Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

PubMed

Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

2018-02-01

The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

PubMed

Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

2017-12-02

DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

Amplification of the Gp41 gene for detection of mutations conferring resistance to HIV-1 fusion inhibitors on genotypic assay

NASA Astrophysics Data System (ADS)

Tanumihardja, J.; Bela, B.

2017-08-01

Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.

Sequetyping: Serotyping Streptococcus pneumoniae by a Single PCR Sequencing Strategy

PubMed Central

Leung, Marcus H.; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Gillespie, Stephen H.

2012-01-01

The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future. PMID:22553238

Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens

PubMed Central

Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.

2012-01-01

Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or negative. We evaluated two conventional primer pairs in common use and a new primer pair based on the dual priming oligonucleotide (DPO) principle. Cross-reactivity was observed when both conventional primer pairs were used, resulting in interpretation difficulties. No cross-reactivity was observed using the DPOs even in specimens with a high ratio of human to bacterial DNA. In addition to reducing cross-reactivity, the DPO principle also offers a high degree of flexibility in the design of primers and should be considered for any PCR assay intended for detection and identification of pathogens directly from human clinical specimens. PMID:22278843

SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

PubMed

Villard, Pierre; Malausa, Thibaut

2013-07-01

SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

PubMed Central

2014-01-01

Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

PubMed

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Development of chloroplast simple sequence repeats (cpSSRs) for the intraspecific study of Gracilaria tenuistipitata (Gracilariales, Rhodophyta) from different populations

PubMed Central

2014-01-01

Background Gracilaria tenuistipitata is an agarophyte with substantial economic potential because of its high growth rate and tolerance to a wide range of environment factors. This red seaweed is intensively cultured in China for the production of agar and fodder for abalone. Microsatellite markers were developed from the chloroplast genome of G. tenuistipitata var. liui to differentiate G. tenuistipitata obtained from six different localities: four from Peninsular Malaysia, one from Thailand and one from Vietnam. Eighty G. tenuistipitata specimens were analyzed using eight simple sequence repeat (SSR) primer-pairs that we developed for polymerase chain reaction (PCR) amplification. Findings Five mononucleotide primer-pairs and one trinucleotide primer-pair exhibited monomorphic alleles, whereas the other two primer-pairs separated the G. tenuistipitata specimens into two main clades. G. tenuistipitata from Thailand and Vietnam were grouped into one clade, and the populations from Batu Laut, Middle Banks and Kuah (Malaysia) were grouped into another clade. The combined dataset of these two primer-pairs separated G. tenuistipitata obtained from Kelantan, Malaysia from that obtained from other localities. Conclusions Based on the variations in repeated nucleotides of microsatellite markers, our results suggested that the populations of G. tenuistipitata were distributed into two main geographical regions: (i) populations in the west coast of Peninsular Malaysia and (ii) populations facing the South China Sea. The correct identification of G. tenuistipitata strains with traits of high economic potential will be advantageous for the mass cultivation of seaweeds. PMID:24490797

Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

USGS Publications Warehouse

Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

2011-01-01

Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena

trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPsmore » to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N{sub 2}-dGuo lesion remained in the ring-closed conformation at the active site. The incoming dNTP, either dGTP or dATP, was positioned with Watson-Crick pairing opposite the template 5'-neighbor base, dCyt or dThy, respectively. In contrast, for the 18-mer:14-mer template-primers with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, ring opening of the adduct to the corresponding N{sub 2}-dGuo aldehyde species occurred. This allowed Watson-Crick base pairing at the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair.« less

A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

PubMed

Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

2002-12-01

The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

PubMed

Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

2009-08-01

Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

PubMed Central

Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

2013-01-01

We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.

PubMed

Khadhair, A H; Evans, I R; Choban, B

2002-01-01

In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.

SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

PubMed Central

2013-01-01

Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†

PubMed Central

Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

2000-01-01

We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

PubMed Central

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.

DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less

The Choice of PCR Primers Has Great Impact on Assessments of Bacterial Community Diversity and Dynamics in a Wastewater Treatment Plant

PubMed Central

Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie

2013-01-01

Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498

The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

PubMed Central

2004-01-01

With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225

Evaluation of a computer-based approach to teaching acid/base physiology.

PubMed

Rawson, Richard E; Quinlan, Kathleen M

2002-12-01

Because acid/base physiology is a difficult subject for most medical and veterinary students, the first author designed a software program, Acid/Base Primer, that would help students with this topic. The Acid/Base Primer was designed and evaluated within a conceptual framework of basic educational principles. Seventy-five first-year veterinary students (of 81; 93% response rate) participated in this study. Students took both a pre- and posttest of content understanding. After completing the Acid/Base Primer in pairs, each student filled out a survey evaluating the features of the program and describing his/her use and experience of it. Four pairs of students participated in interviews that elaborated on the surveys. Scores improved from 53 +/- 2% on the pretest to 74 +/- 1% on an immediate posttest. On surveys and in interviews, students reported that the program helped them construct their own understanding of acid/base physiology and prompted discussions in pairs of students when individual understandings differed. The case-based format provided anchors and a high degree of relevance. Repetition of concepts helped students develop a more complex network of understanding. Questions in the program served to scaffold the learning process by providing direction, accentuating the relevant features of the cases, and provoking discussion. Guidelines for software development were generated on the basis of the findings and relevant educational literature.

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

MRPrimerV: a database of PCR primers for RNA virus detection

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

2017-01-01

Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

PubMed

Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

2017-01-24

The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

Construction of a primary DNA fingerprint database for cotton cultivars.

PubMed

Zhang, Y C; Kuang, M; Yang, W H; Xu, H X; Zhou, D Y; Wang, Y Q; Feng, X A; Su, C; Wang, F

2013-06-13

Forty core primers were used to construct a DNA fingerprint database of 132 cotton species based on multiplex fluorescence detection technology. A high first successful ratio of 99.04% was demonstrated with tetraplex polymerase chain reaction. Forty primer pairs amplified a total of 262 genotypes among 132 species, with an average of 6.55 per primer and values of polymorphism information content varying from 0.340 to 0.882. Conflicting DNA homozygous ratios were found in various species. The highest DNA homozygous ratio was found in landrace standard cultivars, which had an 81.46% DNA homozygous ratio. The lowest occurred in a group of 2010 leading cultivars with a homozygous ratio of 63.04%. Genetic diversity of the 132 species was briefly analyzed using unweighted pair-group method with arithmetic means.

Genome-Wide Identification and Transferability of Microsatellite Markers between Palmae Species

PubMed Central

Xiao, Yong; Xia, Wei; Ma, Jianwei; Mason, Annaliese S.; Fan, Haikuo; Shi, Peng; Lei, Xintao; Ma, Zilong; Peng, Ming

2016-01-01

The Palmae family contains 202 genera and approximately 2800 species. Except for Elaeis guineensis and Phoenix dactylifera, almost no genetic and genomic information is available for Palmae species. Therefore, this is an obstacle to the conservation and genetic assessment of Palmae species, especially those that are currently endangered. The study was performed to develop a large number of microsatellite markers which can be used for genetic analysis in different Palmae species. Based on the assembled genome of E. guineensis and P. dactylifera, a total of 814 383 and 371 629 microsatellites were identified. Among these microsatellites identified in E. guineensis, 734 509 primer pairs could be designed from the flanking sequences of these microsatellites. The majority (618 762) of these designed primer pairs had in silico products in the genome of E. guineensis. These 618 762 primer pairs were subsequently used to in silico amplify the genome of P. dactylifera. A total of 7 265 conserved microsatellites were identified between E. guineensis and P. dactylifera. One hundred and thirty-five primer pairs flanking the conserved SSRs were stochastically selected and validated to have high cross-genera transferability, varying from 16.7 to 93.3% with an average of 73.7%. These genome-wide conserved microsatellite markers will provide a useful tool for genetic assessment and conservation of different Palmae species in the future. PMID:27826307

PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

PubMed

Pauthenier, Cyrille; Faulon, Jean-Loup

2014-07-01

PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

URPD: a specific product primer design tool

PubMed Central

2012-01-01

Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

URPD: a specific product primer design tool.

PubMed

Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

2012-06-19

Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

PubMed Central

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

RUCS: rapid identification of PCR primers for unique core sequences.

PubMed

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

2017-12-15

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Optimization of polymerase chain reaction for detection of Clostridium botulinum type C and D in bovine samples.

PubMed

Prévot, V; Tweepenninckx, F; Van Nerom, E; Linden, A; Content, J; Kimpe, A

2007-01-01

Botulism is a rare but serious paralytic illness caused by a nerve toxin that is produced by the bacterium Clostridium botulinum. The economic, medical and alimentary consequences can be catastrophic in case of an epizooty. A polymerase chain reaction (PCR)-based assay was developed for the detection of C. botulinum toxigenic strains type C and D in bovine samples. This assay has proved to be less expensive, faster and simpler to use than the mouse bioassay, the current reference method for diagnosis of C. botulinum toxigenic strains. Three pairs of primers were designed, one for global detection of C. botulinum types C and D (primer pair Y), and two strain-specific pairs specifically designed for types C (primer pair VC) and D (primer pair VD). The PCR amplification conditions were optimized and evaluated on 13 bovine and two duck samples that had been previously tested by the mouse bioassay. In order to assess the impact of sample treatment, both DNA extracted from crude samples and three different enrichment broths (TYG, CMM, CMM followed by TYG) were tested. A 100% sensitivity was observed when samples were enriched for 5 days in CMM followed by 1 day in TYG broth. False-negative results were encountered when C. botulinum was screened for in crude samples. These findings indicate that the current PCR is a reliable method for the detection of C. botulinum toxigenic strains type C and D in bovine samples but only after proper enrichment in CMM and TYG broth.

Development of Species-Specific SCAR Markers, Based on a SCoT Analysis, to Authenticate Physalis (Solanaceae) Species

PubMed Central

Feng, Shangguo; Zhu, Yujia; Yu, Chenliang; Jiao, Kaili; Jiang, Mengying; Lu, Jiangjie; Shen, Chenjia; Ying, Qicai; Wang, Huizhong

2018-01-01

Physalis is an important genus in the Solanaceae family. It includes many species of significant medicinal value, edible value, and ornamental value. However, many Physalis species are easily confused because of their similar morphological traits, which hinder the utilization and protection of Physalis resources. Therefore, it is necessary to create fast, sensitive, and reliable methods for the Physalis species authentication. Intended for that, in this study, species-specific sequence-characterized amplified region (SCAR) markers were developed for accurate identification of the closely related Physalis species P. angulata, P. minima, P. pubescens, and P. alkekengi var. franchetii, based on a simple and novel marker system, start codon targeted (SCoT) marker. A total of 34 selected SCoT primers yielded 289 reliable SCoT loci, of which 265 were polymorphic. Four species-specific SCoT fragments (SCoT3-1404, SCoT3-1589, SCoT5-550, and SCoT36-520) from Physalis species were successfully identified, cloned, and sequenced. Based on these selected specific DNA fragments, four SCAR primers pairs were developed and named ST3KZ, ST3MSJ, ST5SJ, and ST36XSJ. PCR analysis of each of these primer pairs clearly demonstrated a specific amplified band in all samples of the target Physalis species, but no amplification was observed in other Physalis species. Therefore, the species-specific SCAR primer pairs developed in this study could be used as powerful tools that can rapidly, effectively, and reliably identify and differentiate Physalis species.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

PubMed Central

Huang, M M; Arnheim, N; Goodman, M F

1992-01-01

Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

FUNGAL BIOGEOGRAPHY. Response to Comment on "Global diversity and geography of soil fungi".

PubMed

Tedersoo, Leho; Bahram, Mohammad; Põlme, Sergei; Anslan, Sten; Riit, Taavi; Kõljalg, Urmas; Nilsson, R Henrik; Hildebrand, Falk; Abarenkov, Kessy

2015-08-28

Schadt and Rosling (Technical Comment, 26 June 2015, p. 1438) argue that primer-template mismatches neglected the fungal class Archaeorhizomycetes in a global soil survey. Amplicon-based metabarcoding of nine barcode-primer pair combinations and polymerase chain reaction (PCR)-free shotgun metagenomics revealed that barcode and primer choice and PCR bias drive the diversity and composition of microorganisms in general, but the Archaeorhizomycetes were little affected in the global study. We urge that careful choice of DNA markers and primers is essential for ecological studies using high-throughput sequencing for identification. Copyright © 2015, American Association for the Advancement of Science.

Sex identification of four penguin species using locus-specific PCR.

PubMed

Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

2013-01-01

Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

PubMed Central

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

PubMed Central

Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

PubMed

Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing.

PubMed

Li, Yong; Zhang, Weirui

2015-10-01

Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker-assisted breeding.

Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Lee, H.K.; Flanders, D.J.

The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

Evaluation of Primers Targeting the Diazotroph Functional Gene and Development of NifMAP – A Bioinformatics Pipeline for Analyzing nifH Amplicon Data

PubMed Central

Angel, Roey; Nepel, Maximilian; Panhölzl, Christopher; Schmidt, Hannes; Herbold, Craig W.; Eichorst, Stephanie A.; Woebken, Dagmar

2018-01-01

Diazotrophic microorganisms introduce biologically available nitrogen (N) to the global N cycle through the activity of the nitrogenase enzyme. The genetically conserved dinitrogenase reductase (nifH) gene is phylogenetically distributed across four clusters (I–IV) and is widely used as a marker gene for N2 fixation, permitting investigators to study the genetic diversity of diazotrophs in nature and target potential participants in N2 fixation. To date there have been limited, standardized pipelines for analyzing the nifH functional gene, which is in stark contrast to the 16S rRNA gene. Here we present a bioinformatics pipeline for processing nifH amplicon datasets – NifMAP (“NifH MiSeq Illumina Amplicon Analysis Pipeline”), which as a novel aspect uses Hidden-Markov Models to filter out homologous genes to nifH. By using this pipeline, we evaluated the broadly inclusive primer pairs (Ueda19F–R6, IGK3–DVV, and F2–R6) that target the nifH gene. To evaluate any systematic biases, the nifH gene was amplified with the aforementioned primer pairs in a diverse collection of environmental samples (soils, rhizosphere and roots samples, biological soil crusts and estuarine samples), in addition to a nifH mock community consisting of six phylogenetically diverse members. We noted that all primer pairs co-amplified nifH homologs to varying degrees; up to 90% of the amplicons were nifH homologs with IGK3–DVV in some samples (rhizosphere and roots from tall oat-grass). In regards to specificity, we observed some degree of bias across the primer pairs. For example, primer pair F2–R6 discriminated against cyanobacteria (amongst others), yet captured many sequences from subclusters IIIE and IIIL-N. These aforementioned subclusters were largely missing by the primer pair IGK3–DVV, which also tended to discriminate against Alphaproteobacteria, but amplified sequences within clusters IIIC (affiliated with Clostridia) and clusters IVB and IVC. Primer pair Ueda19F–R6 exhibited the least bias and successfully captured diazotrophs in cluster I and subclusters IIIE, IIIL, IIIM, and IIIN, but tended to discriminate against Firmicutes and subcluster IIIC. Taken together, our newly established bioinformatics pipeline, NifMAP, along with our systematic evaluations of nifH primer pairs permit more robust, high-throughput investigations of diazotrophs in diverse environments. PMID:29760683

Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

PubMed

Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

2012-04-01

Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

Development of a PCR protocol to detect aflatoxigenic molds in food products.

PubMed

Luque, M Isabel; Rodríguez, Alicia; Andrade, María J; Martín, Alberto; Córdoba, Juan J

2012-01-01

Aflatoxins are secondary metabolites produced mainly by Aspergillus species growing in foodstuffs. Because aflatoxins have important health effects, the detection of early contamination of foods by aflatoxigenic molds should be useful. In the present work, a reliable conventional PCR method for detecting aflatoxigenic molds of various species was developed. Fifty-six aflatoxigenic and nonaflatoxigenic strains commonly reported in foodstuffs were tested. Aflatoxin production was first confirmed by micellar electrokinetic capillary electrophoresis or/and high-pressure liquid chromatography-mass spectrometry. Based on the conserved regions of the O-methyltransferase gene (omt-1) involved in the aflatoxin biosynthetic pathway, six primer pairs were designed. With only the designed primer pair AFF1-AFR3, the expected PCR product (381 bp) was obtained in all of the tested aflatoxigenic strains of various species and genera. Amplification products were not obtained with this primer pair for any of the nonaflatoxigenic reference molds. However, an amplicon of 453 bp was obtained for all aflatoxigenic and nonaflatoxigenic mold reference strains with a PCR protocol based on the constitutive fungal β-tubulin gene, which was used as a positive fungal control. The PCR protocol based on omt-1 detected as little as 15 pg of DNA from aflatoxigenic molds and 10(2) to 10(3) CFU/g in contaminated food samples. This PCR protocol should be used as a routine technique to detect aflatoxigenic molds in foods.

Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

PubMed Central

Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

2012-01-01

The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

PubMed

Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

2016-09-01

Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing1

PubMed Central

Li, Yong; Zhang, Weirui

2015-01-01

Premise of the study: Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Methods and Results: Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. Conclusions: This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding. PMID:26504683

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

A PCR-based tool for the cultivation-independent monitoring of Pandora neoaphidis.

PubMed

Fournier, A; Enkerli, J; Keller, S; Widmer, F

2008-09-01

Pandora neoaphidis is one of the most important fungal pathogens of aphids and has a great potential for use in biocontrol. Little is known on how this fungus persists in an area and in particular on its overwintering strategies. It is hypothesized that natural areas play an important role for survival and that soil may serve as a source of inoculum for new aphid populations in spring. To test these hypotheses, a cultivation-independent PCR-based diagnostic tool was developed, that allows the detection of P. neoaphidis in the environment. Two P. neoaphidis specific PCR primer pairs were designed, targeting sequences in the ribosomal RNA gene cluster. Specificity of both primer pairs was demonstrated with P. neoaphidis and non-target close entomophthoralean relatives. Moreover, single amplicons of expected sizes were obtained with both primer pairs from various environmental sample types, including aphid cadavers, plant material, and soil. The PCR-based diagnostic tool was applied to investigate the persistence of P. neoaphidis in soil samples obtained in 2004/2005 from a nettle field harboring infected aphids in fall 2004. P. neoaphidis was detected in every sample collected in November 2004 and March 2005, suggesting an overwintering stage of P. neoaphidis in top soil layers. The developed cultivation-independent PCR-based tool will be valuable for further investigation of the ecology of P. neoaphidis and for the development and future implementation of management strategies against aphids involving conservation biocontrol.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers

Treesearch

M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga

2004-01-01

The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...

Development of SCoT-Based SCAR Marker for Rapid Authentication of Taxus Media.

PubMed

Hao, Juan; Jiao, Kaili; Yu, Chenliang; Guo, Hong; Zhu, Yujia; Yang, Xiao; Zhang, Siyang; Zhang, Lei; Feng, Shangguo; Song, Yaobin; Dong, Ming; Wang, Huizhong; Shen, Chenjia

2018-06-01

Taxus media is an important species in the family Taxaceae with high medicinal and commercial value. Overexploitation and illegal trade have led T. media to a severe threat of extinction. In addition, T. media and other Taxus species have similar morphological traits and are easily misidentified, particularly during the seedling stage. The purpose of this study is to develop a species-specific marker for T. media. Through a screening of 36 start codon targeted (SCoT) polymorphism primers, among 15 individuals of 4 Taxus species (T. media, T. chinensis, T. cuspidate and T. fuana), a clear species-specific DNA fragment (amplified by primer SCoT3) for T. media was identified. After isolation and sequencing, a DNA sequence with 530 bp was obtained. Based on this DNA fragment, a primer pair for the sequence-characterized amplified region marker was designed and named MHSF/MHSR. PCR analysis with primer pair MHSF/MHSR revealed a clear amplified band for all individuals of T. media but not for T. chinensis, T. cuspidate and T. fuana. Therefore, this marker can be used as a quick, efficient and reliable tool to identify T. media among other related Taxus species. The results of this study will lay an important foundation for the protection and management of T. media as a natural resource.

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

Development of highly polymorphic EST-SSR markers and segregation in F₁ hybrid population of Vitis vinifera L.

PubMed

Kayesh, E; Zhang, Y Y; Liu, G S; Bilkish, N; Sun, X; Leng, X P; Fang, J G

2013-09-23

The objectives of this investigation were to develop and validate the expressed sequence tag (EST)-simple sequence repeat (SSR) markers from large EST sequences, and to study the segregation and distribution of SSRs within two grapevine parental lines. In total, 94 F₁ lines crossed between "Early Rose" and "Red Globe" were studied. Approximately 2100 EST-SSR sequences of Vitis vinifera L. were searched for SSRs and analyzed for the design of polymerase chain reaction (PCR) primers amplifying the SSR-rich regions. Trinucleotide repeats were found to be the most abundant, followed by other nucleotide repeats. A total of 182 SSR primer pairs were first developed for the study on the parental polymorphism. Among the 182 SSR primers, 142 primer pairs (78%) could amplify the anticipated PCR products, among which only 52 primer pairs (36.62%) showed polymorphism between the two parents. These polymorphic bands were further surveyed among the 94 F₁ lines, and the results showed that a total of 162 bands were amplified, and 98 of them were polymorphic in both parents (60.86% polymorphism), with an average of 1.88 polymorphic DNA bands for each primer pair. After testing with the chi-square test, 33 of the clearly amplified polymorphic bands followed a 3:1 ratio, and 37 followed a 1:1 ratio. The rest showed distorted segregation ratios.

Expressed Sequence Reference Standards for Evaluating Stage-specific Gene Expression in Southern Green Lacewings, Chrysoperla rufilabris

USDA-ARS?s Scientific Manuscript database

Five developmental stages of Chrysoperla rufilabris were tested using nine primer pairs. Three sequences were highly expressed at all life stages and six were differentially expressed. These primer pairs may be used as standards to quantitate functional gene expression associated with physiological ...

Early diagnosis of a Mexican variant of Papaya meleira virus (PMeV-Mx) by RT-PCR.

PubMed

Zamudio-Moreno, E; Ramirez-Prado, J H; Moreno-Valenzuela, O A; Lopez-Ochoa, L A

2015-02-06

Papaya meleira disease was identified in Brazil in the 1980s. The disease is caused by a double-stranded RNA virus known as Papaya meleira virus (PMeV), which has also been recently reported in Mexico. However, previously reported PMeV primers failed to diagnose the Mexican form of the disease. A genomic approach was used to identify sequences of the Mexican virus isolate, referred here to as PMeV-Mx, to develop a diagnostic method. A mini cDNA library was generated using total RNA from the latex of fruits; this RNA was also sequenced using the Illumina platform. Sequences corresponding to the previously reported 669-base pair sequence for PMeV from Brazil (PMeV-Br) were identified within the PMeV-Mx genome, exhibiting 79-92% identity with PMeV-Br. In addition, a new sequence of 1154-base pairs encoding a putative RNA-dependent RNA polymerase was identified in PMeV-Mx. Primers designed against this sequence detected both virus isolates, 2 amplicons of 173 and 491 base pairs from PMeV-Br and PMeV-Mx, and shared 100 and 98% identity, respectively. PMeV-Mx was found in the latex of fruits, in seedlings, and in the leaves, flowers, petioles, and seeds of mature plants. PMeV-Mx was more abundant in the latex of fruits than in the leaves. The limit of detection of the CB38/CB39 primer pair was 1 fg and 1 pg using total RNA extracted from the latex of fruits and from seedlings, respectively. A sensitive and early diagnosis protocol was developed; this method will enable the certification of seeds and seedlings prior to transplantation to the field.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F. William

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F.W.

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.

Bacterial community structure analysis of sediment in the Sagami River, Japan using a rapid approach based on two-dimensional DNA gel electrophoresis mapping with selective primer pairs.

PubMed

Liu, Guo-hua; Rajendran, Narasimmalu; Amemiya, Takashi; Itoh, Kiminori

2011-11-01

A rapid approach based on two-dimensional DNA gel electrophroesis (2-DGE) mapping with selective primer pairs was employed to analyze bacterial community structure in sediments from upstream, midstream and downstream of Sagami River in Japan. The 2-DGE maps indicated that Alpha- and Delta-proteobacteria were major bacterial populations in the upstream and midstream sediments. Further bacterial community structure analysis showed that richness proportion of Alpha- and Delta-proteobacterial groups reflected a trend toward decreasing from the upstream to downstream sediments. The biomass proportion of bacterial populations in the midstream sediment showed a significantly difference from that in the other sediments, suggesting that there may be an environmental pressure on the midstream bacterial community. Lorenz curves, together with Gini coefficients were successfully applied to the 2-DGE mapping data for resolving evenness of bacterial populations, and showed that the plotted curve from high-resolution 2-DGE mapping became less linear and more an exponential function than that of the 1-DGE methods such as chain length analysis and denaturing gradient gel electrophoresis, suggesting that the 2-DGE mapping may achieve a more detailed evaluation of bacterial community. In conclusion, the 2-DGE mapping combined with the selective primer pairs enables bacterial community structure analysis in river sediment and thus it can also monitor sediment pollution based on the change of bacterial community structure.

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Quantitative phenotyping of X-disease resistance in chokecherry using real-time PCR.

PubMed

Huang, Danqiong; Walla, James A; Dai, Wenhao

2014-03-01

A quantitative real-time SYBR Green PCR (qPCR) assay has been developed to detect and quantify X-disease phytoplasmas in chokecherry. An X-disease phytoplasma-specific and high sensitivity primer pair was designed based on the 16S rRNA gene sequence of X-disease phytoplasmas. This primer pair was specific to the 16SrIII group (X-disease) phytoplasmas. The qPCR method can quantify phytoplasmas from a DNA mix (a mix of both chokecherry and X-disease phytoplasma DNA) at as low as 0.001 ng, 10-fold lower than conventional PCR using the same primer pair. A significant correlation between the copy number of phytoplasmas and visual phenotypic rating scores of X-disease resistance in chokecherry plants was observed. Disease resistant chokecherries had a significantly lower titer of X-disease phytoplasmas than susceptible plants. This suggests that the qPCR assay provides a more objective tool to phenotype phytoplasma disease severity, particularly for early evaluation of host resistance; therefore, this method will facilitate quantitative phenotyping of disease resistance and has great potential in enhancing plant breeding. Copyright © 2013 Elsevier B.V. All rights reserved.

An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

PubMed Central

Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

2015-01-01

Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

PubMed

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

PubMed Central

Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

2016-01-01

Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

PubMed

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-11-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

PubMed

Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

1999-01-01

A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

PubMed Central

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-01-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

A SSR-based composite genetic linkage map for the cultivated peanut (Arachis hypogaea L.) genome

PubMed Central

2010-01-01

Background The construction of genetic linkage maps for cultivated peanut (Arachis hypogaea L.) has and continues to be an important research goal to facilitate quantitative trait locus (QTL) analysis and gene tagging for use in a marker-assisted selection in breeding. Even though a few maps have been developed, they were constructed using diploid or interspecific tetraploid populations. The most recently published intra-specific map was constructed from the cross of cultivated peanuts, in which only 135 simple sequence repeat (SSR) markers were sparsely populated in 22 linkage groups. The more detailed linkage map with sufficient markers is necessary to be feasible for QTL identification and marker-assisted selection. The objective of this study was to construct a genetic linkage map of cultivated peanut using simple sequence repeat (SSR) markers derived primarily from peanut genomic sequences, expressed sequence tags (ESTs), and by "data mining" sequences released in GenBank. Results Three recombinant inbred lines (RILs) populations were constructed from three crosses with one common female parental line Yueyou 13, a high yielding Spanish market type. The four parents were screened with 1044 primer pairs designed to amplify SSRs and 901 primer pairs produced clear PCR products. Of the 901 primer pairs, 146, 124 and 64 primer pairs (markers) were polymorphic in these populations, respectively, and used in genotyping these RIL populations. Individual linkage maps were constructed from each of the three populations and a composite map based on 93 common loci were created using JoinMap. The composite linkage maps consist of 22 composite linkage groups (LG) with 175 SSR markers (including 47 SSRs on the published AA genome maps), representing the 20 chromosomes of A. hypogaea. The total composite map length is 885.4 cM, with an average marker density of 5.8 cM. Segregation distortion in the 3 populations was 23.0%, 13.5% and 7.8% of the markers, respectively. These distorted loci tended to cluster on LG1, LG3, LG4 and LG5. There were only 15 EST-SSR markers mapped due to low polymorphism. By comparison, there were potential synteny, collinear order of some markers and conservation of collinear linkage groups among the maps and with the AA genome but not fully conservative. Conclusion A composite linkage map was constructed from three individual mapping populations with 175 SSR markers in 22 composite linkage groups. This composite genetic linkage map is among the first "true" tetraploid peanut maps produced. This map also consists of 47 SSRs that have been used in the published AA genome maps, and could be used in comparative mapping studies. The primers described in this study are PCR-based markers, which are easy to share for genetic mapping in peanuts. All 1044 primer pairs are provided as additional files and the three RIL populations will be made available to public upon request for quantitative trait loci (QTL) analysis and linkage map improvement. PMID:20105299

Characterization and classification of one new cytoplasmic male sterility (CMS) line based on morphological, cytological and molecular markers in non-heading Chinese cabbage (Brassica rapa L.).

