisa, which is colonised by basidiomycete fungi in other biomes and which evidence suggests may be colonised by mycorrhizal fungi in Antarctica, was sampled from Léonie Island in the southern maritime Antarctic (67 degrees 36' S, 68 degrees 21' W). Microscopic examination of plants indicated that fungal hyphae colonised 78% of the rhizoids of the liverwort, apparently by entering the tips of rhizoids prior to growing into their bases, where they formed hyphal coils. Extensive colonisation of stem medullary cells by hyphae was also observed. DNA was extracted from surface-sterilised liverwort tissues and sequenced following nested PCR, using the primer set ITS1F/TW14, followed by a second round of amplification using the ITSSeb3/TW13 primer set. Neighbour-joining analyses showed that the sequences obtained nested in Sebacinales clade B as a 100% supported sister group to Sebacinales sequences from the leafy liverworts Lophozia sudetica, L. incisa and Calypogeia muelleriana sampled from Europe. Direct PCR using the fungal specific primer set ITS1F/ITS4 similarly identified fungi belonging to Sebacinales clade B as the principal colonists of L. excisa tissues. These observations indicate the presence of a second mycothallus in Antarctica and support the previous suggestion that the Sebacinales has a wide geographical distribution.

A method of multiplex PCR for detection of field released Beauveria bassiana, a fungal entomopathogen applied for pest management in jute (Corchorus olitorius).

PubMed

Biswas, Chinmay; Dey, Piyali; Gotyal, B S; Satpathy, Subrata

2015-04-01

The fungal entomopathogen Beauveria bassiana is a promising biocontrol agent for many pests. Some B. bassiana strains have been found effective against jute pests. To monitor the survival of field released B. bassiana a rapid and efficient detection technique is essential. Conventional methods such as plating method or direct culture method which are based on cultivation on selective media followed by microscopy are time consuming and not so sensitive. PCR based methods are rapid, sensitive and reliable. A single primer PCR may fail to amplify some of the strains. However, multiplex PCR increases the possibility of detection as it uses multiple primers. Therefore, in the present investigation a multiplex PCR protocol was developed by multiplexing three primers SCA 14, SCA 15 and SCB 9 to detect field released B. bassiana strains from soil as well as foliage of jute field. Using our multiplex PCR protocol all the five B. bassiana strains could be detected from soil and three strains viz., ITCC 6063, ITCC 4563 and ITCC 4796 could be detected even from the crop foliage after 45 days of spray.

Multiprimer PCR system for differential identification of mycobacteria in clinical samples.

PubMed Central

Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M

1996-01-01

A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

PubMed Central

Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

2014-01-01

A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

S-genotype identification based on allele-specific PCR in Japanese pear

PubMed Central

Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya

2015-01-01

Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

PubMed

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

NASA Astrophysics Data System (ADS)

Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

2017-04-01

Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

A multiplex PCR method for rapid identification of Brachionus rotifers.

PubMed

Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

2009-01-01

Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions

PubMed Central

Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli

2001-01-01

Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

PubMed Central

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

PubMed

Torriani, S; Zapparoli, G; Dellaglio, F

1999-10-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

PubMed

Wang, Deguo; Liu, Yanhong

2015-05-26

Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

PubMed

Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

2015-10-01

Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.

Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

PubMed

Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

2017-04-01

The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

A universal procedure for primer labelling of amplicons.

PubMed Central

Neilan, B A; Wilton, A N; Jacobs, D

1997-01-01

Detection and visualisation of nucleic acids is integral to genome analyses. Exponential amplification procedures have provided the means for the manipulation of nucleic acid sequences, which were otherwise inaccessible. We describe the development and application of a universal method for the labelling of any PCR product using a single end-labelled primer. Amplification was performed in a single reaction with the resulting amplicon labelled to a high specific activity. The method was adapted to a wide range of PCRs and significantly reduced the expense of such analyses. PMID:9207046

Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

PubMed

Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

2016-07-01

The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

PubMed Central

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

An expanded nuclear phylogenomic PCR toolkit for Sapindales1

PubMed Central

Collins, Elizabeth S.; Gostel, Morgan R.; Weeks, Andrea

2016-01-01

Premise of the study: We tested PCR amplification of 91 low-copy nuclear gene loci in taxa from Sapindales using primers developed for Bursera simaruba (Burseraceae). Methods and Results: Cross-amplification of these markers among 10 taxa tested was related to their phylogenetic distance from B. simaruba. On average, each Sapindalean taxon yielded product for 53 gene regions (range: 16–90). Arabidopsis thaliana (Brassicales), by contrast, yielded product for two. Single representatives of Anacardiaceae and Rutacaeae yielded 34 and 26 products, respectively. Twenty-six primer pairs worked for all Burseraceae species tested if highly divergent Aucoumea klaineana is excluded, and eight of these amplified product in every Sapindalean taxon. Conclusions: Our study demonstrates that customized primers for Bursera can amplify product in a range of Sapindalean taxa. This collection of primer pairs, therefore, is a valuable addition to the toolkit for nuclear phylogenomic analyses of Sapindales and warrants further investigation. PMID:28101434

Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

PubMed Central

Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

2013-01-01

Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

Laser Doppler velocimetry primer

NASA Technical Reports Server (NTRS)

Bachalo, William D.

1985-01-01

Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

PubMed

Bisset, S A; Knight, J S; Bouchet, C L G

2014-02-24

A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

NASA Technical Reports Server (NTRS)

Mikes, F.

1985-01-01

Concluding tests for the thermogravimetric and FTIR analyses of DC 1200 silane primers are discussed as well as methods for HPLC and GC analyses and for determining titanium and silicon by atomic absorption spectroscopy. Tables summarizes results obtained for residue, ash, titanium, silicone, Si/Ti ratio, OH-absorption, the lap-shear test, and the GC headspace for alcohols.

Simultaneous Genotyping of the rs4762 and rs699 Polymorphisms in Angiotensinogen Gene and Correlation with Iranian CAD Patients with Novel Hexa-primer ARMS-PCR

PubMed Central

KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud

2017-01-01

Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324

Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

PubMed

Winn-Deen

1998-12-01

Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.

Evaluation of surface roughness of enamel after various bonding and clean-up procedures on enamel bonded with three different bonding agents: An in-vitro study

PubMed Central

Goel, Amit; Singh, Atul; Gupta, Tarun

2017-01-01

Background The purpose of this study was to analyze and compare the enamel surface roughness before bonding and after debonding, to find correlation between the adhesive remnant index and its effect on enamel surface roughness and to evaluate which clean-up method is most efficient to provide a smoother enamel surface. Material and Methods 135 premolars were divided into 3 groups containing 45 premolars in each group. Group I was bonded by using moisture insensitive primer, Group II by using conventional orthodontic adhesive and Group III by using self-etching primer. Each group was divided into 3 sub-groups on the basis of type of clean-up method applied i,e scaling followed by polishing, tungsten carbide bur and Sof-Lex disc. Enamel surface roughness was measured and compared before bonding and after clean-up. Results Evaluation of pre bonding and post clean-up enamel surface roughness (Ra value) with the t test showed that Post clean-up Ra values were greater than Pre bonding Ra values in all the groups except in teeth bonded with self-etching primer cleaned with Sof-Lex disc. Reliability of ARI score taken at different time interval tested with Kruskal Wallis test suggested that all the readings were reliable. Conclusions No clean-up procedure was able to restore the enamel to its original smoothness. Self-etching primer and Sof-Lex disc clean-up method combination restored the enamel surface roughness (Ra value) closest to its pre-treatment value. Key words:Enamel surface roughness, clean-up method, adhesive remnant index. PMID:28512535

Disentangling Vector-Borne Transmission Networks: A Universal DNA Barcoding Method to Identify Vertebrate Hosts from Arthropod Bloodmeals

PubMed Central

Alcaide, Miguel; Rico, Ciro; Ruiz, Santiago; Soriguer, Ramón; Muñoz, Joaquín; Figuerola, Jordi

2009-01-01

Emerging infectious diseases represent a challenge for global economies and public health. About one fourth of the last pandemics have been originated by the spread of vector-borne pathogens. In this sense, the advent of modern molecular techniques has enhanced our capabilities to understand vector-host interactions and disease ecology. However, host identification protocols have poorly profited of international DNA barcoding initiatives and/or have focused exclusively on a limited array of vector species. Therefore, ascertaining the potential afforded by DNA barcoding tools in other vector-host systems of human and veterinary importance would represent a major advance in tracking pathogen life cycles and hosts. Here, we show the applicability of a novel and efficient molecular method for the identification of the vertebrate host's DNA contained in the midgut of blood-feeding arthropods. To this end, we designed a eukaryote-universal forward primer and a vertebrate-specific reverse primer to selectively amplify 758 base pairs (bp) of the vertebrate mitochondrial Cytochrome c Oxidase Subunit I (COI) gene. Our method was validated using both extensive sequence surveys from the public domain and Polymerase Chain Reaction (PCR) experiments carried out over specimens from different Classes of vertebrates (Mammalia, Aves, Reptilia and Amphibia) and invertebrate ectoparasites (Arachnida and Insecta). The analysis of mosquito, culicoid, phlebotomie, sucking bugs, and tick bloodmeals revealed up to 40 vertebrate hosts, including 23 avian, 16 mammalian and one reptilian species. Importantly, the inspection and analysis of direct sequencing electropherograms also assisted the resolving of mixed bloodmeals. We therefore provide a universal and high-throughput diagnostic tool for the study of the ecology of haematophagous invertebrates in relation to their vertebrate hosts. Such information is crucial to support the efficient management of initiatives aimed at reducing epidemiologic risks of arthropod vector-borne pathogens, a priority for public health. PMID:19768113

Genetic polymorphisms of ADH1B, ADH1C and ALDH2 in Turkish alcoholics: lack of association with alcoholism and alcoholic cirrhosis.

PubMed

Vatansever, Sezgin; Tekin, Fatih; Salman, Esin; Altintoprak, Ender; Coskunol, Hakan; Akarca, Ulus Salih

2015-05-17

No data exists regarding the alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) gene polymorphisms in Turkish alcoholic cirrhotics. We studied the polymorphisms of ADH1B, ADH1C and ALDH2 genes in alcoholic cirrhotics and compared the results with non-cirrhotic alcoholics and healthy volunteers. Overall, 237 subjects were included for the study: 156 alcoholic patients (78 cirrhotics, 78 non-cirrhotic alcoholics) and 81 healthy volunteers. Three different single-nucleotide-polymorphism genotyping methods were used. ADH1C genotyping was performed using a polymerase chain reaction-restriction fragment length polymorphism method. The identified ADH1C genotypes were named according to the presence or absence of the enzyme restriction sites. ADH1B (Arg47Hys) genotyping was performed using the allele specific primer extension method, and ALDH2 (Glu487Lys) genotyping was performed by a multiplex polymerase chain reaction using two allele-specific primer pairs. For ADH1B, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 97.4%, 94.9% and 99.4%, respectively. For ADH1C, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 47%, 36.3% and 45%, respectively. There was no statistical difference between the groups for ADH1B and ADH1C (p>0.05). All alcoholic and non-alcoholic subjects (100%) had the allele *1 for ALDH2. The obtained results for ADH1B, ADH1C, and ALDH gene polymorphisms in the present study are similar to the results of Caucasian studies. ADH1B and ADH1C genetic variations are not related to the development of alcoholism or susceptibility to alcoholic cirrhosis. ALDH2 gene has no genetic variation in the Turkish population.

Current advances in molecular methods for detection of nitrite-dependent anaerobic methane oxidizing bacteria in natural environments.

PubMed

Chen, Jing; Dick, Richard; Lin, Jih-Gaw; Gu, Ji-Dong

2016-12-01

Nitrite-dependent anaerobic methane oxidation (n-damo) process uniquely links microbial nitrogen and carbon cycles. Research on n-damo bacteria progresses quickly with experimental evidences through enrichment cultures. Polymerase chain reaction (PCR)-based methods for detecting them in various natural ecosystems and engineered systems play a very important role in the discovery of their distribution, abundance, and biodiversity in the ecosystems. Important characteristics of n-damo enrichments were obtained and their key significance in microbial nitrogen and carbon cycles was investigated. The molecular methods currently used in detecting n-damo bacteria were comprehensively reviewed and discussed for their strengths and limitations in applications with a wide range of samples. The pmoA gene-based PCR primers for n-damo bacterial detection were evaluated and, in particular, several incorrectly stated PCR primer nucleotide sequences in the published papers were also pointed out to allow correct applications of the PCR primers in current and future investigations. Furthermore, this review also offers the future perspectives of n-damo bacteria based on current information and methods available for a better acquisition of new knowledge about this group of bacteria.

Multiplex PCR method to discriminate Artemisia iwayomogi from other Artemisia plants.

PubMed

Doh, Eui Jeong; Oh, Seung-Eun

2012-01-01

Some plants in the genus Artemisia have been used for medicinal purposes. Among them, Artemisia iwayomogi, commonly referred to as "Haninjin," is one of the major medicinal materials used in traditional Korean medicine. By contrast, Artemisia capillaris and both Artemisia argyi and Artemisia princeps, referred to as "Injinho" and "Aeyup," respectively, are used to treat diseases different from those for which "Haninjin" is prescribed. Therefore, the development of a reliable method to differentiate each Artemisia herb is necessary. We found that a random amplified polymorphic DNA (RAPD) method can be used to efficiently discriminate a few Artemisia plants from one another. To improve the reliability of RAPD amplification, we designed primer sets based on the nucleotide sequences of RAPD products to amplify a sequence-characterized amplified region (SCAR) marker of A. iwayomogi. In addition, we designed two other primer sets to amplify SCAR markers of "Aeyup" (A. argyi and A. princeps) along with "Injinho" (A. capillaris) and Artemisia japonica, which are also traded in Korean herbal markets. Using these three primer sets, we developed a multiplex PCR method concurrently not only to discriminate A. iwayomogi from other Artemisia plants, but also to identify Artemisia plants using a single PCR process.

Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

PubMed

Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

2014-01-01

Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

PubMed

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection.

PubMed Central

Cerón, J; Ortíz, A; Quintero, R; Güereca, L; Bravo, A

1995-01-01

In this paper we describe a PCR strategy that can be used to rapidly identify Bacillus thuringiensis strains that harbor any of the known cryI or cryIII genes. Four general PCR primers which amplify DNA fragments from the known cryI or cryIII genes were selected from conserved regions. Once a strain was identified as an organism that contains a particular type of cry gene, it could be easily characterized by performing additional PCR with specific cryI and cryIII primers selected from variable regions. The method described in this paper can be used to identify the 10 different cryI genes and the five different cryIII genes. One feature of this screening method is that each cry gene is expected to produce a PCR product having a precise molecular weight. The genes which produce PCR products having different sizes probably represent strains that harbor a potentially novel cry gene. Finally, we present evidence that novel crystal genes can be identified by the method described in this paper. PMID:8526493

Comparison of the antibacterial activity of different self-etching primers and adhesives.

PubMed

Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray

2008-11-01

The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other adhesive systems, Clearfil Protect Bond Primer (containing MDPB) showed a high antibacterial effect against all microorganizms tested. Two-step, self-etching primer/adhesive system Clearfil Protect Bond might be a suitable choice under minimally invasive restorations. The recently developed one-step, self-etching system Clearfil Tri S Bond showed no antibacterial effect against microorgazims tested.

Poliovirus serotype-specific VP1 sequencing primers.

PubMed

Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

2011-06-01

The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

PubMed

Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

2015-07-01

Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive

PubMed Central

2018-01-01

Objectives The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Materials and Methods Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al2O3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test (p = 0.05). Results Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 (p < 0.05). Conclusions Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used. PMID:29487838

Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

PubMed

Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

2014-09-01

Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

Back to Basics--The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities.

PubMed

Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H

2015-01-01

DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.

Zoledronate and ion-releasing resins impair dentin collagen degradation.