PubMed

Heng, Shuangping; Shi, Dianyi; Hu, Zhenhua; Huang, Tao; Li, Jinping; Liu, Liyan; Xia, Chunxiu; Yuan, Zhenzhen; Xu, Yuejin; Fu, Tingdong; Wan, Zhengjie

2015-09-01

A new non-heading Chinese cabbage CMS line M119A was characterized and specific molecular markers were developed to classify different CMS types. One new non-heading Chinese cabbage (Brassica rapa L.) cytoplasmic male sterile (CMS) line M119A was obtained by interspecific crosses between the recently discovered hau CMS line of Brassica juncea and B. rapa. Furthermore, the line was characterized and compared with other five isonuclear-alloplasmic CMS lines. The M119A line produced six stamens without pollen and only two stamen fused together in fewer flowers. Tissue section indicated that anther abortion in M119A may have occurred during differentiation of the archesporial cells without pollen sac. All the six CMS lines were grouped into three types based on the presence of three PCR fragments of 825, 465 and 772 bp amplified with different mitochondrial genes specific primers. The 825-bp fragment was amplified both in 09-10A and H201A using the specific primer pair P-orf224-atp6, and showed 100 % identity with the mitochondrial gene of pol CMS. The 465-bp fragment was amplified in 30A and 105A using the primer pair P-orf138 and shared 100 % identity with the mitochondrial gene of ogu CMS. The 772-bp fragment was amplified in M119A and H203A using the primer pair P-orf288 and showed 100 % identity with the mitochondrial gene of hau CMS. Therefore, these markers could efficiently distinguish different types of isonuclear-alloplasmic CMS lines of non-heading Chinese cabbage, which were useful for improving the efficiency of cross-breeding and heterosis utilization in cruciferous vegetables.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

PubMed

van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

2008-09-01

To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

Microsatellite DNA as shared genetic markers among conifer species

Treesearch

C.S. Echt; G.G. Vendramin; C. D. Nelson; Paula E. Marquardt

1999-01-01

Polymerase chain reaction (PCR) primer pairs for 21 simple sequence repeat (SSR) loci in Pinus strobus L, and 6 in Pinus radiata D. Don were evaluated to determine whether SSR marker amplification could be achieved in 1O other conifer species. Eighty percent of SSR primer pairs for (AC) loci that were polymorphic in P. ...

Microsatellite DNA as shared genetic markers among conifer species

Treesearch

Craig S. Echt; G.G. Vendramin; C.D. Nelson; P. Marquardt

1999-01-01

Polymerase chain reaction (PCR) primer pairs for 21 simple sequence repeat (SSR) loci in Pinus strobus L. and 6 in Pinus radiata D. Don. were evaluated to determine whether SSR marker amplification could be achieved in 10 other conifer species. Eighty percent of SSR primer pairs for (AC)n loci that were polymorphic in P. ...

A simple and rapid method for detection of Trypanosoma evansi in the dromedary camel using a nested polymerase chain reaction

PubMed Central

Aradaib, Imadeldin E; Majid, Ali A

2006-01-01

A nested polymerase chain reaction (nPCR)-based assay, was developed and evaluated for rapid detection of Trypanosoma evansi in experimentally infected mice and naturally infected camels (Camelus dromedarius). Four oligonucleotide primers (TE1, TE2, TE3 and TE4), selected from nuclear repetitive gene of T. evansi, were designed and used for PCR amplifications. The first amplification, using a pair of outer primers TE1 and TE2, produced a 821-bp primary PCR product from T. evansi DNA. The second amplification, using nested (internal) pair of primers TE3 and TE4, produced a 270-bp PCR product. T. evansi DNAs extracted from blood samples of experimentally infected mice and naturally infected Sudanese breed of dromedary camels were detected by this nested PCR-based assay. The nested primers TE3 and TE4 increased the sensitivity of the PCR assay and as little as 10 fg of T. evansi DNA (equivalent to a single copy of the putative gene of the parasite) was amplified and visualized onto ethidium bromide-stained agarose gels. Amplification products were not detected when the PCR-based assay was applied to DNA from other blood parasites including Thieleria annulata, Babesia bigemina or nucleic acid free samples. Application of this nPCR-based assay to clinical samples resulted in direct detection of T. evansi from a variety of tissue samples collected from experimentally infected mice and blood from naturally infected camels. The described nPCR-based assay provides a valuable tool to study the epidemiology of T. evansi infection in camels and other susceptible animal populations. PMID:16712737

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

PubMed Central

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

DTIC Science & Technology

2007-05-08

deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

Species-Specific Detection of Mycosphaerella polygoni-cuspidati as a Biological Control Agent for Fallopia japonica by PCR Assay.

PubMed

Kurose, Daisuke; Furuya, Naruto; Saeki, Tetsuya; Tsuchiya, Kenichi; Tsushima, Seiya; Seier, Marion K

2016-10-01

The ascomycete fungus Mycosphaerella polygoni-cuspidati has been undergoing evaluation as a potential classical biological control agent for the invasive weed Fallopia japonica (Japanese knotweed), which has become troublesome in Europe and North America. In advance of the potential release of a biocontrol agent into a new environment, it is crucial to develop an effective monitoring system to enable the evaluation of agent establishment and dispersal within the target host population, as well as any potential attacks on non-target species. Therefore, a primer pair was designed for direct, rapid, and specific detection of the Japanese knotweed pathogen M. polygoni-cuspidati based on the sequences of the internal transcribed spacer regions including the 5.8S rDNA. A PCR product of approximately 298 bp was obtained only when the DNA extracted from mycelial fragments of M. polygoni-cuspidati was used. The lower limit of detection of the PCR method was 100 fg of genomic DNA. Using the specific primer pair, M. polygoni-cuspidati could be detected from both naturally and artificially infected Japanese knotweed plants. No amplification was observed for other Mycosphaerella spp. or fungal endophytes isolated from F. japonica. The designed primer pair is thus effective for the specific detection of M. polygoni-cuspidati in planta.

Developing new microsatellite markers in walnut (Juglans regia L.) from Juglans nigra genomic GA enriched library

Treesearch

Hayat Topcu; Nergiz Coban; Keith Woeste; Mehmet Sutyemez; Salih Kafkas

2015-01-01

We attempted to develop new polymorphic SSR primer pairs in walnut using sequences derived from Juglans nigra L. genomic enriched library with GA repeat. The designed 94 SSR primer pairs were subjected to gradient PCR in 12 walnut cultivars to determine their optimum annealing temperatures and to determine whether they produce bands. Then, the...

In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

PubMed

Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

2003-03-01

SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

PubMed

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

PubMed Central

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

The yeast retrotransposon Ty5 uses the anticodon stem-loop of the initiator methionine tRNA as a primer for reverse transcription.

PubMed Central

Ke, N; Gao, X; Keeney, J B; Boeke, J D; Voytas, D F

1999-01-01

Retrotransposons and retroviruses replicate by reverse transcription of an mRNA intermediate. Most retroelements initiate reverse transcription from a host-encoded tRNA primer. DNA synthesis typically extends from the 3'-OH of the acceptor stem, which is complementary to sequences on the retroelement mRNA (the primer binding site, PBS). However, for some retrotransposons, including the yeast Ty5 elements, sequences in the anticodon stem-loop of the initiator methionine tRNA (IMT) are complementary to the PBS. We took advantage of the genetic tractability of the yeast system to investigate the mechanism of Ty5 priming. We found that transposition frequencies decreased at least 800-fold for mutations in the Ty5 PBS that disrupt complementarity with the IMT. Similarly, transposition was reduced at least 200-fold for IMT mutations in the anticodon stem-loop. Base pairing between the Ty5 PBS and IMT is essential for transposition, as compensatory changes that restored base pairing between the two mutant RNAs restored transposition significantly. An analysis of 12 imt mutants with base changes outside of the region of complementarity failed to identify other tRNA residues important for transposition. In addition, assays carried out with heterologous IMTs from Schizosaccharomyces pombe and Arabidopsis thaliana indicated that residues outside of the anticodon stem-loop have at most a fivefold effect on transposition. Our genetic system should make it possible to further define the components required for priming and to understand the mechanism by which Ty5's novel primer is generated. PMID:10411136

Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

PubMed

Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

2015-10-01

Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.

Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

PubMed

Vela, J; Vitorica, J; Ruano, D

2001-12-01

We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

PubMed

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

PubMed Central

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus.

PubMed

Raue, R; Hess, M

1998-08-01

Three different polymerase chain reactions (PCRs), two of them combined with restriction enzyme analysis (REA), were developed for detection and differentiation of all 12 fowl adenovirus (FAV) serotypes and the egg drop syndrome (EDS) virus. For primer construction FAV1, FAV10 and EDS virus hexon proteins were aligned and conserved and variable regions were determined. Two primer sets (H1/H2 and H3/H4) for single use were constructed which hybridize in three conserved regions of hexon genes. Each primer pair amplifies approximately half of the hexon gene including two loop regions. An amplification product was detected with both primer sets using purified DNA from all FAV1-12 reference strains. Viral EDS DNA was negative using the H1/H2 or H3/H4 primer pair. HaeII digestion of the H1/H2 amplification products differentiates between all viruses except FAV4 and FAV5. In comparison, much more clustering among genomic closely related FAV serotypes was seen after HpaII digestion of the H3/H4 PCR products. Oligonucleotides H5/H6 located in the variable regions of EDS virus hexon gene do not detect any of the FAV serotypes. The PCRs and REA described are suitable to detect all avian adenoviruses infecting chickens, to distinguish all 12 FAV reference strains and to differentiate FAVs from the EDS virus.

Characterization of EST-derived and non-EST simple sequence repeats in an F₁ hybrid population of Vitis vinifera L.

PubMed

Kayesh, E; Bilkish, N; Liu, G S; Chen, W; Leng, X P; Fang, J G

2014-03-31

Among different classes of molecular markers, expressed sequence tags (ESTs) are a new resource for developing simple sequence repeat (SSR) functional markers for genotyping and genetic mapping in F1 hybrid populations of Vitis vinifera L. Recently, because of the availability of an enormous amount of data for ESTs in the public domain, the emphasis has shifted from genomic SSRs to EST-SSRs, which belong to transcribed regions of the genome and may have a role in gene expression or function. The objective of this study was to assess the polymorphisms among 94 F1 hybrids from "Early Rose" and "Red Globe" using 25 EST-derived and 25 non-EST SSR markers. A total collection of 362,375 grape ESTs that were retrieved from the National Center for Biotechnology Information (NCBI) and 2522 EST-SSR sequences were identified. From them, 205 primer pairs were randomly selected, including 176 pairs that were EST-derived and 29 non-EST SSR primer pairs, for polymerase chain reaction amplification. A total of 131 alleles were amplified using 50 pairs of primers; 78 alleles were amplified using EST-derived SSR primers and 53 were from non-EST SSR primers. At most, 6 and 5 alleles were amplified by EST-derived and non-EST SSR primers, respectively. The EST-derived SSR markers showed a maximum polymorphic information content (PIC) value of 1 and a minimum of 0.33 while non-EST SSR markers had maximum and minimum PIC values of 1 and 0.25, respectively. The average PIC value was 0.56 for EST-derived SSR markers and 0.45 for non-EST SSR markers.

Tetranucleotide microsatellite loci from the black bear (Ursus americanus)

USGS Publications Warehouse

Sanderlin, J.S.; Faircloth, B.C.; Shamblin, B.; Conroy, M.J.

2009-01-01

We describe primers and polymerase chain reaction conditions to amplify 21 tetranucleotide microsatellite DNA loci in black bears (Ursus americanus). We tested primers using individuals from two populations, one each in Georgia and Florida. Among individuals from Georgia (n = 29), primer pairs yielded an average of 2.9 alleles (range, one to four) and an average observed heterozygosity (HO) of 0.50 (range, 0.00 to 0.79). Among individuals from Florida (n = 19), primer pairs yielded an average of 5.7 alleles (range, one to 14) and an HO of 0.55 (range, 0.00 to 1.00). A comparison of previously developed markers with individuals from Georgia suggests that bear populations in Georgia and Florida have reduced allelic diversity relative to other populations. ?? 2008 The Authors.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

PubMed

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

PubMed

Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

2014-11-01

To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Crystallographic observation of nonenzymatic RNA primer extension.

PubMed

Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W

2018-05-31

The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.

Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

PubMed

Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

2014-09-01

Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

USGS Publications Warehouse

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Identification and characterization of gene-based SSR markers in date palm (Phoenix dactylifera L.).

PubMed

Zhao, Yongli; Williams, Roxanne; Prakash, C S; He, Guohao

2012-12-15

Date palm (Phoenix dactylifera L.) is an important tree in the Middle East and North Africa due to the nutritional value of its fruit. Molecular Breeding would accelerate genetic improvement of fruit tree through marker assisted selection. However, the lack of molecular markers in date palm restricts the application of molecular breeding. In this study, we analyzed 28,889 EST sequences from the date palm genome database to identify simple-sequence repeats (SSRs) and to develop gene-based markers, i.e. expressed sequence tag-SSRs (EST-SSRs). We identified 4,609 ESTs as containing SSRs, among which, trinucleotide motifs (69.7%) were the most common, followed by tetranucleotide (10.4%) and dinucleotide motifs (9.6%). The motif AG (85.7%) was most abundant in dinucleotides, while motifs AGG (26.8%), AAG (19.3%), and AGC (16.1%) were most common among trinucleotides. A total of 4,967 primer pairs were designed for EST-SSR markers from the computational data. In a follow up laboratory study, we tested a sample of 20 random selected primer pairs for amplification and polymorphism detection using genomic DNA from date palm cultivars. Nearly one-third of these primer pairs detected DNA polymorphism to differentiate the twelve date palm cultivars used. Functional categorization of EST sequences containing SSRs revealed that 3,108 (67.4%) of such ESTs had homology with known proteins. Date palm EST sequences exhibits a good resource for developing gene-based markers. These genic markers identified in our study may provide a valuable genetic and genomic tool for further genetic research and varietal development in date palm, such as diversity study, QTL mapping, and molecular breeding.

Development of Pineapple Microsatellite Markers and Germplasm Genetic Diversity Analysis

PubMed Central

Tong, Helin; Chen, You; Wang, Jingyi; Chen, Yeyuan; Sun, Guangming; He, Junhu; Wu, Yaoting

2013-01-01

Two methods were used to develop pineapple microsatellite markers. Genomic library-based SSR development: using selectively amplified microsatellite assay, 86 sequences were generated from pineapple genomic library. 91 (96.8%) of the 94 Simple Sequence Repeat (SSR) loci were dinucleotide repeats (39 AC/GT repeats and 52 GA/TC repeats, accounting for 42.9% and 57.1%, resp.), and the other three were mononucleotide repeats. Thirty-six pairs of SSR primers were designed; 24 of them generated clear bands of expected sizes, and 13 of them showed polymorphism. EST-based SSR development: 5659 pineapple EST sequences obtained from NCBI were analyzed; among 1397 nonredundant EST sequences, 843 were found containing 1110 SSR loci (217 of them contained more than one SSR locus). Frequency of SSRs in pineapple EST sequences is 1SSR/3.73 kb, and 44 types were found. Mononucleotide, dinucleotide, and trinucleotide repeats dominate, accounting for 95.6% in total. AG/CT and AGC/GCT were the dominant type of dinucleotide and trinucleotide repeats, accounting for 83.5% and 24.1%, respectively. Thirty pairs of primers were designed for each of randomly selected 30 sequences; 26 of them generated clear and reproducible bands, and 22 of them showed polymorphism. Eighteen pairs of primers obtained by the one or the other of the two methods above that showed polymorphism were selected to carry out germplasm genetic diversity analysis for 48 breeds of pineapple; similarity coefficients of these breeds were between 0.59 and 1.00, and they can be divided into four groups accordingly. Amplification products of five SSR markers were extracted and sequenced, corresponding repeat loci were found and locus mutations are mainly in copy number of repeats and base mutations in the flanking region. PMID:24024187

Marker-assisted selection for recognizing wheat mutant genotypes carrying HMW glutenin alleles related to baking quality.

PubMed

Zamani, Mohammad Javad; Bihamta, Mohammad Reza; Naserian Khiabani, Behnam; Tahernezhad, Zahra; Hallajian, Mohammad Taher; Shamsi, Marzieh Varasteh

2014-01-01

Allelic diversity of HMW glutenin loci in several studies revealed that allelic combinations affect dough quality. Dx5 + Dy10 subunits are related to good baking quality and Dx2 + Dy12 are related to undesirable baking quality. One of the most regular methods to evaluate the baking quality is SDS-PAGE which is used to improve baking quality labs. Marker-assisted selection is the method which can recognize the alleles related to baking quality and this method is based on polymerase chain reaction. 10 pairs of specific primers related to Dx2, Dx2.1, Dx5, Dy10, and Dy12 subunits were used for recognizing baking quality of some wheat varieties and some mutant genotypes. Only 5 pairs of them could show the specific bands. All subunits were recognized by the primers except Dx2.1. Some of the primers were extracted from previous studies and the others were designed based on D genome subunits of wheat. SDS-PAGE method accomplished having confidence in these marker's results. To realize the effect of mutation, seed storage proteins were measured. It showed that mutation had effect on the amount of seed storage protein on the mutant seeds (which showed polymorphism).

Development of a molecular approach to describe the composition of Trichoderma communities.

PubMed

Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele

2010-01-01

Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.

Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

PubMed Central

Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

2005-01-01

A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 – 30 November 2011

PubMed Central

ABREU, ALUANA G.; ALBAINA, A.; ALPERMANN, TILMAN J.; APKENAS, VANESSA E.; BANKHEAD-DRONNET, S.; BERGEK, SARA; BERUMEN, MICHAEL L.; CHO, CHANG-HUNG; CLOBERT, JEAN; COULON, AURÉLIE; DE FERAUDY, D.; ESTONBA, A.; HANKELN, THOMAS; HOCHKIRCH, AXEL; HSU, TSAI-WEN; HUANG, TSURNG-JUHN; IRIGOIEN, X.; IRIONDO, M.; KAY, KATHLEEN M.; KINITZ, TIM; KOTHERA, LINDA; LE HÉNANFF, MAXIME; LIEUTIER, F.; LOURDAIS, OLIVIER; MACRINI, CAMILA M. T.; MANZANO, C.; MARTIN, C.; MORRIS, VERONICA R. F.; NANNINGA, GERRIT; PARDO, M. A.; PLIESKE, JÖRG; POINTEAU, S.; PRESTEGAARD, TORE; QUACK, MARKUS; RICHARD, MURIELLE; SAVAGE, HARRY M.; SCHWARCZ, KAISER D.; SHADE, JESSICA; SIMMS, ELLEN L.; SOLFERINI, VERA N.; STEVENS, VIRGINIE M.; VEITH, MICHAEL; WEN, MEI-JUAN; WICKER, FLORIAN; YOST, JENNIFER M.; ZARRAONAINDIA, I.

2017-01-01

This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. PMID:22296658

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan.

PubMed

Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro

2016-10-11

Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

SMM-system: A mining tool to identify specific markers in Salmonella enterica.

PubMed

Yu, Shuijing; Liu, Weibing; Shi, Chunlei; Wang, Dapeng; Dan, Xianlong; Li, Xiao; Shi, Xianming

2011-03-01

This report presents SMM-system, a software package that implements various personalized pre- and post-BLASTN tasks for mining specific markers of microbial pathogens. The main functionalities of SMM-system are summarized as follows: (i) converting multi-FASTA file, (ii) cutting interesting genomic sequence, (iii) automatic high-throughput BLASTN searches, and (iv) screening target sequences. The utility of SMM-system was demonstrated by using it to identify 214 Salmonella enterica-specific protein-coding sequences (CDSs). Eighteen primer pairs were designed based on eighteen S. enterica-specific CDSs, respectively. Seven of these primer pairs were validated with PCR assay, which showed 100% inclusivity for the 101 S. enterica genomes and 100% exclusivity of 30 non-S. enterica genomes. Three specific primer pairs were chosen to develop a multiplex PCR assay, which generated specific amplicons with a size of 180bp (SC1286), 238bp (SC1598) and 405bp (SC4361), respectively. This study demonstrates that SMM-system is a high-throughput specific marker generation tool that can be used to identify genus-, species-, serogroup- and even serovar-specific DNA sequences of microbial pathogens, which has a potential to be applied in food industries, diagnostics and taxonomic studies. SMM-system is freely available and can be downloaded from http://foodsafety.sjtu.edu.cn/SMM-system.html. Copyright © 2011 Elsevier B.V. All rights reserved.

Tetranucleotide microsatellite loci from the black bear (Ursus americanus).

PubMed

Sanderlin, Jamie Skvarla; Faircloth, Brant C; Shamblin, Brian; Conroy, Michael J

2009-01-01

We describe primers and polymerase chain reaction conditions to amplify 21 tetranucleotide microsatellite DNA loci in black bears (Ursus americanus). We tested primers using individuals from two populations, one each in Georgia and Florida. Among individuals from Georgia (n = 29), primer pairs yielded an average of 2.9 alleles (range, one to four) and an average observed heterozygosity (H(O) ) of 0.50 (range, 0.00 to 0.79). Among individuals from Florida (n = 19), primer pairs yielded an average of 5.7 alleles (range, one to 14) and an H(O) of 0.55 (range, 0.00 to 1.00). A comparison of previously developed markers with individuals from Georgia suggests that bear populations in Georgia and Florida have reduced allelic diversity relative to other populations. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.

Isolation and characterization of novel microsatellite markers from the sika deer (Cervus nippon) genome.

PubMed

Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H

2015-09-28

Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.

Ligase Detection Reaction Generation of Reverse Molecular Beacons for Near Real-Time Analysis of Bacterial Pathogens Using Single-Pair Fluorescence Resonance Energy Transfer and a Cyclic Olefin Copolymer Microfluidic Chip

PubMed Central

Peng, Zhiyong; Soper, Steven A.; Pingle, Maneesh R.; Barany, Francis; Davis, Lloyd M.

2015-01-01

Detection of pathogenic bacteria and viruses require strategies that can signal the presence of these targets in near real-time due to the potential threats created by rapid dissemination into water and/or food supplies. In this paper, we report an innovative strategy that can rapidly detect bacterial pathogens using reporter sequences found in their genome without requiring polymerase chain reaction (PCR). A pair of strain-specific primers was designed based on the 16S rRNA gene and were end-labeled with a donor (Cy5) or acceptor (Cy5.5) dye. In the presence of the target bacterium, the primers were joined using a ligase detection reaction (LDR) only when the primers were completely complementary to the target sequence to form a reverse molecular beacon (rMB), thus bringing Cy5 (donor) and Cy5.5 (acceptor) into close proximity to allow fluorescence resonance energy transfer (FRET) to occur. These rMBs were subsequently analyzed using single-molecule detection of the FRET pairs (single-pair FRET; spFRET). The LDR was performed using a continuous flow thermal cycling process configured in a cyclic olefin copolymer (COC) microfluidic device using either 2 or 20 thermal cycles. Single-molecule photon bursts from the resulting rMBs were detected on-chip and registered using a simple laser-induced fluorescence (LIF) instrument. The spFRET signatures from the target pathogens were reported in as little as 2.6 min using spFRET. PMID:21047095

Utility of EST-derived SSR in cultivated peanut (Arachis hypogaea L.) and Arachis wild species

PubMed Central

Liang, Xuanqiang; Chen, Xiaoping; Hong, Yanbin; Liu, Haiyan; Zhou, Guiyuan; Li, Shaoxiong; Guo, Baozhu

2009-01-01

Background Lack of sufficient molecular markers hinders current genetic research in peanuts (Arachis hypogaea L.). It is necessary to develop more molecular markers for potential use in peanut genetic research. With the development of peanut EST projects, a vast amount of available EST sequence data has been generated. These data offered an opportunity to identify SSR in ESTs by data mining. Results In this study, we investigated 24,238 ESTs for the identification and development of SSR markers. In total, 881 SSRs were identified from 780 SSR-containing unique ESTs. On an average, one SSR was found per 7.3 kb of EST sequence with tri-nucleotide motifs (63.9%) being the most abundant followed by di- (32.7%), tetra- (1.7%), hexa- (1.0%) and penta-nucleotide (0.7%) repeat types. The top six motifs included AG/TC (27.7%), AAG/TTC (17.4%), AAT/TTA (11.9%), ACC/TGG (7.72%), ACT/TGA (7.26%) and AT/TA (6.3%). Based on the 780 SSR-containing ESTs, a total of 290 primer pairs were successfully designed and used for validation of the amplification and assessment of the polymorphism among 22 genotypes of cultivated peanuts and 16 accessions of wild species. The results showed that 251 primer pairs yielded amplification products, of which 26 and 221 primer pairs exhibited polymorphism among the cultivated and wild species examined, respectively. Two to four alleles were found in cultivated peanuts, while 3–8 alleles presented in wild species. The apparent broad polymorphism was further confirmed by cloning and sequencing of amplified alleles. Sequence analysis of selected amplified alleles revealed that allelic diversity could be attributed mainly to differences in repeat type and length in the microsatellite regions. In addition, a few single base mutations were observed in the microsatellite flanking regions. Conclusion This study gives an insight into the frequency, type and distribution of peanut EST-SSRs and demonstrates successful development of EST-SSR markers in cultivated peanut. These EST-SSR markers could enrich the current resource of molecular markers for the peanut community and would be useful for qualitative and quantitative trait mapping, marker-assisted selection, and genetic diversity studies in cultivated peanut as well as related Arachis species. All of the 251 working primer pairs with names, motifs, repeat types, primer sequences, and alleles tested in cultivated and wild species are listed in Additional File 1. PMID:19309524

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

A teat papillomatosis case in a Damascus goat (Shami goat) in Hatay province, Turkey: a new putative papillomavirus?

PubMed

Dogan, Fırat; Dorttas, Selvi Deniz; Bilge Dagalp, Seval; Ataseven, Veysel Soydal; Alkan, Feray

2018-06-01

Papillomaviruses (PVs) are epitheliotropic viruses that cause benign proliferative lesions in the skin (warts or papillomas) and mucous membranes of their natural hosts. Recently, new PVs have been found in many animal species. The most common current approach for identifying novel PV types is based on PCR, using various consensus or degenerated primer (broad-range primers), designed on the basis of the multiple alignment of nucleotide or amino acid sequences of a large number of different human papillomaviruses (HPV). PVs have been classified according to the sequence similarity of one of their capsid proteins, L1, without taking into account other regions of the genome and without considering the phenotypic characteristics of the viral infection. In this study, we performed molecular detection and typing of a PV in a goat with teat papillomatosis. Firstly, PCR was performed using the FAP59/FAP64 and MY09/MY11 primer pairs for the L1 gene region. The PV DNA was found to be positive only with the FAP59/FAP64 primer pair. PV DNA was then tested with three primer sets in four different combinations (L2Bf/FAP64, L2Bf/L1Br, FAP59/FAP64, L1Bf/LCRBr) for the gene region encoding the L1, L2 and LCR proteins. The goat teat papilloma sample was amplified using FAP59/FAP64 primers and two primer pairs (L2Bf/FAP64 and L2Bf/L1Br). We obtained products matching approximately 604 bp of the L1 region of the virus. PV DNA was used for typing using sequence analysis/PCR with some type-specific primers for bovids, caprids and cervids. The results of the sequence analysis suggested one new putative PV type with sequence identity ranging from 46.45 to 80.09% to other known papillomaviruses, including Capra hircus papillomavirus (ChPV-2), bovine papillomavirus (BPV) 6, 7, 10, 11 and 12, Rangifer tarandus papillomavirus 3 (RtPV-3) and BPV-7Z (Alpine wild ruminant papillomavirus; Cervus elaphus papillomavirus). We therefore propose that this is the first identification of a new putative type, MG523274 (HTY-goat-TR2016), in a goat with teat papillomatosis. It is essential to identify PV types in different animal species and investigate their prevalence/distribution and clinical consequences in order to develop appropriate prophylactic and/or therapeutic procedures and to determine the interspecies transmission potential and evolution of PVs.

Molecular identification and genetic variation of varieties of Styphnolobium japonicum (Fabaceae) using SRAP markers.

PubMed

Sun, R X; Zhang, C H; Zheng, Y Q; Zong, Y C; Yu, X D; Huang, P

2016-05-06

Thirty-four Styphnolobium japonicum varieties were analyzed using sequence-related amplified polymorphism (SRAP) markers, to investigate genetic variation and test the effectiveness of SRAP markers in DNA fingerprint establishment. Twelve primer pairs were selected from 120 primer combinations for their reproducibility and high polymorphism. We found a total of 430 amplified fragments, of which 415 fragments were considered polymorphic with an average of 34.58 polymorphic fragments for each primer combination. The percentage of polymorphic fragments was 96.60%, and four primer pairs showed 100% polymorphism. Moreover, simple matched coefficients ranged between 0.68 and 0.89, with an average of 0.785, indicating that the genetic variation among varieties was relatively low. This could be because of the narrow genetic basis of the selected breeding material. Based on the similarity coefficient value of 0.76, the varieties were divided into four major groups. In addition, abundant and clear SRAP fingerprints were obtained and could be used to establish DNA fingerprints. In the DNA fingerprints, each variety had its unique pattern that could be easily distinguished from others. The results demonstrated that 34 varieties of S. japonicum had a relatively narrow genetic variation. Hence, a broadening of the genetic basis of breeding material is necessary. We conclude that establishment of DNA fingerprint is feasible by means of SRAP markers.

Gene Polymorphism Studies in a Teaching Laboratory

NASA Astrophysics Data System (ADS)

Shultz, Jeffry

2009-02-01

I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this example, students used genes annotated for the steroid biosynthesis pathway in soybean. The authoritative Kyoto encyclopedia of genes and genomes (KEGG) interactive database and other online resources were used to design primers based first on soybean expressed sequence tags (ESTs), then on ESTs from an alternate organism if soybean sequence was unavailable. Students designed a total of 50 gene-based primer pairs (37 soybean, 13 alternative) and tested these for polymorphism state and similarity between two soybean and two pea lines. Student assessment was based on acquisition of laboratory skills and successful project completion. This simple procedure illustrates conservation of genes and is not limited to soybean or pea. Cost per student estimates are included, along with a detailed protocol and flow diagram of the procedure.

Cross-species amplification of microsatellite markers in the Great Horned Owl Bubo virginianus, Short-eared Owl Asio flammeus and Snowy Owl B. scandiacus for use in population genetics, individual identification and parentage studies

USGS Publications Warehouse

Dial, Cody R.; Talbot, Sandra L.; Sage, George K.; Seidensticker, M.T.; Holt, D.W.

2012-01-01

Using DNA from blood and feathers, we screened twenty-four microsatellite primer pairs initially developed for six strigid owls, and four primer pairs shown to be polymorphic across avian taxa, for their utility in Great Horned Owl (Bubo virginianus), Short-eared Owl (Asio flammeus), and Snowy Owl (Bubo scandiacus). Eight of these primers reliably amplified polymorphic fragments in Great Horned Owl, eleven in Short-eared owl, and ten in Snowy Owl. Analyses of results from presumably unrelated owls demonstrate the utility of these loci for individual identification, parentage assignment, and population genetics studies.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

PubMed

Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

2017-08-01

A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

Assessing the germplasm of Laminaria (phaeophyceae) with random amplified polymorphic DNA (RAPD) method

NASA Astrophysics Data System (ADS)

He, Yingjun; Zou, Yuping; Wang, Xiaodong; Zheng, Zhiguo; Zhang, Daming; Duan, Delin

2003-06-01

Eighteen gametophytes including L. japonica, L. ochotensis and L. longissima, were verified with random amplified polymorphic DNA (RAPD) technique. Eighteen ten-base primers were chosen from 100 primers selected for final amplification test. Among the total of 205 bands amplified, 181 (88.3%) were polymorphic. The genetic distance among different strains ranged from 0.072 to 0.391. The dendrogram constructed by unweighted pair-group method with arithmetic (UPGMA) method showed that the female and male gametophytes of the same cell lines could be grouped in pairs respectively. It indicated that RAPD analysis could be used not only to distinguish different strains of Laminaria, but also to distinguish male and female gametophyte within the same cell lines. There is ambiguous systematic relationship if judged merely by the present data. It seems that the use of RAPD marker is limited to elucidation of the phylogenetic relationship among the species of Laminaria.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

PubMed Central

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

An expanded nuclear phylogenomic PCR toolkit for Sapindales1

PubMed Central

Collins, Elizabeth S.; Gostel, Morgan R.; Weeks, Andrea

2016-01-01

Premise of the study: We tested PCR amplification of 91 low-copy nuclear gene loci in taxa from Sapindales using primers developed for Bursera simaruba (Burseraceae). Methods and Results: Cross-amplification of these markers among 10 taxa tested was related to their phylogenetic distance from B. simaruba. On average, each Sapindalean taxon yielded product for 53 gene regions (range: 16–90). Arabidopsis thaliana (Brassicales), by contrast, yielded product for two. Single representatives of Anacardiaceae and Rutacaeae yielded 34 and 26 products, respectively. Twenty-six primer pairs worked for all Burseraceae species tested if highly divergent Aucoumea klaineana is excluded, and eight of these amplified product in every Sapindalean taxon. Conclusions: Our study demonstrates that customized primers for Bursera can amplify product in a range of Sapindalean taxa. This collection of primer pairs, therefore, is a valuable addition to the toolkit for nuclear phylogenomic analyses of Sapindales and warrants further investigation. PMID:28101434

Genetic diversity analysis of tree peony germplasm using iPBS markers.

PubMed

Duan, Y B; Guo, D L; Guo, L L; Wei, D F; Hou, X G

2015-07-06

We examined the genetic diversity of 10 wild species (populations) and 55 varieties of tree peony using inter-primer binding site (iPBS) markers. From a total of 36 iPBS primers, 16 were selected based on polymorphic amplification. The number of bands amplified by each primer ranged from 9 to 19, with an average of 12.88 bands per primer. The length of bands ranged from 100 to 2000 bp, concentrated at 200 to 1800 bp. Sixteen primers amplified 206 bands in total, of which 173 bands were polymorphic with a polymorphism ratio of 83.98%. Each primer amplified 10.81 polymorphic bands on average. The data were then used to construct a phylogenetic tree using unweighted pair group method with arithmetic mean methods. Clustering analysis showed that the genetic relationships among the varieties were not only related to the genetic background or geographic origin, but also to the flowering phase, flower color, and flower type. Our data also indicated that iPBS markers were useful tools for classifying tree peony germplasms and for tree peony breeding, and the specific bands were helpful for molecular identification of tree peony varieties.

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

[SSR loci information analysis in transcriptome of Andrographis paniculata].

PubMed

Li, Jun-Ren; Chen, Xiu-Zhen; Tang, Xiao-Ting; He, Rui; Zhan, Ruo-Ting

2018-06-01

To study the SSR loci information and develop molecular markers, a total of 43 683 Unigenes in transcriptome of Andrographis paniculata were used to explore SSR. The distribution frequency of SSR and the basic characteristics of repeat motifs were analyzed using MicroSAtellite software, SSR primers were designed by Primer 3.0 software and then validated by PCR. Moreover, the gene function analysis of SSR Unigene was obtained by Blast. The results showed that 14 135 SSR loci were found in the transcriptome of A. paniculata, which distributed in 9 973 Unigenes with a distribution frequency of 32.36%. Di-nucleotide and Tri-nucleotide repeat were the main types, accounted for 75.54% of all SSRs. The repeat motifs of AT/AT and CCG/CGG were the predominant repeat types of Di-nucleotide and Tri-nucleotide, respectively. A total of 4 740 pairs of SSR primers with the potential to produce polymorphism were designed for maker development. Ten pairs of primers in 20 pairs of randomly picked primers produced fragments with expected molecular size. The gene function of Unigenes containing SSR were mostly related to the basic metabolism function of A. paniculata. The SSR markers in transcriptome of A. paniculata show rich type, strong specificity and high potential of polymorphism, which will benefit the candidate gene mining and marker-assisted breeding. Copyright© by the Chinese Pharmaceutical Association.

DNA barcoding amphibians and reptiles.

PubMed

Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

2012-01-01

Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

Characterization of 14 microsatellite markers for genetic analysis and cultivar identification of walnut

USDA-ARS?s Scientific Manuscript database

One hundred and forty-seven primer pairs originally designed to amplify microsatellites, also known as simple sequence repeats (SSR), in black walnut (Juglans nigra L.) were screened for utility in persian walnut (J. regia L.). Based on scorability and number of informative polymorphisms, the best 1...

The development and mapping of functional markers in Fragaria and their transferability and potential for mapping in other genera.

PubMed

Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R

2007-01-01

We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.

ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

PubMed

Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

2017-10-01

ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Amplification of DNA of Xanthomonas axonopodis pv. citri from historic citrus canker herbarium specimens.

PubMed

Li, Wenbin; Brlansky, Ronald H; Hartung, John S

2006-05-01

Herbaria are important resources for the study of the origins and dispersal of plant pathogens, particularly bacterial plant pathogens that incite local lesions in which large numbers of pathogen genomes are concentrated. Xanthomonas axonopodis pv. citri (Xac), the causal agent of citrus bacterial canker disease, is a notable example of such a pathogen. The appearance of novel strains of the pathogen in Florida and elsewhere make it increasingly important to understand the relationships among strains of this pathogen. USDA-ARS at Beltsville, Maryland maintains approximately 700 herbarium specimens with citrus canker disease lesions up to 90 years old, originally collected from all over the world, and so is an important resource for phytogeographic studies of this bacterium. Unfortunately, DNA in herbarium specimens is degraded and may contain high levels of inhibitors of PCR. In this study, we compared a total of 23 DNA isolation techniques in combination with 31 novel primer pairs in order to develop an efficient protocol for the analysis of Xac DNA in herbarium specimens. We identified the most reliable extraction method, identified in terms of successful amplification by our panel of 31 primer pairs. We also identified the most robust primer pairs, identified as successful in the largest number of extracts prepared by different methods. We amplified Xac genomic sequences up to 542 bp long from herbarium samples up to 89 years old. Primers varied in effectiveness, with some primer pairs amplifying Xac DNA from a 1/10,000 dilution of extract from a single lesion from a citrus canker herbarium specimen. Our methodology will be useful to identify pathogens and perform molecular analyses of bacterial and possibly fungal genomes from herbarium specimens.

High throughput pyrosequencing technology for molecular differential detection of Babesia vogeli, Hepatozoon canis, Ehrlichia canis and Anaplasma platys in canine blood samples.

PubMed

Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Kongklieng, Amornmas; Tantrawatpan, Chairat; Boonmars, Thidarut; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

2014-06-01

Canine babesiosis, hepatozoonosis, ehrlichiosis, and anaplasmosis are tick-borne diseases caused by different hemopathogens. These diseases are causes of morbidity and mortality in dogs. The classic method for parasite detection and differentiation is based on microscopic observation of blood smears. The limitations of the microscopic method are that its performance requires a specially qualified person with professional competence, and it is ineffective in differentiating closely related species. This study applied PCR amplification with high throughput pyrosequencing for molecular differential detection of the following 4 hemoparasites common to tropical areas in dog blood samples: Babesia vogeli, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys. PCR was initially used to amplify specific target regions of the ribosomal RNA genes of each parasite using 2 primer pairs that included 18S rRNA for protozoa (B. vogeli and H. canis) and 16S rRNA for rickettsia (E. canis and A. platys). Babesia vogeli and H. canis were discriminated using 9 nucleotide positions out of 30 base pairs, whereas E. canis and A. platys were differentiated using 15 nucleotide positions out of 34 base pairs that were determined from regions adjacent to 3' ends of the sequencing primers. This method provides a challenging alternative for a rapid diagnosis and surveillance of these tick-borne diseases in canines. Copyright © 2014 Elsevier GmbH. All rights reserved.

Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Wiesner, G.; Laken, S.

The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

PubMed

Bertolini, Francesca; Ghionda, Marco Ciro; D'Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

A Next Generation Semiconductor Based Sequencing Approach for the Identification of Meat Species in DNA Mixtures

PubMed Central

Bertolini, Francesca; Ghionda, Marco Ciro; D’Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures. PMID:25923709

Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

PubMed

Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

2014-07-01

In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

Polymorphism of follicle stimulating hormone beta (FSHβ) subunit gene and its association with litter traits in giant panda.

PubMed

Huang, Xiaoyu; Li, Desheng; Wang, Jiwen; Huang, Yan; Han, Chunchun; Zhang, Guiquan; Huang, Zhi; Wu, Honglin; Wei, Ming; Wang, Guosong; Hu, Haiping; Deng, Tao; He, Tao; Zhou, Yingming; Song, Shixian; Luo, Bo; Zhang, Heming

2013-11-01

The different SSCP patterns of the follicle stimulating hormone beta (FSHβ) gene amplified by three pairs of primers were sequenced. Comparisons among the three nucleotide sequences of three genotypes indicated that three base substitutions (A213T, A91G, and A89C) were detected in FSHβ gene, which A213T substitution led to one amino acids mutation (Lys > Met), and the other two substitutions were synonymous mutations. The AA, AB and BB genotypes patterns obtained by FSHβ primer1 had evident relation with the litter traits, but the SSCP genotypes patterns obtained by FSHβ primer2 and primer3 had no evident relation with the litter traits in giant panda. The giant panda with AA and AB genotype had the largest litter size and multiparity rate compared with the BB genotypes (P < 0.05). We speculated that the giant pandas with the A allele have better litter traits than those with the B allele.

Transferability of microsatellite markers of Capsicum annuum L. to C. frutescens L. and C. chinense Jacq.

PubMed

Carvalho, S I C; Ragassi, C F; Oliveira, I B; Amaral, Z P S; Reifschneider, F J B; Faleiro, F G; Buso, G S C

2015-07-17

In order to support further genetic, diversity, and phylogeny studies of Capsicum species, the transferability of a Capsicum annuum L. simple sequence repeat (SSR) microsatellite set was analyzed for C. frutescens L. ("malagueta" and "tabasco" peppers) and C. chinense Jacq. (smell peppers, among other types). A total of 185 SSR primers were evaluated in 12 accessions from 115 C. frutescens L. and 480 C. chinense Jacq, representing different types within each species. Transferability to C. frutescens L. and C. chinense Jacq. occurred for 116 primers (62.7%). Nineteen (16.37%) were polymorphic in C. frutescens L. and 36 (31.03%) in C. chinense Jacq., 17 of which were coincident and could be used to analyze samples obtained for the 2 species. Among these primers, CA49 showed a different amplitude range of alleles between the 2 species (130-132 base pairs for C. frutescens L. and 120-128 base pairs for C. chinense Jacq.), and could differentiate the species. A total of 55 alleles were identified among the 19 polymorphic SSR loci among accessions of C. frutescens L., with the number of alleles per locus ranging from 2 to 5, a mean of 2.89, and the polymorphic information content ranging from 0.30 to 0.65. The number of alleles identified in C. chinense Jacq. was 119, ranging from 2 to 5 alleles per locus, an average of 3.30, and polymorphic information content from 0.19 to 0.68. The C. annuum L. SSR primers were most often transfer-able and polymorphic for C. frutescens L. and C. chinense Jacq., and we present a set of SSR for each species.

Comparison of Species Richness Estimates Obtained Using Nearly Complete Fragments and Simulated Pyrosequencing-Generated Fragments in 16S rRNA Gene-Based Environmental Surveys▿ †

PubMed Central

Youssef, Noha; Sheik, Cody S.; Krumholz, Lee R.; Najar, Fares Z.; Roe, Bruce A.; Elshahed, Mostafa S.

2009-01-01

Pyrosequencing-based 16S rRNA gene surveys are increasingly utilized to study highly diverse bacterial communities, with special emphasis on utilizing the large number of sequences obtained (tens to hundreds of thousands) for species richness estimation. However, it is not yet clear how the number of operational taxonomic units (OTUs) and, hence, species richness estimates determined using shorter fragments at different taxonomic cutoffs correlates with the number of OTUs assigned using longer, nearly complete 16S rRNA gene fragments. We constructed a 16S rRNA clone library from an undisturbed tallgrass prairie soil (1,132 clones) and used it to compare species richness estimates obtained using eight pyrosequencing candidate fragments (99 to 361 bp in length) and the nearly full-length fragment. Fragments encompassing the V1 and V2 (V1+V2) region and the V6 region (generated using primer pairs 8F-338R and 967F-1046R) overestimated species richness; fragments encompassing the V3, V7, and V7+V8 hypervariable regions (generated using primer pairs 338F-530R, 1046F-1220R, and 1046F-1392R) underestimated species richness; and fragments encompassing the V4, V5+V6, and V6+V7 regions (generated using primer pairs 530F-805R, 805F-1046R, and 967F-1220R) provided estimates comparable to those obtained with the nearly full-length fragment. These patterns were observed regardless of the alignment method utilized or the parameter used to gauge comparative levels of species richness (number of OTUs observed, slope of scatter plots of pairwise distance values for short and nearly complete fragments, and nonparametric and parametric species richness estimates). Similar results were obtained when analyzing three other datasets derived from soil, adult Zebrafish gut, and basaltic formations in the East Pacific Rise. Regression analysis indicated that these observed discrepancies in species richness estimates within various regions could readily be explained by the proportions of hypervariable, variable, and conserved base pairs within an examined fragment. PMID:19561178

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

Method for the detection of Salmonella enterica serovar Enteritidis

DOEpatents

Agron, Peter G.; Andersen, Gary L.; Walker, Richard L.

2008-10-28

Described herein is the identification of a novel Salmonella enterica serovar Enteritidis locus that serves as a marker for DNA-based identification of this bacterium. In addition, three primer pairs derived from this locus that may be used in a nucleotide detection method to detect the presence of the bacterium are also disclosed herein.

Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

NASA Astrophysics Data System (ADS)

Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

2013-11-01

This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

Microsatellite primers for red drum (Sciaenops ocellatus)

USDA-ARS?s Scientific Manuscript database

In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

PubMed Central

2009-01-01

Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

Detection and identification of genetically modified EE-1 brinjal (Solanum melongena) by single, multiplex and SYBR® real-time PCR.

PubMed

Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R

2013-01-01

Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.

Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

PubMed

Kokosková, B; Mráz, I; Fousek, J

2010-05-01

Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

PubMed

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

Development and validation of the first SSR markers for Mimosa scabrella Benth.

PubMed

Saiki, F A; Bernardi, A P; Reis, M S; Faoro, H; Souza, E M; Pedrosa, F O; Mantovani, A; Guidolin, A F

2017-02-16

Mimosa scabrella Benth., popularly known as ''bracatinga'', is a pioneer and endemic species of Brazil, occurring in Mixed Ombrophilous Forest associated with Brazilian Atlantic Rainforest biomes. It is a fast-growing tree of the Fabaceae family that facilitates the dynamics of ecological succession. SSR development, when there is no genome sequence, is time and labor intensive and there are no molecular markers for M. scabrella. We developed and validated the first microsatellite markers for this tetraploid species, evaluating mother trees and progenies. Using Illumina sequencing, we identified 290 SSR loci and 211 primer pairs. After 31 SSR loci PCR/agarose electrophoresis selection, a subset of 11 primer pairs was synthetized with fluorescence in the forward primer for PCR and capillary electrophoresis validation with leaf DNA of 33 adult and 411 progeny individuals. Polymorphic locus percentage was 36, 4 in 11 loci, 3 chloroplast SSRs, and 1 nuclear SSR. Allele number of polymorphic loci ranged from 2 to 11 alleles considering all sampling. All 11 primer pairs were also tested for cross-species amplification for five Fabaceae-Mimosoideae species, ranging from 2 loci transferred to Calliandra tweedii Benth. and all 11 loci transferred to Mimosa taimbensis Burkart. The assessed and validated SSR markers for M. scabrella are suitable and useful for analysis and population genetic studies.

A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

PubMed

Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

2015-10-30

Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

Isolation and characterization of microsatellite markers for Cotinus coggygria Scop. (Anacardiaceae) by 454 pyrosequencing.

PubMed

Wang, Wei; Li, Zhuo; Li, Yong

2014-03-24

Cotinus coggygria Scop. (Anacardiaceae) is a deciduous shrub or small tree that is native to a large area covering from southern Europe, east across central Asia, and the Himalayas in northern China. Shotgun 454 pyrosequencing was used to develop microsatellite markers from the genome of C. coggygria. In this study, 349 microsatellite loci were identified from 40,074 individual sequence reads produced by one-sixteenth run, and primer pairs were designed for these loci. To test the primer amplification efficiency, 50 microsatellite primer pairs were tested across 12 individuals from two C. coggygria populations (Wuzhi Mountain: 36°30'N, 113°39'E; Tianlong Mountain: 37°42'N, 112°26'E). Among the 50 tested primer pairs, eight were found to be polymorphic. The average allele number of the microsatellites was 3.5 per locus, with a range from two to five. The inbreeding coefficient ranged from -0.478 to 0.222. The observed and expected heterozygosities varied from 0.167 to 0.750 and from 0.163 to 0.743, respectively. This set of markers is potentially useful for assessing the genetic diversity, as well as for understanding the population structure and phylogeographical and landscape genetic patterns, of C. coggygria.

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

USGS Publications Warehouse

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

PubMed

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Targeting the Mevalonate Pathway to Reduce Mortality from Ovarian Cancer

DTIC Science & Technology

2017-12-01

at cis-regulatory elements such as enhancers to facilitate gene transcription. CRISPR /Cas9- mediated ablation of a putative Meis1 enhancer carrying...Tables S4 and S5. 10 Cancer Cell 30, 1–16, July 11, 2016the CRISPR /Cas9-based genomic editing technology. Cas9 and a pair of single guide RNAs (sgRNA... CRISPR /Cas9-mediated deletio sgMeis1, a pair of sgRNAs that target the DMR boundaries. (N) Sequencing of the genomic PCR products from F2/R2 primers shows

Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

PubMed Central

Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

2005-01-01

Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

Characterization of Aspergillus flavus strains from Brazilian Brazil nuts and cashew by RAPD and ribosomal DNA analysis.

PubMed

Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G

2008-07-01

The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.

Identification of apple cultivars on the basis of simple sequence repeat markers.

PubMed

Liu, G S; Zhang, Y G; Tao, R; Fang, J G; Dai, H Y

2014-09-12

DNA markers are useful tools that play an important role in plant cultivar identification. They are usually based on polymerase chain reaction (PCR) and include simple sequence repeats (SSRs), inter-simple sequence repeats, and random amplified polymorphic DNA. However, DNA markers were not used effectively in the complete identification of plant cultivars because of the lack of known DNA fingerprints. Recently, a novel approach called the cultivar identification diagram (CID) strategy was developed to facilitate the use of DNA markers for separate plant individuals. The CID was designed whereby a polymorphic maker was generated from each PCR that directly allowed for cultivar sample separation at each step. Therefore, it could be used to identify cultivars and varieties easily with fewer primers. In this study, 60 apple cultivars, including a few main cultivars in fields and varieties from descendants (Fuji x Telamon) were examined. Of the 20 pairs of SSR primers screened, 8 pairs gave reproducible, polymorphic DNA amplification patterns. The banding patterns obtained from these 8 primers were used to construct a CID map. Each cultivar or variety in this study was distinguished from the others completely, indicating that this method can be used for efficient cultivar identification. The result contributed to studies on germplasm resources and the seedling industry in fruit trees.

The skin microbiome in psoriatic arthritis: methodology development and pilot data.

PubMed

Castelino, Madhura; Eyre, Stephen; Moat, John; Fox, Graeme; Martin, Paul; Ijaz, Umer; Quince, Christopher; Ho, Pauline; Upton, Mathew; Barton, Anne

2015-02-26

Skin microbiota are likely to be important in the development of conditions such as psoriatic arthritis. Profiling the bacterial community in the psosriatic plaques will contribute to our understanding of the role of the skin microbiome in these conditions. The aim of this work was to determine the optimum study design for work on the skin microbiome with use of the MiSeq platform. The objectives were to compare data generated from two platforms for two primer pairs in a low density mock bacterial community. DNA was obtained from two low density mock communities of 11 diverse bacterial strains (with and without human DNA supplementation) and from swabs taken from the skin of four healthy volunteers. The DNA was amplified with primer pairs covering hypervariable regions of the 16S rRNA gene: primers 63F and 519R (V1-V3), and 347F and 803R (V3-V4). The resultant libraries were indexed for the MiSeq and Roche454 platforms and sequenced. Both datasets were de-noised, cleaned of chimeras, and analysed by use of QIIME software (version 1.8.0). No significant difference in the diversity indices at the phylum and the genus level between the platforms was seen. Comparison of the diversity indices for the mock community data for the two primer pairs demonstrated that the V3-V4 hypervariable region had significantly better capture of bacterial diversity than did the V1-V3 region. Amplification with the same primer pairs showed strong concordance within each platform (98·9-99·8%), with negligible effect of spiked human DNA contamination. Comparison at the family level classification between samples processed on the MiSeq and Roche454 platforms using the V3-V4 hypervariable region also showed a high level of concordance (87%), although less so for the V1-V3 primers (10%). The pilot data from healthy volunteers were similar. Results obtained from the V3-V4 16S rRNA hypervariable region, sequencing on the MiSeq and Roche454 platforms, were concordant between replicates, and between each other. These findings suggest that the MiSeq platform, and these primers, is a comparable method for determining skin microbiota to the widely used Roche454 methodology. NIHR Manchester Musculoskeletal Biomedical Research Unit. Copyright © 2015 Elsevier Ltd. All rights reserved.

A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

PubMed

Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

2005-06-01

Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism generated by SPCC11 was essentially due to the variation in length of the mononucleotide repeats.

Development and characterization of microsatellite markers for the Pacific abalone ( Haliotis discus) via EST database mining

NASA Astrophysics Data System (ADS)

Zhan, Aibin; Bao, Zhenmin; Wang, Mingling; Chang, Dan; Yuan, Jian; Wang, Xiaolong; Hu, Xiaoli; Liang, Chengzhu; Hu, Jingjie

2008-05-01

The EST database of the Pacific abalone ( Haliotis discus) was mined for developing microsatellite markers. A total of 1476 EST sequences were registered in GenBank when data mining was performed. Fifty sequences (approximately 3.4%) were found to contain one or more microsatellites. Based on the length and GC content of the flanking regions, cluster analysis and BLASTN, 13 microsatellite-containing ESTs were selected for PCR primer design. The results showed that 10 out of 13 primer pairs could amplify scorable PCR products and showed polymorphism. The number of alleles ranged from 2 to 13 and the values of H o and H e varied from 0.1222 to 0.8611 and 0.2449 to 0.9311, respectively. No significant linkage disequilibrium (LD) between any pairs of these loci was found, and 6 of 10 loci conformed to the Hardy-Weinberg equilibrium (HWE). These EST-SSRs are therefore potential tools for studies of intraspecies variation and hybrid identification.

Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

PubMed Central

Watkins, Norman E.; SantaLucia, John

2005-01-01

Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

PubMed

Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

2017-04-05

Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

PubMed Central

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

A PMB Primer.

ERIC Educational Resources Information Center

Whetstone, B. D.; Yates, Benny

This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.

PubMed

Prevost, S; Andre, S; Remize, F

2010-12-01

Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.

Molecular diagnostic for boll weevil (Coleoptera: Curculionidae) based on amplification of three species-specific microsatellites.

PubMed

Kim, Kyung Seok; Szendrei, Zsofia; Rodriguez-Saona, Cesar; Mulder, Phillip G; Sappington, Thomas W

2009-04-01

The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton, Gossypium hirsutum L., in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally the traps collect nontarget weevils that can be misidentified by scouts. For example, the congeneric pepper weevil, Anthonomus eugenii Cano, and other superficially similar weevils are attracted to components of the boll weevil lure or trap color. Although morphologically distinguishable by trained personnel, the potential for misidentification is compounded when captured weevils are dismembered or partially consumed by ants or ground beetles that sometimes feed on them in the traps. Because misidentification can have expensive consequences, a molecular diagnostic tool would be of great value to eradication managers. We demonstrate that a cocktail of three primer pairs in a single polymerase chain reaction (PCR) amplify species-specific microsatellites that unambiguously distinguish the boll weevil from three other weevil species tested, including pepper weevil; cranberry weevil, Anthonomus eugenii musculus Say; and pecan weevil, Curculio caryae Horn. However, it does not distinguish the boll weevil from the subspecific "thurberia" weevil. A universal internal transcribed spacer primer pair included in the cocktail cross-amplifies DNA from all species, serving as a positive control. Furthermore, the diagnostic primers amplified the target microsatellites from various boll weevil adult body parts, indicating that the PCR technology using the primer cocktail is sensitive enough to positively identify a boll weevil even when the body is partly degraded.

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

PubMed Central

Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

2012-01-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223

A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

PubMed

Bisset, S A; Knight, J S; Bouchet, C L G

2014-02-24

A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

[Contamination with genetically modified maize MON863 of processed foods on the market].

PubMed

Ohgiya, Yoko; Sakai, Masaaki; Miyashita, Taeko; Yano, Koichi

2009-06-01

Genetically modified maize MON863 (MON863), which has passed a safety examination in Japan, is commercially cultivated in the United States as a food and a resource for fuel. Maize is an anemophilous flower, which easily hybridizes. However, an official method for quantifying the content of MON863 has not been provided yet in Japan. We here examined MON863 contamination in maize-processed foods that had no labeling indicating of the use of genetically modified maize.From March 2006 to July 2008, we purchased 20 frozen maize products, 8 maize powder products, 7 canned maize products and 4 other maize processed foods. Three primer pairs named MON 863 primer, MON863-1, and M3/M4 for MON863-specific integrated cassette were used for qualitative polymerase chain reaction (PCR). A primer pair "SSIIb-3" for starch synthase gene was used to confirm the quality of extracted DNA. The starch synthase gene was detected in all samples. In qualitative tests, the MON863-specific fragments were detected in 7 (18%) maize powder products out of the 39 processed foods with all the three primer pairs.We concluded that various maize processed foods on the market were contaminated with MON863. It is important to accumulate further information on MON863 contamination in maize-processed foods that have no label indication of the use of genetically modified maize.

3'-terminal sequence of a small round structured virus (SRSV) in Japan.

PubMed

Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S

1994-01-01

We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.

Kinetoplast DNA minicircles of phloem-restricted Phytomonas associated with wilt diseases of coconut and oil palms have a two-domain structure.

PubMed

Dollet, M; Sturm, N R; Ahomadegbe, J C; Campbell, D A

2001-11-27

We report the cloning and sequencing of the first minicircle from a phloem-restricted, pathogenic Phytomonas sp. (Hart 1) isolated from a coconut palm with hartrot disease. The minicircle possessed a two-domain structure of two conserved regions, each containing three conserved sequence blocks (CSB). Based on the sequence around CSB 3 from Hart 1, PCR primers were designed to allow specific amplification of Phytomonas minicircles. This primer pair demonstrated specificity for at least six groups of plant trypanosomatids and did not amplify from insect trypanosomatids. The PCR results were consistent with a two-domain structure for other plant trypanosomatids.

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

PubMed

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Use of novel species-specific PCR primers targeted to DNA gyrase subunit B (gyrB) gene for species identification of the Cronobacter sakazakii and Cronobacter dublinensis.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina

2013-02-01

Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.

Molecular DNA-based detection of ionising radiation in meat.

PubMed

Şakalar, Ergün

2017-05-01

Ionising radiation induces molecular alterations, such as formation of ions, free radicals, and new stable molecules, and cleavage of the chemical bonds of the molecules present in food. Irradiation-treated meat should be labelled to control the process and to ensure free consumer choice. Therefore, sensitive analytical methods are required to detect the irradiation dose. Meat samples were exposed to radiation doses of 0, 0.272, 0.497, 1.063, 3.64, 8.82 and 17.42 kGy in an industrial 60 Co gamma cell. Primers were designed to amplify 998, 498 and 250-base pair (bp) regions of the 18S rRNA gene of nuclear DNA from the irradiated samples. A new DNA-based method was developed to quantify the radiation exposed to the unstored meat and the meat stored at -20 °C for 3 and 6 months. The method was able to detect meat samples stored and unstored with dose limits of 1.063 and 3.64 kGy, respectively. The level of irradiation can be detected using primer pairs that target particularly different-sized sequences for DNA amplification by PCR. This method can be widely used for the analysis of not only meat samples, but also all biological materials containing DNA. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Diversity analysis in Cannabis sativa based on large-scale development of expressed sequence tag-derived simple sequence repeat markers.

PubMed

Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

2014-01-01

Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.