PubMed

Tezvergil-Mutluay, A; Seseogullari-Dirihan, R; Feitosa, V P; Tay, F R; Watson, T F; Pashley, D H; Sauro, S

2014-10-01

This study analyzed the amounts of solubilized telopeptides cross-linked carboxyterminal telopeptide of type I collagen (ICTP) and C-terminal crosslinked telopeptide of type I collagen (CTX) derived from matrix-metalloproteinases (MMPs) and cysteine cathepsins (CTPs) subsequent to application of a filler-free (Res.A) or an ion-releasing resin (Res.B) to ethylenediaminetetraacetic acid (EDTA)-demineralized dentin with or without zoledronate-containing primer (Zol-primer) pre-treatment. The chemical modification induced following treatments and artificial saliva (AS) storage was also analyzed through attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR). Totally EDTA-demineralized specimens were infiltrated with Res.A or Res.B with or without Zol-primer pre-treatment, light-cured, and immersed in AS for up to 4 wk. ICTP release was reduced following infiltration with Res.B and further reduced when Res.B was used with Zol-primer; remarkable phosphate mineral uptake was attained after AS storage. CTX release was increased in Res.A- and Res.B-treated dentin. However, when Zol-primer was used with Res.A, the CTX release fell significantly compared to the other tested resin-infiltration methods. In conclusion, zoledronate offers an additional inhibitory effect to the ion-releasing resins in MMP-mediated collagen degradation. However, Zol-primer induces a modest reduction in CTX release only when used with resin-based systems containing no ion-releasing fillers. © International & American Associations for Dental Research.

Zoledronate and Ion-releasing Resins Impair Dentin Collagen Degradation

PubMed Central

Tezvergil-Mutluay, A.; Seseogullari-Dirihan, R.; Feitosa, V.P.; Tay, F.R.; Watson, T.F.; Pashley, D.H.; Sauro, S.

2014-01-01

This study analyzed the amounts of solubilized telopeptides cross-linked carboxyterminal telopeptide of type I collagen (ICTP) and C-terminal crosslinked telopeptide of type I collagen (CTX) derived from matrix-metalloproteinases (MMPs) and cysteine cathepsins (CTPs) subsequent to application of a filler-free (Res.A) or an ion-releasing resin (Res.B) to ethylenediaminetetraacetic acid (EDTA)-demineralized dentin with or without zoledronate-containing primer (Zol-primer) pre-treatment. The chemical modification induced following treatments and artificial saliva (AS) storage was also analyzed through attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR). Totally EDTA-demineralized specimens were infiltrated with Res.A or Res.B with or without Zol-primer pre-treatment, light-cured, and immersed in AS for up to 4 wk. ICTP release was reduced following infiltration with Res.B and further reduced when Res.B was used with Zol-primer; remarkable phosphate mineral uptake was attained after AS storage. CTX release was increased in Res.A- and Res.B-treated dentin. However, when Zol-primer was used with Res.A, the CTX release fell significantly compared to the other tested resin-infiltration methods. In conclusion, zoledronate offers an additional inhibitory effect to the ion-releasing resins in MMP-mediated collagen degradation. However, Zol-primer induces a modest reduction in CTX release only when used with resin-based systems containing no ion-releasing fillers. PMID:25074494

Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

PubMed

Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

2016-10-01

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

Polymerase Spiral Reaction (PSR): A novel isothermal nucleic acid amplification method.

PubMed

Liu, Wei; Dong, Derong; Yang, Zhan; Zou, Dayang; Chen, Zeliang; Yuan, Jing; Huang, Liuyu

2015-07-29

In this study, we report a novel isothermal nucleic acid amplification method only requires one pair of primers and one enzyme, termed Polymerase Spiral Reaction (PSR) with high specificity, efficiency, and rapidity under isothermal condition. The recombinant plasmid of blaNDM-1 was imported to Escherichia coli BL21, and selected as the microbial target. PSR method employs a Bst DNA polymerase and a pair of primers designed targeting the blaNDM-1 gene sequence. The forward and reverse Tab primer sequences are reverse to each other at their 5' end (Nr and N), whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The PSR method was performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure. PSR assay was monitored continuously in a real-time turbidimeter instrument or visually detected with the aid of a fluorescent dye (SYBR Greenı), and could be finished within 1 h with a high accumulation of 10(9) copies of the target and a fine sensitivity of 6 CFU per reaction. Clinical evaluation was also conducted using PSR, showing high specificity of this method. The PSR technique provides a convenient and cost-effective alternative for clinical screening, on-site diagnosis and primary quarantine purposes.

Identification of spider-mite species and their endosymbionts using multiplex PCR.

PubMed

Zélé, Flore; Weill, Mylène; Magalhães, Sara

2018-02-01

Spider mites of the genus Tetranychidae are severe crop pests. In the Mediterranean a few species coexist, but they are difficult to identify based on morphological characters. Additionally, spider mites often harbour several species of endosymbiotic bacteria, which may affect the biology of their hosts. Here, we propose novel, cost-effective, multiplex diagnostic methods allowing a quick identification of spider-mite species as well as of the endosymbionts they carry. First, we developed, and successfully multiplexed in a single PCR, primers to identify Tetranychus urticae, T. evansi and T. ludeni, some of the most common tetranychids found in southwest Europe. Moreover, we demonstrated that this method allows detecting multiple species in a single pool, even at low frequencies (up to 1/100), and can be used on entire mites without DNA extraction. Second, we developed another set of primers to detect spider-mite endosymbionts, namely Wolbachia, Cardinium and Rickettsia in a multiplex PCR, along with a generalist spider-mite primer to control for potential failure of DNA amplification in each PCR. Overall, our method represents a simple, cost-effective and reliable method to identify spider-mite species and their symbionts in natural field populations, as well as to detect contaminations in laboratory rearings. This method may easily be extended to other species.

Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

PubMed

Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

2015-01-01

Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

Two molecular markers based on mitochondrial genomes for varieties identification of the northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids.

PubMed

Xincheng, Zhang; Kunci, Chen; Xinping, Zhu; Jian, Zhao; Qing, Luo; Xiaoyou, Hong; Wei, Li; Fengfang, Xiao

2015-08-01

The northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids have played important roles in the Chinese freshwater aquaculture industry, with an annual production in China exceeding 400 thousand tons. While these are popular aquaculture breeds in China, it is not easy to identify northern snakehead, blotched snakehead, and their hybrids. Thus, a method should be developed to identify these varieties. To distinguish between the reciprocal hybrids (C. argus ♀ × C. maculata ♂ and C. maculata ♀ × C. argus ♂), the mitochondrial genome sequences of northern snakehead and blotched snakehead and their reciprocal hybrids were compared. Following the alignment and analysis of mtDNA sequences of northern snakehead, blotched snakehead and their hybrids, two pairs of specific primers were designed based on identified differences ranging from 12S rRNA to 16S rRNA gene. The BY1 primers amplified the same bands in the blotched snakehead and the hybrid (C. maculata ♀ × C. argus ♂), while producing no products in northern snakehead and the hybrid (C. argus ♀ × C. maculata ♂). Amplification with WY1 yielded the opposite results. Then, 30 individuals per fish were randomized to verify the primers, and the results showed that the primers were specific for breeds, as intended. The specific primers can not only simply distinguish between two kinds of hybrids, but also rapidly identify the two parents. This study provides a method of molecular marker identification to identify reciprocal hybrids.

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

PubMed Central

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

A set of plastid loci for use in multiplex fragment length genotyping for intraspecific variation in Pinus (Pinaceae)1

PubMed Central

Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann

2014-01-01

• Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625

Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

PubMed

Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

2017-07-01

Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

[Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].

PubMed

Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun

2009-10-01

To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.

In-cell RNA structure probing with SHAPE-MaP.

PubMed

Smola, Matthew J; Weeks, Kevin M

2018-06-01

This protocol is an extension to: Nat. Protoc. 10, 1643-1669 (2015); doi:10.1038/nprot.2015.103; published online 01 October 2015RNAs play key roles in many cellular processes. The underlying structure of RNA is an important determinant of how transcripts function, are processed, and interact with RNA-binding proteins and ligands. RNA structure analysis by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) takes advantage of the reactivity of small electrophilic chemical probes that react with the 2'-hydroxyl group to assess RNA structure at nucleotide resolution. When coupled with mutational profiling (MaP), in which modified nucleotides are detected as internal miscodings during reverse transcription and then read out by massively parallel sequencing, SHAPE yields quantitative per-nucleotide measurements of RNA structure. Here, we provide an extension to our previous in vitro SHAPE-MaP protocol with detailed guidance for undertaking and analyzing SHAPE-MaP probing experiments in live cells. The MaP strategy works for both abundant-transcriptome experiments and for cellular RNAs of low to moderate abundance, which are not well examined by whole-transcriptome methods. In-cell SHAPE-MaP, performed in roughly 3 d, can be applied in cell types ranging from bacteria to cultured mammalian cells and is compatible with a variety of structure-probing reagents. We detail several strategies by which in-cell SHAPE-MaP can inform new biological hypotheses and emphasize downstream analyses that reveal sequence or structure motifs important for RNA interactions in cells.

Genetic and transcriptional organization of the clpC locus in Bifidobacterium breve UCC 2003.

PubMed

Ventura, Marco; Fitzgerald, Gerald F; van Sinderen, Douwe

2005-10-01

A homolog of the clpC ATPase gene was identified in the genome of Bifidobacterium breve UCC 2003. Since this gene is very well conserved among eubacteria, we employed a PCR-based approach using primers based on highly conserved regions of ClpC proteins in order to identify homologous genes in other bifidobacterial species. Analysis by slot blot, Northern blot, and primer extension experiments showed that transcription of clpC is induced in response to moderate heat shock regimes. Moreover, we identified in the genome sequence of B. breve UCC 2003 a gene, designated clgR, which is predicted to encode a transcriptional regulator involved in regulation of the bifidobacterial clpC gene. The role of this protein in the regulation of B. breve UCC 2003 clpC gene expression was investigated by performing gel retardation experiments. We show that a biologically active ClgR molecule requires one or more proteinaceous coactivators to assist in the specific binding of ClgR to the clpC promoter region.

Genetic and Transcriptional Organization of the clpC Locus in Bifidobacterium breve UCC 2003

PubMed Central

Ventura, Marco; Fitzgerald, Gerald F.; van Sinderen, Douwe

2005-01-01

A homolog of the clpC ATPase gene was identified in the genome of Bifidobacterium breve UCC 2003. Since this gene is very well conserved among eubacteria, we employed a PCR-based approach using primers based on highly conserved regions of ClpC proteins in order to identify homologous genes in other bifidobacterial species. Analysis by slot blot, Northern blot, and primer extension experiments showed that transcription of clpC is induced in response to moderate heat shock regimes. Moreover, we identified in the genome sequence of B. breve UCC 2003 a gene, designated clgR, which is predicted to encode a transcriptional regulator involved in regulation of the bifidobacterial clpC gene. The role of this protein in the regulation of B. breve UCC 2003 clpC gene expression was investigated by performing gel retardation experiments. We show that a biologically active ClgR molecule requires one or more proteinaceous coactivators to assist in the specific binding of ClgR to the clpC promoter region. PMID:16204550

Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

PubMed

Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

2013-10-01

Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

Clinical validation of 3 commercial real-time reverse transcriptase polymerase chain reaction assays for the detection of Middle East respiratory syndrome coronavirus from upper respiratory tract specimens.

PubMed

Mohamed, Deqa H; AlHetheel, AbdulKarim F; Mohamud, Hanat S; Aldosari, Kamel; Alzamil, Fahad A; Somily, Ali M

2017-04-01

Since discovery of Middle East respiratory syndrome coronavirus (MERS-CoV), a novel betacoronavirus first isolated and characterized in 2012, MERS-CoV real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assays represent one of the most rapidly expanding commercial tests. However, in the absence of extensive evaluations of these assays on positive clinical material of different sources, evaluating their diagnostic effectiveness remains challenging. We describe the diagnostic performance evaluation of 3 common commercial MERS-CoV rRT-PCR assays on a large panel (n = 234) of upper respiratory tract specimens collected during an outbreak episode in Saudi Arabia. Assays were compared to the RealStar® MERS-CoV RT-PCR (Alton Diagnostics, Hamburg, Germany) assay as the gold standard. Results showed i) the TIB MolBiol® LightMix UpE and Orf1a assays (TIB MolBiol, Berlin, Germany) to be the most sensitive, followed by ii) the Anyplex™ Seegene MERS-CoV assay (Seegene, Seoul, Korea), and finally iii) the PrimerDesign™ Genesig® HCoV_2012 assay (PrimerDesign, England, United Kingdom). We also evaluate a modified protocol for the PrimerDesign™ Genesig® HCoV_2012 assay. Copyright © 2017 Elsevier Inc. All rights reserved.

SHAPE Selection (SHAPES) enrich for RNA structure signal in SHAPE sequencing-based probing data

PubMed Central

Poulsen, Line Dahl; Kielpinski, Lukasz Jan; Salama, Sofie R.; Krogh, Anders; Vinther, Jeppe

2015-01-01

Selective 2′ Hydroxyl Acylation analyzed by Primer Extension (SHAPE) is an accurate method for probing of RNA secondary structure. In existing SHAPE methods, the SHAPE probing signal is normalized to a no-reagent control to correct for the background caused by premature termination of the reverse transcriptase. Here, we introduce a SHAPE Selection (SHAPES) reagent, N-propanone isatoic anhydride (NPIA), which retains the ability of SHAPE reagents to accurately probe RNA structure, but also allows covalent coupling between the SHAPES reagent and a biotin molecule. We demonstrate that SHAPES-based selection of cDNA–RNA hybrids on streptavidin beads effectively removes the large majority of background signal present in SHAPE probing data and that sequencing-based SHAPES data contain the same amount of RNA structure data as regular sequencing-based SHAPE data obtained through normalization to a no-reagent control. Moreover, the selection efficiently enriches for probed RNAs, suggesting that the SHAPES strategy will be useful for applications with high-background and low-probing signal such as in vivo RNA structure probing. PMID:25805860

Alterations in Synthesis and Repair of DNA during the Development of Loach Misgurnus fossilis

PubMed Central

Gening, Leonid V.; Lakhin, Andrei V.; Makarova, Irina V.; Nenasheva, Valentina V.; Andreeva, Ludmila E.; Tarantul, Vyacheslav Z.

2016-01-01

Using a modified radiolabeled primer extension method (we named this modification misGvA—“misincorporation of G versus A”) we have investigated the DNA synthesis and repair at early and late stages of development of loach Misgurnus fossilis. The misincorporation activity of DNA polymerase iota (Pol ι) in wild-type loach could not be detected by this method at any stage of loach development. In transgenic loach overexpressing human Pol ι we have shown that the bypassing of DNA synthesis arrest after incorporation of mismatched nucleotide by Pol ι (the T-stop) was not associated with this enzyme. Non-transgenic loach larvae are virtually lacking the capacity for error correction of DNA duplex containing a mismatched nucleotide. Such repair activity develops only in the adult fish. It appears that the initial stages of development are characterized by more intensive DNA synthesis, while in terminal stages the repair activities become more prominent. The misGvA approach clearly indicates substantial changes in the DNA synthesis intensity, although the role of particular replicative and repair DNA polymerases in this process requires further study. PMID:29615575

The Specificity of Peptide Chain Extension by N-Carboxyanhydrides

NASA Technical Reports Server (NTRS)

Wen, Ke; Orgel, Leslie E.

2001-01-01

We have used amino acids activated by carbonyldiimidazole to study the enantiospecificity of peptide elongation in aqueous solution. Peptide primers Glu(sub 10) and Ala3Glulo were elongated with the enantiomers of arginine, glutamic acid, asparagine, phenylalanine, serine and valine. The homochiral addition was always the more efficient reaction; the enantiospecificity was large in some cases but very small in others. In every case Ala(sub 3)Glu(sub l0) was elongated more efficiently than Glu(sub 10).

Detection of Candida species by nested PCR method in one-humped camels (Camelus dromedarius).