Diversity Analysis in Cannabis sativa Based on Large-Scale Development of Expressed Sequence Tag-Derived Simple Sequence Repeat Markers

PubMed Central

Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

2014-01-01

Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis. PMID:25329551

Epigenetic Therapy of Hematopoietic Malignancies: Novel Approaches for Tissue-Specific and Global Inhibition of EZH2 Enzymatic Activities

DTIC Science & Technology

2017-10-01

at cis-regulatory elements such as enhancers to facilitate gene transcription. CRISPR /Cas9- mediated ablation of a putative Meis1 enhancer carrying...Tables S4 and S5. 10 Cancer Cell 30, 1–16, July 11, 2016the CRISPR /Cas9-based genomic editing technology. Cas9 and a pair of single guide RNAs (sgRNA... CRISPR /Cas9-mediated deletio sgMeis1, a pair of sgRNAs that target the DMR boundaries. (N) Sequencing of the genomic PCR products from F2/R2 primers shows

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

Isolation and characterization of microsatellite markers for red elm (Ulmus rubra Muhl.) and cross-species amplification with Siberian elm (Ulmus pumila L.).

PubMed

Zalapa, J E; Brunet, J; Guries, R P

2008-01-01

Ulmus pumila is an elm species, non-native to the USA that hybridizes with Ulmus rubra. In order to study the genetic structure and hybridization patterns between these two elm species, we developed 15 primer pairs for microsatellite loci in U. rubra and tested their cross-amplification in U. pumila. All 15 primers amplified in both species, 11 of which possessed species-specific alleles. Eight loci were polymorphic in U. pumila and eight in U. rubra, each with two to eight alleles per locus. In addition, five primer pairs previously developed in U. laevis and U. carpinifolia (syn. U. minor) cross-amplified and showed polymorphic loci in U. pumila and/or U. rubra. These markers will facilitate the study of genetic structure and gene flow between U. rubra and exotic, invasive U. pumila. © 2007 Blackwell Publishing Ltd No claim to original US government works.

Nucleic acid amplification of HIV-1 integrase sequence subtypes CRF01_AE and B for development of HIV anti-integrase drug resistance genotyping assay

NASA Astrophysics Data System (ADS)

Adlar, F. R.; Bela, B.

2017-08-01

To anticipate the potential use of anti-integrase drugs in Indonesia for treatment of HIV-1 infection, the development of a drug resistance genotyping assay for anti-integrase is crucial in identifying the genetic drug resistance profile of Indonesian HIV-1 strains. This experiment aimed to amplify a target region in the integrase gene of Indonesian HIV-1 subtypes CRF01_AE and B that contain genetic mutations known to confer resistance to anti-integrase drug. Eleven archived plasma samples from individuals living with HIV-1 were obtained from the Virology and Cancer Pathobiology Research Center for Health Service (VCPRC FKUI-RSCM) laboratory. One of the plasma samples contained HIV-1 subtype B, and the remaining plasma samples contained subtype CRF01_AE. The target regions for all samples were amplified through RT-PCR, with an annealing temperature of 55 °C, using the primer pair AE_POL 4086F and AE_POL 5232R that were designed by VCPRC FKUI-RSCM. The results of this experiment show that 18.2% (2/11) of the samples were successfully amplified using the one-step RT-PCR. While the primer pair was effective in amplifying the target region in the integrase gene sequence for subtype B (100%; 1/1), it had a low efficacy (10%, 1/10) for subtype CRF01_AE. In conclusion, the primer pair can be used to amplify the target region in Indonesian HIV-1 strain subtypes CRF01_AE and B. However, optimization of the PCR condition and an increased number of samples would help to determine an accurate representation of the efficacy of the primer pair.

A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko

Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities.

PubMed

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-11-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* #

PubMed Central

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-01-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

A novel copro-diagnostic molecular method for qualitative detection and identification of parasitic nematodes in amphibians and reptiles.

PubMed

Huggins, Lucas G; Michaels, Christopher J; Cruickshank, Sheena M; Preziosi, Richard F; Else, Kathryn J

2017-01-01

Anthropogenic disturbance via resource acquisition, habitat fragmentation and climate change, amongst other factors, has led to catastrophic global biodiversity losses and species extinctions at an accelerating rate. Amphibians are currently one of the worst affected classes with at least a third of species categorised as being threatened with extinction. At the same time, they are also critically important for many habitats and provide man with a powerful proxy for ecosystem health by acting as a bioindicator group. Whilst the causes of synchronised amphibian losses are varied recent research has begun to highlight a growing role that macroparasites are playing in amphibian declines. However, diagnosing parasite infection in the field can be problematic, principally relying on collection and euthanasia of hosts, followed by necropsy and morphological identification of parasites in situ. The current study developed a non-invasive PCR-based methodology for sensitive detection and identification of parasitic nematode DNA released in the faeces of infected amphibians as egg or tissue fragments (environmental DNA). A DNA extraction protocol optimised for liberation of DNA from resilient parasite eggs was developed alongside the design of a novel, nematode universal, degenerate primer pair, thus avoiding the difficulties of using species specific primers in situations where common parasite species are unknown. Used in conjunction this protocol and primer pair was tested on a wide range of faecal samples from captive and wild amphibians. The primers and protocol were validated and detected infections, including a Railletnema nematode infection in poison dart frogs from ZSL London Zoo and Mantella cowani frogs in the wild. Furthermore, we demonstrate the efficacy of our PCR-based protocol for detecting nematode infection in other hosts, such as the presence of pinworm (Aspiculuris) in two tortoise species and whipworm (Trichuris muris) in mice. Our environmental DNA approach mitigates problems associated with microscopic identification and can be applied to detect nematode parasitoses in wild and captive hosts for infection surveillance and maintenance of healthy populations.

A novel copro-diagnostic molecular method for qualitative detection and identification of parasitic nematodes in amphibians and reptiles

PubMed Central

Michaels, Christopher J.

2017-01-01

Anthropogenic disturbance via resource acquisition, habitat fragmentation and climate change, amongst other factors, has led to catastrophic global biodiversity losses and species extinctions at an accelerating rate. Amphibians are currently one of the worst affected classes with at least a third of species categorised as being threatened with extinction. At the same time, they are also critically important for many habitats and provide man with a powerful proxy for ecosystem health by acting as a bioindicator group. Whilst the causes of synchronised amphibian losses are varied recent research has begun to highlight a growing role that macroparasites are playing in amphibian declines. However, diagnosing parasite infection in the field can be problematic, principally relying on collection and euthanasia of hosts, followed by necropsy and morphological identification of parasites in situ. The current study developed a non-invasive PCR-based methodology for sensitive detection and identification of parasitic nematode DNA released in the faeces of infected amphibians as egg or tissue fragments (environmental DNA). A DNA extraction protocol optimised for liberation of DNA from resilient parasite eggs was developed alongside the design of a novel, nematode universal, degenerate primer pair, thus avoiding the difficulties of using species specific primers in situations where common parasite species are unknown. Used in conjunction this protocol and primer pair was tested on a wide range of faecal samples from captive and wild amphibians. The primers and protocol were validated and detected infections, including a Railletnema nematode infection in poison dart frogs from ZSL London Zoo and Mantella cowani frogs in the wild. Furthermore, we demonstrate the efficacy of our PCR-based protocol for detecting nematode infection in other hosts, such as the presence of pinworm (Aspiculuris) in two tortoise species and whipworm (Trichuris muris) in mice. Our environmental DNA approach mitigates problems associated with microscopic identification and can be applied to detect nematode parasitoses in wild and captive hosts for infection surveillance and maintenance of healthy populations. PMID:28934299

Development of a real-time TaqMan assay to detect mendocina sublineage Pseudomonas species in contaminated metalworking fluids.

PubMed

Saha, Ratul; Donofrio, Robert S; Bagley, Susan T

2010-08-01

A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.

One-Tube-Only Standardized Site-Directed Mutagenesis: An Alternative Approach to Generate Amino Acid Substitution Collections

PubMed Central

Mingo, Janire; Erramuzpe, Asier; Luna, Sandra; Aurtenetxe, Olaia; Amo, Laura; Diez, Ibai; Schepens, Jan T. G.; Hendriks, Wiljan J. A. J.; Cortés, Jesús M.; Pulido, Rafael

2016-01-01

Site-directed mutagenesis (SDM) is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis. PMID:27548698

A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

PubMed

Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

2015-06-01

Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Transcriptional Analysis of In vivo Plasmodium yoelii Liver Stage Gene Expression

DTIC Science & Technology

2005-04-26

reaction was added to a PCR master mix with one of several oligonucleotide primer pairs (Table S6). The primers were designed and the specific conditions ...Koonin EV. Using the COG database to improve gene recognition in complete genomes. Genetica 2000;108:9–17. 26] Florens L, Washburn MP, Raine JD, et al

New Arsenate Reductase Gene (arrA) PCR Primers for Diversity Assessment and Quantification in Environmental Samples

PubMed Central

Sorensen, Darwin L.; Dupont, R. Ryan

2016-01-01

ABSTRACT The extent of arsenic contamination in drinking water and its potential threat to human health have resulted in considerable research interest in the microbial species responsible for arsenic reduction. The arsenate reductase gene (arrA), an important component of the microbial arsenate reduction system, has been widely used as a biomarker to study arsenate-reducing microorganisms. A new primer pair was designed and evaluated for quantitative PCR (qPCR) and high-throughput sequencing of the arrA gene, because currently available PCR primers are not suitable for these applications. The primers were evaluated in silico and empirically tested for amplification of arrA genes in clones and for amplification and high-throughput sequencing of arrA genes from soil and groundwater samples. In silico, this primer pair matched (≥90% DNA identity) 86% of arrA gene sequences from GenBank. Empirical evaluation showed successful amplification of arrA gene clones of diverse phylogenetic groups, as well as amplification and high-throughput sequencing of independent soil and groundwater samples without preenrichment, suggesting that these primers are highly specific and can amplify a broad diversity of arrA genes. The arrA gene diversity from soil and groundwater samples from the Cache Valley Basin (CVB) in Utah was greater than anticipated. We observed a significant correlation between arrA gene abundance, quantified through qPCR, and reduced arsenic (AsIII) concentrations in the groundwater samples. Furthermore, we demonstrated that these primers can be useful for studying the diversity of arsenate-reducing microbial communities and the ways in which their relative abundance in groundwater may be associated with different groundwater quality parameters. IMPORTANCE Arsenic is a major drinking water contaminant that threatens the health of millions of people worldwide. The extent of arsenic contamination and its potential threat to human health have resulted in considerable interest in the study of microbial species responsible for the reduction of arsenic, i.e., the conversion of AsV to AsIII. In this study, we developed a new primer pair to evaluate the diversity and abundance of arsenate-reducing microorganisms in soil and groundwater samples from the CVB in Utah. We observed significant arrA gene diversity in the CVB soil and groundwater samples, and arrA gene abundance was significantly correlated with the reduced arsenic (AsIII) concentrations in the groundwater samples. We think that these primers are useful for studying the ecology of arsenate-reducing microorganisms in different environments. PMID:27913413

Hindering the illegal trade in dog and cat furs through a DNA-based protocol for species identification.

PubMed

Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita

2018-01-01

In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.

A versatile genome-scale PCR-based pipeline for high-definition DNA FISH.

PubMed

Bienko, Magda; Crosetto, Nicola; Teytelman, Leonid; Klemm, Sandy; Itzkovitz, Shalev; van Oudenaarden, Alexander

2013-02-01

We developed a cost-effective genome-scale PCR-based method for high-definition DNA FISH (HD-FISH). We visualized gene loci with diffraction-limited resolution, chromosomes as spot clusters and single genes together with transcripts by combining HD-FISH with single-molecule RNA FISH. We provide a database of over 4.3 million primer pairs targeting the human and mouse genomes that is readily usable for rapid and flexible generation of probes.

A blackberry (Rubus L.) expressed sequence tag library for the development of simple sequence repeat markers

PubMed Central

Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P

2008-01-01

Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry. PMID:18570660

Development of a multiplex PCR assay for the detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei, Burkholderia thailandensis, and Burkholderia cepacia complex.

PubMed

Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry

2017-10-01

Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.

Isolation and characterization of 14 tetranucleotide microsatellite loci for the cannonball jellyfish (Stomolophus sp.) by next generation sequencing.

PubMed

Getino-Mamet, Leandro Nicolás; Valdivia-Carrillo, Tania; Gómez Daglio, Liza; García-De León, Francisco Javier

2017-04-01

The Cannonball jellyfish (Stomolophus sp.) is a species of jellyfish with high relevance in artisanal fishing. Studies of their populations do not extend beyond the morphological descriptions knowing that presents a great morphological variability. However, there are no genetic studies to determine the number of independent populations, so microsatellite markers become a suitable option. Since there are no species-specific microsatellite loci, in this paper, 14 new microsatellite loci are characterized. Microsatellite loci were isolated de novo through next generation sequencing, by two runs on Illumina MiSeq. A total of 506,771,269 base pair were obtained, from which 142,616 were microsatellite loci, and 1546 of them could design primers. We tested 14 primer pairs on 32 individuals from Bahía de La Paz, Gulf of California. We observed low genetic variation among loci (mean number of alleles per locus = 4.33, mean observed heterozygosity 0.381, mean expected heterozygosity 0.501). These loci are the first ones described for the species and will be helpful to carry out genetic diversity and population genetics studies.

PlantFuncSSR: Integrating First and Next Generation Transcriptomics for Mining of SSR-Functional Domains Markers

PubMed Central

Sablok, Gaurav; Pérez-Pulido, Antonio J.; Do, Thac; Seong, Tan Y.; Casimiro-Soriguer, Carlos S.; La Porta, Nicola; Ralph, Peter J.; Squartini, Andrea; Muñoz-Merida, Antonio; Harikrishna, Jennifer A.

2016-01-01

Analysis of repetitive DNA sequence content and divergence among the repetitive functional classes is a well-accepted approach for estimation of inter- and intra-generic differences in plant genomes. Among these elements, microsatellites, or Simple Sequence Repeats (SSRs), have been widely demonstrated as powerful genetic markers for species and varieties discrimination. We present PlantFuncSSRs platform having more than 364 plant species with more than 2 million functional SSRs. They are provided with detailed annotations for easy functional browsing of SSRs and with information on primer pairs and associated functional domains. PlantFuncSSRs can be leveraged to identify functional-based genic variability among the species of interest, which might be of particular interest in developing functional markers in plants. This comprehensive on-line portal unifies mining of SSRs from first and next generation sequencing datasets, corresponding primer pairs and associated in-depth functional annotation such as gene ontology annotation, gene interactions and its identification from reference protein databases. PlantFuncSSRs is freely accessible at: http://www.bioinfocabd.upo.es/plantssr. PMID:27446111

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesismore » at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.« less

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification

PubMed Central

Guo, Xu-Guang; Zhou, Shan

2014-01-01

Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Identification and authentication of Rosa species through development of species-specific SCAR marker(s).

PubMed

Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M

2014-05-30

Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.

A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts

PubMed Central

Ealba, Erin L.; Schneider, Richard A.

2013-01-01

Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056

A new rapid methodological strategy to assess BRCA mutational status.

PubMed

Vuttariello, Emilia; Borra, Marco; Calise, Celeste; Mauriello, Elvira; Greggi, Stefano; Vecchione, Aldo; Biffali, Elio; Chiappetta, Gennaro

2013-07-01

Hereditary cancers account for approximately 10 % of breast and ovarian cancers. Mutations of the BRCA1 and BRCA2 genes, encoding two proteins involved in DNA repair, underlie most cases of such hereditary cancers. Women with BRCA mutations develop breast cancer in 50-80 % of cases and ovarian cancer in 10-40 % of cases. Assessing BRCA mutational status is needed to direct the clinical management of women with predisposition to these hereditary cancers. However, BRCA screening constitutes a bottleneck in terms of costs and time to deliver results. We developed a PCR-based assay using 73 primer pairs covering the entire coding regions of BRCA1 and BRCA2. PCR primers, containing at the 5' end the universal M13 primer sequences, were pre-spotted in 96-well plates. Following PCR, direct sequencing was performed using M13 primers, allowing to standardize the conditions. PCR amplification and sequencing were successful for each amplicon. We tested and validated the assay on 10 known gDNAs from patients with Hereditary breast and ovarian cancer (HBOC). Our strategy is a promising time and cost-effective method to detect BRCA mutations in the clinical setting, which is essential to formulate a personalized therapy for patients with HBOC.

Host-associated bacterial taxa from Chlorobi, Chloroflexi, GN02, Synergistetes, SR1, TM7, and WPS-2 Phyla/candidate divisions

PubMed Central

Camanocha, Anuj; Dewhirst, Floyd E.

2014-01-01

Background and objective In addition to the well-known phyla Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, Spirochaetes, Fusobacteria, Tenericutes, and Chylamydiae, the oral microbiomes of mammals contain species from the lesser-known phyla or candidate divisions, including Synergistetes, TM7, Chlorobi, Chloroflexi, GN02, SR1, and WPS-2. The objectives of this study were to create phyla-selective 16S rDNA PCR primer pairs, create selective 16S rDNA clone libraries, identify novel oral taxa, and update canine and human oral microbiome databases. Design 16S rRNA gene sequences for members of the lesser-known phyla were downloaded from GenBank and Greengenes databases and aligned with sequences in our RNA databases. Primers with potential phylum level selectivity were designed heuristically with the goal of producing nearly full-length 16S rDNA amplicons. The specificity of primer pairs was examined by making clone libraries from PCR amplicons and determining phyla identity by BLASTN analysis. Results Phylum-selective primer pairs were identified that allowed construction of clone libraries with 96–100% specificity for each of the lesser-known phyla. From these clone libraries, seven human and two canine novel oral taxa were identified and added to their respective taxonomic databases. For each phylum, genome sequences closest to human oral taxa were identified and added to the Human Oral Microbiome Database to facilitate metagenomic, transcriptomic, and proteomic studies that involve tiling sequences to the most closely related taxon. While examining ribosomal operons in lesser-known phyla from single-cell genomes and metagenomes, we identified a novel rRNA operon order (23S-5S-16S) in three SR1 genomes and the splitting of the 23S rRNA gene by an I-CeuI-like homing endonuclease in a WPS-2 genome. Conclusions This study developed useful primer pairs for making phylum-selective 16S rRNA clone libraries. Phylum-specific libraries were shown to be useful for identifying previously unrecognized taxa in lesser-known phyla and would be useful for future environmental and host-associated studies. PMID:25317252

Massive dominance of Epsilonproteobacteria in formation waters from a Canadian oil sands reservoir containing severely biodegraded oil

PubMed Central

Hubert, Casey R J; Oldenburg, Thomas B P; Fustic, Milovan; Gray, Neil D; Larter, Stephen R; Penn, Kevin; Rowan, Arlene K; Seshadri, Rekha; Sherry, Angela; Swainsbury, Richard; Voordouw, Gerrit; Voordouw, Johanna K; Head, Ian M

2012-01-01

Summary The subsurface microbiology of an Athabasca oil sands reservoir in western Canada containing severely biodegraded oil was investigated by combining 16S rRNA gene- and polar lipid-based analyses of reservoir formation water with geochemical analyses of the crude oil and formation water. Biomass was filtered from formation water, DNA was extracted using two different methods, and 16S rRNA gene fragments were amplified with several different primer pairs prior to cloning and sequencing or community fingerprinting by denaturing gradient gel electrophoresis (DGGE). Similar results were obtained irrespective of the DNA extraction method or primers used. Archaeal libraries were dominated by Methanomicrobiales (410 of 414 total sequences formed a dominant phylotype affiliated with a Methanoregula sp.), consistent with the proposed dominant role of CO2-reducing methanogens in crude oil biodegradation. In two bacterial 16S rRNA clone libraries generated with different primer pairs, > 99% and 100% of the sequences were affiliated with Epsilonproteobacteria (n = 382 and 72 total clones respectively). This massive dominance of Epsilonproteobacteria sequences was again obtained in a third library (99% of sequences; n = 96 clones) using a third universal bacterial primer pair (inosine-341f and 1492r). Sequencing of bands from DGGE profiles and intact polar lipid analyses were in accordance with the bacterial clone library results. Epsilonproteobacterial OTUs were affiliated with Sulfuricurvum, Arcobacter and Sulfurospirillum spp. detected in other oil field habitats. The dominant organism revealed by the bacterial libraries (87% of all sequences) is a close relative of Sulfuricurvum kujiense – an organism capable of oxidizing reduced sulfur compounds in crude oil. Geochemical analysis of organic extracts from bitumen at different reservoir depths down to the oil water transition zone of these oil sands indicated active biodegradation of dibenzothiophenes, and stable sulfur isotope ratios for elemental sulfur and sulfate in formation waters were indicative of anaerobic oxidation of sulfur compounds. Microbial desulfurization of crude oil may be an important metabolism for Epsilonproteobacteria indigenous to oil reservoirs with elevated sulfur content and may explain their prevalence in formation waters from highly biodegraded petroleum systems. PMID:21824242

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE PAGES

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

2015-12-09

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

PubMed Central

Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

2016-01-01

Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

Two molecular markers based on mitochondrial genomes for varieties identification of the northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids.

PubMed

Xincheng, Zhang; Kunci, Chen; Xinping, Zhu; Jian, Zhao; Qing, Luo; Xiaoyou, Hong; Wei, Li; Fengfang, Xiao

2015-08-01

The northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids have played important roles in the Chinese freshwater aquaculture industry, with an annual production in China exceeding 400 thousand tons. While these are popular aquaculture breeds in China, it is not easy to identify northern snakehead, blotched snakehead, and their hybrids. Thus, a method should be developed to identify these varieties. To distinguish between the reciprocal hybrids (C. argus ♀ × C. maculata ♂ and C. maculata ♀ × C. argus ♂), the mitochondrial genome sequences of northern snakehead and blotched snakehead and their reciprocal hybrids were compared. Following the alignment and analysis of mtDNA sequences of northern snakehead, blotched snakehead and their hybrids, two pairs of specific primers were designed based on identified differences ranging from 12S rRNA to 16S rRNA gene. The BY1 primers amplified the same bands in the blotched snakehead and the hybrid (C. maculata ♀ × C. argus ♂), while producing no products in northern snakehead and the hybrid (C. argus ♀ × C. maculata ♂). Amplification with WY1 yielded the opposite results. Then, 30 individuals per fish were randomized to verify the primers, and the results showed that the primers were specific for breeds, as intended. The specific primers can not only simply distinguish between two kinds of hybrids, but also rapidly identify the two parents. This study provides a method of molecular marker identification to identify reciprocal hybrids.

AFLP marking and polymorphism among progenies of Gymnema sylvestre: an important medicinal plant of India.

PubMed

Osman, Magda Abbaker; Dhawan, Sunita Singh; Bahl, Janak Raj; Darokar, Mahendra P; Khanuja, Suman P S

2011-11-01

The level of polymorphism among twelve selected progenies of Gymnema sylvestre was investigated through AFLP markers by multiplexing PCR reactions using 64 (8x8) primer combinations. Fourteen primer combinations were selected as the most suitable combination for G. sylvestre. Analysis of the 12 progenies with these 14 primer pairs produced 1689 fragments of which 972 (57.5%) were polymorphic and 485 (28.7%) were unique to a particular genotype. The number of fragments produced by individual primer pairs was in the range of 55 to 225. Out of these, polymorphic fragments were in the range of 34 (E-ACC/M-CAC) to 157 (E-AGG/M-CAG) and unique bands observed were 8 (E-ACC / M-CAC) to 69 (E-AGG/M-CAC). Different primer combinations detected different levels of polymorphism, ranging from 33% (E-AGG/ M-CAC) to 69.8% (E-AGG/ M-CAC). From the observations, it appears that the primer combinations E-AGG/M-CAC, E-AGG/CTG, E-AGG/CAG and E-ACA/CAT were the most informative for the detection of polymorphism among the progenies compared with others, since they produced a high number of unique fragments. The similarity coefficient ranged from 0.212 to 0.731. High similarity was observed between progeny S8 and S9 (73%) and high divergence between progenies S3 and S11. Among the selected progeny, S9 was found to be the most similar to the parent (63%), while genotype S11 was the most distant (36.9%).

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

PubMed Central

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

Genetic diversity and relationship analysis of Gossypium arboreum accessions.

PubMed

Liu, F; Zhou, Z L; Wang, C Y; Wang, Y H; Cai, X Y; Wang, X X; Zhang, Z S; Wang, K B

2015-11-19

Simple sequence repeat techniques were used to identify the genetic diversity of 101 Gossypium arboreum accessions collected from India, Vietnam, and the southwest of China (Guizhou, Guangxi, and Yunnan provinces). Twenty-six pairs of SSR primers produced a total of 103 polymorphic loci with an average of 3.96 polymorphic loci per primer. The average of the effective number of alleles, Nei's gene diversity, and Shannon's information index were 0.59, 0.2835, and 0.4361, respectively. The diversity varied among different geographic regions. The result of principal component analysis was consistent with that of unweighted pair group method with arithmetic mean clustering analysis. The 101 G. arboreum accessions were clustered into 2 groups.

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2009-30 November 2009.

PubMed

An, Junghwa; Bechet, Arnaud; Berggren, Asa; Brown, Sarah K; Bruford, Michael W; Cai, Qingui; Cassel-Lundhagen, Anna; Cezilly, Frank; Chen, Song-Lin; Cheng, Wei; Choi, Sung-Kyoung; Ding, X Y; Fan, Yong; Feldheim, Kevin A; Feng, Z Y; Friesen, Vicki L; Gaillard, Maria; Galaraza, Juan A; Gallo, Leonardo; Ganeshaiah, K N; Geraci, Julia; Gibbons, John G; Grant, William S; Grauvogel, Zac; Gustafsson, S; Guyon, Jeffrey R; Han, L; Heath, Daniel D; Hemmilä, S; Hogan, J Derek; Hou, B W; Jakse, Jernej; Javornik, Branka; Kaňuch, Peter; Kim, Kyung-Kil; Kim, Kyung-Seok; Kim, Sang-Gyu; Kim, Sang-In; Kim, Woo-Jin; Kim, Yi-Kyung; Klich, Maren A; Kreiser, Brian R; Kwan, Ye-Seul; Lam, Athena W; Lasater, Kelly; Lascoux, M; Lee, Hang; Lee, Yun-Sun; Li, D L; Li, Shao-Jing; Li, W Y; Liao, Xiaolin; Liber, Zlatko; Lin, Lin; Liu, Shaoying; Luo, Xin-Hui; Ma, Y H; Ma, Yajun; Marchelli, Paula; Min, Mi-Sook; Moccia, Maria Domenica; Mohana, Kumara P; Moore, Marcelle; Morris-Pocock, James A; Park, Han-Chan; Pfunder, Monika; Ivan, Radosavljević; Ravikanth, G; Roderick, George K; Rokas, Antonis; Sacks, Benjamin N; Saski, Christopher A; Satovic, Zlatko; Schoville, Sean D; Sebastiani, Federico; Sha, Zhen-Xia; Shin, Eun-Ha; Soliani, Carolina; Sreejayan, N; Sun, Zhengxin; Tao, Yong; Taylor, Scott A; Templin, William D; Shaanker, R Uma; Vasudeva, R; Vendramin, Giovanni G; Walter, Ryan P; Wang, Gui-Zhong; Wang, Ke-Jian; Wang, Y Q; Wattier, Rémi A; Wei, Fuwen; Widmer, Alex; Woltmann, Stefan; Won, Yong-Jin; Wu, Jing; Xie, M L; Xu, Genbo; Xu, Xiao-Jun; Ye, Hai-Hui; Zhan, Xiangjiang; Zhang, F; Zhong, J

2010-03-01

This article documents the addition of 411 microsatellite marker loci and 15 pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Acanthopagrus schlegeli, Anopheles lesteri, Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus oryzae, Aspergillus terreus, Branchiostoma japonicum, Branchiostoma belcheri, Colias behrii, Coryphopterus personatus, Cynogolssus semilaevis, Cynoglossus semilaevis, Dendrobium officinale, Dendrobium officinale, Dysoxylum malabaricum, Metrioptera roeselii, Myrmeciza exsul, Ochotona thibetana, Neosartorya fischeri, Nothofagus pumilio, Onychodactylus fischeri, Phoenicopterus roseus, Salvia officinalis L., Scylla paramamosain, Silene latifo, Sula sula, and Vulpes vulpes. These loci were cross-tested on the following species: Aspergillus giganteus, Colias pelidne, Colias interior, Colias meadii, Colias eurytheme, Coryphopterus lipernes, Coryphopterus glaucofrenum, Coryphopterus eidolon, Gnatholepis thompsoni, Elacatinus evelynae, Dendrobium loddigesii Dendrobium devonianum, Dysoxylum binectariferum, Nothofagus antarctica, Nothofagus dombeyii, Nothofagus nervosa, Nothofagus obliqua, Sula nebouxii, and Sula variegata. This article also documents the addition of 39 sequencing primer pairs and 15 allele specific primers or probes for Paralithodes camtschaticus. © 2010 Blackwell Publishing Ltd.

Significant variance in genetic diversity among populations of Schistosoma haematobium detected using microsatellite DNA loci from a genome-wide database.

PubMed

Glenn, Travis C; Lance, Stacey L; McKee, Anna M; Webster, Bonnie L; Emery, Aidan M; Zerlotini, Adhemar; Oliveira, Guilherme; Rollinson, David; Faircloth, Brant C

2013-10-17

Urogenital schistosomiasis caused by Schistosoma haematobium is widely distributed across Africa and is increasingly being targeted for control. Genome sequences and population genetic parameters can give insight into the potential for population- or species-level drug resistance. Microsatellite DNA loci are genetic markers in wide use by Schistosoma researchers, but there are few primers available for S. haematobium. We sequenced 1,058,114 random DNA fragments from clonal cercariae collected from a snail infected with a single Schistosoma haematobium miracidium. We assembled and aligned the S. haematobium sequences to the genomes of S. mansoni and S. japonicum, identifying microsatellite DNA loci across all three species and designing primers to amplify the loci in S. haematobium. To validate our primers, we screened 32 randomly selected primer pairs with population samples of S. haematobium. We designed >13,790 primer pairs to amplify unique microsatellite loci in S. haematobium, (available at http://www.cebio.org/projetos/schistosoma-haematobium-genome). The three Schistosoma genomes contained similar overall frequencies of microsatellites, but the frequency and length distributions of specific motifs differed among species. We identified 15 primer pairs that amplified consistently and were easily scored. We genotyped these 15 loci in S. haematobium individuals from six locations: Zanzibar had the highest levels of diversity; Malawi, Mauritius, Nigeria, and Senegal were nearly as diverse; but the sample from South Africa was much less diverse. About half of the primers in the database of Schistosoma haematobium microsatellite DNA loci should yield amplifiable and easily scored polymorphic markers, thus providing thousands of potential markers. Sequence conservation among S. haematobium, S. japonicum, and S. mansoni is relatively high, thus it should now be possible to identify markers that are universal among Schistosoma species (i.e., using DNA sequences conserved among species), as well as other markers that are specific to species or species-groups (i.e., using DNA sequences that differ among species). Full genome-sequencing of additional species and specimens of S. haematobium, S. japonicum, and S. mansoni is desirable to better characterize differences within and among these species, to develop additional genetic markers, and to examine genes as well as conserved non-coding elements associated with drug resistance.