PubMed

Parin, Ugur; Erbas, Goksel; Kirkan, Sukru; Savasan, Serap; Tugba Yuksel, H; Balat, Gamze

2018-02-01

Systemic fungal diseases are the infections caused by false treatment protocols and generally are not taken into consideration especially in the veterinary field. One-humped camels are found in the western side of the Aegean region of our country and bred for wrestling. The aim of this study is the application of diagnosing systemic fungi infection from camel blood samples by the PCR method. In this study, specific primers for DNA topoisomerase II gene sequences were used. As a result, a systemic fungal infection was detected by the nested PCR method from 10 (20%) out of 50 DNA samples taken from camels located on the western side of the Aegean region. In this study, 3 (30%) samples were identified as Candida albicans, 3 (30%) samples were identified as C. glabrata, and 4 (40%) samples were identified as C. parapsilosis. In conclusion, the 20% positive systemic fungal infection rate in one-humped camels observed in the present study showed that the systemic fungal infections are not taken into considerations in veterinary medicine. Further studies are suggested in order to obtain and to maintain extensive data for systemic fungal diseases in our country for one-humped camels.

Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

PubMed Central

2012-01-01

Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence.

PubMed

Navarro, B; Daròs, J A; Flores, R

1996-01-01

Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.

Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

PubMed

Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

2007-10-01

Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.

Detection of HbsAg and hATIII genetically modified goats (Caprahircus) by loop-mediated isothermal amplification.

PubMed

Tao, Chenyu; Zhang, Qingde; Zhai, Shanli; Liu, Bang

2013-11-01

In this study, sensitive and rapid detection systems were designed using a loop-mediated isothermal amplification (LAMP) method to detect the genetically modified goats. A set of 4 primers were designed for each exogenous nucleic acids HBsAg and hATIII. The DNA samples were first amplified with the outer and inner primers and released a single-stranded DNA,of which both ends were stem-loop structure. Then one inner primer hybridized with the loop, and initiated displacement synthesis in less than 1 h. The result could be visualized by both agarose gel electrophoresis and unaided eyes directly after adding SYBR GREEN 1. The detection limit of LAMP was ten copies of target molecules, indicating that LAMP was tenfold more sensitive than the classical PCR. Furthermore, all the samples of genetically modified goats were tested positively by LAMP, and the results demonstrated that the LAMP was a rapid and sensitive method for detecting the genetically modified organism.

RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

PubMed

Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

2008-06-15

A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

Primer-Free Aptamer Selection Using A Random DNA Library

PubMed Central

Pan, Weihua; Xin, Ping; Patrick, Susan; Dean, Stacey; Keating, Christine; Clawson, Gary

2010-01-01

Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified through an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX) to recognize a wide variety of targets, from small molecules to proteins and other macromolecules 2-4. Aptamers have properties that are well suited for in vivo diagnostic and/or therapeutic applications: Besides good specificity and affinity, they are easily synthesized, survive more rigorous processing conditions, they are poorly immunogenic, and their relatively small size can result in facile penetration of tissues. Aptamers that are identified through the standard SELEX process usually comprise ~80 nucleotides (nt), since they are typically selected from nucleic acid libraries with ~40 nt long randomized regions plus fixed primer sites of ~20 nt on each side. The fixed primer sequences thus can comprise nearly ~50% of the library sequences, and therefore may positively or negatively compromise identification of aptamers in the selection process 3, although bioinformatics approaches suggest that the fixed sequences do not contribute significantly to aptamer structure after selection 5. To address these potential problems, primer sequences have been blocked by complementary oligonucleotides or switched to different sequences midway during the rounds of SELEX 6, or they have been trimmed to 6-9 nt 7, 8. Wen and Gray 9 designed a primer-free genomic SELEX method, in which the primer sequences were completely removed from the library before selection and were then regenerated to allow amplification of the selected genomic fragments. However, to employ the technique, a unique genomic library has to be constructed, which possesses limited diversity, and regeneration after rounds of selection relies on a linear reamplification step. Alternatively, efforts to circumvent problems caused by fixed primer sequences using high efficiency partitioning are met with problems regarding PCR amplification 10. We have developed a primer-free (PF) selection method that significantly simplifies SELEX procedures and effectively eliminates primer-interference problems 11, 12. The protocols work in a straightforward manner. The central random region of the library is purified without extraneous flanking sequences and is bound to a suitable target (for example to a purified protein or complex mixtures such as cell lines). Then the bound sequences are obtained, reunited with flanking sequences, and re-amplified to generate selected sub-libraries. As an example, here we selected aptamers to S100B, a protein marker for melanoma. Binding assays showed Kd s in the 10-7 - 10-8 M range after a few rounds of selection, and we demonstrate that the aptamers function effectively in a sandwich binding format. PMID:20689511

Use of Base Modifications in Primers and Amplicons to Improve Nucleic Acids Detection in the Real-Time Snake Polymerase Chain Reaction

PubMed Central

2011-01-01

Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073

Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

PubMed Central

Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

2013-01-01

Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

Effect of quaternary ammonium and silver nanoparticle-containing adhesives on dentin bond strength and dental plaque microcosm biofilms

PubMed Central

Zhang, Ke; Melo, Mary Anne S.; Cheng, Lei; Weir, Michael D.; Bai, Yuxing; Xu, Hockin H. K.

2012-01-01

Objectives Antibacterial bonding agents are promising to hinder the residual and invading bacteria at the tooth-restoration interfaces. The objectives of this study were to develop an antibacterial bonding agent by incorporation of quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg), and to investigate the effect of QADM-NAg adhesive and primer on dentin bond strength and plaque microcosm biofilm response for the first time. Methods Scotchbond Multi-Purpose adhesive and primer were used as control. Experimental adhesive and primer were made by adding QADM and NAg into control adhesive and primer. Human dentin shear bond strengths were measured (n = 10). A dental plaque microcosm biofilm model with human saliva as inoculum was used to investigate biofilm metabolic activity, colony-forming unit (CFU) counts, lactic acid production, and live/dead staining assay (n = 6). Results Adding QADM and NAg into adhesive and primer did not compromise the dentin shear bond strength which ranged from 30 to 35 MPa (p > 0.1). Scanning electron microscopy (SEM) examinations revealed numerous resin tags, which were similar for the control and the QADM and NAg groups. Adding QADM or NAg markedly reduced the biofilm viability, compared to adhesive control. QADM and NAg together in the adhesive had a much stronger antibacterial effect than using each agent alone (p < 0.05). Adding QADM and NAg in both adhesive and primer had the strongest antibacterial activity, reducing metabolic activity, CFU, and lactic acid by an order of magnitude, compared to control. Significance Without compromising dentin bond strength and resin tag formation, the QADM and NAg containing adhesive and primer achieved strong antibacterial effects against microcosm biofilms for the first time. QADM-NAg adhesive and primer are promising to combat residual bacteria in tooth cavity and invading bacteria at the margins, thereby to inhibit secondary caries. QADM and NAg incorporation may have a wide applicability to other dental bonding systems. PMID:22592165

Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

PubMed

Panicker, Gitika; Bej, Asim K

2005-10-01

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

Composite-composite repair bond strength: effect of different adhesion primers.

PubMed

Tezvergil, A; Lassila, L V J; Vallittu, P K

2003-11-01

Recently, new products have been introduced to repair composite restorations that may be used as 'one-step' primers or monomers and silane compounds which are used separately as 'multi-step' primers. The aim of this study was to compare the shear bond strength of the new composite resin to aged composite, by using different adhesion primers. The substrates were particulate filler composite (Z250, 3M-ESPE), which was aged by boiling for 8 h and storing at 37 degrees C in water for 3 weeks. The aged substrate surfaces were wet-ground flat with 320-grit silicon carbide paper and subjected randomly (n=8) to either one-step adhesion primer: Compoconnect (CC) (Heraus Kulzer), or multi-step: Clearfil Repair (CF) (Kuraray) or an intermediate resin: Scothchbond Multi-purpose adhesive resin (3M-ESPE) according to the manufacturers' recommendations. Specimens with no surface treatment were used as control (C). New composite resin (Z250) was added to the substrate using 2 mm layer increments and light cured. The specimens were either water stored for 48 h or water stored for 24 h and then thermocycled for 6000 cycles. The shear bond strengths were measured with a crosshead speed of 1.0 mm/min using a universal testing machine. Data were analysed by two-way ANOVA and Tukey's post-hoc tests (p=0.05). All surface treatment methods showed significant difference compared to control (p<0.05). CF showed higher bond strength than CC and MP (p<0.05). Storage condition did not show a significant difference (p>0.05) in bond strength values. It was concluded that multi-step adhesion primer yielded higher bond strength compared to one-step primer or intermediate resin.

Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S-23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide.

PubMed

Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X

2003-01-01

The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.

Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.

PubMed

Saetung, Rattika; Ongchai, Siriwan; Charoenkwan, Pimlak; Sanguansermsri, Torpong

2013-11-01

Beta thalassemia is a common hereditary hemalogogical disease in Thailand, with a prevalence of 5-8%. In this study, we evaluated the high resolution DNA melting (HRM) assay to identify beta thalassemia mutation in samples from 143 carriers of the beta thalassemia traits in at risk couples. The DNA was isolated from venous blood samples and tested for mutation under a series of 5 PCR-HRM (A, B, C, D and E primers) protocols. The A primers were for detection of beta thalassemia mutations in the HBB promoter region, the B primers for mutations in exon I, the C primers for exon II, the D primers for exon III and the E primers for the 3.4 kb deletion mutation. The mutations were diagnosed by comparing the complete melting curve profiles of a wild type control with those for each mutant sample. With the PCR-HRM technique, fourteen types of beta thalassemia mutations were detected. Each mutation had a unique and specific melting profile. The mutations included 36.4% (52 cases) codon 41/42-CTTT, 26.6% (38 cases) codon 17 A-T, 11.2% (16 cases) IVS1-1 G-T, 8.4% (12 cases) codon 71/72 +A, 8.4% (12 cases) of the 3.4 kb deletion and 3.5% (5 cases) -28 A-G. The remainder included one instance each of -87 C-A, -31 A-C, codon 27/28 +C, codon 30 G-A, IVS1-5 G-C, codon 35 C-A, codon 41-C and IVSII -654 C-T. Of the total cases, 85.8% of the mutations could be detected by primers B and C. The PCR-HRM method provides a rapid, simple and highly feasible strategy for mutation screening of beta thalassemia traits.

Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

PubMed Central

Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

2014-01-01

Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

PubMed

Kageyama, A; Benno, Y

2001-01-01

PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

Rapid combined assay for Salmonella detection in food samples.

PubMed

Gadó, I; Major, P; Király, M; Pláveczky, M G

2000-01-01

A rapid method was developed to detect salmonellae in food samples. The method gave a possibility to obtain results after 28 h 30 min. The preenrichment in buffered peptone water lasted for 6 h, the enrichment in Rappaport-Vassiliadis medium was applied for 18 h followed by PCR with INVA1-INVA2 primer pair, adapting Chiu and Ou's method. This procedure was suitable to demonstrate salmonella contamination at min. 10 cfu/25 g sample. Out of 18 samples there was a good agreement between the results of the conventional and rapid methods in case of 17 samples. PCR with SPVC1-SPVC2 primer pair informing about the presence of virulence plasmid was performed in separate tubes, because decreased sensitivity was observed in case of multiplex PCR.

Using Economic Evaluation to Illustrate Value of Care for Improving Patient Safety and Quality: Choosing the Right Method.

PubMed

Padula, William V; Lee, Ken K H; Pronovost, Peter J

2017-08-03

To scale and sustain successful quality improvement (QI) interventions, it is recommended for health system leaders to calculate the economic and financial sustainability of the intervention. Many methods of economic evaluation exist, and the type of method depends on the audience: providers, researchers, and hospital executives. This is a primer to introduce cost-effectiveness analysis, budget impact analysis, and return on investment calculation as 3 distinct methods for each stakeholder needing a measurement of the value of QI at the health system level. Using cases for the QI of hospital-acquired condition rates (e.g., pressure injuries), this primer proceeds stepwise through each method beginning from the same starting point of constructing a model so that the repetition of steps is minimized and thereby capturing the attention of all intended audiences.

PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

DOE PAGES

Yoon, Hyejin; Leitner, Thomas

2014-12-17

Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

Long distance PCR in detection of inversion mutations of F8C gene in hemophilia A patients.

PubMed

Poláková, H; Zmetáková, I; Kádasi, L'

2003-06-01

In the present paper, the experience with detection of intron 22 inversion of F8C gene in severe hemophilia A patients using a recently described long-distance PCR (LD-PCR) method was reported. To test the sensitivity and the specifity of the LD-PCR, analysis of 46 DNA samples of patients and their family members, previously tested by Southern hybridization, was performed. In addition, 16 DNA samples of severe hemophilia A patients in which causative mutation was unknown, were included in analysis. Four-primers, P, Q, A&B, which are able to differentiate between the affected males with or without the inversion, and in female carriers, were used in LD-PCR. Two primers, P&Q, are located within the F8C gene flanking int22h1. Two further primers, A&B, flank int22h2 and int22h3, extragene homologs of int22h1. Nine combinations of four primers were used to identify the optimal one. Four-primers (P, Q, A&B), three-primers (P,Q & B;P, A & B; A, B & Q;P, Q & A) and two-primers (A & B; P & Q; A & Q; P & B) PCR amplifications were performed in the hemophilia A patients as well as in obligate carriers DNA samples. Successful amplification required introduction of some modifications of the original protocol. The most reproducible and uniform results were obtained using two-primers PCR, performed in four single reactions. Thus, a total of 46 DNA samples, 22 were hemizygous for inversion, 6 without the inversion, 14 carriers and 4 non-carriers of inversion. Perfect correlation between genotypes determined using Southern hybridization and LD-PCR was achieved. The optimalized two-primers LD-PCR protocol was used for analysis of 16 DNA samples of severe hemophilia A patients with unknown mutation. Ten cases of inversions and six cases without them were detected. Thus in additional 10 severe hemophilic patients DNA diagnosis was completed. The most successful and reproducible results were obtained performing four single LD-PCR reactions with combinations of two-primers A & B; P & Q; A&Q, and P&B in each DNA sample and this approach is recommended for routine using in clinical practice.

Impact of gamma rays on the Phaffia rhodozyma genome revealed by RAPD-PCR.

PubMed

Najafi, N; Hosseini, Ramin; Ahmadi, Ar

2011-12-01

Phaffia rhodozyma is a red yeast which produces astaxanthin as the major carotenoid pigment. Astaxanthin is thought to reduce the incidence of cancer and degenerative diseases in man. It also enhances the immune response and acts as a free-radical quencher, a precursor of vitamin A, or a pigment involved in the visual attraction of animals as mating partners. The impact of gamma irradiation was studied on the Phaffia rhodozyma genome. Ten mutant strains, designated Gam1-Gam10, were obtained using gamma irradiation. Ten decamer random amplified polymorphic DNA (RAPD) primers were employed to assess genetic changes. Nine primers revealed scorable polymorphisms and a total of 95 band positions were scored; amongst which 38 bands (37.5%) were polymorphic. Primer F with 3 bands and primer J20 with 13 bands produced the lowest and the highest number of bands, respectively. Primer A16 produced the highest number of polymorphic bands (70% polymorphism) and primer F showed the lowest number of polymorphic bands (0% polymorphism). Genetic distances were calculated using Jaccard's coefficient and the UPGMA method. A dendrogram was created using SPSS (version 11.5) and the strains were clustered into four groups. RAPD markers could distinguish between the parental and the mutant strains of P. rhodozyma. RAPD technique showed that some changes had occurred in the genome of the mutated strains. This technique demonstrated the capability to differentiate between the parental and the mutant strains.

Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

PubMed Central

Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

2015-01-01

The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

PubMed

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

PubMed Central

2012-01-01

Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

PrimerZ: streamlined primer design for promoters, exons and human SNPs.

PubMed

Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

2007-07-01

PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

Identification of Erwinia species isolated from apples and pears by differential PCR.

PubMed

Gehring, I; Geider, K

2012-04-01

Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.

Marker-assisted selection for recognizing wheat mutant genotypes carrying HMW glutenin alleles related to baking quality.