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

PubMed

Meena, Ram Prasnna; Baranwal, V K

2016-09-01

Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.

Ancient DNA analyses of museum specimens from selected Presbytis (primate: Colobinae) based on partial Cyt b sequences

NASA Astrophysics Data System (ADS)

Aifat, N. R.; Yaakop, S.; Md-Zain, B. M.

2016-11-01

The IUCN Red List of Threatened Species has categorized Malaysian primates from being data deficient to critically endanger. Thus, ancient DNA analyses hold great potential to understand phylogeny, phylogeography and population history of extinct and extant species. Museum samples are one of the alternatives to provide important sources of biological materials for a large proportion of ancient DNA studies. In this study, a total of six museum skin samples from species Presbytis hosei (4 samples) and Presbytis frontata (2 samples), aged between 43 and 124 years old were extracted to obtain the DNA. Extraction was done by using QIAGEN QIAamp DNA Investigator Kit and the ability of this kit to extract museum skin samples was tested by amplification of partial Cyt b sequence using species-specific designed primer. Two primer pairs were designed specifically for P. hosei and P. frontata, respectively. These primer pairs proved to be efficient in amplifying 200bp of the targeted species in the optimized PCR conditions. The performance of the sequences were tested to determine genetic distance of genus Presbytis in Malaysia. From the analyses, P. hosei is closely related to P. chrysomelas and P. frontata with the value of 0.095 and 0.106, respectively. Cyt b gave a clear data in determining relationships among Bornean species. Thus, with the optimized condition, museum specimens can be used for molecular systematic studies of the Malaysian primates.

A sequence-based genetic map of Medicago truncatula and comparison of marker colinearity with M. sativa.

PubMed Central

Choi, Hong-Kyu; Kim, Dongjin; Uhm, Taesik; Limpens, Eric; Lim, Hyunju; Mun, Jeong-Hwan; Kalo, Peter; Penmetsa, R Varma; Seres, Andrea; Kulikova, Olga; Roe, Bruce A; Bisseling, Ton; Kiss, Gyorgy B; Cook, Douglas R

2004-01-01

A core genetic map of the legume Medicago truncatula has been established by analyzing the segregation of 288 sequence-characterized genetic markers in an F(2) population composed of 93 individuals. These molecular markers correspond to 141 ESTs, 80 BAC end sequence tags, and 67 resistance gene analogs, covering 513 cM. In the case of EST-based markers we used an intron-targeted marker strategy with primers designed to anneal in conserved exon regions and to amplify across intron regions. Polymorphisms were significantly more frequent in intron vs. exon regions, thus providing an efficient mechanism to map transcribed genes. Genetic and cytogenetic analysis produced eight well-resolved linkage groups, which have been previously correlated with eight chromosomes by means of FISH with mapped BAC clones. We anticipated that mapping of conserved coding regions would have utility for comparative mapping among legumes; thus 60 of the EST-based primer pairs were designed to amplify orthologous sequences across a range of legume species. As an initial test of this strategy, we used primers designed against M. truncatula exon sequences to rapidly map genes in M. sativa. The resulting comparative map, which includes 68 bridging markers, indicates that the two Medicago genomes are highly similar and establishes the basis for a Medicago composite map. PMID:15082563

Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea)

PubMed Central

Gimenes, Marcos A; Hoshino, Andrea A; Barbosa, Andrea VG; Palmieri, Dario A; Lopes, Catalina R

2007-01-01

Background The genus Arachis includes Arachis hypogaea (cultivated peanut) and wild species that are used in peanut breeding or as forage. Molecular markers have been employed in several studies of this genus, but microsatellite markers have only been used in few investigations. Microsatellites are very informative and are useful to assess genetic variability, analyze mating systems and in genetic mapping. The objectives of this study were to develop A. hypogaea microsatellite loci and to evaluate the transferability of these markers to other Arachis species. Results Thirteen loci were isolated and characterized using 16 accessions of A. hypogaea. The level of variation found in A. hypogaea using microsatellites was higher than with other markers. Cross-transferability of the markers was also high. Sequencing of the fragments amplified using the primer pair Ah11 from 17 wild Arachis species showed that almost all wild species had similar repeated sequence to the one observed in A. hypogaea. Sequence data suggested that there is no correlation between taxonomic relationship of a wild species to A. hypogaea and the number of repeats found in its microsatellite loci. Conclusion These results show that microsatellite primer pairs from A. hypogaea have multiple uses. A higher level of variation among A. hypogaea accessions can be detected using microsatellite markers in comparison to other markers, such as RFLP, RAPD and AFLP. The microsatellite primers of A. hypogaea showed a very high rate of transferability to other species of the genus. These primer pairs provide important tools to evaluate the genetic variability and to assess the mating system in Arachis species. PMID:17326826

Transcriptome characterization and SSR discovery in large-scale loach Paramisgurnus dabryanus (Cobitidae, Cypriniformes).

PubMed

Li, Caijuan; Ling, Qufei; Ge, Chen; Ye, Zhuqing; Han, Xiaofei

2015-02-25

The large-scale loach (Paramisgurnus dabryanus, Cypriniformes) is a bottom-dwelling freshwater species of fish found mainly in eastern Asia. The natural germplasm resources of this important aquaculture species has been recently threatened due to overfishing and artificial propagation. The objective of this study is to obtain the first functional genomic resource and candidate molecular markers for future conservation and breeding research. Illumina paired-end sequencing generated over one hundred million reads that resulted in 71,887 assembled transcripts, with an average length of 1465bp. 42,093 (58.56%) protein-coding sequences were predicted; and 43,837 transcripts had significant matches to NCBI nonredundant protein (Nr) database. 29,389 and 14,419 transcripts were assigned into gene ontology (GO) categories and Eukaryotic Orthologous Groups (KOG), respectively. 22,102 (31.14%) transcripts were mapped to 302 KEGG pathways. In addition, 15,106 candidate SSR markers were identified, with 11,037 pairs of PCR primers designed. 400 primers pairs of SSR selected randomly were validated, of which 364 (91%) pairs of primers were able to produce PCR products. Further test with 41 loci and 20 large-scale loach specimens collected from the four largest lakes in China showed that 36 (87.8%) loci were polymorphic. The transcriptomic profile and SSR repertoire obtained in this study will facilitate population genetic studies and selective breeding of large-scale loach in the future. Copyright © 2015. Published by Elsevier B.V.

Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

PubMed

Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2013-01-01

Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

PubMed

Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

1996-04-15

A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.

PubMed

Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L

1990-08-01

To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.

A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize.

PubMed

Matsuoka, T; Kuribara, H; Akiyama, H; Miura, H; Goda, Y; Kusakabe, Y; Isshiki, K; Toyoda, M; Hino, A

2001-02-01

Seven lines of genetically modified (GM) maize have been authorized in Japan as foods and feeds imported from the USA. We improved a multiplex PCR method described in the previous report in order to distinguish the five lines of GM maize. Genomic DNA was extracted from GM maize with a silica spin column kit, which could reduce experimental time and improve safety in the laboratory and potentially in the environment. We sequenced recombinant DNA (r-DNA) introduced into GM maize, and re-designed new primer pairs to increase the specificity of PCR to distinguish five lines of GM maize by multiplex PCR. A primer pair for the maize intrinsic zein gene (Ze1) was also designed to confirm the presence of amplifiable maize DNA. The lengths of PCR products using these six primer pairs were different. The Ze1 and the r-DNAs from the five lines of GM maize were qualitatively detected in one tube. The specific PCR bands were distinguishable from each other on the basis of the expected length. The r-DNA could be detected from maize samples containing 0.5% of each of the five lines of GM maize. The sensitivity would be acceptable to secure the verification of non-GMO materials and to monitor the reliability of the labeling system.

Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas

PubMed Central

2014-01-01

Background Grasspea (Lathyrus sativus L., 2n = 14), a member of the family Leguminosae, holds great agronomic potential as grain and forage legume crop in the arid areas for its superb resilience to abiotic stresses such as drought, flood and salinity. The crop could not make much progress through conventional breeding in the past, and there are hardly any detailed molecular biology studies due to paucity of reliable molecular markers representative of the entire genome. Results Using the 454 FLX Titanium pyrosequencing technique, 651,827 simple sequence repeat (SSR) loci were identified and 50,144 nonredundant primer pairs were successfully designed, of which 288 were randomly selected for validation among 23 L. sativus and one L. cicera accessions of diverse provenance. 74 were polymorphic, 70 monomorphic, and 144 with no PCR product. The number of observed alleles ranged from two to five, the observed heterozygosity from 0 to 0.9545, and Shannon’s information index ranged from 0.1013 to 1.0980, respectively. The dendrogram constructed by using unweighted pair group method with arithmetic mean (UPGMA) based on Nei's genetic distance, showed obvious distinctions and understandable relationships among the 24 accessions. Conclusions The large number of SSR primer pairs developed in this study would make a significant contribution to genomics enabled improvement of grasspea. PMID:24635905

Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

PubMed

Kageyama, A; Benno, Y

2001-01-01

PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

DEVELOPMENT OF CRASSPHAGE-BASED QPCR ASSAYS ...

EPA Pesticide Factsheets

A newly discovered bacteriophage, “crAssphage”, is predicted to be both highlyabundant and predominantly human-associated, both ideal characteristics for a human-specific fecal indicator. A total of 384 end-point PCR primers were designed along the length of the crAssphage genome, eliminating regions suspected to be hypervariable or react with other animal sources. The primer pairs were rigorously tested in three rounds of screening for specificity, geographic variability, limit of detection, and environmental water performance. The two best performing assays, crAss056 and crAss064, were adapted to a qPCR platform and exhibited a specificity of 98.0% and 98.9%, respectively. The markers’ abundance was compared with two bacterial based assays and were found at concentrations at or above the bacterial based assays in wastewater influent and impacted environmental waters. This poster will present the methodology of the novel marker development and the potential uses for this technology in maintaining sustainable waterways in the future. To inform the public.

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

Detection of Canine Distemper Virus Nucleoprotein RNA by Reverse Transcription-PCR Using Serum, Whole Blood, and Cerebrospinal Fluid from Dogs with Distemper

PubMed Central

Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.

1999-01-01

Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566

Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

PubMed

Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

2002-12-01

The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

Characterization of the Kenaf (Hibiscus cannabinus) Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers

PubMed Central

Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi

2016-01-01

Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies. PMID:26960153

Genetic diversity in intraspecific hybrid populations of Eucommia ulmoides Oliver evaluated from ISSR and SRAP molecular marker analysis.

PubMed

Yu, J; Wang, Y; Ru, M; Peng, L; Liang, Z S

2015-07-03

Eucommia ulmoides Oliver, the only extant species of Eucommiaceae, is a second-category state-protected endangered plant in China. Evaluation of genetic diversity among some intraspecific hybrid populations of E. ulmoides Oliver is vital for breeding programs and further conservation of this rare species. We studied the genetic diversity of 130 accessions from 13 E. ulmoides intraspecific hybrid populations using inter-simple sequence related (ISSR) and sequence-related amplified polymorphism (SRAP) markers. Of the 100 ISSR primers and 100 SRAP primer combinations screened, eight ISSRs and eight SRAPs were used to evaluate the level of polymorphism and discriminating capacity. A total number of 65 bands were amplified using eight ISSR primers, in which 50 bands (76.9%) were polymorphic, with an average of 8.1 polymorphic fragments per primer. Alternatively, another 244 bands were observed using eight SRAP primer combinations, and 163 (66.8%) of them were polymorphic, with an average of 30.5 polymorphic fragments per primer. The unweighted pair-group method (UPGMA) analysis showed that these 13 populations could be classified into three groups by the ISSR marker and two groups by the SRAP marker. Principal coordinate analysis using SRAP was completely identical to the UPGMA-based clustering, although this was partly confirmed by the results of UPGMA cluster analysis using the ISSR marker. This study provides insights into the genetic background of E. ulmoides intraspecific hybrids. The progenies of the variations "Huazhong-3", "big fruit", "Yanci", and "smooth bark" present high genetic diversity and offer great potential for E. ulmoides breeding and conservation.

Development of Genomic Microsatellite Markers in Carthamus tinctorius L. (Safflower) Using Next Generation Sequencing and Assessment of Their Cross-Species Transferability and Utility for Diversity Analysis

PubMed Central

Variath, Murali Tottekkad; Joshi, Gopal; Bali, Sapinder; Agarwal, Manu; Kumar, Amar; Jagannath, Arun; Goel, Shailendra

2015-01-01

Background Safflower (Carthamus tinctorius L.), an Asteraceae member, yields high quality edible oil rich in unsaturated fatty acids and is resilient to dry conditions. The crop holds tremendous potential for improvement through concerted molecular breeding programs due to the availability of significant genetic and phenotypic diversity. Genomic resources that could facilitate such breeding programs remain largely underdeveloped in the crop. The present study was initiated to develop a large set of novel microsatellite markers for safflower using next generation sequencing. Principal Findings Low throughput genome sequencing of safflower was performed using Illumina paired end technology providing ~3.5X coverage of the genome. Analysis of sequencing data allowed identification of 23,067 regions harboring perfect microsatellite loci. The safflower genome was found to be rich in dinucleotide repeats followed by tri-, tetra-, penta- and hexa-nucleotides. Primer pairs were designed for 5,716 novel microsatellite sequences with repeat length ≥ 20 bases and optimal flanking regions. A subset of 325 microsatellite loci was tested for amplification, of which 294 loci produced robust amplification. The validated primers were used for assessment of 23 safflower accessions belonging to diverse agro-climatic zones of the world leading to identification of 93 polymorphic primers (31.6%). The numbers of observed alleles at each locus ranged from two to four and mean polymorphism information content was found to be 0.3075. The polymorphic primers were tested for cross-species transferability on nine wild relatives of cultivated safflower. All primers except one showed amplification in at least two wild species while 25 primers amplified across all the nine species. The UPGMA dendrogram clustered C. tinctorius accessions and wild species separately into two major groups. The proposed progenitor species of safflower, C. oxyacantha and C. palaestinus were genetically closer to cultivated safflower and formed a distinct cluster. The cluster analysis also distinguished diploid and tetraploid wild species of safflower. Conclusion Next generation sequencing of safflower genome generated a large set of microsatellite markers. The novel markers developed in this study will add to the existing repertoire of markers and can be used for diversity analysis, synteny studies, construction of linkage maps and marker-assisted selection. PMID:26287743

Using NMR and molecular dynamics to link structure and dynamics effects of the universal base 8-aza, 7-deaza, N8 linked adenosine analog

PubMed Central

Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.

2016-01-01

A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150

Rapid and sensitive detection of Curvularia lunata associated with maize leaf spot based on its Clg2p gene using semi-nested PCR.

PubMed

Hou, J M; Ma, B C; Zuo, Y H; Guo, L L; Gao, S G; Wang, Y Y; Liu, T

2013-04-01

Curvularia lunata (Wakker) Boed, the causative agent of Curvularia leaf spot in maize, was determined according to conidiophore and conidium morphology in a previous study. In the current study, a sensitive polymerase chain reaction assay was developed for the detection of C. lunata. Two specific forward (ClgD1/ClgD2) and one reverse primers (ClgD3) were designed based on a Ras-related (Clg2p) gene. Eight C. lunata isolates that represent different virulent strains in maize, six other Curvularia spp., and 22 fungal plant pathogens were used to test the specificity of the primers. PCR amplification using ClgD1/ClgD3 as the first-round primers resulted in an 870-bp band from the C. lunata isolates. The detection sensitivity using ClgD1/ClgD3 was 100 pg of genomic DNA. In the second round of PCR, a 1 : 50 dilution of the first-round PCR products was used as a template with the ClgD2/ClgD3 primer pair, which increased the detection sensitivity to 1 fg. This semi-nested PCR procedure could also be used to detect C. lunata from infected maize leaves. The proposed PCR-based assay may be used for diagnosing and monitoring maize Curvularia leaf spot. The semi-nested PCR assay may provide researchers and laboratory technologists a tool to rapidly detect C. lunata, which causes maize Curvularia leaf spot, compared with histological examination. © 2012 The Society for Applied Microbiology.

Development of SSR Markers and Genetic Diversity in White Birch (Betula platyphylla)

PubMed Central

Hao, Wei; Wang, Shengji; Liu, Huajing; Zhou, Boru; Wang, Xinwang; Jiang, Tingbo

2015-01-01

In order to study genetic diversity of white birch (Betula platyphylla), 544 primer pairs were designed based on the genome-wide Solexa sequences. Among them, 215 primer pairs showed polymorphism between five genotypes and 111 primer pairs that presented clear visible bands in genotyping 41 white birch plants that were collected from 6 different geographical regions. A total of 717 alleles were obtained at 111 loci with a range of 2 to 12 alleles per locus. The results of statistic analysis showed that polymorphic frequency of the alleles ranged from 17% to 100% with a mean of 55.85%; polymorphism information content (PIC) of the loci was from 0.09 to 0.58 with a mean of 0.30; and gene diversity between the tested genotypes was from 0.01 to 0.66 with a mean of 0.36. The results also indicated that major allele frequency ranged from 0.39 to 1.00 with an mean of 0.75; expected heterozygosity from 0.22 to 0.54 with a mean of 0.46; observed heterozygosity from 0.02 to 0.95 with a mean of 0.26; Nei's index from 0.21 to 0.54 with a mean of 0.46; and Shannon's Information from 0.26 to 0.87 with a mean of 0.66. The 41 white birch genotypes at the 111 selected SSR loci showed low to moderate similarity (0.025-0.610), indicating complicated genetic diversity among the white birch collections. The UPGMA-based clustering analysis of the allelic constitution of 41 white birch genotypes at 111 SSR loci suggested that the six different geographical regions can be further separated into four clusters at a similarity coefficient of 0.22. Genotypes from Huanren and Liangshui provenances were grouped into Cluster I, genotypes from Xiaobeihu and Qingyuan provenances into Cluster II, genotypes from Finland provenance into Cluster III, and genotypes from Maoershan into Cluster IV. The information provided in this study could help for genetic improvement and germplasm conservation, evaluation and utilization in white birch tree breeding program. PMID:25923698

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 May 2009-31 July 2009.

PubMed

Almany, Glenn R; DE Arruda, Maurício P; Arthofer, Wolfgang; Atallah, Z K; Beissinger, Steven R; Berumen, Michael L; Bogdanowicz, S M; Brown, S D; Bruford, Michael W; Burdine, C; Busch, Jeremiah W; Campbell, Nathan R; Carey, D; Carstens, Bryan C; Chu, K H; Cubeta, Marc A; Cuda, J P; Cui, Zhaoxia; Datnoff, L E; Dávila, J A; Davis, Emily S; Davis, R M; Diekmann, Onno E; Eizirik, Eduardo; Fargallo, J A; Fernandes, Fabiano; Fukuda, Hideo; Gale, L R; Gallagher, Elizabeth; Gao, Yongqiang; Girard, Philippe; Godhe, Anna; Gonçalves, Evonnildo C; Gouveia, Licinia; Grajczyk, Amber M; Grose, M J; Gu, Zhifeng; Halldén, Christer; Härnström, Karolina; Hemmingsen, Amanda H; Holmes, Gerald; Huang, C H; Huang, Chuan-Chin; Hudman, S P; Jones, Geoffrey P; Kanetis, Loukas; Karunasagar, Iddya; Karunasagar, Indrani; Keyghobadi, Nusha; Klosterman, S J; Klug, Page E; Koch, J; Koopman, Margaret M; Köppler, Kirsten; Koshimizu, Eriko; Krumböck, Susanne; Kubisiak, T; Landis, J B; Lasta, Mario L; Lee, Chow-Yang; Li, Qianqian; Li, Shou-Hsien; Lin, Rong-Chien; Liu, M; Liu, Na; Liu, W C; Liu, Yuan; Loiseau, A; Luan, Weisha; Maruthachalam, K K; McCormick, Helen M; Mellick, Rohan; Monnahan, P J; Morielle-Versute, Eliana; Murray, Tomás E; Narum, Shawn R; Neufeld, Katie; De Nova, P J G; Ojiambo, Peter S; Okamoto, Nobuaki; Othman, Ahmad Sofiman; Overholt, W A; Pardini, Renata; Paterson, Ian G; Patty, Olivia A; Paxton, Robert J; Planes, Serge; Porter, Carolyn; Pratchett, Morgan S; Püttker, Thomas; Rasic, Gordana; Rasool, Bilal; Rey, O; Riegler, Markus; Riehl, C; Roberts, John M K; Roberts, P D; Rochel, Elisabeth; Roe, Kevin J; Rossetto, Maurizio; Ruzzante, Daniel E; Sakamoto, Takashi; Saravanan, V; Sarturi, Cladinara Roberts; Schmidt, Anke; Schneider, Maria Paula Cruz; Schuler, Hannes; Serb, Jeanne M; Serrão, Ester T A; Shi, Yaohua; Silva, Artur; Sin, Y W; Sommer, Simone; Stauffer, Christian; Strüssmann, Carlos Augusto; Subbarao, K V; Syms, Craig; Tan, Feng; Tejedor, Eugenio Daniel; Thorrold, Simon R; Trigiano, Robert N; Trucco, María I; Tsuchiya-Jerep, Mirian Tieko Nunes; Vergara, P; Van De Vliet, Mirjam S; Wadl, Phillip A; Wang, Aimin; Wang, Hongxia; Wang, R X; Wang, Xinwang; Wang, Yan; Weeks, Andrew R; Wei, Fuwen; Werner, William J; Wiley, E O; Williams, D A; Wilkins, Richard J; Wisely, Samantha M; With, Kimberly A; Wu, Danhua; Yao, Cheng-Te; Yau, Cynthia; Yeap, Beng-Keok; Zhai, Bao-Ping; Zhan, Xiangjiang; Zhang, Guo-Yan; Zhang, S Y; Zhao, Ru; Zhu, Lifeng

2009-11-01

This article documents the addition of 512 microsatellite marker loci and nine pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Alcippe morrisonia morrisonia, Bashania fangiana, Bashania fargesii, Chaetodon vagabundus, Colletes floralis, Coluber constrictor flaviventris, Coptotermes gestroi, Crotophaga major, Cyprinella lutrensis, Danaus plexippus, Fagus grandifolia, Falco tinnunculus, Fletcherimyia fletcheri, Hydrilla verticillata, Laterallus jamaicensis coturniculus, Leavenworthia alabamica, Marmosops incanus, Miichthys miiuy, Nasua nasua, Noturus exilis, Odontesthes bonariensis, Quadrula fragosa, Pinctada maxima, Pseudaletia separata, Pseudoperonospora cubensis, Podocarpus elatus, Portunus trituberculatus, Rhagoletis cerasi, Rhinella schneideri, Sarracenia alata, Skeletonema marinoi, Sminthurus viridis, Syngnathus abaster, Uroteuthis (Photololigo) chinensis, Verticillium dahliae, Wasmannia auropunctata, and Zygochlamys patagonica. These loci were cross-tested on the following species: Chaetodon baronessa, Falco columbarius, Falco eleonorae, Falco naumanni, Falco peregrinus, Falco subbuteo, Didelphis aurita, Gracilinanus microtarsus, Marmosops paulensis, Monodelphis Americana, Odontesthes hatcheri, Podocarpus grayi, Podocarpus lawrencei, Podocarpus smithii, Portunus pelagicus, Syngnathus acus, Syngnathus typhle,Uroteuthis (Photololigo) edulis, Uroteuthis (Photololigo) duvauceli and Verticillium albo-atrum. This article also documents the addition of nine sequencing primer pairs and sixteen allele specific primers or probes for Oncorhynchus mykiss and Oncorhynchus tshawytscha; these primers and assays were cross-tested in both species. © 2009 Blackwell Publishing Ltd.

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

PubMed

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

Genetic diversity of Iranian honey bee (Apis mellifera meda Skorikow, 1829) populations based on ISSR markers.

PubMed

Rahimi, A; Mirmoayedi, A; Kahrizi, D; Zarei, L; Jamali, S

2016-04-30

Honey bee is one of the most important insects considering its role in agriculture,ecology and economy as a whole. In this study, the genetic diversity of different Iranian honey bee populations was evaluated using inter simple sequence repeat (ISSR) markers. During May to September 2014, 108 young worker honey bees were collected from six different populations in 30 different geoclimatic locations from Golestan, Mazendaran, Guilan, West Azerbaijan, East Azerbaijan, Ardebil provinces of Iran. DNA was extracted from the worker honey bees. The quality and quantity of extracted DNA were measured. A set of ten primers were screened with the laboratory populations of honey bees. The number of fragments produced in the different honey bee populations varied from 3 to 10, varying within 150 to 1500 bp. The used ten ISSR primers generated 40 polymorphic fragments, and the average heterozygosity for each primer was 0.266. Maximum numbers of bands were recorded for primer A1. A dendrogram based on the Unweighted Pair Group Method with Arithmetic mean (UPGMA) method generated two sub-clusters. Honey bee populations of Golestan, Mazendaran, Guilan provinces were located in the first group. The second group included honey bee populations of Ardebil, West Azerbaijan, East Azerbaijan provinces, but this group showed a close relationship with other populations. The results showed obviously the ability of the ISSR marker technique to detect the genetic diversity among the honey bee populations.

Standardized molecular diagnostic tool for the identification of cryptic species within the Bemisia tabaci complex.

PubMed

Elfekih, Samia; Tay, Wee Tek; Gordon, Karl; Court, Leon N; De Barro, Paul J

2018-01-01

The whitefly Bemisia tabaci complex harbours over 40 cryptic species that have been placed in 11 phylogenetically distinct clades based on the molecular characterization of partial mitochondrial DNA COI (mtCOI) gene region. Four cryptic species are currently within the invasive clade, i.e. MED, MEAM1, MEAM2 and IO. Correct identification of these species is a critical step towards implementing reliable measures for plant biosecurity and border protection; however, no standardized B. tabaci-specific primers are currently available which has caused inconsistencies in the species identification processes. We report three sets of polymerase chain reaction (PCR) primers developed to amplify the mtCOI region which can be used for genotyping MED, MEAM1 and IO species, and tested these primers on 91 MED, 35 MEAM1 and five IO individuals. PCR and sequencing of amplicons identified a total of 21, six and one haplotypes in MED, MEAM1 and IO respectively, of which six haplotypes were new to the B. tabaci database. These primer pairs enabled standardization and robust molecular species identification via mtCOI screening of the targeted invasive cryptic species and will improve quarantine decisions. Use of this diagnostic tool could be extended to other species within the complex. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Non-invasive assessment of parasitic nematode species diversity in wild Soay sheep using molecular markers.

PubMed

Wimmer, B; Craig, B H; Pilkington, J G; Pemberton, J M

2004-04-01

Considerable effort has been put into detecting and identifying parasitic nematodes in live ruminants, but to date most studies are limited to a small group of nematodes and/or to experimentally infected sheep. In this study, a PCR-based assay using species-specific primer pairs, located in the second internal transcribed spacer ribosomal DNA, was developed to identify nine different species from six different families of parasitic nematodes in a wild, unmanaged and naturally infected population of sheep. Each primer pair was tested for its specificity and sensitivity and it exclusively amplified the species it was designed for and exhibited a high degree of sensitivity. The method was applied to eggs and cultured larvae to identify the parasitic nematodes present in a pooled faecal sample from several host individuals with unknown parasite burden. To test detection reliability, a faecal sample from an individual with known parasite burden (through post-mortem analysis) was also examined. All species present could be correctly identified by PCR, but detecting very low levels and/or early stages of infection proved to be difficult. The method was also tested for its applicability to high through-put screening of faecal samples.

A nested multiplex polymerase chain reaction assay for the differential identification of three zooanthroponotic chlamydial strains in porcine swab samples.

PubMed

Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo

2011-07-01

Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.

Qualitative PCR method for Roundup Ready soybean: interlaboratory study.

PubMed

Kodama, Takashi; Kasahara, Masaki; Minegishi, Yasutaka; Futo, Satoshi; Sawada, Chihiro; Watai, Masatoshi; Akiyama, Hiroshi; Teshima, Reiko; Kurosawa, Yasunori; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2011-01-01

Quantitative and qualitative methods based on PCR have been developed for genetically modified organisms (GMO). Interlaboratory studies were previously conducted for GMO quantitative methods; in this study, an interlaboratory study was conducted for a qualitative method for a GM soybean, Roundup Ready soy (RR soy), with primer pairs designed for the quantitative method of RR soy studied previously. Fourteen laboratories in Japan participated. Each participant extracted DNA from 1.0 g each of the soy samples containing 0, 0.05, and 0.10% of RR soy, and performed PCR with primer pairs for an internal control gene (Le1) and RR soy followed by agarose gel electrophoresis. The PCR product amplified in this PCR system for Le1 was detected from all samples. The sensitivity, specificity, and false-negative and false-positive rates of the method were obtained from the results of RR soy detection. False-negative rates at the level of 0.05 and 0.10% of the RR soy samples were 6.0 and 2.3%, respectively, revealing that the LOD of the method was somewhat below 0.10%. The current study demonstrated that the qualitative method would be practical for monitoring the labeling system of GM soy in kernel lots.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

PubMed Central

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

PubMed

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

PubMed

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

Quantification of Azospirillum brasilense FP2 Bacteria in Wheat Roots by Strain-Specific Quantitative PCR.