PubMed

Zamani, Mohammad Javad; Bihamta, Mohammad Reza; Naserian Khiabani, Behnam; Tahernezhad, Zahra; Hallajian, Mohammad Taher; Shamsi, Marzieh Varasteh

2014-01-01

Allelic diversity of HMW glutenin loci in several studies revealed that allelic combinations affect dough quality. Dx5 + Dy10 subunits are related to good baking quality and Dx2 + Dy12 are related to undesirable baking quality. One of the most regular methods to evaluate the baking quality is SDS-PAGE which is used to improve baking quality labs. Marker-assisted selection is the method which can recognize the alleles related to baking quality and this method is based on polymerase chain reaction. 10 pairs of specific primers related to Dx2, Dx2.1, Dx5, Dy10, and Dy12 subunits were used for recognizing baking quality of some wheat varieties and some mutant genotypes. Only 5 pairs of them could show the specific bands. All subunits were recognized by the primers except Dx2.1. Some of the primers were extracted from previous studies and the others were designed based on D genome subunits of wheat. SDS-PAGE method accomplished having confidence in these marker's results. To realize the effect of mutation, seed storage proteins were measured. It showed that mutation had effect on the amount of seed storage protein on the mutant seeds (which showed polymorphism).

Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

PubMed

Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

2013-03-01

Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Amplification of DNA of Xanthomonas axonopodis pv. citri from historic citrus canker herbarium specimens.

PubMed

Li, Wenbin; Brlansky, Ronald H; Hartung, John S

2006-05-01

Herbaria are important resources for the study of the origins and dispersal of plant pathogens, particularly bacterial plant pathogens that incite local lesions in which large numbers of pathogen genomes are concentrated. Xanthomonas axonopodis pv. citri (Xac), the causal agent of citrus bacterial canker disease, is a notable example of such a pathogen. The appearance of novel strains of the pathogen in Florida and elsewhere make it increasingly important to understand the relationships among strains of this pathogen. USDA-ARS at Beltsville, Maryland maintains approximately 700 herbarium specimens with citrus canker disease lesions up to 90 years old, originally collected from all over the world, and so is an important resource for phytogeographic studies of this bacterium. Unfortunately, DNA in herbarium specimens is degraded and may contain high levels of inhibitors of PCR. In this study, we compared a total of 23 DNA isolation techniques in combination with 31 novel primer pairs in order to develop an efficient protocol for the analysis of Xac DNA in herbarium specimens. We identified the most reliable extraction method, identified in terms of successful amplification by our panel of 31 primer pairs. We also identified the most robust primer pairs, identified as successful in the largest number of extracts prepared by different methods. We amplified Xac genomic sequences up to 542 bp long from herbarium samples up to 89 years old. Primers varied in effectiveness, with some primer pairs amplifying Xac DNA from a 1/10,000 dilution of extract from a single lesion from a citrus canker herbarium specimen. Our methodology will be useful to identify pathogens and perform molecular analyses of bacterial and possibly fungal genomes from herbarium specimens.

Bond strength of poly(methyl methacrylate) denture base material to cast titanium and cobalt-chromium alloy.

PubMed

Matsuda, Yasuhiro; Yanagida, Hiroaki; Ide, Takako; Matsumura, Hideo; Tanoue, Naomi

2010-06-01

The shear bond strength of an auto-polymerizing poly(methyl methacrylate) denture base resin material to cast titanium and cobalt-chromium alloy treated with six conditioning methods was investigated. Disk specimens (10 mm in diameter and 2.5 mm in thickness) were cast from pure titanium and cobalt-chromium alloy. The specimens were wet ground to a final surface finish of 600 grit, air dried, and treated with the following bonding systems: 1) air abraded with 50-70-microm-grain alumina (SAN); 2) air abraded with 50-70-microm-grain alumina + conditioned with Alloy Primer (ALP); 3) air abraded with 50-70-microm-grain alumina + conditioned with AZ Primer (AZP); 4) air abraded with 50-70-microm-grain alumina + conditioned with Estenia Opaque Primer (EOP); 5) air abraded with 50-70-microm-grain alumina + conditioned with Metal Link Primer (MLP), and 6) treated with ROCATEC system (ROC). A denture base material (Palapress Vario) was then applied to each metal specimen. Shear bond strengths were determined before and after 10,000 thermocycles. The strengths decreased after thermocycling in all combinations. Among the treatment methods assessed, groups 2 and 4 showed significantly (p < 0.05) enhanced shear bond strengths for both metals. In group 4, the strength in MPa (n = 7) after thermocycling for cobalt-chromium alloy was 38.3, which was statistically (p < 0.05) higher than that for cast titanium (34.7). Air abrasion followed by the application of two primers containing a hydrophobic phosphate monomer (MDP) effectively improved the strength of the bond of denture base material to cast titanium and cobalt-chromium alloy.

Heat-mediated activation of affinity-immobilized Taq DNA polymerase.

PubMed

Nilsson, J; Bosnes, M; Larsen, F; Nygren, P A; Uhlén, M; Lundeberg, J

1997-04-01

A novel strategy for heat-mediated activation of recombinant Taq DNA polymerase is described. A serum albumin binding protein tag is used to affinity-immobilize an E. coli-expressed Taq DNA polymerase fusion protein onto a solid support coated with human serum albumin (HSA). Analysis of heat-mediated elution showed that elevated temperatures (> 70 degrees C) were required to significantly release the fusion protein from the solid support. A primer-extension assay showed that immobilization of the fusion protein resulted in little or no extension product. In contrast, fusion protein released from the HSA ligand by heat showed high polymerase activity. Thus, a heat-mediated release and reactivation of the Taq DNA polymerase fusion protein from the solid support can be obtained to allow for hot-start PCR with improved amplification performance.

Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

USGS Publications Warehouse

Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

2007-01-01

The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

Cultivation-Independent Characterization of Methylobacterium Populations in the Plant Phyllosphere by Automated Ribosomal Intergenic Spacer Analysis▿ †

PubMed Central

Knief, Claudia; Frances, Lisa; Cantet, Franck; Vorholt, Julia A.

2008-01-01

Bacteria of the genus Methylobacterium are widespread in the environment, but their ecological role in ecosystems, such as the plant phyllosphere, is not very well understood. To gain better insight into the distribution of different Methylobacterium species in diverse ecosystems, a rapid and specific cultivation-independent method for detection of these organisms and analysis of their community structure is needed. Therefore, 16S rRNA gene-targeted primers specific for this genus were designed and evaluated. These primers were used in PCR in combination with a reverse primer that binds to the tRNAAla gene, which is located upstream of the 23S rRNA gene in the 16S-23S intergenic spacer (IGS). PCR products that were of different lengths were obtained due to the length heterogeneity of the IGS of different Methylobacterium species. This length variation allowed generation of fingerprints of Methylobacterium communities in environmental samples by automated ribosomal intergenic spacer analysis. The Methylobacterium communities on leaves of different plant species in a natural field were compared using this method. The new method allows rapid comparisons of Methylobacterium communities and is thus a useful tool to study Methylobacterium communities in different ecosystems. PMID:18263752

Forensic SNP genotyping with SNaPshot: Technical considerations for the development and optimization of multiplexed SNP assays.

PubMed

Fondevila, M; Børsting, C; Phillips, C; de la Puente, M; Consortium, Euroforen-NoE; Carracedo, A; Morling, N; Lareu, M V

2017-01-01

This review explores the key factors that influence the optimization, routine use, and profile interpretation of the SNaPshot single-base extension (SBE) system applied to forensic single-nucleotide polymorphism (SNP) genotyping. Despite being a mainly complimentary DNA genotyping technique to routine STR profiling, use of SNaPshot is an important part of the development of SNP sets for a wide range of forensic applications with these markers, from genotyping highly degraded DNA with very short amplicons to the introduction of SNPs to ascertain the ancestry and physical characteristics of an unidentified contact trace donor. However, this technology, as resourceful as it is, displays several features that depart from the usual STR genotyping far enough to demand a certain degree of expertise from the forensic analyst before tackling the complex casework on which SNaPshot application provides an advantage. In order to provide the basis for developing such expertise, we cover in this paper the most challenging aspects of the SNaPshot technology, focusing on the steps taken to design primer sets, optimize the PCR and single-base extension chemistries, and the important features of the peak patterns observed in typical forensic SNP profiles using SNaPshot. With that purpose in mind, we provide guidelines and troubleshooting for multiplex-SNaPshot-oriented primer design and the resulting capillary electrophoresis (CE) profile interpretation (covering the most commonly observed artifacts and expected departures from the ideal conditions). Copyright © 2017 Central Police University.

RNA Structural Analysis by Evolving SHAPE Chemistry

PubMed Central

Spitale, Robert C.; Flynn, Ryan A.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

2017-01-01

RNA is central to the flow of biological information. From transcription to splicing, RNA localization, translation, and decay, RNA is intimately involved in regulating every step of the gene expression program, and is thus essential for health and understanding disease. RNA has the unique ability to base-pair with itself and other nucleic acids to form complex structures. Hence the information content in RNA is not simply its linear sequence of bases, but is also encoded in complex folding of RNA molecules. A general chemical functionality that all RNAs have is a 2’-hydroxyl group in the ribose ring, and the reactivity of the 2'-hydroxyl in RNA is gated by local nucleotide flexibility. In other words, the 2'-hydroxyl is reactive at single-stranded and conformationally flexible positions but is unreactive at nucleotides constrained by base pairing. Recent efforts have been focused on developing reagents that modify RNA as a function of RNA 2’ hydroxyl group flexibility. Such RNA structure probing techniques can be read out by primer extension in experiments termed RNA SHAPE (Selective 2’ Hydroxyl Acylation and Primer Extension). Herein we describe the efforts devoted to the design and utilization of SHAPE probes for characterizing RNA structure. We also describe current technological advances that are being used to utilize SHAPE chemistry with deep sequencing to probe many RNAs in parallel. The merger of chemistry with genomics is sure to open the door to genome-wide exploration of RNA structure and function. PMID:25132067

Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames.

PubMed Central

Hall, R L; Moyer, R W

1991-01-01

Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245

Recent sequence variation in probe binding site affected detection of respiratory syncytial virus group B by real-time RT-PCR.

PubMed

Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James

2017-03-01

Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR

PubMed Central

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.

New universal ITS2 primers for high-resolution herbivory analyses using DNA metabarcoding in both tropical and temperate zones.

PubMed

Moorhouse-Gann, Rosemary J; Dunn, Jenny C; de Vere, Natasha; Goder, Martine; Cole, Nik; Hipperson, Helen; Symondson, William O C

2018-06-04

DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187-387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.

Simple sequence repeat markers useful for sorghum downy mildew (Peronosclerospora sorghi) and related species

PubMed Central

Perumal, Ramasamy; Nimmakayala, Padmavathi; Erattaimuthu, Saradha R; No, Eun-Gyu; Reddy, Umesh K; Prom, Louis K; Odvody, Gary N; Luster, Douglas G; Magill, Clint W

2008-01-01

Background A recent outbreak of sorghum downy mildew in Texas has led to the discovery of both metalaxyl resistance and a new pathotype in the causal organism, Peronosclerospora sorghi. These observations and the difficulty in resolving among phylogenetically related downy mildew pathogens dramatically point out the need for simply scored markers in order to differentiate among isolates and species, and to study the population structure within these obligate oomycetes. Here we present the initial results from the use of a biotin capture method to discover, clone and develop PCR primers that permit the use of simple sequence repeats (microsatellites) to detect differences at the DNA level. Results Among the 55 primers pairs designed from clones from pathotype 3 of P. sorghi, 36 flanked microsatellite loci containing simple repeats, including 28 (55%) with dinucleotide repeats and 6 (11%) with trinucleotide repeats. A total of 22 microsatellites with CA/AC or GT/TG repeats were the most abundant (40%) and GA/AG or CT/TC types contribute 15% in our collection. When used to amplify DNA from 19 isolates from P. sorghi, as well as from 5 related species that cause downy mildew on other hosts, the number of different bands detected for each SSR primer pair using a LI-COR- DNA Analyzer ranged from two to eight. Successful cross-amplification for 12 primer pairs studied in detail using DNA from downy mildews that attack maize (P. maydis & P. philippinensis), sugar cane (P. sacchari), pearl millet (Sclerospora graminicola) and rose (Peronospora sparsa) indicate that the flanking regions are conserved in all these species. A total of 15 SSR amplicons unique to P. philippinensis (one of the potential threats to US maize production) were detected, and these have potential for development of diagnostic tests. A total of 260 alleles were obtained using 54 microsatellites primer combinations, with an average of 4.8 polymorphic markers per SSR across 34 Peronosclerospora, Peronospora and Sclerospora spp isolates studied. Cluster analysis by UPGMA as well as principal coordinate analysis (PCA) grouped the 34 isolates into three distinct groups (all 19 isolates of Peronosclerospora sorghi in cluster I, five isolates of P. maydis and three isolates of P. sacchari in cluster II and five isolates of Sclerospora graminicola in cluster III). Conclusion To our knowledge, this is the first attempt to extensively develop SSR markers from Peronosclerospora genomic DNA. The newly developed SSR markers can be readily used to distinguish isolates within several species of the oomycetes that cause downy mildew diseases. Also, microsatellite fragments likely include retrotransposon regions of DNA and these sequences can serve as useful genetic markers for strain identification, due to their degree of variability and their widespread occurrence among sorghum, maize, sugarcane, pearl millet and rose downy mildew isolates. PMID:19040756

Status of NC Primer Demonstration & Transition

DTIC Science & Technology

2014-11-20

Camo Paint Scheme H-53 • Six a/c selected for demonstration of Hentzen 17176KEP FRCE • Full non-chromate coating stack-up demo – Hentzen...CCC • BUNO #: #163076 #163080 #164859 11 NC Primer Demos: Camo Paint Scheme F/A-18A-D • 13 a/c selected for demonstration of PPG-Deft 02-GN... Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K

Amplification of trace amounts of nucleic acids

DOEpatents

Church, George M [Brookline, MA; Zhang, Kun [Brighton, MA

2008-06-17

Methods of reducing background during amplification of small amounts of nucleic acids employ careful analysis of sources of low level contamination. Ultraviolet light can be used to reduce nucleic acid contaminants in reagents and equipment. "Primer-dimer" background can be reduced by judicious design of primers. We have shown clean signal-to-noise with as little as starting material as one single human cell (.about.6 picogram), E. coli cell (.about.5 femtogram) or Prochlorococcus cell (.about.3 femtogram).

Shear bond strength of orthodontic metal brackets to aged composite using three primers

PubMed Central

Tayebi, Ali; Fallahzadeh, Farnoosh

2017-01-01

Background This study aimed to assess the effect of surface preparation with sandblasting and diamond bur along with the use of three primers on shear bond strength (SBS) of metal brackets to aged composite. Material and Methods In this in vitro, experimental study, 60 Filtek Z250 composite discs were fabricated (10×2mm), immersed in distilled water for 24 hours and subjected to 5000 thermal cycles. They were randomly divided into two groups (n=30) of sandblasting with aluminum oxide particles for 10 seconds and surface roughening with bur. Each group was randomly divided into three subgroups (n=10) for use of Transbond XT, Assure Plus and Composite Primer. Metal brackets were bonded and the samples were stored in distilled water for 24 hours followed by 2000 thermal cycles. The SBS of brackets was measured and the adhesive remnant index (ARI) score was calculated. The data were analyzed by one-way ANOVA, t-test and Chi square test. Results The difference in the mean SBS was not significant among the six subgroups. Conclusions All combinations of primers and surface preparation methods provided adequately high SBS between brackets and aged composite surfaces. Considering the ARI scores, surface roughening by bur is superior to sandblasting. Key words:Shear strength, composite resins, orthodontic brackets, aged composite, surface preparation. PMID:28638550

Competitive amplification of differentially melting amplicons (CADMA) enables sensitive and direct detection of all mutation types by high-resolution melting analysis.

PubMed

Kristensen, Lasse S; Andersen, Gitte B; Hager, Henrik; Hansen, Lise Lotte

2012-01-01

Sensitive and specific mutation detection is of particular importance in cancer diagnostics, prognostics, and individualized patient treatment. However, the majority of molecular methodologies that have been developed with the aim of increasing the sensitivity of mutation testing have drawbacks in terms of specificity, convenience, or costs. Here, we have established a new method, Competitive Amplification of Differentially Melting Amplicons (CADMA), which allows very sensitive and specific detection of all mutation types. The principle of the method is to amplify wild-type and mutated sequences simultaneously using a three-primer system. A mutation-specific primer is designed to introduce melting temperature decreasing mutations in the resulting mutated amplicon, while a second overlapping primer is designed to amplify both wild-type and mutated sequences. When combined with a third common primer very sensitive mutation detection becomes possible, when using high-resolution melting (HRM) as detection platform. The introduction of melting temperature decreasing mutations in the mutated amplicon also allows for further mutation enrichment by fast coamplification at lower denaturation temperature PCR (COLD-PCR). For proof-of-concept, we have designed CADMA assays for clinically relevant BRAF, EGFR, KRAS, and PIK3CA mutations, which are sensitive to, between 0.025% and 0.25%, mutated alleles in a wild-type background. In conclusion, CADMA enables highly sensitive and specific mutation detection by HRM analysis. © 2011 Wiley Periodicals, Inc.

Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

PubMed

Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

2017-08-01

The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

PubMed

Abdulmawjood, A; Roth, S; Bülte, M

2002-10-01

For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

PubMed Central

Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

2006-01-01

PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

Molecular and agronomic analysis of intraspecific variability in Capsicum baccatum var. pendulum accessions.

PubMed

Leite, P S S; Rodrigues, R; Silva, R N O; Pimenta, S; Medeiros, A M; Bento, C S; Gonçalves, L S A

2016-10-05

Capsicum baccatum is one of the most important chili peppers in South America, since this region is considered to be the center of origin and diversity of this species. In Brazil, C. baccatum has been widely explored by family farmers and there are different local names for each fruit phenotype, such as cambuci and dedo-de-moça (lady's finger). Although very popular among farmers and consumers, C. baccatum has been less extensively studied than other Capsicum species. This study describes the phenotypic and genotypic variability in C. baccatum var. pendulum accessions. Twenty-nine accessions from the Universidade Estadual do Norte Fluminense Darcy Ribeiro gene bank, and one commercial genotype ('BRS-Mari') were evaluated for 53 morphoagronomic descriptors (31 qualitative and 22 quantitative traits). In addition, accessions were genotyped using 30 microsatellite primers. Three accessions from the C. annuum complex were included in the molecular characterization. Nine of 31 qualitative descriptors were monomorphic, while all quantitative descriptors were highly significant different between accessions (P < 0.01). Using the unweighted pair group method using arithmetic averages, four groups were obtained based on multicategoric variables and five groups were obtained based on quantitative variables. In the genotyping analysis, 12 polymorphic simple sequence repeat primers amplified in C. baccatum with dissimilarity between accessions ranging from 0.13 to 0.91, permitting the formation of two distinct groups for Bayesian analysis. These results indicate wide variability among the accessions comparing phenotypic and genotypic data and revealed distinct patterns of dissimilarity between matrices, indicating that both steps are valuable for the characterization of C. baccatum var. pendulum accessions.

A microsphere-based assay for mutation analysis of the biotinidase gene using dried blood spots

PubMed Central

Lindau-Shepard, Barbara; Janik, David K.; Pass, Kenneth A.

2012-01-01

Biotinidase deficiency is an autosomal recessive syndrome caused by defects in the biotinidase gene, the product of which affects biotin metabolism. Newborn screening (NBS) for biotinidase deficiency can identify affected infants prior to onset of symptoms; biotin supplementation can resolve or prevent the clinical features. In NBS, dry blood spots (DBS) are usually tested for biotinidase enzyme activity by colorimetric analysis. By taking advantage of the multiplexing capabilities of the Luminex platform, we have developed a microsphere-based array genotyping method for the simultaneous detection of six disease causing mutations in the biotinidase gene, thereby permitting a second tier of molecular analysis. Genomic DNA was extracted from 3.2 mm DBS. Biotinidase gene sequences, containing the mutations of interest, were amplified by multiplexed polymerase chain reaction, followed by multiplexed allele-specific primer extension using universally tagged genotyping primers. The products were then hybridized to anti-tag carrying xTAG microspheres and detected on the Luminex platform. Genotypes were verified by sequencing. Genotyping results of 22 known biotinidase deficient samples by our xTAG biotinidase assay was in concordance with the results obtained from DNA sequencing, for all 6 mutations used in our panel. These results indicate that genotyping by an xTAG microsphere-based array is accurate, flexible, and can be adapted for high-throughput. Since NBS for biotinidase deficiency is by enzymatic assay, less than optimal quality of the DBS itself can compromise enzyme activity, while the DNA from these samples mostly remains unaffected. This assay warrants evaluation as a viable complement to the biotinidase semi-quantitative colorimetric assay. PMID:27625817

Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

PubMed

Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

2013-02-01

Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

[Optimized application of nested PCR method for detection of malaria].

PubMed

Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

2017-04-28

Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P < 0.05). Conclusion The optimized PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

Comparison of shear test methods for evaluating the bond strength of resin cement to zirconia ceramic.

PubMed

Kim, Jae-Hoon; Chae, Soyeon; Lee, Yunhee; Han, Geum-Jun; Cho, Byeong-Hoon

2014-11-01

This study compared the sensitivity of three shear test methods for measuring the shear bond strength (SBS) of resin cement to zirconia ceramic and evaluated the effects of surface treatment methods on the bonding. Polished zirconia ceramic (Cercon base, DeguDent) discs were randomly divided into four surface treatment groups: no treatment (C), airborne-particle abrasion (A), conditioning with Alloy primer (Kuraray Medical Co.) (P) and conditioning with Alloy primer after airborne-particle abrasion (AP). The bond strengths of the resin cement (Multilink N, Ivoclar Vivadent) to the zirconia specimens of each surface treatment group were determined by three SBS test methods: the conventional SBS test with direct filling of the mold (Ø 4 mm × 3 mm) with resin cement (Method 1), the conventional SBS test with cementation of composite cylinders (Ø 4 mm × 3 mm) using resin cement (Method 2) and the microshear bond strength (μSBS) test with cementation of composite cylinders (Ø 0.8 mm × 1 mm) using resin cement (Method 3). Both the test method and the surface treatment significantly influenced the SBS values. In Method 3, as the SBS values increased, the coefficients of variation decreased and the Weibull parameters increased. The AP groups showed the highest SBS in all of the test methods. Only in Method 3 did the P group show a higher SBS than the A group. The μSBS test was more sensitive to differentiating the effects of surface treatment methods than the conventional SBS tests. Primer conditioning was a stronger contributing factor for the resin bond to zirconia ceramic than was airborne-particle abrasion.

Construction of a primary DNA fingerprint database for cotton cultivars.

PubMed

Zhang, Y C; Kuang, M; Yang, W H; Xu, H X; Zhou, D Y; Wang, Y Q; Feng, X A; Su, C; Wang, F

2013-06-13

Forty core primers were used to construct a DNA fingerprint database of 132 cotton species based on multiplex fluorescence detection technology. A high first successful ratio of 99.04% was demonstrated with tetraplex polymerase chain reaction. Forty primer pairs amplified a total of 262 genotypes among 132 species, with an average of 6.55 per primer and values of polymorphism information content varying from 0.340 to 0.882. Conflicting DNA homozygous ratios were found in various species. The highest DNA homozygous ratio was found in landrace standard cultivars, which had an 81.46% DNA homozygous ratio. The lowest occurred in a group of 2010 leading cultivars with a homozygous ratio of 63.04%. Genetic diversity of the 132 species was briefly analyzed using unweighted pair-group method with arithmetic means.

Development and characterization of 32 microsatellite loci in Genipa americana (Rubiaceae)1

PubMed Central

Manoel, Ricardo O.; Freitas, Miguel L. M.; Barreto, Mariana A.; Moraes, Mário L. T.; Souza, Anete P.; Sebbenn, Alexandre M.

2014-01-01

• Premise of the study: Microsatellite primers were developed for the tree species Genipa americana (Rubiaceae) for further population genetic studies. • Methods and Results: We identified 144 clones containing 65 repeat motifs from a genomic library enriched for (CT)8 and (GT)8 motifs. Primer pairs were developed for 32 microsatellite loci and validated in 40 individuals of two natural G. americana populations. Seventeen loci were polymorphic, revealing from three to seven alleles per locus. The observed and expected heterozygosities ranged from 0.24 to 1.00 and from 0.22 to 0.78, respectively. • Conclusions: The 17 primers identified as polymorphic loci are suitable to study the genetic diversity and structure, mating system, and gene flow in G. americana. PMID:25202610

Effect of surface treatments on the bond strengths of facing composite resins to zirconia copings.

PubMed

Tsumita, M; Kokubo, Y; Kano, T

2012-09-01

The present study evaluated and compared the bond strength between zirconia and facing composite resin using different surface conditioning methods before and after thermocycling. Four primers, three opaque resins, and two facing composite resins were used, and 10 surface treatment procedures were conducted. The bond strength was measured before and after 4,000 cycles of thermocycling. The mean values of each group were statistically analyzed using one-way analysis of variance (ANOVA). The bond strengths of facing composite resins to zirconia after various treatments varied depending on the primers, opaque resins, body resins, and thermocycling. The application of primers and opaque resins to the zirconia surface after sandblasting is expected to yield strong bond strength of the facing composite resin (Estenia CG&B) even after thermocycling.

Characterization of 10 new nuclear microsatellite markers in Acca sellowiana (Myrtaceae)1

PubMed Central

Klabunde, Gustavo H. F.; Olkoski, Denise; Vilperte, Vinicius; Zucchi, Maria I.; Nodari, Rubens O.

2014-01-01

• Premise of the study: Microsatellite primers were identified and characterized in Acca sellowiana in order to expand the limited number of pre-existing polymorphic markers for use in population genetic studies for conservation, phylogeography, breeding, and domestication. • Methods and Results: A total of 10 polymorphic microsatellite primers were designed from clones obtained from a simple sequence repeat (SSR)–enriched genomic library. The primers amplified di- and trinucleotide repeats with four to 27 alleles per locus. In all tested populations, the observed heterozygosity ranged from 0.269 to 1.0. • Conclusions: These new polymorphic SSR markers will allow future genetic studies to be denser, either for genetic structure characterization of natural populations or for studies involving genetic breeding and domestication process in A. sellowiana. PMID:25202632

Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †

PubMed Central

Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary

2008-01-01

Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

PubMed

Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

2015-06-01

The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR

PubMed Central

Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209

Genetic diversity in intraspecific hybrid populations of Eucommia ulmoides Oliver evaluated from ISSR and SRAP molecular marker analysis.

PubMed

Yu, J; Wang, Y; Ru, M; Peng, L; Liang, Z S

2015-07-03

Eucommia ulmoides Oliver, the only extant species of Eucommiaceae, is a second-category state-protected endangered plant in China. Evaluation of genetic diversity among some intraspecific hybrid populations of E. ulmoides Oliver is vital for breeding programs and further conservation of this rare species. We studied the genetic diversity of 130 accessions from 13 E. ulmoides intraspecific hybrid populations using inter-simple sequence related (ISSR) and sequence-related amplified polymorphism (SRAP) markers. Of the 100 ISSR primers and 100 SRAP primer combinations screened, eight ISSRs and eight SRAPs were used to evaluate the level of polymorphism and discriminating capacity. A total number of 65 bands were amplified using eight ISSR primers, in which 50 bands (76.9%) were polymorphic, with an average of 8.1 polymorphic fragments per primer. Alternatively, another 244 bands were observed using eight SRAP primer combinations, and 163 (66.8%) of them were polymorphic, with an average of 30.5 polymorphic fragments per primer. The unweighted pair-group method (UPGMA) analysis showed that these 13 populations could be classified into three groups by the ISSR marker and two groups by the SRAP marker. Principal coordinate analysis using SRAP was completely identical to the UPGMA-based clustering, although this was partly confirmed by the results of UPGMA cluster analysis using the ISSR marker. This study provides insights into the genetic background of E. ulmoides intraspecific hybrids. The progenies of the variations "Huazhong-3", "big fruit", "Yanci", and "smooth bark" present high genetic diversity and offer great potential for E. ulmoides breeding and conservation.

Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers

DTIC Science & Technology

2008-12-01

sample) was as follows: 5 µL buffer, 2 µL MgCl2, 2.5 µL DMSO, 1 µL betaine , 1 µL each dNTP, 2.5 µL F primer, 2.5 µL R primer, 0.54 µL taq polymerase...and 25.1 µL H2O. Betaine and increased DMSO were added to the master mix to eliminate polymerase jumping during PCR ampli- fication.10 Using the

Identification of a locus characteristic of male individuals of buffalo grass [Buchloe dactyloides (Nutt.) Engelm.] by using an RAPD marker.

PubMed

Li, Y X; Wang, X G; Yang, C H; Cong, L L; Wu, F F; Xue, J G; Han, Y H

2013-09-27

Buffalo grass [Buchloe dactyloides (Nutt.) Engelm.] plants can be either male, female, or hermaphrodite (monoecious). As there is no morphological difference in the early vegetative growth of these three classes of plants, it is worthwhile to use molecular biological methods to attempt to identify the sex of a plant at this early growth period. In this study, we identified 23 plants that had a stable sex for over at least 3 years. Of these, 9 were male plants, 10 were female plants, and 4 were hermaphrodites. Screening of 300 RAPD primers identified a primer, namely S211 (5'-ttccccgcga-3'), which is capable of identifying male plants. The specific fragment was cloned, sequenced, and submitted to the GenBank database (accession No. JN982469). When used to identify the sex of 188 plants during their first growing season, the S211 primer correctly identified 85.8% of all male plants. Our results showed that the S211 primer can identify the male, and in doing so, it facilitates buffalo grass breeding work.

One Primer To Rule Them All: Universal Primer That Adds BBa_B0034 Ribosomal Binding Site to Any Coding Standard 10 BioBrick

PubMed Central

2015-01-01

Here, we present a universal, simple, efficient, and reliable way to add small BioBrick parts to any BioBrick via PCR that is compatible with BioBrick assembly standard 10. As a proof of principle, we have designed a universal primer, rbs_B0034, that contains a ribosomal binding site (RBS; BBa_B0034) and that can be used in PCR to amplify any coding BioBrick that starts with ATG. We performed test PCRs with rbs_B0034 on 31 different targets and found it to be 93.6% efficient. Moreover, when supplemented with a complementary primer, addition of RBS can be accomplished via whole plasmid site-directed mutagenesis, thus reducing the time required for further assembly of composite parts. The described method brings simplicity to the addition of small parts, such as regulatory elements to existing BioBricks. The final product of the PCR assembly is indistinguishable from the standard or 3A BioBrick assembly. PMID:25524097

Development of microsatellite markers of vandaceous orchids for species and variety identification.

PubMed

Peyachoknagul, S; Nettuwakul, C; Phuekvilai, P; Wannapinpong, S; Srikulnath, K

2014-07-24

Vandaceous orchids are a group of orchid genera in the subfamily Vandoideae. Among this group, Mokara, Phalaenopsis, and Vanda are the most popular and commercially important orchids in Thailand. Novel microsatellite markers were developed from Mokara, the intergeneric hybrid from 3 genera Vanda, Ascocentrum, and Arachnis by using enriched method. Six primers from this study plus one primer previously developed from Vanda genome, a total of 7 markers, were selected to characterize 4 orchid genera (Mokara, Vanda, Rhynchostylis, and Ascocenda). The observed and expected heterozygosities varied in the 4 genera from 0.0000-1.0000 and 0.0000-0.8765, respectively. The transferability of these primers was also investigated in 76 vandaceous orchids from 12 genera. Three primer pairs, MOK26, MOK29, and MOK62, could successfully amplify the DNA of all samples, while MOK103 could be used with most of the samples. The total number of alleles from 76 samples ranged from 3 to 19 alleles per locus, with an average of 8.5714. Therefore, these markers could be used for variety/ species identification, certification and protection, genetic diversity, and evolutionary studies.

Comparison of Ribotyping, Randomly Amplified Polymorphic DNA Analysis, and Pulsed-Field Gel Electrophoresis in Typing of Lactobacillus rhamnosus and L. casei Strains

PubMed Central

Tynkkynen, Soile; Satokari, Reetta; Saarela, Maria; Mattila-Sandholm, Tiina; Saxelin, Maija

1999-01-01

A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively. PMID:10473394

Comparison of ribotyping, randomly amplified polymorphic DNA analysis, and pulsed-field gel electrophoresis in typing of Lactobacillus rhamnosus and L. casei strains.