PubMed

Stets, Maria Isabel; Alqueres, Sylvia Maria Campbell; Souza, Emanuel Maltempi; Pedrosa, Fábio de Oliveira; Schmid, Michael; Hartmann, Anton; Cruz, Leonardo Magalhães

2015-10-01

Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft genome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possible matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth conditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile conditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell numbers (∼10(7) CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used here can be applied to other organisms whose genome sequences are available. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Quantification of Azospirillum brasilense FP2 Bacteria in Wheat Roots by Strain-Specific Quantitative PCR

PubMed Central

Stets, Maria Isabel; Alqueres, Sylvia Maria Campbell; Souza, Emanuel Maltempi; Pedrosa, Fábio de Oliveira; Schmid, Michael

2015-01-01

Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft genome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possible matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth conditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile conditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell numbers (∼107 CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used here can be applied to other organisms whose genome sequences are available. PMID:26187960

A mass spectrometry-based multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification.

PubMed

Park, Jung Hun; Jang, Hyowon; Jung, Yun Kyung; Jung, Ye Lim; Shin, Inkyung; Cho, Dae-Yeon; Park, Hyun Gyu

2017-05-15

We herein describe a new mass spectrometry-based method for multiplex SNP genotyping by utilizing allele-specific ligation and strand displacement amplification (SDA) reaction. In this method, allele-specific ligation is first performed to discriminate base sequence variations at the SNP site within the PCR-amplified target DNA. The primary ligation probe is extended by a universal primer annealing site while the secondary ligation probe has base sequences as an overhang with a nicking enzyme recognition site and complementary mass marker sequence. The ligation probe pairs are ligated by DNA ligase only at specific allele in the target DNA and the resulting ligated product serves as a template to promote the SDA reaction using a universal primer. This process isothermally amplifies short DNA fragments, called mass markers, to be analyzed by mass spectrometry. By varying the sizes of the mass markers, we successfully demonstrated the multiplex SNP genotyping capability of this method by reliably identifying several BRCA mutations in a multiplex manner with mass spectrometry. Copyright © 2016 Elsevier B.V. All rights reserved.

Genetic study of kelp ``901'' strain

NASA Astrophysics Data System (ADS)

Xia, Peng; Wang, Xiuliang; Li, Xiaojie; Zhao, Yushan; Yao, Lin; Duan, Delin

2005-06-01

Based on DNA extraction and optimization of random amplified reaction (RAPD) to the gametophytes and sporophytes of Kelp “901” strain, genetic study on variation was conducted to its parents and offsprings of F6, F7, F8, and F9 generation. RAPD results have shown that among 30 selected primers for gametophytes, 297 loci ranging from 200 to 3 000 bp were obtained in the average of 9.9 loci for each primer. This indicated a high polymorphic rate with RAPD detection. UPGMA (unweighted pair-group method arithmetic average) analysis showed that each male and female gametophyte of a generation could be clustered into one pair separately. The genetic distances of the Kelp 901 generation were 0.3212 0.4767, and the maximum was between F7 and F8 (0.4767). Identity analysis showed that F6 generation was more close to the female parent (0.6593), and F7 generation was more close to the male parent (0.578 8). To the sporophytes study in 24 selected primers for RAPD amplification, 191 loci ranging from 230 2800 bp were obtained, in the average to each primer of 8.0 loci. The heterozygosity to six populations were male parent (0.2239), female parent (0.1072), F6 (0.2164), F7(0.2286), F8(0.2296) and F9(0.3172). The nearest genetic distance was 0.083 5(F8, F9). Total heterozygosity (HT) of F6, F7, F8 and F9 generations was 0.3186, the average heterozygosity (HS) for F6, F7, F8 and F9 generations was 0.2480, and deduced coefficient of population differentiation (Gst) was 22.2%. Six sequence characterized amplified regions (SCAR) were preliminary screened through RAPD analysis. It needed to be verified in detail as they are significant for molecular marker assistance in breeding and selecting Laminaria.

RNA Structural Analysis by Evolving SHAPE Chemistry

PubMed Central

Spitale, Robert C.; Flynn, Ryan A.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

2017-01-01

RNA is central to the flow of biological information. From transcription to splicing, RNA localization, translation, and decay, RNA is intimately involved in regulating every step of the gene expression program, and is thus essential for health and understanding disease. RNA has the unique ability to base-pair with itself and other nucleic acids to form complex structures. Hence the information content in RNA is not simply its linear sequence of bases, but is also encoded in complex folding of RNA molecules. A general chemical functionality that all RNAs have is a 2’-hydroxyl group in the ribose ring, and the reactivity of the 2'-hydroxyl in RNA is gated by local nucleotide flexibility. In other words, the 2'-hydroxyl is reactive at single-stranded and conformationally flexible positions but is unreactive at nucleotides constrained by base pairing. Recent efforts have been focused on developing reagents that modify RNA as a function of RNA 2’ hydroxyl group flexibility. Such RNA structure probing techniques can be read out by primer extension in experiments termed RNA SHAPE (Selective 2’ Hydroxyl Acylation and Primer Extension). Herein we describe the efforts devoted to the design and utilization of SHAPE probes for characterizing RNA structure. We also describe current technological advances that are being used to utilize SHAPE chemistry with deep sequencing to probe many RNAs in parallel. The merger of chemistry with genomics is sure to open the door to genome-wide exploration of RNA structure and function. PMID:25132067

[Oligonucleotide microarray for subtyping avian influenza virus].

PubMed

Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

2008-09-01

Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

DOE PAGES

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; ...

2015-03-31

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

PubMed Central

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai

2015-01-01

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995

The Role of SncN and Ski in Mammary Epithelial Cell Transformation

DTIC Science & Technology

2005-07-01

cellular activities through the Smad proteins. Upon phosphorylation by the active TGFβ receptor kinases, Smad2 and Smad3 oligomerize with Smad4, translocate...sequence in sense and antisense orientation with an intervening linker . Primer pairs were designed to generate single-strand overhangs upon annealing...nuclear protein, based on studies of ectopically expressed SnoN and endogenous SnoN in cancer cell lines. In the nucleus, SnoN binds to Smad2, Smad3 , and

DIFFERENTIATION OF SCHISTOSOMA HAEMATOBIUM FROM RELATED SCHISTOSOMES BY PCR AMPLIFYING AN INTER-REPEAT SEQUENCE

PubMed Central

ABBASI, IBRAHIM; KING, CHARLES H.; STURROCK, ROBERT F.; KARIUKI, CURTIS; MUCHIRI, ERIC; HAMBURGER, JOSEPH

2008-01-01

Schistosoma haematobium infects nearly 150 million people, primarily in Africa, and is transmitted by select species of local bulinid snails. These snails can host other related trematode species as well, so that effective detection and monitoring of snails infected with S. haematobium requires a successful differentiation between S. haematobium and any closely related schistosome species. To enable differential detection of S. haematobium DNA by simple polymerase chain reaction (PCR), we designed and tested primer pairs from numerous newly identified Schistosoma DNA repeat sequences. However, all pairs tested were found unsuitable for this purpose. Differentiation of S. haematobium from S. bovis, S. mattheei, S. curassoni, and S. intercalatum (but not from S. margrebowiei) was ultimately accomplished by PCR using one primer from a newly identified repeat, Sh110, and a second primer from a known schistosomal splice-leader sequence. For evaluation of residual S. haematobium transmission after control interventions, this differentiation tool will enable accurate monitoring of infected snails in areas where S. haematobium is sympatric with the most prevalent other schistosome species. PMID:17488921

A rapid method for differentiating Saccharomyces sensu stricto strains from other yeast species in an enological environment.

PubMed

Nardi, Tiziana; Carlot, Milena; De Bortoli, Elena; Corich, Viviana; Giacomini, Alessio

2006-11-01

During programs for the selection of enological yeasts, several hundred natural isolates are usually screened. The scope of these operations is to isolate strains possessing good fermentative properties without necessarily arriving at a precise species designation: in other words, to detect strains belonging to the Saccharomyces sensu stricto complex. In the present study, a pair of primers, designed within the variable D1/D2 region of the 26S subunit of ribosomal yeast RNA, have been constructed. These generate an amplification fragment of 471 bp that is specific for the seven Saccharomyces sensu stricto species, while no signal was obtained for Saccharomyces sensu lato strains (17 species) or for another 18 selected species commonly found in enological environments. A second pair of primers was also constructed, within the 18S rRNA gene, composed of perfectly conserved sequences common for all 42 yeast species examined, which generate a 900 bp (c.) band for all strains. This was used as a positive experimental control in multiplex PCR analysis using all four primers.

Mining and characterization of EST-SSR markers for Zingiber officinale Roscoe with transferability to other species of Zingiberaceae.

PubMed

Awasthi, Praveen; Singh, Ashish; Sheikh, Gulfam; Mahajan, Vidushi; Gupta, Ajai Prakash; Gupta, Suphla; Bedi, Yashbir S; Gandhi, Sumit G

2017-10-01

Zingiber officinale is a model spice herb, well known for its medicinal value. It is primarily a vegetatively propagated commercial crop. However, considerable diversity in its morphology, fiber content and chemoprofiles has been reported. The present study explores the utility of EST-derived markers in studying genetic diversity in different accessions of Z. officinale and their cross transferability within the Zingiberaceae family. A total of 38,115 ESTs sequences were assembled to generate 7850 contigs and 10,762 singletons. SSRs were searched in the unigenes and 515 SSR-containing ESTs were identified with a frequency of 1 SSR per 25.21 kb of the genome. These ESTs were also annotated using BLAST2GO. Primers were designed for 349 EST-SSRs and 25 primer pairs were randomly picked for EST SSR study. Out of these, 16 primer pairs could be optimized for amplification in different accessions of Z. officinale as well as other species belonging to Zingiberaceae. GES454, GES466, GES480 and GES486 markers were found to exhibit 100% cross-transferability among different members of Zingiberaceae.

Isolation of novel microsatellite markers and their application for genetic diversity and parentage analyses in sika deer.

PubMed

Yang, Wanyun; Zheng, Junjun; Jia, Boyin; Wei, Haijun; Wang, Guiwu; Yang, Fuhe

2018-02-15

Every part of the sika deer (Cervus nippon) body is valuable traditional Chinese medicine. And sika deer is the most important semi-domestic medicinal animal that is widely bred in Jilin province northeast of China. But few studies had been conducted to characterize the microsatellite markers derived from sika deer. We firstly used IlluminaHiSeq™2500 sequencing technology obtained 125Mbp genomic data of sika deer. Using microsatellite identification tool (MISA), 22,479 microsatellites were identified. From these data, 100 potential primers were selected for further polymorphic validation, finally, 76 primer pairs were successfully amplified and 29 primer pairs were found to be obvious polymorphic in 8 different individuals. Using those polymorphic microsatellite markers, we analyzed the genetic diversity of Jilin sika deer population. The mean number of alleles of the 29 loci is 9.31 based on genotyping blood DNA from 96 Jilin sika deer; The mean expected heterozygosity and polymorphic information content (PIC) value of the 29 loci is 0.72 and 0.68 respectively, and among which 26 loci are highly polymorphic (PIC>0.50). According to the electrophoretic results and PIC value of these 29 loci, 10 loci with combined paternity exclusion probabilities>99.99% were selected to use in parentage verification for 16 sika deer. All the offspring of a family could be successfully assigned to their biological father. These microsatellite markers generated in this study could greatly facilitate future studies of molecular breeding in sika deer. Copyright © 2017 Elsevier B.V. All rights reserved.

De novo characterization of Larimichthys crocea transcriptome for growth-/immune-related gene identification and massive microsatellite (SSR) marker development

NASA Astrophysics Data System (ADS)

Han, Zhaofang; Xiao, Shijun; Liu, Xiande; Liu, Yang; Li, Jiakai; Xie, Yangjie; Wang, Zhiyong

2017-03-01

The large yellow croaker, Larimichthys crocea is an important marine fish in China with a high economic value. In the last decade, the stock conservation and aquaculture industry of this species have been facing severe challenges because of wild population collapse and degeneration of important economic traits. However, genes contributing to growth and immunity in L. crocea have not been thoroughly analyzed, and available molecular markers are still not sufficient for genetic resource management and molecular selection. In this work, we sequenced the transcriptome in L. crocea liver tissue with a Roche 454 sequencing platform and assembled the transcriptome into 93 801 transcripts. Of them, 38 856 transcripts were successfully annotated in nt, nr, Swiss-Prot, InterPro, COG, GO and KEGG databases. Based on the annotation information, 3 165 unigenes related to growth and immunity were identified. Additionally, a total of 6 391 simple sequence repeats (SSRs) were identified from the transcriptome, among which 4 498 SSRs had enough flanking regions to design primers for polymerase chain reactions (PCR). To access the polymorphism of these markers, 30 primer pairs were randomly selected for PCR amplification and validation in 30 individuals, and 12 primer pairs (40.0%) exhibited obvious length polymorphisms. This work applied RNA-Seq to assemble and analyze a live transcriptome in L. crocea. With gene annotation and sequence information, genes related to growth and immunity were identified and massive SSR markers were developed, providing valuable genetic resources for future gene functional analysis and selective breeding of L. crocea.

Microsatellites for the genus Cucurbita and an SSR-based genetic linkage map of Cucurbita pepo L.

PubMed Central

Gong, L.; Stift, G.; Kofler, R.; Pachner, M.

2008-01-01

Until recently, only a few microsatellites have been available for Cucurbita, thus their development is highly desirable. The Austrian oil-pumpkin variety Gleisdorfer Ölkürbis (C. pepo subsp. pepo) and the C. moschata cultivar Soler (Puerto Rico) were used for SSR development. SSR-enriched partial genomic libraries were established and 2,400 clones were sequenced. Of these 1,058 (44%) contained an SSR at least four repeats long. Primers were designed for 532 SSRs; 500 primer pairs produced fragments of expected size. Of these, 405 (81%) amplified polymorphic fragments in a set of 12 genotypes: three C. moschata, one C. ecuadorensis, and eight C. pepo representing all eight cultivar groups. On an average, C. pepo and C. moschata produced 3.3 alleles per primer pair, showing high inter-species transferability. There were 187 SSR markers detecting polymorphism between the USA oil-pumpkin variety “Lady Godiva” (O5) and the Italian crookneck variety “Bianco Friulano” (CN), which are the parents of our previous F2 mapping population. It has been used to construct the first published C. pepo map, containing mainly RAPD and AFLP markers. Now the updated map comprises 178 SSRs, 244 AFLPs, 230 RAPDs, five SCARs, and two morphological traits (h and B). It contains 20 linkage groups with a map density of 2.9 cM. The observed genome coverage (Co) is 86.8%. Electronic supplementary material The online version of this article (doi:10.1007/s00122-008-0750-2) contains supplementary material, which is available to authorized users. PMID:18379753

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Development of a rapid, sensitive and specific diagnostic assay for fish Aquareovirus based on RT-PCR.

PubMed

Seng, E K; Fang, Q; Lam, T J; Sin, Y M

2004-06-15

A rapid, sensitive and highly specific detection method for Aquareovirus based on reverse-transcription polymerase chain reaction (RT-PCR) was developed. Based on multiple sequence alignment of the cloned sequences of a local isolates, the Threadfin reovirus (TFV) and Guppy reovirus (GPV) with Grass carp reovirus (GCRV), a pair of degenerate primers was selected carefully and synthesized. Using this primer combination, only one specific product, approximately 450 bp in length was obtained when RT-PCR was carried out using the genomic double-stranded RNA (dsRNA) of TFV, GPV and GCRV. Similar results were also obtained when Chum salmon reovirus (CSRV) and Striped bass reovirus (SBRV) dsRNA were used as templates. No products were observed when nucleic acids other than the dsRNA of the aquareoviruses described above were used as RT-PCR templates. This technique could detect not only TFV but also GPV and GCRV in low titer virus-infected cell cultured cells. Furthermore, this method has also been shown to be able to diagnose GPV-infected guppy (Poecilia reticulata) that exhibit clinical symptoms as well as GPV-carrier guppy. Collectively, these results showed that the RT-PCR amplification method using specific degenerate primers described below is very useful for rapid and accurate detection of a variety of aquareovirus strains isolated from different host species and origin.

Relatedness of Indian flax genotypes (Linum usitatissimum L.): an inter-simple sequence repeat (ISSR) primer assay.

PubMed

Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S

2010-06-01

The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations.

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

PubMed

Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

2015-08-01

Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Inheritance of microsatellite loci in the polyploid lake sturgeon (Acipenser fulvescens)

USGS Publications Warehouse

Pyatskowit, J.D.; Krueger, C.C.; Kincaid, H.L.; May, B.

2001-01-01

Inheritance in the expression of amplicons for four microsatellite primer pairs was determined using 10 families created from gametes of wild lake sturgeon (Acipenser fulvescens). Loci Afu34 and Afu68 expressed a maximum of two even-intensity bands per individual and had progeny genotype ratios that fit disomic inheritance (P > 0.05). Some variation exhibited at Afu34 and Afu68 was attributable to a null allele. Genotype expression at both loci also indicated that one female parent had transmitted unreduced gametes. Primer Afu39 amplified products that exhibited four gene doses, where genotype counts fit expected ratios for disomic inheritance (P > 0.05) indicating amplification of products from two disomic loci that share alleles. Meiotic drive was evident at the Afu39 loci based on a test for random segregation (P < 0.05). Only the expression of Afu19 gave evidence of tetrasomic inheritance based on a single progeny potentially produced by a double reduction gamete. No evidence for proposed octoploid inheritance was observed.

High-Resolution Melting (HRM) of the Cytochrome B Gene: A Powerful Approach to Identify Blood-Meal Sources in Chagas Disease Vectors

PubMed Central

Peña, Victor H.; Fernández, Geysson J.; Gómez-Palacio, Andrés M.; Mejía-Jaramillo, Ana M.; Cantillo, Omar; Triana-Chávez, Omar

2012-01-01

Methods to determine blood-meal sources of hematophagous Triatominae bugs (Chagas disease vectors) are serological or based on PCR employing species-specific primers or heteroduplex analysis, but these are expensive, inaccurate, or problematic when the insect has fed on more than one species. To solve those problems, we developed a technique based on HRM analysis of the mitochondrial gene cytochrome B (Cyt b). This technique recognized 14 species involved in several ecoepidemiological cycles of the transmission of Trypanosoma cruzi and it was suitable with DNA extracted from intestinal content and feces 30 days after feeding, revealing a resolution power that can display mixed feedings. Field samples were analyzed showing blood meal sources corresponding to domestic, peridomiciliary and sylvatic cycles. The technique only requires a single pair of primers that amplify the Cyt b gene in vertebrates and no other standardization, making it quick, easy, relatively inexpensive, and highly accurate. PMID:22389739

Review of Detection of Brucella sp. by Polymerase Chain Reaction

PubMed Central

Yu, Wei Ling; Nielsen, Klaus

2010-01-01

Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

Rapid combined assay for Salmonella detection in food samples.

PubMed

Gadó, I; Major, P; Király, M; Pláveczky, M G

2000-01-01

A rapid method was developed to detect salmonellae in food samples. The method gave a possibility to obtain results after 28 h 30 min. The preenrichment in buffered peptone water lasted for 6 h, the enrichment in Rappaport-Vassiliadis medium was applied for 18 h followed by PCR with INVA1-INVA2 primer pair, adapting Chiu and Ou's method. This procedure was suitable to demonstrate salmonella contamination at min. 10 cfu/25 g sample. Out of 18 samples there was a good agreement between the results of the conventional and rapid methods in case of 17 samples. PCR with SPVC1-SPVC2 primer pair informing about the presence of virulence plasmid was performed in separate tubes, because decreased sensitivity was observed in case of multiplex PCR.

In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

NASA Astrophysics Data System (ADS)

Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

2016-03-01

Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

PubMed Central

Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

2016-01-01

Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

PubMed

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-10-21

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

Assessment of genetic diversity in lettuce (Lactuca sativa L.) germplasm using RAPD markers.

PubMed

Sharma, Shubhangi; Kumar, Pankaj; Gambhir, Geetika; Kumar, Ramesh; Srivastava, D K

2018-01-01

The importance of germplasm characterization is an important link between the conservation and utilization of plant genetic resources in various breeding programmes. In the present study, genetic variability and relationships among 25 Lactuca sativa L. genotypes were tested using random amplified polymorphic DNA (RAPD) molecular markers. A total of 45 random decamer oligonucleotide primers were examined to generate RAPD profiles, out of these reproducible patterns were obtained with 22 primers. A total of 87 amplicon were obtained, out of which all were polymorphic and 7 were unique bands. The level of polymorphism across genotypes was 100% as revealed by RAPD. Genetic similarity matrix, based on Jaccard's coefficients ranged from 13.7 to 84.10% indicating a wide genetic base. Dendrogram was constructed by unweighted pair group method with arithmetic averages method. RAPD technology could be useful for identification of different accessions as well as assessing the genetic similarity among different genotypes of lettuce. The study reveals the limited genetic base and the needs to diversify using new sources from the germplasm.

Genetic Diversity of Pinus Roxburghii Sarg. Collected from Different Himalayan Regions of India Assessed by Random Amplified Polymorphic DNA Analysis

PubMed Central

Sinha, Dwaipayan; Singh, Jyotsna; Tandon, P. K.; Kakkar, Poonam

2013-01-01

Present study was aimed at molecular genetic fingerprint profile of 15 genotypes of three populations of Pinus roxburghii Sarg. from Himalayan regions of India using random amplified polymorphic DNA (RAPD) based markers. Needles of Pinus roxburghii Sarg. were collected from Dharamshala, Himachal Pradesh (HP), Nainital, Uttarakhand (UK) and Darjeeling, West Bengal (WB) regions of India. The samples were subjected to DNA extraction and RAPD analysis using oligonucleotide purification cartridge (OPC) primers. Out of 15 primers tested, nine primers gave scorable bands. Altogether 48 bands were obtained, out of which 43 were found to be polymorphic. Number of amplified fragments with RAPD primers ranged from four to eight with the size of amplicon ranging from 500 to 7,000bp. Investigation of natural diversity at intraspecies level was performed with 15 genotypes. Forty-eight amplification products were scored by RAPD and showed 89.58% polymorphism with a mean intrapopulation genetic diversity (Hpop) of 0.2754. A significant inter- and intrapopulation diversity was observed, with the percentage of polymorphic loci (Pp) ranging from 50.09 to 70.83%, Shannon's information index (I) from 0.3262 to 0.4689 and Nei's gene diversity (h) from 0.2032 to 0.3335 with mean Nei's gene diversity 0.377 and the overall estimate of gene flow being (Nm) 1.3555. Unweighted pair-group method with arithmetic average (UPGMA) analysis based Dendrogram showed single cluster. The variation amongst the samples of the three ecological regions can be attributed to varied climatic conditions and may help in conservation/future cultivation of these species. PMID:24403729

Development of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae.

PubMed

Liu, Hailan; Guo, Xiaoqin; Wu, Jiasheng; Chen, Guo-Bo; Ying, Yeqing

2013-03-01

KEY MESSAGE : We develop a set of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae. Being evolutionary conserved, single-copy orthologous (COSII) genes are particularly useful in comparative mapping and phylogenetic investigation among species. In this study, we identified 2,684 COSII genes based on five sequenced Poaceae genomes including rice, maize, sorghum, foxtail millet, and brachypodium, and then developed 1,072 COSII markers whose transferability and polymorphism among five bamboo species were further evaluated with 46 pairs of randomly selected primers. 91.3 % of the 46 primers obtained clear amplification in at least one bamboo species, and 65.2 % of them produced polymorphism in more than one species. We also used 42 of them to construct the phylogeny for the five bamboo species, and it might reflect more precise evolutionary relationship than the one based on the vegetative morphology. The results indicated a promising prospect of applying these markers to the investigation of genetic diversity and the classification of Poaceae. To ease and facilitate access of the information of common interest to readers, a web-based database of the COSII markers is provided ( http://www.sicau.edu.cn/web/yms/PCOSWeb/PCOS.html ).

[Analysis on genetic polymorphism of 5 STR loci selected from X chromosome].

PubMed

Liu, Qi-ji; Gong, Yao-qin; Zhang, Xi-yu; Gao, Gui-min; Li, Jiang-xia; Guo, Yi-shou

2005-02-01

To select short tandem repeats(STR) from X chromosome. STR is a universal genetic marker that has changeable polymorphism and stable heredity in human genome. It is a specific DNA segment composed of 2-6 base pairs as its core sequence. It is an ideal DNA marker used in linkage analysis and gene mapping. In this study, 8 short tandem repeats were selected from two genomic clones on X chromosome by using BCM Search Launcher. Primers amplifying the STR loci were designed by using Primer 3.0 according to the unique sequence flanking the STRs. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five of these STRs were polymorphic. Chi-square test indicated that the distribution of genotypes agreed with Hardy-Weinberg equilibrium (P>0.05). Five polymorphic short tandem repeats have been identified on chromosome X and will be useful for linkage analysis and gene mapping.

A full-coordinate model of the polymerase domain of HIV-1 reverse transcriptase and its interaction with a nucleic acid substrate

NASA Technical Reports Server (NTRS)

Setlik, R. F.; Meyer, D. J.; Shibata, M.; Roskwitalski, R.; Ornstein, R. L.; Rein, R.

1994-01-01

We present a full-coordinate model of residues 1-319 of the polymerase domain of HIV-I reverse transcriptase. This model was constructed from the x-ray crystallographic structure of Jacobo-Molina et al. (Jacobo-Molina et al., P.N.A.S. USA 90, 6320-6324 (1993)) which is currently available to the degree of C-coordinates. The backbone and side-chain atoms were constructed using the MAXSPROUT suite of programs (L. Holm and C. Sander, J. Mol. Biol. 218, 183-194 (1991)) and refined through molecular modeling. A seven base pair A-form dsDNA was positioned in the nucleic acid binding cleft to represent the template-primer complex. The orientation of the template-primer complex in the nucleic acid binding cleft was guided by the positions of phosphorus atoms in the crystal structure.

Isolation and characterization of 30 microsatellite loci for Cunninghamia lanceolata (Taxodiaceae)1

PubMed Central

Wang, Si-Si; Zhang, Yang; Liu, De-Chen; Sun, Xiao-Wei; Wang, Rong; Li, Yuan-Yuan

2017-01-01

Premise of the study: To quantify the population-level genetic characteristics of Cunninghamia lanceolata (Taxodiaceae), an important timber conifer, we developed 30 pairs of microsatellite primers based on the nuclear genome. Methods and Results: Using the streptavidin-biotin capture system, we developed 14 polymorphic and 16 monomorphic microsatellites. Polymorphisms were detected in 14 loci using 94 individual trees that were collected from three C. lanceolata populations in Hubei and Zhejiang provinces and in Chongqing Municipality, China. There were three to 30 alleles per locus, and the observed and expected heterozygosities ranged from 0.0313–0.8333 and from 0.0313–0.9246, respectively. Cross-species amplification showed that two to seven polymorphic loci were functional in three of the five related species that were collected. Conclusions: Our newly developed microsatellite primers provide neutral molecular markers that are beneficial to future studies of population genetics and germplasm conservation of C. lanceolata. PMID:28989826

Coordinated DNA dynamics during the human telomerase catalytic cycle

NASA Astrophysics Data System (ADS)

Parks, Joseph W.; Stone, Michael D.

2014-06-01

The human telomerase reverse transcriptase (hTERT) utilizes a template within the integral RNA subunit (hTR) to direct extension of telomeres. Telomerase exhibits repeat addition processivity (RAP) and must therefore translocate the nascent DNA product into a new RNA:DNA hybrid register to prime each round of telomere repeat synthesis. Here, we use single-molecule FRET and nuclease protection assays to monitor telomere DNA structure and dynamics during the telomerase catalytic cycle. DNA translocation during RAP proceeds through a previously uncharacterized kinetic substep during which the 3‧-end of the DNA substrate base pairs downstream within the hTR template. The rate constant for DNA primer realignment reveals this step is not rate limiting for RAP, suggesting a second slow conformational change repositions the RNA:DNA hybrid into the telomerase active site and drives the extrusion of the 5‧-end of the DNA primer out of the enzyme complex.

Development and characterization of EST-SSR markers for Begonia luzhaiensis (Begoniaceae)1

PubMed Central

Tseng, Yu-Hsin; Huang, Han-Yau; Xu, Wei-Bin; Yang, Hsun-An; Liu, Yan; Peng, Ching-I; Chung, Kuo-Fang

2017-01-01

Premise of the study: Microsatellite primers were developed for Begonia luzhaiensis (Begoniaceae) to assess genetic diversity and population genetic structure. Methods and Results: Based on the transcriptome data of B. luzhaiensis, 60 primer pairs were selected for initial validation, of which 16 yielded polymorphic microsatellite loci in 57 individuals. The number of alleles observed for these 16 loci ranged from one to nine. The observed and expected heterozygosity ranged from 0.000 to 1.000 and from 0.000 to 0.804 with averages of 0.370 and 0.404, respectively. Five loci could be successfully amplified in B. leprosa. Conclusions: The expressed sequence tag–simple sequence repeat markers are the first specifically developed for B. luzhaiensis and the first developed in Begonia sect. Coelocentrum. These markers will be useful for future studies of the genetic structure and phylogeography of B. luzhaiensis. PMID:28529834

Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

PubMed

Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

2016-07-01

The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

[Genetic diversity of wild Cynodon dactylon germplasm detected by SRAP markers].