PubMed

Tynkkynen, S; Satokari, R; Saarela, M; Mattila-Sandholm, T; Saxelin, M

1999-09-01

A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively.

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

PubMed

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

Allelic inhibition of displacement activity: a simplified one tube allele-specific PCR for evaluation of ITPA polymorphisms.

PubMed

Galmozzi, E; Facchetti, F; Degasperi, E; Aghemo, A; Lampertico, P

2013-02-01

Recently, genome-wide association studies (GWAS) in patients with chronic hepatitis C virus (HCV) infection have identified two functional single nucleotide polymorphisms (SNPs) in the inosine triphosphatase (ITPA) gene, that are associated strongly and independently with hemolytic anemia in patients exposed to pegylated-interferon (Peg-IFN) plus ribavirin (RBV) combined therapy. Here has been developed a simplified allele discrimination polymerase chain reaction (PCR) assay named allelic inhibition of displacement activity (AIDA) for evaluation of ITPA polymorphisms. AIDA system relies on three unlabeled primers only, two outer common primers and one inner primer with allele-specific 3' terminus mismatch. DNA samples from 192 patients with chronic HCV infection were used to validate the AIDA system and results were compared with the gold standard TaqMan(®) SNP genotyping assay. Concordant data were obtained for all samples, granting for high specificity of the method. In conclusion, AIDA is a practical one-tube method to reproducibly and to assess accurately rs7270101 and rs1127354 ITPA SNPs. Copyright © 2012 Elsevier B.V. All rights reserved.

Identification of Staphylococcus spp. using (GTG)₅-PCR fingerprinting.

PubMed

Svec, Pavel; Pantůček, Roman; Petráš, Petr; Sedláček, Ivo; Nováková, Dana

2010-12-01

A group of 212 type and reference strains deposited in the Czech Collection of Microorganisms (Brno, Czech Republic) and covering 41 Staphylococcus species comprising 21 subspecies was characterised using rep-PCR fingerprinting with the (GTG)₅ primer in order to evaluate this method for identification of staphylococci. All strains were typeable using the (GTG)₅ primer and generated PCR products ranging from 200 to 4500 bp. Numerical analysis of the obtained fingerprints revealed (sub)species-specific clustering corresponding with the taxonomic position of analysed strains. Taxonomic position of selected strains representing the (sub)species that were distributed over multiple rep-PCR clusters was verified and confirmed by the partial rpoB gene sequencing. Staphylococcus caprae, Staphylococcus equorum, Staphylococcus sciuri, Staphylococcus piscifermentans, Staphylococcus xylosus, and Staphylococcus saprophyticus revealed heterogeneous fingerprints and each (sub)species was distributed over several clusters. However, representatives of the remaining Staphylococcus spp. were clearly separated in single (sub)species-specific clusters. These results showed rep-PCR with the (GTG)₅ primer as a fast and reliable method applicable for differentiation and straightforward identification of majority of Staphylococcus spp. Copyright © 2010 Elsevier GmbH. All rights reserved.

Identification of genes from pattern formation, tyrosine kinase, and potassium channel families by DNA amplification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamb, A.; Weir, M.; Rudy, B.

1989-06-01

The study of gene family members has been aided by the isolation of related genes on the basis of DNA homology. The authors have adapted the polymerase chain reaction to screen animal genomes very rapidly and reliably for likely gene family members. Using conserved amino acid sequences to design degenerate oligonucleotide primers, they have shown that the genome of the nematode Caenorhabditis elegans contains sequences homologous to many Drosophila genes involved in pattern formation, including the segment polarity gene wingless (vertebrate int-1), and homeobox sequences characteristic of the Antennapedia, engrailed, and paired families. In addition, they have used this methodmore » to show that C. elegans contains at least five different sequences homologous to genes in the tyrosine kinase family. Lastly, they have isolated six potassium channel sequences from humans, a result that validates the utility of the method with large genomes and suggests that human potassium channel gene diversity may be extensive.« less

Prospecting Metagenomic Enzyme Subfamily Genes for DNA Family Shuffling by a Novel PCR-based Approach*

PubMed Central

Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong

2010-01-01

DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349

Helicase-dependent amplification of nucleic acids.

PubMed

Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand

2013-10-11

Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.

Review of Detection of Brucella sp. by Polymerase Chain Reaction

PubMed Central

Yu, Wei Ling; Nielsen, Klaus

2010-01-01

Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

PubMed Central

O’Halloran, Damien M.

2016-01-01

Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

Transposon facilitated DNA sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, D.E.; Berg, C.M.; Huang, H.V.

1990-01-01

The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less

Use of species-specific PCR for the identification of 10 sea cucumber species

NASA Astrophysics Data System (ADS)

Wen, Jing; Zeng, Ling

2014-11-01

We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

Hydrology of Central Florida Lakes - A Primer

USGS Publications Warehouse

Schiffer, Donna M.

1998-01-01

INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central Florida, the interactions between lakes and ground- and surface-waters, and to describe how these interactions affect lake water levels. Included are descriptions of the basic geology and geomorphology of central Florida, origins of central Florida lakes, factors that affect lake water levels, lake water quality, and common methods of improving water quality. The geographic area discussed in this primer is approximate (fig. 1) and includes west and east-central Florida, extending from the Gulf of Mexico to the Atlantic Ocean coastlines, northward into Marion, Putnam, and Flagler Counties, and southward to Lake Okeechobee. The information presented here was obtained from the many publications available on lakes in central Florida, as well as from publications on Florida geology, hydrology, and primers on ground water, surface water, and water quality. Many publications are available that provide more detailed information on lake water quality, and this primer is not intended as an extensive treatise on that subject. The reader is referred to the reference section of this primer for sources of more detailed information on lake water quality. Lakes discussed in this report are identified in figure 2. Technical terms used in the report are shown in bold italics and are defined in the glossary. The classification of some water bodies as lakes is highly subjective. What one individual considers a lake another might consider a pond. Generally, any water- filled depression or group of depressions in the land surface could be considered a lake. Lakes differ from swamps or wetlands in the type and amount of vegetation, water depth, and some water-quality characteristics. Lakes typically have emergent vegetation along the shoreline with a large expanse of open water in the center. Swamps or wetlands, on the other hand, are characterized by a water surface interrupted by the emergence of many varieties of plant life, from saw grasses to cypress trees. Lakes may be na

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

Serotyping of Streptococcus pneumoniae Based on Capsular Genes Polymorphisms

PubMed Central

Raymond, Frédéric; Boucher, Nancy; Allary, Robin; Robitaille, Lynda; Lefebvre, Brigitte; Tremblay, Cécile

2013-01-01

Streptococcus pneumoniae serotype epidemiology is essential since serotype replacement is a concern when introducing new polysaccharide-conjugate vaccines. A novel PCR-based automated microarray assay was developed to assist in the tracking of the serotypes. Autolysin, pneumolysin and eight genes located in the capsular operon were amplified using multiplex PCR. This step was followed by a tagged fluorescent primer extension step targeting serotype-specific polymorphisms. The tagged primers were then hybridized to a microarray. Results were exported to an expert system to identify capsular serotypes. The assay was validated on 166 cultured S. pneumoniae samples from 63 different serotypes as determined by the Quellung method. We show that typing only 12 polymorphisms located in the capsular operon allows the identification at the serotype level of 22 serotypes and the assignation of 24 other serotypes to a subgroup of serotypes. Overall, 126 samples (75.9%) were correctly serotyped, 14 were assigned to a member of the same serogroup, 8 rare serotypes were erroneously serotyped, and 18 gave negative serotyping results. Most of the discrepancies involved rare serotypes or serotypes that are difficult to discriminate using a DNA-based approach, for example 6A and 6B. The assay was also tested on clinical specimens including 43 cerebrospinal fluid samples from patients with meningitis and 59 nasopharyngeal aspirates from bacterial pneumonia patients. Overall, 89% of specimens positive for pneumolysin were serotyped, demonstrating that this method does not require culture to serotype clinical specimens. The assay showed no cross-reactivity for 24 relevant bacterial species found in these types of samples. The limit of detection for serotyping and S. pneumoniae detection was 100 genome equivalent per reaction. This automated assay is amenable to clinical testing and does not require any culturing of the samples. The assay will be useful for the evaluation of serotype prevalence changes after new conjugate vaccines introduction. PMID:24086706

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

PubMed

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR

PubMed Central

2013-01-01

Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

Development of a tetra-primer ARMS-PCR for detecting the E198A SNP in the isotype-1 β-tubulin gene of Haemonchus contortus populations in China.

PubMed

Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu

2018-03-15

The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.

[RAPD analysis of Aspergilli and its application in brewing industry].

PubMed

Pan, Li; Wang, Bin; Guo, Yong

2007-06-01

Phylogenetic analysis of sixteen Aspergilli was done by RAPD technology, using Aspergillus oryzae AS3.951, Aspergillus flavus GIM3.18 and Aspergillus sojae AS3.495 as controls. First, genome DNA of the sixteen test strains were prepared by improved extraction method, and their quality was verified by electrophoresis and spectrophotometry. They displayed an identical band (approximately 20 kb) in agarose gel electrophoresis, which conformed to the fact that these strains all belong to Aspergillus. OD260/OD280 of the prepared DNA ranged from 1.80 to 1.90, illustrating that they were good enough to be used as templates in the following RAPD-PCR experiment. Then, three appropriate primers (Primerl, Primer2, Primer5) for RAPD-PCR were screened from nine random primers, and repetitive experiments demonstrated that the RAPD-PCR polymorphic patterns of the sixteen test strains based on these three primers were stable. There were usually 8-14 bands in their RADP-PCR patterns, where the number of the main bands was 4-9 and the secondary bands were abundant. There were totally 181 bands in their RAPD-PCR patterns, where the percentage of polymorphic bands reached to 40.9% (74 bands). The similarity coefficient between the strains was calculated based on their RAPD-PCR patterns, ranging from 8.0% to 96.6%. All these data suggests that the genetic polymorphism of the strains is abundant and they have evident genetic differentiation. The phylogenetic tree of the sixteen test strains was reconstructed according to their RAPD-PCR patterns with Primer1, Primer2 and Primer5. It basically corresponded to traditional morphological taxonomy, demonstrating that the application of RAPD molecular marker in the phylogenetic analysis of these Aspergilli is feasible. Besides, the aflatoxin-producing strains (GIM3.17, CICC2219, CICC2357, CICC2390, CICC2402, CICC2404) could be easily discriminated by RAPD molecular marker, whereas it is difficult to distinguish them by conventional morphological taxonomy. Consequently, RAPD molecular marker provides a novel clue to discriminating aflatoxin-producing strains in brewing industry.

Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

PubMed

Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

2017-08-01

Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

Simultaneous genotyping of HPA-17w to -21w by PCR-SSP in Chinese Cantonese.

PubMed

Zhou, Haojie; Ding, Haoqiang; Chen, Yangkai; Li, Xiaofan; Ye, Xin; Nie, Yongmei

2015-01-01

Studies have reported the polymorphism of human platelet antigen (HPA)-17w, -18w, -19w, -20w, and -21w. However, the distribution of these five antigens in Chinese Cantonese is still unknown. In this study, we designed new sequence-specific primers for HPA-19w to -21w and used published primers for HPA-17w and -18w to develop a polymerase chain reaction with the sequence-specific primers (PCR-SSP) method for simultaneously genotyping HPA-17w to -21w. A total of 820 unrelated Cantonese apheresis platelet donors in Guangzhou were involved in this study. Among the five HPAs, complete a/a homozygosity was observed for HPA-17w to -20w with an allele frequency of 1.0000. For HPA-21w, nine individuals (9/820, 1.10%) were found to be HPA-21a/bw heterozygous and the allele frequencies of HPA-21a and HPA-21bw were 0.9945 (1631/1640) and 0.0055 (9/1640), respectively. The reliability of the PCR-SSP method was determined by comparing with the genotyping results by DNA sequencing, and no inconsistencies were observed between the two methods. This study provides a reliable PCR-SSP method for simultaneously genotyping HPA-17w to -21w and could improve HPA-matched platelet transfusion in Chinese Cantonese.

An alternative method to quantify 2-MIB producing cyanobacteria in drinking water reservoirs: Method development and field applications.

PubMed

Chiu, Yi-Ting; Yen, Hung-Kai; Lin, Tsair-Fuh

2016-11-01

2-Methylisoborneol (2-MIB) is a commonly detected cyanobacterial odorant in drinking water sources in many countries. To provide safe and high-quality water, development of a monitoring method for the detection of 2-MIB-synthesis (mibC) genes is very important. In this study, new primers MIBS02F/R intended specifically for the mibC gene were developed and tested. Experimental results show that the MIBS02F/R primer set was able to capture 13 2-MIB producing cyanobacterial strains grown in the laboratory, and to effectively amplify the targeted DNA region from 17 2-MIB-producing cyanobacterial strains listed in the literature. The primers were further coupled with a TaqMan probe to detect 2-MIB producers in 29 drinking water reservoirs (DWRs). The results showed statistically significant correlations between mibC genes and 2-MIB concentrations for the data from each reservoir (R 2 =0.413-0.998; p<0.05), from all reservoirs in each of the three islands (R 2 =0.302-0.796; p<0.01), and from all data of the three islands (R 2 =0.473-0.479; p<0.01). The results demonstrate that the real-time PCR can be an alternative method to provide information to managers of reservoirs and water utilities facing 2-MIB-related incidents. Copyright © 2016 Elsevier Inc. All rights reserved.

Genetic diversity analysis of Chrysopidae family (Insecta, Neuroptera) via molecular markers.

PubMed

Yari, Kheirollah; Mirmoayedi, Alinaghi; Marami, Marzieh; Kazemi, Elham; Kahrizi, Danial

2014-09-01

In entomology, improvement of molecular methods would be beneficial tools for accurate identification and detecting the genetic diversity of insect species to discover a corroborative evidence for the traditional classification based on morphology. The aim of this study was focused on RAPD-PCR method for distinguishing the genetic diversity between eight species of Chrysopidae family. In current research, many specimens were collected in different locations of Tehran province (Iran), between them 24 specimens were identified. The wing venation, male genitalia and other morphological characters were used for identification and also the sexing of species was recognized with study of external genitalia. Then, the DNA was extracted with CTAB method. The RAPD-PCR method was carried out with twenty random primers. The agarose gel electrophoresis was used for separation of the PCR products. Based on electrophoresis results, 133 bands were amplified and between them, 126 bands were poly-morph and others were mono-morph. Also, among the applied primers, the primers OPA02 with 19 bands and OPA03 with 8 bands were amplified the maximum and minimum of bands, respectively. The results showed that 80.35 and 73.21 % of genetic similarity existed between Chrysopa pallens-Chrysopa dubitans, and between the Chrysoperla kolthoffi and Chrysoperla carnea, respectively. The minimum (45.53 %) of genetic similarity was observed between C. kolthoffi and C. dubitans, and the maximum (0.80 %) was seen between C. pallens and C. dubitans.

Development of Cross-Assembly Phage PCR-Based Methods ...

EPA Pesticide Factsheets

Technologies that can characterize human fecal pollution in environmental waters offer many advantages over traditional general indicator approaches. However, many human-associated methods cross-react with non-human animal sources and lack suitable sensitivity for fecal source identification applications. The genome of a newly discovered bacteriophage (~97 kbp), the Cross-Assembly phage or “crAssphage”, assembled from a human gut metagenome DNA sequence library is predicted to be both highly abundant and predominately occur in human feces suggesting that this double stranded DNA virus may be an ideal human fecal pollution indicator. We report the development of two human-associated crAssphage endpoint PCR methods (crAss056 and crAss064). A shotgun strategy was employed where 384 candidate primers were designed to cover ~41 kbp of the crAssphage genome deemed favorable for method development based on a series of bioinformatics analyses. Candidate primers were subjected to three rounds of testing to evaluate assay optimization, specificity, limit of detection (LOD95), geographic variability, and performance in environmental water samples. The top two performing candidate primer sets exhibited 100% specificity (n = 70 individual samples from 8 different animal species), >90% sensitivity (n = 10 raw sewage samples from different geographic locations), LOD95 of 0.01 ng/µL of total DNA per reaction, and successfully detected human fecal pollution in impaired envi

Development of a quantitative fluorescence single primer isothermal amplification-based method for the detection of Salmonella.