PubMed

Yi, Yang-Jie; Zhang, Xin-Quan; Huang, Lin-Kai; Ling, Yao; Ma, Xiao; Liu, Wei

2008-01-01

Sequence-related amplified polymorphism (SRAP) molecular markers were used to detect the genetic diversity of 32 wild accessions of Cynodon dactylon collected from Sichuan, Chongqing, Guizhou and Tibet, China. The following results were obtained. (1) Fourteen primer pairs produced 132 polymorphic bands, averaged 9.4 bands per primer pair. The percentage of polymorphic bands in average was 79.8%. The Nei's genetic similarity coefficient of the tested accessions ranged from 0.591 to 0.957, and the average Nei's coefficient was 0.759. These results suggested that there was rich genetic diversity among the wild resources of Cynodon dactylon tested. (2) Thirty two wild accessions were clustered into four groups. Moreover, the accessions from the same origin frequently clustered into one group. The findings implied that a correlation among the wild resources, geographical and ecological environment. (3) Genetic differentiation between and within six eco-geographical groups of C. dactylon was estimated by Shannon's diversity index, which showed that 65.56% genetic variance existed within group, and 34.44% genetic variance was among groups. (4) Based on Nei's unbiased measures of genetic identity, UPGMA cluster analysis measures of six eco-geographical groups of Cynodon dactylon, indicated that there was a correlation between genetic differentiation and eco-geographical habits among the groups.

Two EST-derived marker systems for cultivar identification in tree peony.

PubMed

Zhang, J J; Shu, Q Y; Liu, Z A; Ren, H X; Wang, L S; De Keyser, E

2012-02-01

Tree peony (Paeonia suffruticosa Andrews), a woody deciduous shrub, belongs to the section Moutan DC. in the genus of Paeonia of the Paeoniaceae family. To increase the efficiency of breeding, two EST-derived marker systems were developed based on a tree peony expressed sequence tag (EST) database. Using target region amplification polymorphism (TRAP), 19 of 39 primer pairs showed good amplification for 56 accessions with amplicons ranging from 120 to 3,000 bp long, among which 99.3% were polymorphic. In contrast, 7 of 21 primer pairs demonstrated adequate amplification with clear bands for simple sequence repeats (SSRs) developed from ESTs, and a total of 33 alleles were found in 56 accessions. The similarity matrices generated by TRAP and EST-SSR markers were compared, and the Mantel test (r = 0.57778, P = 0.0020) showed a moderate correlation between the two types of molecular markers. TRAP markers were suitable for DNA fingerprinting and EST-SSR markers were more appropriate for discriminating synonyms (the same cultivars with different names due to limited information exchanged among different geographic areas). The two sets of EST-derived markers will be used further for genetic linkage map construction and quantitative trait locus detection in tree peony.

Genomic typing of canine parvovirus circulating in the State of Rio de Janeiro, Brazil from 1995 to 2001 using polymerase chain reaction assay.

PubMed

Costa, A P; Leite, J P G; Labarthe, N V; Garcia, R C N Cubel

2005-11-01

In this study, the genomic types of canine parvovirus (CPV) circulating in the State of Rio de Janeiro, Brazil, from 1995 to 2001, were investigated using the polymerase chain reaction assay (PCR). A total of 78 faecal samples from gastroenteritic puppies, confirmed as positive for canine parvovirus by haemagglutination/haemagglutination inhibition tests or virus isolation in cell culture (MDCK), were examined. The viral DNA was extracted from faecal samples using a combination of phenol- chloroform and silica-guanidine thiocyanate methods. PCR was carried out with differential pairs of primers to distinguish the old (CPV-2) and new types of virus (CPv-2a or CPV-2b). Specific amplicons were observed for all samples using the primer pair P2ab, which detects CPV-2a and CPV-2b. Seventy-six from a total of 78 samples (97%) were considered as CPV-2b because of their reaction with the primer pair P2b. Thirty samples (30/78) were from previously vaccinated puppies and in 15 of them the enteritis symptoms began from 1 to 12 days after vaccination. PCR confirmed the infection by wild virus (CPV-2b) in 5 of these 15 puppies who had received old-type vaccines. Our results show that CPV-2b was the prevalent type circulating in the State of Rio de Janeiro from 1995 to 2001.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

PubMed

Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

2010-05-01

A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

Start codon targeted (SCoT) and target region amplification polymorphism (TRAP) for evaluating the genetic relationship of Dendrobium species.

PubMed

Feng, Shangguo; He, Refeng; Yang, Sai; Chen, Zhe; Jiang, Mengying; Lu, Jiangjie; Wang, Huizhong

2015-08-10

Two molecular marker systems, start codon targeted (SCoT) and target region amplification polymorphism (TRAP), were used for genetic relationship analysis of 36 Dendrobium species collected from China. Twenty-two selected SCoT primers produced 337 loci, of which 324 (96%) were polymorphic, whereas 13 TRAP primer combinations produced a total of 510 loci, with 500 (97.8%) of them being polymorphic. An average polymorphism information content of 0.953 and 0.983 was detected using the SCoT and TRAP primers, respectively, showing that a high degree of genetic diversity exists among Chinese Dendrobium species. The partition of clusters in the unweighted pair group method with arithmetic mean dendrogram and principal coordinate analysis plot based on the SCoT and TRAP markers was similar and clustered the 36 Dendrobium species into four main groups. Our results will provide useful information for resource protection and will also be useful to improve the current Dendrobium breeding programs. Our results also demonstrate that SCoT and TRAP markers are informative and can be used to evaluate genetic relationships between Dendrobium species. Copyright © 2015 Elsevier B.V. All rights reserved.

Isolation, characterization, and development of WRKY genes as useful genetic markers in Theobroma cacao.

PubMed

Borrone, James W; Kuhn, David N; Schnell, Raymond J

2004-08-01

There is currently an international effort in improving disease resistance and crop yield in Theobroma cacao L., an economically important crop of the tropics, using marker-assisted selection for breeding. We are developing molecular genetic markers focusing upon gene families involved with disease resistance. One such family is the WRKY proteins, which are plant-specific transcriptional factors associated with regulating defense responses to both abiotic and biotic stresses. Degenerate PCR primers were designed to the highly conserved DNA-binding domain and other conserved motifs of group I and group II, subgroups a-c, WRKY genes. Sixteen individual WRKY fragments were isolated from a mixture of T. cacao DNA using one pair of primers. Of the 16 WRKY loci investigated, seven contained single nucleotide polymorphisms within the intron as detected by sequence comparison of the PCR products. Four of these were successfully converted into molecular markers and mapped in an F2 population by capillary electrophoresis-single strand conformation polymorphism analysis. This is the first report of a pair of degenerate primers amplifying WRKY loci directly from genomic DNA and demonstrates a simple method for developing useful genetic markers from members of a large gene family. Copyright 2004 Springer-Verlag

Robust Detection of Rare Species Using Environmental DNA: The Importance of Primer Specificity

PubMed Central

Wilcox, Taylor M.; McKelvey, Kevin S.; Young, Michael K.; Jane, Stephen F.; Lowe, Winsor H.; Whiteley, Andrew R.; Schwartz, Michael K.

2013-01-01

Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method’s sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design. PMID:23555689

RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

NASA Astrophysics Data System (ADS)

Wang, Tiegu; Huang, Qunce; Feng, Weisen

2007-10-01

Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

Robust detection of rare species using environmental DNA: the importance of primer specificity.

PubMed

Wilcox, Taylor M; McKelvey, Kevin S; Young, Michael K; Jane, Stephen F; Lowe, Winsor H; Whiteley, Andrew R; Schwartz, Michael K

2013-01-01

Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design.

Robotic Enrichment Processing of Roche 454 Titanium Emlusion PCR at the DOE Joint Genome Institute

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamilton, Matthew; Wilson, Steven; Bauer, Diane

2010-05-28

Enrichment of emulsion PCR product is the most laborious and pipette-intensive step in the 454 Titanium process, posing the biggest obstacle for production-oriented scale up. The Joint Genome Institute has developed a pair of custom-made robots based on the Microlab Star liquid handling deck manufactured by Hamilton to mediate the complexity and ergonomic demands of the 454 enrichment process. The robot includes a custom built centrifuge, magnetic deck positions, as well as heating and cooling elements. At present processing eight emulsion cup samples in a single 2.5 hour run, these robots are capable of processing up to 24 emulsion cupmore » samples. Sample emulsions are broken using the standard 454 breaking process and transferred from a pair of 50ml conical tubes to a single 2ml tube and loaded on the robot. The robot performs the enrichment protocol and produces beads in 2ml tubes ready for counting. The robot follows the Roche 454 enrichment protocol with slight exceptions to the manner in which it resuspends beads via pipette mixing rather than vortexing and a set number of null bead removal washes. The robotic process is broken down in similar discrete steps: First Melt and Neutralization, Enrichment Primer Annealing, Enrichment Bead Incubation, Null Bead Removal, Second Melt and Neutralization and Sequencing Primer Annealing. Data indicating our improvements in enrichment efficiency and total number of bases per run will also be shown.« less

E-microsatellite markers for Centella asiatica (Gotu Kola) genome: validation and cross-transferability in Apiaceae family for plant omics research and development.

PubMed

Sahu, Jagajjit; Das Talukdar, Anupam; Devi, Kamalakshi; Choudhury, Manabendra Dutta; Barooah, Madhumita; Modi, Mahendra Kumar; Sen, Priyabrata

2015-01-01

Abstract Centella asiatica (Gotu Kola) is a plant that grows in tropical swampy regions of the world and has important medicinal and culinary use. It is often considered as part of Ayurvedic medicine, traditional African medicine, and traditional Chinese medicine. The unavailability of genomics resources is significantly impeding its genetic improvement. To date, no attempt has been made to develop Expressed Sequence Tags (ESTs) derived Simple Sequence Repeat (SSR) markers (eSSRs) from the Centella genome. Hence, the present study aimed to develop eSSRs and their further experimental validation and cross-transferability of these markers in different genera of the Apiaceae family to which Centella belongs. An in-house pipeline was developed for the entire analyses by combining bioinformatics tools and perl scripts. A total of 4443 C. asiatica EST sequences from dbEST were processed, which generated 2617 nonredundant high quality EST sequences consisting 441 contigs and 2176 singletons. Out of 1776.5 kb of examined sequences, 417 (15.9%) ESTs containing 686 SSRs were detected with a density of one SSR per 2.59 kb. The gene ontology study revealed 282 functional domains involved in various processes, components, and functions, out of which 64 ESTs were found to have both SSRs and functional domains. Out of 603 designed EST-SSR primers, 18 pairs of primers were selected for validation based on the optimum parameter value. Reproducible amplification was obtained for six primer pairs in C. asiatica that were further tested for cross-transferability in nine other important genera/species of the Apiaceae family. Cross-transferability of the EST-SSR markers among the species were examined and Centella javanica showed highest transferability (83.3%). The study revealed six highly polymorphic EST-SSR primers with an average PIC value of 0.95. In conclusion, these EST-SSR markers hold a big promise for the genomics analysis of Centella asiatica, to facilitate comparative map-based analyses across other related species within the Apiaceae family, and future marker-assisted breeding programs. To the best of our knowledge, this is the first report of development of EST-SSRs in Centella asiatica by in silico approaches, which offers a veritable potential in further use in plant omics research and development.

Analysis of sequence diversity through internal transcribed spacers and simple sequence repeats to identify Dendrobium species.

PubMed

Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y

2014-04-08

The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.

Determination of genetic diversity among Saccharina germplasm using ISSR and RAPD markers.

PubMed

Cui, Cuiju; Li, Yan; Liu, Yanling; Li, Xiaojie; Luo, Shiju; Zhang, Zhuangzhi; Wu, Ruina; Liang, Guangjin; Sun, Juan; Peng, Jie; Tian, Pingping

2017-02-01

Various species of genus Saccharina are economically important brown macroalgae cultivated in China. The genetic background of the conserved Saccharina germplasm was not clear. In this report, DNA-based molecular markers such as inter simple sequence repeats (ISSR) and random amplified polymorphic DNA (RAPD) were used to assess the genetic diversity and phylogenetic relationships among 48 Saccharina germplasms. A total of 50 ISSR and 50 RAPD primers were tested, of which only 33 polymorphic primers (17 ISSR and 16 RAPD) had an amplified clear and reproducible profile, and could be used. Seventeen ISSR primers yielded a total of 262 bands, of which 256 were polymorphic, and 15.06 polymorphic bands per primer were amplified from 48 kelp gametophytes. Sixteen RAPD primers produced 355 bands, of which 352 were polymorphic, and 22 polymorphic bands per primer were observed across 48 individuals. The simple matching coefficient of ISSR, RAPD and pooled ISSR and RAPD dendrograms ranged from 0.568 to 0.885, 0.670 to 0.873, and 0.667 to 0.862, revealing high genetic diversity. Based on the unweighted pair group method with the arithmetic averaging algorithm (UPGMA) cluster analysis and the principal components analysis (PCA) of ISSR data, the 48 gametophytes were divided into three main groups. The Mantel test revealed a similar polymorphism distribution pattern between ISSR and RAPD markers, the correlation coefficient r was 0.62, and the results indicated that both ISSR and RAPD markers were effective to assess the selected gametophytes, while matrix correlation of the ISSR marker system (r=0.78) was better than that of the RAPD marker system (r=0.64). Genetic analysis data from this study were helpful in understanding the genetic relationships among the selected 17 kelp varieties (or lines) and provided guidance for molecular-assisted selection for parental gametophytes of hybrid kelp breeding. Copyright © 2016 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

Genetic diversity and gene differentiation among ten species of Zingiberaceae from Eastern India.

PubMed

Mohanty, Sujata; Panda, Manoj Kumar; Acharya, Laxmikanta; Nayak, Sanghamitra

2014-08-01

In the present study, genetic fingerprints of ten species of Zingiberaceae from eastern India were developed using PCR-based markers. 19 RAPD (Rapid Amplified polymorphic DNA), 8 ISSR (Inter Simple Sequence Repeats) and 8 SSR (Simple Sequence Repeats) primers were used to elucidate genetic diversity important for utilization, management and conservation. These primers produced 789 loci, out of which 773 loci were polymorphic (including 220 unique loci) and 16 monomorphic loci. Highest number of bands amplified (263) in Curcuma caesia whereas lowest (209) in Zingiber cassumunar. Though all the markers discriminated the species effectively, analysis of combined data of all markers resulted in better distinction of individual species. Highest number of loci was amplified with SSR primers with resolving power in a range of 17.4-39. Dendrogram based on three molecular data using unweighted pair group method with arithmetic mean classified all the species into two clusters. Mantle matrix correspondence test revealed high matrix correlation in all the cases. Correlation values for RAPD, ISSR and SSR were 0.797, 0.84 and 0.8, respectively, with combined data. In both the genera wild and cultivated species were completely separated from each other at genomic level. It also revealed distinct genetic identity between species of Curcuma and Zingiber. High genetic diversity documented in the present study provides a baseline data for optimization of conservation and breeding programme of the studied zingiberacious species.

PCR-based Diagnosis of Toxoplasma Parasite in Ocular Infections Having Clinical Indications of Toxoplasmosis.

PubMed

Farhadi, Atieh; Haniloo, Ali; Fazaeli, Asghar; Moradian, Siamak; Farhadi, Mehdi

2017-01-01

The diagnosis of ocular toxoplasmosis is mainly based on clinical features. However, ocular fluid testing by PCR may be very helpful for approval or rejection of this etiology. In this study, we utilized a nested-PCR technique, targeting the B1 partial sequence to analyze the aqueous and vitreous samples for evaluating the presence of the Toxoplasma DNA. Fifty aqueous or vitreous humor samples were obtained from patients with clinical features of ocular toxoplasmosis admitted to ophthalmology hospitals and clinics in Iran, within 2014. The samples were subsequently subjected to DNA extraction and purification. For nested amplification of the Toxoplasma B1 gene, two primer pairs were used. The outer and inner primers are expected to produce a 193 bp and a 96 bp fragments, respectively. The first-round PCR resulted in the detection of T. gondii in 58% of samples by amplification of the expected 193bp DNA fragment. The nested-PCR using the inner primers, detected 15 additional samples from those with negative amplicons in the first round PCR (overall positivity of 88%). In addition, vitreous samples showed relatively more positive cases than aqueous humor in detection of the infection. The nested-PCR protocol using the B1 gene, with the high detection power, could be a useful complimentary method to clinical diagnose of ocular toxoplasmosis.

Design of new genome- and gene-sourced primers and identification of QTL for seed oil content in a specially high-oil Brassica napus cultivar.

PubMed

Sun, Meiyu; Hua, Wei; Liu, Jing; Huang, Shunmou; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

2012-01-01

Rapeseed (Brassica napus L.) is one of most important oilseed crops in the world. There are now various rapeseed cultivars in nature that differ in their seed oil content because they vary in oil-content alleles and there are high-oil alleles among the high-oil rapeseed cultivars. For these experiments, we generated doubled haploid (DH) lines derived from the cross between the specially high-oil cultivar zy036 whose seed oil content is approximately 50% and the specially low-oil cultivar 51070 whose seed oil content is approximately 36%. First, to address the deficiency in polymorphic markers, we designed 5944 pairs of newly developed genome-sourced primers and 443 pairs of newly developed primers related to oil-content genes to complement the 2244 pairs of publicly available primers. Second, we constructed a new DH genetic linkage map using 527 molecular markers, consisting of 181 publicly available markers, 298 newly developed genome-sourced markers and 48 newly developed markers related to oil-content genes. The map contained 19 linkage groups, covering a total length of 2,265.54 cM with an average distance between markers of 4.30 cM. Third, we identified quantitative trait loci (QTL) for seed oil content using field data collected at three sites over 3 years, and found a total of 12 QTL. Of the 12 QTL associated with seed oil content identified, 9 were high-oil QTL which derived from the specially high-oil cultivar zy036. Two high-oil QTL on chromosomes A2 and C9 co-localized in two out of three trials. By QTL mapping for seed oil content, we found four candidate genes for seed oil content related to four gene markers: GSNP39, GSSR161, GIFLP106 and GIFLP046. This information will be useful for cloning functional genes correlated with seed oil content in the future.

Design of New Genome- and Gene-Sourced Primers and Identification of QTL for Seed Oil Content in a Specially High-Oil Brassica napus Cultivar

PubMed Central

Liu, Jing; Huang, Shunmou; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

2012-01-01

Rapeseed (Brassica napus L.) is one of most important oilseed crops in the world. There are now various rapeseed cultivars in nature that differ in their seed oil content because they vary in oil-content alleles and there are high-oil alleles among the high-oil rapeseed cultivars. For these experiments, we generated doubled haploid (DH) lines derived from the cross between the specially high-oil cultivar zy036 whose seed oil content is approximately 50% and the specially low-oil cultivar 51070 whose seed oil content is approximately 36%. First, to address the deficiency in polymorphic markers, we designed 5944 pairs of newly developed genome-sourced primers and 443 pairs of newly developed primers related to oil-content genes to complement the 2244 pairs of publicly available primers. Second, we constructed a new DH genetic linkage map using 527 molecular markers, consisting of 181 publicly available markers, 298 newly developed genome-sourced markers and 48 newly developed markers related to oil-content genes. The map contained 19 linkage groups, covering a total length of 2,265.54 cM with an average distance between markers of 4.30 cM. Third, we identified quantitative trait loci (QTL) for seed oil content using field data collected at three sites over 3 years, and found a total of 12 QTL. Of the 12 QTL associated with seed oil content identified, 9 were high-oil QTL which derived from the specially high-oil cultivar zy036. Two high-oil QTL on chromosomes A2 and C9 co-localized in two out of three trials. By QTL mapping for seed oil content, we found four candidate genes for seed oil content related to four gene markers: GSNP39, GSSR161, GIFLP106 and GIFLP046. This information will be useful for cloning functional genes correlated with seed oil content in the future. PMID:23077542

Isolation, amplification and characterization of foodborne pathogen disease bacteria gene for rapid kit test development

NASA Astrophysics Data System (ADS)

Nurjayadi, M.; Santoso, I.; Kartika, I. R.; Kurniadewi, F.; Saamia, V.; Sofihan, W.; Nurkhasanah, D.

2017-07-01

There is a lot of public concern over food safety. Food-safety cases recently, including many food poisoning cases in both the developed and developing countries, considered to be the national security threats which involved police investigation. Quick and accurate detection methods are needed to handle the food poisoning cases with a big number of sufferers at the same time. Therefore, the research is aimed to develop a specific, sensitive, and rapid result molecular detection tool for foodborne pathogen bacteria. We, thus, propose genomic level approach with Polymerase Chain Reaction. The research has successfully produced a specific primer to perform amplification to fim-C S. typhi, E. coli, and pef Salmonella typhimurium genes. The electrophoresis result shows that amplification products are 95 base pairs, 121 base pairs, and 139 base pairs; and all three genes are in accordance with the size of the in silico to third genes bacteria. In conclusion, the research has been successfully designed a specific detection tool to three foodborne pathogen bacteria genes. Further stages test and the uses of Real-time PCR in the detection are still in the trial process for better detection method.

Enhanced Reliability and Accuracy for Field Deployable Bioforensic Detection and Discrimination of Xylella fastidiosa subsp. pauca, Causal Agent of Citrus Variegated Chlorosis Using Razor Ex Technology and TaqMan Quantitative PCR

PubMed Central

Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333

Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

PubMed

Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

Molecular detection of Hepatozoon canis and Babesia canis vogeli in domestic dogs from Cuiabá, Brazil.

PubMed

Spolidorio, Mariana Granziera; Torres, Mariana de Medeiros; Campos, Wilma Neres da Silva; Melo, Andréia Lima Tomé; Igarashi, Michelle; Amude, Alexandre Mendes; Labruna, Marcelo Bahia; Aguiar, Daniel Moura

2011-01-01

The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co‑infection of Babesia spp. and Hepatozoon spp. was seen in 5 dogs. Sequenced samples revealed 100% identity with B. canis vogeli, and H. canis. This is the first molecular detection of H. canis in domestic dogs from Cuiabá. Additionally, it is described for the first time the presence of B. canis vogeli circulating among dogs in Cuiabá.

Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

PubMed Central

Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-01-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

PubMed

Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-08-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

Chapter 17. Extension of endogenous primers as a tool to detect micro-RNA targets.

PubMed

Vatolin, Sergei; Weil, Robert J

2008-01-01

Mammalian cells express a large number of small, noncoding RNAs, including micro-RNAs (miRNAs), that can regulate both the level of a target mRNA and the protein produced by the target mRNA. Recognition of miRNA targets is a complicated process, as a single target mRNA may be regulated by several miRNAs. The potential for combinatorial miRNA-mediated regulation of miRNA targets complicates diagnostic and therapeutic applications of miRNAs. Despite significant progress in understanding the biology of miRNAs and advances in computational predictions of miRNA targets, methods that permit direct physical identification of miRNA-mRNA complexes in eukaryotic cells are still required. Several groups have utilized coimmunoprecipitation of RNA associated with a protein(s) that is part of the RNA silencing macromolecular complex. This chapter describes a detailed but straightforward strategy that identifies miRNA targets based on the assumption that small RNAs base paired with a complementary target mRNA can be used as a primer to synthesize cDNA that may be used for cloning, identification, and functional analysis.

COI barcode based species-specific primers for identification of five species of stored-product pests from genus Cryptolestes (Coleoptera: Laemophloeidae).

PubMed

Varadínová, Z; Wang, Y J; Kučerová, Z; Stejskal, V; Opit, G; Cao, Y; Li, F J; Li, Z H

2015-04-01

Flat grain beetles of the genus Cryptolestes (Coleoptera: Laemophloeidae) are one of the economically most important stored-product pests which feed on many kinds of agricultural products, especially grains. Nine of more than 40 described Cryptolestes species are recognized as stored-product pests and two of the pest species have a cosmopolitan distribution. Given the rapid growth in global trade of food products, ecological barriers to the spread of pests are easily overcome. Therefore, development of reliable systems for routine quarantine inspection and early infestation detection is vital. In the present study, we established a new rapid and accurate cytochrome c oxidase subunit I-based system for molecular identification of five common stored-product Cryptolestes species, namely, Cryptolestes capensis, Cryptolestes ferrugineus, Cryptolestes pusilloides, Cryptolestes pusillus and Cryptolestes turcicus. Five species-specific primer pairs for traditional uniplex polymerase chain reaction assay are described and their specificity and sensitivity for the identification process is evaluated using larval samples of 12 different populations from three continents (Asia, Europe and North America).

Recombinase-based isothermal amplification of nucleic acids with self-avoiding molecular recognition systems (SAMRS).

PubMed

Sharma, Nidhi; Hoshika, Shuichi; Hutter, Daniel; Bradley, Kevin M; Benner, Steven A

2014-10-13

Recombinase polymerase amplification (RPA) is an isothermal method to amplify nucleic acid sequences without the temperature cycling that classical PCR uses. Instead of using heat to denature the DNA duplex, RPA uses recombination enzymes to swap single-stranded primers into the duplex DNA product; these are then extended using a strand-displacing polymerase to complete the cycle. Because RPA runs at low temperatures, it never forces the system to recreate base-pairs following Watson-Crick rules, and therefore it produces undesired products that impede the amplification of the desired product, complicating downstream analysis. Herein, we show that most of these undesired side products can be avoided if the primers contain components of a self-avoiding molecular recognition system (SAMRS). Given the precision that is necessary in the recombination systems for them to function biologically, it is surprising that they accept SAMRS. SAMRS-RPA is expected to be a powerful tool within the range of amplification techniques available to scientists. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Targeting Conserved Genes in Fusarium Species.

PubMed

Gil-Serna, Jéssica; Patiño, Belén; Jurado, Miguel; Mirete, Salvador; Vázquez, Covadonga; González-Jaén, M Teresa

2017-01-01

Fumonisins are important mycotoxins contaminating foods and feeds which are mainly produced by F. verticillioides and F. proliferatum. Additionally, both are pathogens of maize and other cereals. We describe two highly sensitive, rapid, and species-specific PCR protocols which enable detection and discrimination of these closely related species in cereal flour or grain samples. The specific primer pairs of these assays were based on the intergenic spacer region of the multicopy rDNA unit which highly improves the sensitivity of the PCR assay in comparison with single-copy target regions.

Genetic Diversity in Various Accessions of Pineapple [Ananas comosus (L.) Merr.] Using ISSR and SSR Markers.

PubMed

Wang, Jian-Sheng; He, Jun-Hu; Chen, Hua-Rui; Chen, Ye-Yuan; Qiao, Fei

2017-12-01

Inter simple sequence repeat (ISSR) and simple sequence repeat (SSR) markers were used to assess the genetic diversity of 36 pineapple accessions that were introduced from 10 countries/regions. Thirteen ISSR primers amplified 96 bands, of which 91 (93.65%) were polymorphic, whereas 20 SSR primers amplified 73 bands, of which 70 (96.50%) were polymorphic. Nei's gene diversity (h = 0.28), Shannon's information index (I = 0.43), and polymorphism information content (PIC = 0.29) generated using the SSR primers were higher than that with ISSR primers (h =  0.23, I = 0.37, PIC = 0.24), thereby suggesting that the SSR system is more efficient than the ISSR system in assessing genetic diversity in various pineapple accessions. Mean genetic similarities were 0.74, 0.61, and 0.69, as determined using ISSR, SSR, and combined ISSR/SSR, respectively. These results suggest that the genetic diversity among pineapple accessions is very high. We clustered the 36 pineapple accessions into three or five groups on the basis of the phylogenetic trees constructed based on the results of ISSR, SSR, and combined ISSR/SSR analyses using the unweighted pair-group with arithmetic averaging (UPGMA) method. The results of principal components analysis (PCA) also supported the UPGMA clustering. These results will be useful not only for the scientific conservation and management of pineapple germplasm but also for the improvement of the current pineapple breeding strategies.

Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

USGS Publications Warehouse

Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

1999-01-01

We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

Development and characterization of 32 microsatellite loci in Genipa americana (Rubiaceae)1

PubMed Central

Manoel, Ricardo O.; Freitas, Miguel L. M.; Barreto, Mariana A.; Moraes, Mário L. T.; Souza, Anete P.; Sebbenn, Alexandre M.

2014-01-01

• Premise of the study: Microsatellite primers were developed for the tree species Genipa americana (Rubiaceae) for further population genetic studies. • Methods and Results: We identified 144 clones containing 65 repeat motifs from a genomic library enriched for (CT)8 and (GT)8 motifs. Primer pairs were developed for 32 microsatellite loci and validated in 40 individuals of two natural G. americana populations. Seventeen loci were polymorphic, revealing from three to seven alleles per locus. The observed and expected heterozygosities ranged from 0.24 to 1.00 and from 0.22 to 0.78, respectively. • Conclusions: The 17 primers identified as polymorphic loci are suitable to study the genetic diversity and structure, mating system, and gene flow in G. americana. PMID:25202610

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

PubMed Central

David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

2017-01-01

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

Genetic Analysis of 430 Chinese Cynodon dactylon Accessions Using Sequence-Related Amplified Polymorphism Markers

PubMed Central

Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

2014-01-01

Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260–1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53–0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars. PMID:25338051

Chloroplast and nuclear DNA studies in a few members of the Brassica oleracea L. group using PCR-RFLP and ISSR-PCR markers: a population genetic analysis.

PubMed

Panda, S; Martín, J P; Aguinagalde, I

2003-04-01

A population genetic analysis of chloroplast and nuclear DNA was performed covering nine wild populations of Brassica oleracea. Three members of the n = 9 group, all close to B. oleracea, Brassica alboglabra Bailey, Brassica bourgeaui (Webb) O. Kuntze and Brassica montana Pourret, were also studied to better understand their relationship with B. oleracea. Chloroplast DNA was analysed using the PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism) method. The ISSR-PCR (inter-simple sequence repeat - polymerase chain reaction) technique was adopted to study nuclear DNA. Twelve primer pairs of chloroplast DNA showed very good amplification. The amplified product of each primer pair, digested by three restriction enzymes, revealed no variation of cpDNA among the taxa studied. This indicates they may have the same chloroplast genotype. Seven selected ISSR primers have detected genetic variation, both within and among the populations/taxa surveyed. The information obtained on the intra- and inter-populational genetic diversity of wild populations of B. oleracea neatly defined the individual plants. It could provide important guidelines for backing management and conservation strategies in this species. The study confirms a close relationship between B. alboglabra, B. bourgeaui and B. montana, which is parallel to their morphological similitude.