PubMed

Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing

2016-02-16

Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.

Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane

PubMed Central

Zhou, Dinggang; Guo, Jinlong; Xu, Liping; Gao, Shiwu; Lin, Qingliang; Wu, Qibin; Wu, Luguang; Que, Youxiong

2014-01-01

To meet the demand for detection of foreign genes in genetically modified (GM) sugarcane necessary for regulation of gene technology, an efficient method with high specificity and rapidity was developed for the cry1Ac gene, based on loop-mediated isothermal amplification (LAMP). A set of four primers was designed using the sequence of cry1Ac along with optimized reaction conditions: 5.25 mM of Mg2+, 4:1 ratio of inner primer to outer primer, 2.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. Three post-LAMP detection methods (precipitation, calcein (0.60 mM) with Mn2+ (0.05 mM) complex and SYBR Green I visualization), were shown to be effective. The sensitivity of the LAMP method was tenfold higher than that of conventional PCR when using templates of the recombinant cry1Ac plasmid or genomic DNA from cry1Ac transgenic sugarcane plants. More importantly, this system allowed detection of the foreign gene on-site when screening GM sugarcane without complex and expensive instruments, using the naked eye. This method can not only provide technological support for detection of cry1Ac, but can also further facilitate the use of this detection technique for other transgenes in GM sugarcane. PMID:24810230

Effects of different etching methods and bonding procedures on shear bond strength of orthodontic metal brackets applied to different CAD/CAM ceramic materials.

PubMed

Buyuk, S Kutalmış; Kucukekenci, Ahmet Serkan

2018-03-01

To investigate the shear bond strength (SBS) of orthodontic metal brackets applied to different types of ceramic surfaces treated with different etching procedures and bonding agents. Monolithic CAD/CAM ceramic specimens (N = 120; n = 40 each group) of feldspathic ceramic Vita Mark II, resin nanoceramic Lava Ultimate, and hybrid ceramic Vita Enamic were fabricated (14 × 12 × 3 mm). Ceramic specimens were separated into four subgroups (n = 10) according to type of surface treatment and bonding onto the ceramic surface. Within each group, four subgroups were prepared by phosphoric acid, hydrofluoric acid, Transbond XT primer, and Clearfill Ceramic primer. Mandibular central incisor metal brackets were bonded with light-cure composite. The SBS data were analyzed using three-way analysis of variance (ANOVA) and Tukey HSD tests. The highest SBS was found in the Vita Enamic group, which is a hybrid ceramic, etched with hydrofluoric acid and applied Transbond XT Adhesive primer (7.28 ± 2.49 MPa). The lowest SBS was found in the Lava Ultimate group, which is a resin nano-ceramic etched with hydrofluoric acid and applied Clearfill ceramic primer (2.20 ± 1.21 MPa). CAD/CAM material types and bonding procedures affected bond strength ( P < .05), but the etching procedure did not ( P > .05). The use of Transbond XT as a primer bonding agent resulted in higher SBS.

Development of PCR protocols for specific identification of Clostridium spiroforme and detection of sas and sbs genes.

PubMed

Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio

2008-10-15

Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.

Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

PubMed

Gell, I; Cubero, J; Melgarejo, P

2007-12-01

To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Interactive optimization approach for optimal impulsive rendezvous using primer vector and evolutionary algorithms

NASA Astrophysics Data System (ADS)

Luo, Ya-Zhong; Zhang, Jin; Li, Hai-yang; Tang, Guo-Jin

2010-08-01

In this paper, a new optimization approach combining primer vector theory and evolutionary algorithms for fuel-optimal non-linear impulsive rendezvous is proposed. The optimization approach is designed to seek the optimal number of impulses as well as the optimal impulse vectors. In this optimization approach, adding a midcourse impulse is determined by an interactive method, i.e. observing the primer-magnitude time history. An improved version of simulated annealing is employed to optimize the rendezvous trajectory with the fixed-number of impulses. This interactive approach is evaluated by three test cases: coplanar circle-to-circle rendezvous, same-circle rendezvous and non-coplanar rendezvous. The results show that the interactive approach is effective and efficient in fuel-optimal non-linear rendezvous design. It can guarantee solutions, which satisfy the Lawden's necessary optimality conditions.

Resin adhesion strengths to zirconia ceramics after primer treatment with silane coupling monomer or oligomer.

PubMed

Okada, Masahiro; Inoue, Kazusa; Irie, Masao; Taketa, Hiroaki; Torii, Yasuhiro; Matsumoto, Takuya

2017-09-26

Resin bonding to zirconia ceramics is difficult to achieve using the standard methods for conventional silica-based dental ceramics, which employ silane coupling monomers as primers. The hypothesis in this study was that a silane coupling oligomer -a condensed product of silane coupling monomers- would be a more suitable primer for zirconia. To prove this hypothesis, the shear bond strengths between a composite resin and zirconia were compared after applying either a silane coupling monomer or oligomer. The shear bond strength increased after applying a non-activated ethanol solution of the silane coupling oligomer compared with that achieved when applying the monomer. Thermal treatment of the zirconia at 110°C after application of the silane coupling agents was essential to improve the shear bond strength between the composite resin cement and zirconia.

PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

PubMed Central

Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2014-01-01

Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the discovery of complex patterns in gene expression of soil fungal communities. PMID:25545363

[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

PubMed

Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

2013-10-18

To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

The development of loop-mediated isothermal amplification (LAMP) assays for the rapid authentication of five forbidden vegetables in strict vegetarian diets

PubMed Central

Lee, Meng-Shiou; Su, Ting-Ying; Lien, Yi-Yang; Sheu, Shyang-Chwen

2017-01-01

Plant-based food ingredients such as garlic, Chinese leek, Chinese onion, green onion and onion are widely used in many cuisines around the world. However, these ingredients known as the “five forbidden vegetables” (FFVs) are not allowed in some vegetarian diets. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of FFVs using five respective LAMP primer sets. The specific primers targeted the ITS1-5.8S-ITS2 nuclear ribosomal DNA sequence regions among the five vegetables. The results demonstrated that the identification of FFVs using the newly developed LAMP assay is more sensitive than the traditional PCR method. Using pepper, basil, parsley, chili and ginger as references, established LAMP primer sets showed high specificity for the identification of the FFV species. Moreover, when FFVs were mixed with other plant ingredients at different ratios (100:0, 50:50, 20:80, 10:90, 5:95, 2:98, and 1:99), no cross-reactivity was evident using LAMP. Finally, genomic DNAs extracted from boiled and steamed FFVs in processed foods were used as templates; the performance of the LAMP reaction was not influenced using validated LAMP primers. Not only can FFV ingredients be identified but commercial foods containing FFVs can also be authenticated. This LAMP method will be useful for the authentication of FFVs in practical food markets in the future. PMID:28290475

The development of loop-mediated isothermal amplification (LAMP) assays for the rapid authentication of five forbidden vegetables in strict vegetarian diets.

PubMed

Lee, Meng-Shiou; Su, Ting-Ying; Lien, Yi-Yang; Sheu, Shyang-Chwen

2017-03-14

Plant-based food ingredients such as garlic, Chinese leek, Chinese onion, green onion and onion are widely used in many cuisines around the world. However, these ingredients known as the "five forbidden vegetables" (FFVs) are not allowed in some vegetarian diets. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of FFVs using five respective LAMP primer sets. The specific primers targeted the ITS1-5.8S-ITS2 nuclear ribosomal DNA sequence regions among the five vegetables. The results demonstrated that the identification of FFVs using the newly developed LAMP assay is more sensitive than the traditional PCR method. Using pepper, basil, parsley, chili and ginger as references, established LAMP primer sets showed high specificity for the identification of the FFV species. Moreover, when FFVs were mixed with other plant ingredients at different ratios (100:0, 50:50, 20:80, 10:90, 5:95, 2:98, and 1:99), no cross-reactivity was evident using LAMP. Finally, genomic DNAs extracted from boiled and steamed FFVs in processed foods were used as templates; the performance of the LAMP reaction was not influenced using validated LAMP primers. Not only can FFV ingredients be identified but commercial foods containing FFVs can also be authenticated. This LAMP method will be useful for the authentication of FFVs in practical food markets in the future.

Simultaneous Amplicon Sequencing to Explore Co-Occurrence Patterns of Bacterial, Archaeal and Eukaryotic Microorganisms in Rumen Microbial Communities

PubMed Central

Kittelmann, Sandra; Seedorf, Henning; Walters, William A.; Clemente, Jose C.; Knight, Rob; Gordon, Jeffrey I.; Janssen, Peter H.

2013-01-01

Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats. PMID:23408926

Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities.

PubMed

Kittelmann, Sandra; Seedorf, Henning; Walters, William A; Clemente, Jose C; Knight, Rob; Gordon, Jeffrey I; Janssen, Peter H

2013-01-01

Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats.

Genetic diversity of Iranian honey bee (Apis mellifera meda Skorikow, 1829) populations based on ISSR markers.

PubMed

Rahimi, A; Mirmoayedi, A; Kahrizi, D; Zarei, L; Jamali, S

2016-04-30

Honey bee is one of the most important insects considering its role in agriculture,ecology and economy as a whole. In this study, the genetic diversity of different Iranian honey bee populations was evaluated using inter simple sequence repeat (ISSR) markers. During May to September 2014, 108 young worker honey bees were collected from six different populations in 30 different geoclimatic locations from Golestan, Mazendaran, Guilan, West Azerbaijan, East Azerbaijan, Ardebil provinces of Iran. DNA was extracted from the worker honey bees. The quality and quantity of extracted DNA were measured. A set of ten primers were screened with the laboratory populations of honey bees. The number of fragments produced in the different honey bee populations varied from 3 to 10, varying within 150 to 1500 bp. The used ten ISSR primers generated 40 polymorphic fragments, and the average heterozygosity for each primer was 0.266. Maximum numbers of bands were recorded for primer A1. A dendrogram based on the Unweighted Pair Group Method with Arithmetic mean (UPGMA) method generated two sub-clusters. Honey bee populations of Golestan, Mazendaran, Guilan provinces were located in the first group. The second group included honey bee populations of Ardebil, West Azerbaijan, East Azerbaijan provinces, but this group showed a close relationship with other populations. The results showed obviously the ability of the ISSR marker technique to detect the genetic diversity among the honey bee populations.

PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

PubMed

Pauthenier, Cyrille; Faulon, Jean-Loup

2014-07-01

PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Specific detection and identification of [Actinobacillus] muris by PCR using primers targeting the 16S-23S rRNA internal transcribed spacer regions.

PubMed

Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin

2013-08-01

[Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.

[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

PubMed

Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

2015-01-01

Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms.

PubMed

Dinon, Andréia Z; Prins, Theo W; van Dijk, Jeroen P; Arisi, Ana Carolina M; Scholtens, Ingrid M J; Kok, Esther J

2011-05-01

Primers and probes were developed for the element-specific detection of cry1A.105 and cry2Ab2 genes, based on their DNA sequence as present in GM maize MON89034. Cry genes are present in many genetically modified (GM) plants and they are important targets for developing GMO element-specific detection methods. Element-specific methods can be of use to screen for the presence of GMOs in food and feed supply chains. Moreover, a combination of GMO elements may indicate the potential presence of unapproved GMOs (UGMs). Primer-probe combinations were evaluated in terms of specificity, efficiency and limit of detection. Except for specificity, the complete experiment was performed in 9 PCR runs, on 9 different days and by testing 8 DNA concentrations. The results showed a high specificity and efficiency for cry1A.105 and cry2Ab2 detection. The limit of detection was between 0.05 and 0.01 ng DNA per PCR reaction for both assays. These data confirm the applicability of these new primer-probe combinations for element detection that can contribute to the screening for GM and UGM crops in food and feed samples.

Single Cell Total RNA Sequencing through Isothermal Amplification in Picoliter-Droplet Emulsion.

PubMed

Fu, Yusi; Chen, He; Liu, Lu; Huang, Yanyi

2016-11-15

Prevalent single cell RNA amplification and sequencing chemistries mainly focus on polyadenylated RNAs in eukaryotic cells by using oligo(dT) primers for reverse transcription. We develop a new RNA amplification method, "easier-seq", to reverse transcribe and amplify the total RNAs, both with and without polyadenylate tails, from a single cell for transcriptome sequencing with high efficiency, reproducibility, and accuracy. By distributing the reverse transcribed cDNA molecules into 1.5 × 10 5 aqueous droplets in oil, the cDNAs are isothermally amplified using random primers in each of these 65-pL reactors separately. This new method greatly improves the ease of single-cell RNA sequencing by reducing the experimental steps. Meanwhile, with less chance to induce errors, this method can easily maintain the quality of single-cell sequencing. In addition, this polyadenylate-tail-independent method can be seamlessly applied to prokaryotic cell RNA sequencing.

HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization

PubMed Central

Meisal, Roger; Rounge, Trine Ballestad; Christiansen, Irene Kraus; Eieland, Alexander Kirkeby; Worren, Merete Molton; Molden, Tor Faksvaag; Kommedal, Øyvind; Hovig, Eivind; Leegaard, Truls Michael

2017-01-01

Sensitive and specific genotyping of human papillomaviruses (HPVs) is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS) to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP)-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution. PMID:28045981

HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization.

PubMed

Meisal, Roger; Rounge, Trine Ballestad; Christiansen, Irene Kraus; Eieland, Alexander Kirkeby; Worren, Merete Molton; Molden, Tor Faksvaag; Kommedal, Øyvind; Hovig, Eivind; Leegaard, Truls Michael; Ambur, Ole Herman

2017-01-01

Sensitive and specific genotyping of human papillomaviruses (HPVs) is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS) to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP)-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution.

[Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus].

PubMed

Yang, Yu; Bai, Lin; Hu, Kong-Xin; Yang, Zhi-Hong; Hu, Jian-Ping; Wang, Jing

2012-08-01

Marburg virus and Ebola virus are acute infections with high case fatality rates. A rapid, sensitive detection method was established to detect Marburg virus and Ebola virus by multiplex real-time fluorescence quantitative PCR. Designing primers and Taqman probes from highly conserved sequences of Marburg virus and Ebola virus through whole genome sequences alignment, Taqman probes labeled by FAM and Texas Red, the sensitivity of the multiplex real-time quantitative PCR assay was optimized by evaluating the different concentrations of primers and Probes. We have developed a real-time PCR method with the sensitivity of 30.5 copies/microl for Marburg virus positive plasmid and 28.6 copies/microl for Ebola virus positive plasmids, Japanese encephalitis virus, Yellow fever virus, Dengue virus were using to examine the specificity. The Multiplex real-time PCR assays provide a sensitive, reliable and efficient method to detect Marburg virus and Ebola virus simultaneously.

Detection of Fungi from an Indoor Environment using Loop-mediated Isothermal Amplification (LAMP) Method.

PubMed

Nakayama, Takako; Yamazaki, Takashi; Yo, Ayaka; Tone, Kazuya; Mahdi Alshahni, Mohamed; Fujisaki, Ryuichi; Makimura, Koichi

2017-01-01

　Loop-mediated isothermal amplification (LAMP) is a useful DNA detection method with high specificity and sensitivity. The LAMP reaction is carried out within a short time at a constant temperature without the need for thermal cycling. We developed a LAMP primer set for detecting a wide range of fungi by aligning the sequences of the large subunit ribosomal RNA gene of Candida albicans (Ascomycota), Cryptococcus neoformans (Basidiomycota), and Mucor racemosus (Mucorales). The threshold of C. albicans rDNA as template with our LAMP primer set was in the range of 10-100 copies per a reaction. In this study, we evaluated the correlation between colony forming units (CFU) and LAMP detection rate using the LAMP method for environmental fungi. The LAMP method should be a useful means of detecting fungi in indoor environments, disaster areas, or even in confined manned spacecraft to prevent allergies or infections caused by fungi.

Application of the multiplex PCR method for discrimination of Artemisia iwayomogi from other Artemisia herbs.

PubMed

Lee, Mi Young; Doh, Eui Jeong; Kim, Eung Soo; Kim, Young Wha; Ko, Byong Seob; Oh, Seung-Eun

2008-04-01

Some plants classified in the genus Artemisia are used for medicinal purposes. In particular, A. iwayomogi, which is referred to as 'Haninjin,' is used as an important medicinal material in traditional Korean medicine. However, A. capillaris, and both A. argyi and A. princeps, referred to as 'Injinho' and 'Aeyup,' respectively, are used for purposes other than those for which 'Haninjin' is utilized. However, it is occasionally difficult to differentiate 'Haninjin' from 'Injinho' and/or 'Aeyup' on the basis of their morphological features, particularly when in the dried and/or sliced form. Therefore, the development of a reliable method by which to discriminate 'Haninjin' from other Artemisia herbs, especially 'Injinho' and 'Aeyup,' is clearly necessary. We recently determined that the RAPD (random amplified polymorphic DNA) technique can be used to discriminate efficiently between some Artemisia herbs. In particular, when applied to RAPD, the non-specific UBC primer 391 (5'-GCG AAC CTC G-3') was demonstrated to amplify PCR products specific to A. iwayomogi. Based on the nucleotide sequences of the PCR product, we designed a 2F1 (5'-ACC TCG GAC CTA AAT ACA-3')/ 2F3 (5'-TTA TGA TTC ATG TTC AAT TC-3') primer set to amplify a SCAR (sequence-characterized amplified region) marker of A. iwayomogi. Employing this primer set, along with two other primer sets amplifying SCAR markers of 'Aeyup' (A. argyi and A. princeps) and both 'Injinho' (A. capillaris) and A. japonica, which are classified into the same subgroup in a phenogram constructed from RAPD analysis, we developed a multiplex PCR method by which A. iwayomogi could be discriminated with certainty from other Artemisia herbs. Via this method, we determined not only whether the tested Artemisia herb was A. iwayomogi, but also which Artemisia herbs were tested concurrently with A. iwayomogi.

Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat pox virus and sheep pox virus.

PubMed

Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang

2014-01-17

Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.

Histoimmunogenetics Markup Language 1.0: Reporting next generation sequencing-based HLA and KIR genotyping.

PubMed

Milius, Robert P; Heuer, Michael; Valiga, Daniel; Doroschak, Kathryn J; Kennedy, Caleb J; Bolon, Yung-Tsi; Schneider, Joel; Pollack, Jane; Kim, Hwa Ran; Cereb, Nezih; Hollenbach, Jill A; Mack, Steven J; Maiers, Martin

2015-12-01

We present an electronic format for exchanging data for HLA and KIR genotyping with extensions for next-generation sequencing (NGS). This format addresses NGS data exchange by refining the Histoimmunogenetics Markup Language (HML) to conform to the proposed Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) reporting guidelines (miring.immunogenomics.org). Our refinements of HML include two major additions. First, NGS is supported by new XML structures to capture additional NGS data and metadata required to produce a genotyping result, including analysis-dependent (dynamic) and method-dependent (static) components. A full genotype, consensus sequence, and the surrounding metadata are included directly, while the raw sequence reads and platform documentation are externally referenced. Second, genotype ambiguity is fully represented by integrating Genotype List Strings, which use a hierarchical set of delimiters to represent allele and genotype ambiguity in a complete and accurate fashion. HML also continues to enable the transmission of legacy methods (e.g. site-specific oligonucleotide, sequence-specific priming, and Sequence Based Typing (SBT)), adding features such as allowing multiple group-specific sequencing primers, and fully leveraging techniques that combine multiple methods to obtain a single result, such as SBT integrated with NGS. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

DNA cards: determinants of DNA yield and quality in collecting genetic samples for pharmacogenetic studies.

PubMed

Mas, Sergi; Crescenti, Anna; Gassó, Patricia; Vidal-Taboada, Jose M; Lafuente, Amalia

2007-08-01

As pharmacogenetic studies frequently require establishment of DNA banks containing large cohorts with multi-centric designs, inexpensive methods for collecting and storing high-quality DNA are needed. The aims of this study were two-fold: to compare the amount and quality of DNA obtained from two different DNA cards (IsoCode Cards or FTA Classic Cards, Whatman plc, Brentford, Middlesex, UK); and to evaluate the effects of time and storage temperature, as well as the influence of anticoagulant ethylenediaminetetraacetic acid on the DNA elution procedure. The samples were genotyped by several methods typically used in pharmacogenetic studies: multiplex PCR, PCR-restriction fragment length polymorphism, single nucleotide primer extension, and allelic discrimination assay. In addition, they were amplified by whole genome amplification to increase genomic DNA mass. Time, storage temperature and ethylenediaminetetraacetic acid had no significant effects on either DNA card. This study reveals the importance of drying blood spots prior to isolation to avoid haemoglobin interference. Moreover, our results demonstrate that re-isolation protocols could be applied to increase the amount of DNA recovered. The samples analysed were accurately genotyped with all the methods examined herein. In conclusion, our study shows that both DNA cards, IsoCode Cards and FTA Classic Cards, facilitate genetic and pharmacogenetic testing for routine clinical practice.

Nucleotide exchange and excision technology DNA shuffling and directed evolution.

PubMed

Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M

2011-01-01

Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.

Genome amplification of single sperm using multiple displacement amplification.

PubMed

Jiang, Zhengwen; Zhang, Xingqi; Deka, Ranjan; Jin, Li

2005-06-07

Sperm typing is an effective way to study recombination rate on a fine scale in regions of interest. There are two strategies for the amplification of single meiotic recombinants: repulsion-phase allele-specific PCR and whole genome amplification (WGA). The former can selectively amplify single recombinant molecules from a batch of sperm but is not scalable for high-throughput operation. Currently, primer extension pre-amplification is the only method used in WGA of single sperm, whereas it has limited capacity to produce high-coverage products enough for the analysis of local recombination rate in multiple large regions. Here, we applied for the first time a recently developed WGA method, multiple displacement amplification (MDA), to amplify single sperm DNA, and demonstrated its great potential for producing high-yield and high-coverage products. In a 50 mul reaction, 76 or 93% of loci can be amplified at least 2500- or 250-fold, respectively, from single sperm DNA, and second-round MDA can further offer >200-fold amplification. The MDA products are usable for a variety of genetic applications, including sequencing and microsatellite marker and single nucleotide polymorphism (SNP) analysis. The use of MDA in single sperm amplification may open a new era for studies on local recombination rates.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

Use of molecular markers to compare Fusarium verticillioides pathogenic strains isolated from plants and humans.

PubMed

Chang, S C; Macêdo, D P C; Souza-Motta, C M; Oliveira, N T

2013-08-12

Fusarium verticillioides is a pathogen of agriculturally important crops, especially maize. It is considered one of the most important pathogens responsible for fumonisin contamination of food products, which causes severe, chronic, and acute intoxication in humans and animals. Moreover, it is recognized as a cause of localized infections in immunocompetent patients and disseminated infections among severely immunosuppressed patients. Several molecular tools have been used to analyze the intraspecific variability of fungi. The objective of this study was to use molecular markers to compare pathogenic isolates of F. verticillioides and isolates of the same species obtained from clinical samples of patients with Fusarium mycoses. The molecular markers that we used were inter-simple sequence repeat markers (primers GTG5 and GACA4), intron splice site primer (primer EI1), random amplified polymorphic DNA marker (primer OPW-6), and restriction fragment length polymorphism-internal transcribed spacer (ITS) from rDNA. From the data obtained, clusters were generated based on the UPGMA clustering method. The amplification products obtained using primers ITS4 and ITS5 and loci ITS1-5.8-ITS2 of the rDNA yielded fragments of approximately 600 bp for all the isolates. Digestion of the ITS region fragment using restriction enzymes such as EcoRI, DraI, BshI, AluI, HaeIII, HinfI, MspI, and PstI did not permit differentiation among pathogenic and clinical isolates. The inter-simple sequence repeat, intron splice site primer, and random amplified polymorphic DNA markers presented high genetic homogeneity among clinical isolates in contrast to the high variability found among the phytopathogenic isolates of F. verticillioides.

Identification of Pork Adulteration in Processed Meat Products Using the Developed Mitochondrial DNA-Based Primers

PubMed Central

Ha, Jimyeong; Kim, Sejeong; Lee, Jeeyeon; Lee, Soomin; Lee, Heeyoung; Choi, Yukyung; Oh, Hyemin; Yoon, Yohan

2017-01-01

The identification of pork in commercially processed meats is one of the most crucial issues in the food industry because of religious food ethics, medical purposes, and intentional adulteration to decrease production cost. This study therefore aimed to develop a method for the detection of pork adulteration in meat products using primers specific for pig mitochondrial DNA. Mitochondrial DNA sequences for pig, cattle, chicken, and sheep were obtained from GenBank and aligned. The 294-bp mitochondrial DNA D-loop region was selected as the pig target DNA sequence and appropriate primers were designed using the MUSCLE program. To evaluate primer sensitivity, pork-beef-chicken mixtures were prepared as follows: i) 0% pork-50% beef-50% chicken, ii) 1% pork-49.5% beef-49.5% chicken, iii) 2% pork-49% beef-49% chicken, iv) 5% pork-47.5% beef-47.5% chicken, v) 10% pork-45% beef-45% chicken, and vi) 100% pork-0% beef-0% chicken. In addition, a total of 35 commercially packaged products, including patties, nuggets, meatballs, and sausages containing processed chicken, beef, or a mixture of various meats, were purchased from commercial markets. The primers developed in our study were able to detect as little as 1% pork in the heat treated pork-beef-chicken mixtures. Of the 35 processed products, three samples were pork positive despite being labeled as beef or chicken only or as a beef-chicken mix. These results indicate that the developed primers could be used to detect pork adulteration in various processed meat products for application in safeguarding religious food ethics, detecting allergens, and preventing food adulteration. PMID:28747833

Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

PubMed

Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

2015-08-01

Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

PubMed Central

Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

2012-01-01

The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

PubMed Central

Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2016-01-01

A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

Tooth surface treatment strategies for adhesive cementation

PubMed Central

2017-01-01

PURPOSE The aim of this study was to evaluate the effect of tooth surface pre-treatment steps on shear bond strength, which is essential for understanding the adhesive cementation process. MATERIALS AND METHODS Shear bond strengths of different cements with various tooth surface treatments (none, etching, priming, or etching and priming) on enamel and dentin of human teeth were measured using the Swiss shear test design. Three adhesives (Permaflo DC, Panavia F 2.0, and Panavia V5) and one self-adhesive cement (Panavia SA plus) were included in this study. The interface of the cement and the tooth surface with the different pre-treatments was analyzed using SEM. pH values of the cements and primers were measured. RESULTS The highest bond strength values for all cements were achieved with etching and primer on enamel (25.6 ± 5.3 - 32.3 ± 10.4 MPa). On dentin, etching and priming produced the highest bond strength values for all cements (8.6 ± 2.9 - 11.7 ± 3.5 MPa) except for Panavia V5, which achieved significantly higher bond strengths when pre-treated with primer only (15.3 ± 4.1 MPa). Shear bond strength values were correlated with the micro-retentive surface topography of enamel and the tag length on dentin except for Panavia V5, which revealed the highest bond strength with primer application only without etching, resulting in short but sturdy tags. CONCLUSION The highest bond strength can be achieved for Panavia F 2.0, Permaflo DC, and Panavia SA plus when the tooth substrate is previously etched and the respective primer is applied. The new cement Panavia V5 displayed low technique-sensitivity and attained significantly higher adhesion of all tested cements to dentin when only primer was applied. PMID:28435616

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

PubMed

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

PubMed

Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2016-08-01

A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.

Osteogensis imperfecta type I is commonly due to a COLIAI null allel of type I collagen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.C.; Pruchno, C.J.; Atkinson, M.

Dermal fibroblasts from most individuals with osteogenesis imperfecta (OI) type I produce about half the normal amount of type I procollagen, as a result of decreased synthesis of one of its constituent chains, pro[alpha](I). To test the hypothesis that decreased synthesis of pro[alpha](I) chains results from mutations in the COL1A1 gene, the authors used primer extension with nucleotide-specific chain termination to measure the contribution of individual COL1A1 alleles to the mRNA pool in fibroblasts from affected individuals. A polymorphic Mn/I restriction endonuclease site in the 3'-untranslated region of COL1A1 was used to distinguish the transcripts of the two alleles inmore » heterozygous individuals. Twenty-three individuals from 21 unrelated families were studied. In each case there was marked diminution in steady-state mRNA levels from one COL1A2 allele. Loss of an allele through deletion or rearrangement was not the cause of the diminished COL1A1 mRNA levels. Primer extension with nucleotide-specific chain termination allows identification of the mutant COL1A1 allele in cell strains that are heterozygous for an expressed polymorphism. It is applicable to sporadic cases, to small families, and to large families in whom key individuals are uninformative at the polymorphic sites used in linkage analysis, making it a useful adjunct to the biochemical screening of collagenous proteins for OI. 40 refs., 3 figs., 1 tab.« less

Electrochemical primer extension based on polyoxometalate electroactive labels for multiplexed detection of single nucleotide polymorphisms.

PubMed

Chahin, Nassif; Uribe, Laura A; Debela, Ahmed M; Thorimbert, Serge; Hasenknopf, Bernold; Ortiz, Mayreli; Katakis, Ioannis; O'Sullivan, Ciara K

2018-06-07

Polyoxymetalates (POMs) ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ) were used to modify dideoxynucleotides (ddNTPs) through amide bond formation, and applied to the multiplexed detection of single nucleotide polymorphisms (SNPs) in an electrochemical primer extension reaction. Each gold electrode of an array was functionalised with a short single stranded thiolated DNA probe, specifically designed to extend with the POM-ddNTP at the SNP site to be interrogated. The system was applied to the simultaneous detection of 4 SNPs within a single stranded 103-mer model target generated using asymmetric PCR, highlighting the potential of POM-ddNTPs for targeted, multiplexed SNP detection. The four DNA bases were successfully labelled with both ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ), and [SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- demonstrated to be the more suitable due to its single oxidation peak, which provides an unequivocal signal. The POM-ddNTP enzymatically incorporated to the DNA anchored to the surface was visualised by AFM using gold coated mica. The developed assay has been demonstrated to be highly reproducible, simple to carry out and with very low non-specific background signals. Future work will focus on applying the developed platform to the detection of SNPs associated with rifampicin resistance in real samples from patients suffering from tuberculosis. Copyright © 2018. Published by Elsevier B.V.

Structure and regulation of the Yersinia pestis yscBCDEF operon.

PubMed Central

Haddix, P L; Straley, S C

1992-01-01

We have investigated the physical and genetic structure and regulation of the Yersinia pestis yscBCDEF region, previously called lcrC. DNA sequence analysis showed that this region is homologous to the corresponding part of the ysc locus of Yersinia enterocolitica and suggested that the yscBCDEF cistrons belong to a single operon on the low-calcium response virulence plasmid pCD1. Promoter activity measurements of ysc subclones indicated that yscBCDEF constitutes a suboperon of the larger ysc region by revealing promoter activity in a clone containing the 3' end of yscD, intact yscE and yscF, and part of yscG. These experiments also revealed an additional weak promoter upstream of yscD. Northern (RNA) analysis with a yscD probe showed that operon transcription is thermally induced and downregulated in the presence of Ca2+. Primer extension of operon transcripts suggested that two promoters, a moderate-level constitutive one and a stronger, calcium-downregulated one, control full-length operon transcription at 37 degrees C. Primer extension provided additional support for the proposed designation of a yscBCDEF suboperon by identifying a 5' end within yscF, for which relative abundances in the presence and absence of Ca2+ revealed regulation that is distinct from that for transcripts initiating farther upstream. YscB and YscC were expressed in Escherichia coli by using a high-level transcription system. Attempts to express YscD were only partially successful, but they revealed interesting regulation at the translational level. Images PMID:1624469