Identification on commercialized products of AFLP markers able to discriminate slow- from fast-growing chicken strains.

PubMed

Fumière, Olivier; Dubois, Marc; Grégoire, Dimitrie; Théwis, André; Berben, Gilbert

2003-02-26

The European chicken meat market is characterized by numerous quality marks: "Label de Qualité Wallon" in Belgium, "Label Rouge" in France, denominations of geographical origin, organic agriculture, etc. Most of those certified productions have specifications requiring the use of slow-growing chicken strains. The amplified fragment length polymorphism (AFLP) technique has been used to search molecular markers able to discriminate slow-growing chicken strains from fast-growing ones and to authenticate certified products. Two pairs of restriction enzymes (EcoRI/MseI and EcoRI/TaqI) and 121 selective primer combinations were tested on individual DNA samples from chicken products essentially in carcass form that were ascribed as belonging to either slow- or fast-growing strains. Within the resulting fingerprints, two fragments were identified as type-strains specific markers. One primer combination gives a band (333 bp) that is specific for slow-growing chickens, and another primer pair generates a band (372 bp) that was found to be characteristic of fast-growing chickens. The two markers were isolated, cloned, and sequenced. The effectiveness and the specificity of the two interesting determinants were assessed on individuals of two well-known strains (ISA 657 and Cobb 500) and on commercialized products coming from various origins.

Nested PCR for ultrasensitive detection of the potato ring rot bacterium, Clavibacter michiganensis subsp. sepedonicus.

PubMed

Lee, I M; Bartoszyk, I M; Gundersen, D E; Mogen, B; Davis, R E

1997-07-01

Oligonucleotide primers derived from sequences of the 16S rRNA gene (CMR16F1, CMR16R1, CMR16F2, and CMR16R2) and insertion element IS1121 of Clavibacter michiganensis subsp. sepedonicus (CMSIF1, CMSIR1, CMSIF2, and CMISR2) were used in nested PCR to detect the potato ring rot bacterium C. michiganensis subsp. sepedonicus. Nested PCR with primer pair CMSIF1-CMSIR1 followed by primer pair CMSIF2-CMSIR2 specifically detected C. michiganensis subsp. sepedonicus, while nested PCR with CMR16F1-CMR16R1 followed by CMR16F2-CMR16R2 detected C. michiganensis subsp. sepedonicus and the other C. michiganensis subspecies. In the latter case, C. michiganensis subsp. sepedonicus can be differentiated from the other subspecies by restriction fragment length polymorphism (RFLP) analyses of the nested PCR products (16S rDNA sequences). The nested PCR assays developed in this work allow ultrasensitive detection of very low titers of C. michiganensis subsp. sepedonicus which may be present in symptomiess potato plants or tubers and which cannot be readily detected by direct PCR (single PCR amplification). RFLP analysis of PCR products provides for an unambiguous confirmation of the identify of C. michiganensis subsp. sepedonicus.

Polymerase Spiral Reaction (PSR): A novel isothermal nucleic acid amplification method.

PubMed

Liu, Wei; Dong, Derong; Yang, Zhan; Zou, Dayang; Chen, Zeliang; Yuan, Jing; Huang, Liuyu

2015-07-29

In this study, we report a novel isothermal nucleic acid amplification method only requires one pair of primers and one enzyme, termed Polymerase Spiral Reaction (PSR) with high specificity, efficiency, and rapidity under isothermal condition. The recombinant plasmid of blaNDM-1 was imported to Escherichia coli BL21, and selected as the microbial target. PSR method employs a Bst DNA polymerase and a pair of primers designed targeting the blaNDM-1 gene sequence. The forward and reverse Tab primer sequences are reverse to each other at their 5' end (Nr and N), whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The PSR method was performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure. PSR assay was monitored continuously in a real-time turbidimeter instrument or visually detected with the aid of a fluorescent dye (SYBR Greenı), and could be finished within 1 h with a high accumulation of 10(9) copies of the target and a fine sensitivity of 6 CFU per reaction. Clinical evaluation was also conducted using PSR, showing high specificity of this method. The PSR technique provides a convenient and cost-effective alternative for clinical screening, on-site diagnosis and primary quarantine purposes.

Improving molecular tools for global surveillance of measles virus.

PubMed

Bankamp, Bettina; Byrd-Leotis, Lauren A; Lopareva, Elena N; Woo, Gibson K S; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W; Ramamurty, Nalini; Mulders, Mick N; Featherstone, David; Bellini, William J; Rota, Paul A

2013-09-01

The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. Published by Elsevier B.V.

Improving molecular tools for global surveillance of measles virus⋆

PubMed Central

Bankamp, Bettina; Byrd-Leotis, Lauren A.; Lopareva, Elena N.; Woo, Gibson K.S.; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W.; Ramamurty, Nalini; Mulders, Mick N.; Featherstone, David; Bellini, William J.; Rota, Paul A.

2017-01-01

Background The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. Objectives The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. Study design A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. Results A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. Conclusions These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. PMID:23806666

Development and Identification of SSR Markers Associated with Starch Properties and β-Carotene Content in the Storage Root of Sweet Potato (Ipomoea batatas L.)

PubMed Central

Zhang, Kai; Wu, Zhengdan; Tang, Daobin; Lv, Changwen; Luo, Kai; Zhao, Yong; Liu, Xun; Huang, Yuanxin; Wang, Jichun

2016-01-01

Sweet potato (Ipomoea batatas L.) is a nutritious food crop and, based on the high starch content of its storage root, a potential bioethanol feedstock. Enhancing the nutritional value and starch quantity of storage roots are important goals of sweet potato breeding programs aimed at developing improved varieties for direct consumption, processing, and industrial uses. However, developing improved lines of sweet potato is challenging due to the genetic complexity of this plant and the lack of genome information. Short sequence repeat (SSR) markers are powerful molecular tools for tracking important loci in crops and for molecular-based breeding strategies; however, few SSR markers and marker-trait associations have hitherto been identified in sweet potato. In this study, we identified 1824 SSRs by using a de novo assembly of publicly available ESTs and mRNAs in sweet potato, and designed 1476 primer pairs based on SSR-containing sequences. We mapped 214 pairs of primers in a natural population comprised of 239 germplasms, and identified 1278 alleles with an average of 5.972 alleles per locus and a major allele frequency of 0.7702. Population structure analysis revealed two subpopulations in this panel of germplasms, and phenotypic characterization demonstrated that this panel is suitable for association mapping of starch-related traits. We identified 32, 16, and 17 SSR markers associated with starch content, β-carotene content, and starch composition in the storage root, respectively, using association analysis and further evaluation of a subset of sweet potato genotypes with various characteristics. The SSR markers identified here can be used to select varieties with desired traits and to investigate the genetic mechanism underlying starch and carotenoid formation in the starchy roots of sweet potato. PMID:26973669

Rapid development of microsatellite markers with 454 pyrosequencing in a vulnerable fish, the mottled skate, Raja pulchra.

PubMed

Kang, Jung-Ha; Park, Jung-Youn; Jo, Hyun-Su

2012-01-01

The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs) were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62%) produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1-10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy-Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni's correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species.

A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat food.

PubMed

Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook

2014-07-01

A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.

Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn.

PubMed

Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng

2014-02-01

Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

Occurrence of two newly named oral treponemes - Treponema parvum and Treponema putidum - in primary endodontic infections.

PubMed

Rôças, I N; Siqueira, J F

2005-12-01

Recent evidence from molecular genetic studies has revealed that oral Treponema species are involved in infections of endodontic origin. This study assessed the occurrence of two newly named oral treponemes - Treponema parvum and Treponema putidum - in primary endodontic infections using a culture-independent identification technique. Genomic DNA was isolated directly from clinical samples, and a 16S rRNA gene-based nested polymerase chain reaction (PCR) assay was used to determine the presence of T. parvum and T. putidum. Species-specific primer pairs were developed by aligning closely related 16S rRNA gene sequences. The specificity for each primer pair was validated by running PCR against a panel of oral bacteria and by sequence analysis of PCR products from positive clinical samples. T. parvum was detected in 52% of the root canals associated with chronic apical periodontitis, in 20% of the cases diagnosed as acute apical periodontitis, and in no abscessed case. In general, T. parvum was detected in 26% of the samples from primary endodontic infections. T. putidum was found in only one case of acute apical periodontitis (2% of the total number of cases investigated). The devised nested PCR protocol was able to identify both T. parvum and T. putidum directly in clinical samples and demonstrated that these two treponemes can take part in endodontic infections.

[EST-SSR identification, markers development of Ligusticum chuanxiong based on Ligusticum chuanxiong transcriptome sequences].

PubMed

Yuan, Can; Peng, Fang; Yang, Ze-Mao; Zhong, Wen-Juan; Mou, Fang-Sheng; Gong, Yi-Yun; Ji, Pei-Cheng; Pu, De-Qiang; Huang, Hai-Yan; Yang, Xiao; Zhang, Chao

2017-09-01

Ligusticum chuanxiong is a well-known traditional Chinese medicine plant. The study on its molecular markers development and germplasm resources is very important. In this study, we obtained 24 422 unigenes by assembling transcriptome sequencing reads of L. chuanxiong root. EST-SSR was detected and 4 073 SSR loci were identified. EST-SSR distribution and characteristic analysis results showed that the mono-nucleotide repeats were the main repeat types, accounting for 41.0%. In addition, the sequences containing SSR were functionally annotated in Gene Ontology (GO) and KEGG pathway and were assigned to 49 GO categories, 242 KEGG pathways, among them 2 201 sequences were annotated against Nr database. By validating 235 EST-SSRs,74 primer pairs were ultimately proved to have high quality amplification. Subsequently, genetic diversity analysis, UPGMA cluster analysis, PCoA analysis and population structure analysis of 34 L. chuanxiong germplasm resources were carried out with 74 primer pairs. In both UPGMA tree and PCoA results, L. chuanxiong resources were clustered into two groups, which are believed to be partial related to their geographical distribution. In this study, EST-SSRs in L. chuanxiong was firstly identified, and newly developed molecular markers would contribute significantly to further genetic diversity study, the purity detection, gene mapping, and molecular breeding. Copyright© by the Chinese Pharmaceutical Association.

Rapid Development of Microsatellite Markers with 454 Pyrosequencing in a Vulnerable Fish, the Mottled Skate, Raja pulchra

PubMed Central

Kang, Jung-Ha; Park, Jung-Youn; Jo, Hyun-Su

2012-01-01

The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs) were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62%) produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1–10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy–Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni’s correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species. PMID:22837688

The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants.

PubMed

Rosner, A; Maslenin, L; Spiegel, S

1997-09-01

The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

Analysis of expressed sequence tags from Prunus mume flower and fruit and development of simple sequence repeat markers

PubMed Central

2010-01-01

Background Expressed Sequence Tag (EST) has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST) sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047), among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs) in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65%) and low in the peach (46%), and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species. PMID:20626882

Transcriptome analysis of Houttuynia cordata Thunb. by Illumina paired-end RNA sequencing and SSR marker discovery.

PubMed

Wei, Lin; Li, Shenghua; Liu, Shenggui; He, Anna; Wang, Dan; Wang, Jie; Tang, Yulian; Wu, Xianjin

2014-01-01

Houttuynia cordata Thunb. is an important traditional medical herb in China and other Asian countries, with high medicinal and economic value. However, a lack of available genomic information has become a limitation for research on this species. Thus, we carried out high-throughput transcriptomic sequencing of H. cordata to generate an enormous transcriptome sequence dataset for gene discovery and molecular marker development. Illumina paired-end sequencing technology produced over 56 million sequencing reads from H. cordata mRNA. Subsequent de novo assembly yielded 63,954 unigenes, 39,982 (62.52%) and 26,122 (40.84%) of which had significant similarity to proteins in the NCBI nonredundant protein and Swiss-Prot databases (E-value <10(-5)), respectively. Of these annotated unigenes, 30,131 and 15,363 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. In addition, 24,434 (38.21%) unigenes were mapped onto 128 pathways using the KEGG pathway database and 17,964 (44.93%) unigenes showed homology to Vitis vinifera (Vitaceae) genes in BLASTx analysis. Furthermore, 4,800 cDNA SSRs were identified as potential molecular markers. Fifty primer pairs were randomly selected to detect polymorphism among 30 samples of H. cordata; 43 (86%) produced fragments of expected size, suggesting that the unigenes were suitable for specific primer design and of high quality, and the SSR marker could be widely used in marker-assisted selection and molecular breeding of H. cordata in the future. This is the first application of Illumina paired-end sequencing technology to investigate the whole transcriptome of H. cordata and to assemble RNA-seq reads without a reference genome. These data should help researchers investigating the evolution and biological processes of this species. The SSR markers developed can be used for construction of high-resolution genetic linkage maps and for gene-based association analyses in H. cordata. This work will enable future functional genomic research and research into the distinctive active constituents of this genus.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Genetic relationship and diversity among coconut (Cocos nucifera L.) accessions revealed through SCoT analysis.

PubMed

Rajesh, M K; Sabana, A A; Rachana, K E; Rahman, Shafeeq; Jerard, B A; Karun, Anitha

2015-12-01

Coconut (Cocos nucifera L.) is one of the important palms grown both as a homestead and plantation crop in countries and most island territories of tropical regions. Different DNA-based marker systems have been utilized to assess the extent of genetic diversity in coconut. Advances in genomics research have resulted in the development of novel gene-targeted markers. In the present study, we have used a simple and novel marker system, start codon targeted polymorphism (SCoT), for its evaluation as a potential marker system in coconut. SCoT markers were utilized for assessment of genetic diversity in 23 coconut accessions (10 talls and 13 dwarfs), representing different geographical regions. Out of 25 SCoT primers screened, 15 primers were selected for this study based on their consistent amplification patterns. A total of 102 scorable bands were produced by the 15 primers, 88 % of which were polymorphic. The scored data were used to construct a similarity matrix. The similarity coefficient values ranged between 0.37 and 0.91. These coefficients were utilized to construct a dendrogram using the unweighted pair group of arithmetic means (UPGMA). The extent of genetic diversity observed based on SCoT analysis of coconut accessions was comparable to earlier findings using other marker systems. Tall and dwarf coconut accessions were clearly demarcated, and in general, coconut accessions from the same geographical region clustered together. The results indicate the potential of SCoT markers to be utilized as molecular markers to detect DNA polymorphism in coconut accessions.

A Real-Time PCR Assay to Identify and Discriminate Among Wild-Type and Vaccine Strains of Varicella-Zoster Virus and Herpes Simplex Virus in Clinical Specimens, and Comparison With the Clinical Diagnoses

PubMed Central

Harbecke, Ruth; Oxman, Michael N.; Arnold, Beth A.; Ip, Charlotte; Johnson, Gary R.; Levin, Myron J.; Gelb, Lawrence D.; Schmader, Kenneth E.; Straus, Stephen E.; Wang, Hui; Wright, Peter F.; Pachucki, Constance T.; Gershon, Anne A.; Arbeit, Robert D.; Davis, Larry E.; Simberkoff, Michael S.; Weinberg, Adriana; Williams, Heather M.; Cheney, Carol; Petrukhin, Luba; Abraham, Katalin G.; Shaw, Alan; Manoff, Susan; Antonello, Joseph M.; Green, Tina; Wang, Yue; Tan, Charles; Keller, Paul M.

2014-01-01

A real-time PCR assay was developed to identify varicella-zoster virus (VZV) and herpes simplex virus (HSV) DNA in clinical specimens from subjects with suspected herpes zoster (HZ; shingles). Three sets of primers and probes were used in separate PCR reactions to detect and discriminate among wild-type VZV (VZV-WT), Oka vaccine strain VZV (VZV-Oka), and HSV DNA, and the reaction for each virus DNA was multiplexed with primers and probe specific for the human β-globin gene to assess specimen adequacy. Discrimination of all VZV-WT strains, including Japanese isolates and the Oka parent strain, from VZV-Oka was based upon a single nucleotide polymorphism at position 106262 in ORF 62, resulting in preferential amplification by the homologous primer pair. The assay was highly sensitive and specific for the target virus DNA, and no cross-reactions were detected with any other infectious agent. With the PCR assay as the gold standard, the sensitivity of virus culture was 53% for VZV and 77% for HSV. There was 92% agreement between the clinical diagnosis of HZ by the Clinical Evaluation Committee and the PCR assay results. PMID:19475609

Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

PubMed Central

Pooler, M R; Ritchie, D F; Hartung, J S

1996-01-01

Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

Analysis of genetic relationships and identification of lily cultivars based on inter-simple sequence repeat markers.

PubMed

Cui, G F; Wu, L F; Wang, X N; Jia, W J; Duan, Q; Ma, L L; Jiang, Y L; Wang, J H

2014-07-29

Inter-simple sequence repeat (ISSR) markers were used to discriminate 62 lily cultivars of 5 hybrid series. Eight ISSR primers generated 104 bands in total, which all showed 100% polymorphism, and an average of 13 bands were amplified by each primer. Two software packages, POPGENE 1.32 and NTSYSpc 2.1, were used to analyze the data matrix. Our results showed that the observed number of alleles (NA), effective number of alleles (NE), Nei's genetic diversity (H), and Shannon's information index (I) were 1.9630, 1.4179, 0.2606, and 0.4080, respectively. The highest genetic similarity (0.9601) was observed between the Oriental x Trumpet and Oriental lilies, which indicated that the two hybrids had a close genetic relationship. An unweighted pair-group method with arithmetic means dendrogram showed that the 62 lily cultivars clustered into two discrete groups. The first group included the Oriental and OT cultivars, while the Asiatic, LA, and Longiflorum lilies were placed in the second cluster. The distribution of individuals in the principal component analysis was consistent with the clustering of the dendrogram. Fingerprints of all lily cultivars built from 8 primers could be separated completely. This study confirmed the effect and efficiency of ISSR identification in lily cultivars.

Assessing the genetic relationships of Curcuma alismatifolia varieties using simple sequence repeat markers.

PubMed

Taheri, S; Abdullah, T L; Abdullah, N A P; Ahmad, Z; Karimi, E; Shabanimofrad, M R

2014-09-05

The genus Curcuma is a member of the ginger family (Zingiberaceae) that has recently become popular for use as flowering pot plants, both indoors and as patio and landscape plants. We used PCR-based molecular markers (SSRs) to elucidate genetic variation and relationships between five varieties of Curcuma (Curcuma alismatifolia) cultivated in Malaysia. Of the primers tested, 8 (of 17) SSR primers were selected for their reproducibility and high rates of polymorphism. The number of presumed alleles revealed by the SSR analysis ranged from two to six alleles, with a mean value of 3.25 alleles per locus. The values of HO and HE ranged from 0 to 0.8 (mean value of 0.2) and 0.1837 to 0.7755 (mean value of 0.5102), respectively. Eight SSR primers yielded 26 total amplified fragments and revealed high rates of polymorphism among the varieties studied. The polymorphic information content varied from 0.26 to 0.73. Dice's similarity coefficient was calculated for all pairwise comparisons and used to construct an unweighted pair group method with arithmetic average (UPGMA) dendrogram. Similarity coefficient values from 0.2105 to 0.6667 (with an average of 0.4386) were found among the five varieties examined. A cluster analysis of data using a UPGMA algorithm divided the five varieties/hybrids into 2 groups.

Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

PubMed

Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

2015-07-01

Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

Validation of internal controls for extraction and amplification of nucleic acids from enteric viruses in water samples.

PubMed

Hata, Akihiko; Katayama, Hiroyuki; Kitajima, Masaaki; Visvanathan, Chettiyappan; Nol, Chea; Furumai, Hiroaki

2011-07-01

Inhibitors that reduce viral nucleic acid extraction efficiency and interfere with cDNA synthesis and/or polymerase activity affect the molecular detection of viruses in aquatic environments. To overcome these significant problems, we developed a methodology for assessing nucleic acid yields and DNA amplification efficiencies for environmental water samples. This involved adding particles of adenovirus type 5 and murine norovirus and newly developed primer-sharing controls, which are amplified with the same primer pairs and result in the same amplicon sizes as the targets, to these samples. We found that nucleic acid loss during the extraction process, rather than reverse transcription-PCR (RT-PCR) inhibition, more significantly attributed to underestimation of the presence of viral genomes in the environmental water samples tested in this study. Our success rate for satisfactorily amplifying viral RNAs and DNAs by RT-PCR was higher than that for obtaining adequate nucleic acid preparations. We found that inhibitory properties were greatest when we used larger sample volumes. A magnetic silica bead-based RNA extraction method effectively removed inhibitors that interfere with viral nucleic acid extraction and RT-PCR. To our knowledge, this is the first study to assess the inhibitory properties of environmental water samples by using both control virus particles and primer-sharing controls.

Amplification of thermostable lipase genes fragment from thermogenic phase of domestic waste composting process

NASA Astrophysics Data System (ADS)

Nurhasanah, Nurbaiti, Santi; Madayanti, Fida; Akhmaloka

2015-09-01

Lipases are lipolytic enzymes, catalyze the hydrolysis of fatty acid ester bonds of triglycerides to produce free fatty acids and glycerol. The enzyme is widely used in various fields of biotechnological industry. Hence, lipases with unique properties (e.g.thermostable lipase) are still being explored by variation methods. One of the strategy is by using metagenomic approach to amplify the gene directly from environmental sample. This research was focused on amplification of lipase gene fragment directly from the thermogenic phase of domestic waste composting in aerated trenches. We used domestic waste compost from waste treatment at SABUGA, ITB for the sample. Total chromosomal DNA were directly extracted from several stages at thermogenic phase of compost. The DNA was then directly used as a template for amplification of thermostable lipase gene fragments using a set of internal primers namely Flip-1a and Rlip-1a that has been affixed with a GC clamp in reverse primer. The results showed that the primers amplified the gene from four stages of thermogenic phase with the size of lipase gene fragment of approximately 570 base pairs (bp). These results were further used for Denaturing Gradient Gel Electrophoresis (DGGE) analysis to determine diversity of thermostable lipase gene fragments.

MethPrimer: designing primers for methylation PCRs.

PubMed

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

PubMed Central

Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

2006-01-01

Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species. PMID:16714575

Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

PubMed

Elsheikha, H M; Schott, H C; Mansfield, L S

2006-06-01

Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

PubMed

Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

2007-06-01

The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

Recombination-assisted megaprimer (RAM) cloning

PubMed Central

Mathieu, Jacques; Alvarez, Emilia; Alvarez, Pedro J.J.

2014-01-01

No molecular cloning technique is considered universally reliable, and many suffer from being too laborious, complex, or expensive. Restriction-free cloning is among the simplest, most rapid, and cost-effective methods, but does not always provide successful results. We modified this method to enhance its success rate through the use of exponential amplification coupled with homologous end-joining. This new method, recombination-assisted megaprimer (RAM) cloning, significantly extends the application of restriction-free cloning, and allows efficient vector construction with much less time and effort when restriction-free cloning fails to provide satisfactory results. The following modifications were made to the protocol:•Limited number of PCR cycles for both megaprimer synthesis and the cloning reaction to reduce error propagation.•Elimination of phosphorylation and ligation steps previously reported for cloning methods that used exponential amplification, through the inclusion of a reverse primer in the cloning reaction with a 20 base pair region of homology to the forward primer.•The inclusion of 1 M betaine to enhance both reaction specificity and yield. PMID:26150930

Development of microsatellite markers for Viscum coloratum (Santalaceae) and their application to wild populations1

PubMed Central

Kim, Bo-Yun; Park, Han-Sol; Kim, Soonok; Kim, Young-Dong

2017-01-01

Premise of the study: Microsatellite primers were developed for Viscum coloratum (Santalaceae), a semiparasitic medicinal plant that is known for its anticancer properties. Due to excessive human harvesting and loss of suitable habitat of its populations, it has become a potentially threatened species requiring immediate conservation efforts. Methods and Results: Based on transcriptome data for V. coloratum, 124 primer pairs were randomly selected for initial validation, of which 19 yielded polymorphic microsatellite loci, with two to six alleles per locus. The usefulness of these markers was assessed for 60 individuals representing three populations of V. coloratum. Observed and expected heterozygosity values ranged from 0.033 to 0.833 and 0.032 to 0.672, respectively. Cross-species amplification for 19 loci in the related species V. album was conducted. Conclusions: The 19 newly developed loci are expected to be useful for studying the population genetics and ecological conservation of V. coloratum. PMID:28090408

Biogeochemical and Molecular Signatures of Anaerobic Methane Oxidation in a Marine Sediment

PubMed Central

Thomsen, Trine R.; Finster, Kai; Ramsing, Niels B.

2001-01-01

Anaerobic methane oxidation was investigated in 6-m-long cores of marine sediment from Aarhus Bay, Denmark. Measured concentration profiles for methane and sulfate, as well as in situ rates determined with isotope tracers, indicated that there was a narrow zone of anaerobic methane oxidation about 150 cm below the sediment surface. Methane could account for 52% of the electron donor requirement for the peak sulfate reduction rate detected in the sulfate-methane transition zone. Molecular signatures of organisms present in the transition zone were detected by using selective PCR primers for sulfate-reducing bacteria and for Archaea. One primer pair amplified the dissimilatory sulfite reductase (DSR) gene of sulfate-reducing bacteria, whereas another primer (ANME) was designed to amplify archaeal sequences found in a recent study of sediments from the Eel River Basin, as these bacteria have been suggested to be anaerobic methane oxidizers (K. U. Hinrichs, J. M. Hayes, S. P. Sylva, P. G. Brewer, and E. F. DeLong, Nature 398:802–805, 1999). Amplification with the primer pairs produced more amplificate of both target genes with samples from the sulfate-methane transition zone than with samples from the surrounding sediment. Phylogenetic analysis of the DSR gene sequences retrieved from the transition zone revealed that they all belonged to a novel deeply branching lineage of diverse DSR gene sequences not related to any previously described DSR gene sequence. In contrast, DSR gene sequences found in the top sediment were related to environmental sequences from other estuarine sediments and to sequences of members of the genera Desulfonema, Desulfococcus, and Desulfosarcina. Phylogenetic analysis of 16S rRNA sequences obtained with the primers targeting the archaeal group of possible anaerobic methane oxidizers revealed two clusters of ANME sequences, both of which were affiliated with sequences from the Eel River Basin. PMID:11282617

Biogeochemical and molecular signatures of anaerobic methane oxidation in a marine sediment.

PubMed

Thomsen, T R; Finster, K; Ramsing, N B

2001-04-01

Anaerobic methane oxidation was investigated in 6-m-long cores of marine sediment from Aarhus Bay, Denmark. Measured concentration profiles for methane and sulfate, as well as in situ rates determined with isotope tracers, indicated that there was a narrow zone of anaerobic methane oxidation about 150 cm below the sediment surface. Methane could account for 52% of the electron donor requirement for the peak sulfate reduction rate detected in the sulfate-methane transition zone. Molecular signatures of organisms present in the transition zone were detected by using selective PCR primers for sulfate-reducing bacteria and for Archaea. One primer pair amplified the dissimilatory sulfite reductase (DSR) gene of sulfate-reducing bacteria, whereas another primer (ANME) was designed to amplify archaeal sequences found in a recent study of sediments from the Eel River Basin, as these bacteria have been suggested to be anaerobic methane oxidizers (K. U. Hinrichs, J. M. Hayes, S. P. Sylva, P. G. Brewer, and E. F. DeLong, Nature 398:802-805, 1999). Amplification with the primer pairs produced more amplificate of both target genes with samples from the sulfate-methane transition zone than with samples from the surrounding sediment. Phylogenetic analysis of the DSR gene sequences retrieved from the transition zone revealed that they all belonged to a novel deeply branching lineage of diverse DSR gene sequences not related to any previously described DSR gene sequence. In contrast, DSR gene sequences found in the top sediment were related to environmental sequences from other estuarine sediments and to sequences of members of the genera Desulfonema, Desulfococcus, and Desulfosarcina. Phylogenetic analysis of 16S rRNA sequences obtained with the primers targeting the archaeal group of possible anaerobic methane oxidizers revealed two clusters of ANME sequences, both of which were affiliated with sequences from the Eel River Basin.

Rapid and inexpensive analysis of genetic variability in Arapaima gigas by PCR multiplex panel of eight microsatellites.

PubMed

Hamoy, I G; Santos, E J M; Santos, S E B

2008-01-22

The aim of the present study was the development of a multiplex genotyping panel of eight microsatellite markers of Arapaima gigas, previously described. Specific primer pairs were developed, each one of them marked with either FAM-6, HEX or NED. The amplification conditions using the new primers were standardized for a single reaction. The results obtained demonstrate high heterozygosity (average of 0.69) in a Lower Amazon population. The multiplex system described can thus be considered a fast, efficient and inexpensive method for the investigation of genetic variability in Arapaima populations.

DNA barcoding Indian freshwater fishes.

PubMed

Lakra, Wazir Singh; Singh, M; Goswami, Mukunda; Gopalakrishnan, A; Lal, K K; Mohindra, V; Sarkar, U K; Punia, P P; Singh, K V; Bhatt, J P; Ayyappan, S

2016-11-01

DNA barcoding is a promising technique for species identification using a short mitochondrial DNA sequence of cytochrome c oxidase I (COI) gene. In the present study, DNA barcodes were generated from 72 species of freshwater fish covering the Orders Cypriniformes, Siluriformes, Perciformes, Synbranchiformes, and Osteoglossiformes representing 50 genera and 19 families. All the samples were collected from diverse sites except the species endemic to a particular location. Species were represented by multiple specimens in the great majority of the barcoded species. A total of 284 COI sequences were generated. After amplification and sequencing of 700 base pair fragment of COI, primers were trimmed which invariably generated a 655 base pair barcode sequence. The average Kimura two-parameter (K2P) distances within-species, genera, families, and orders were 0.40%, 9.60%, 13.10%, and 17.16%, respectively. DNA barcode discriminated congeneric species without any confusion. The study strongly validated the efficiency of COI as an ideal marker for DNA barcoding of Indian freshwater fishes.

The structure of the human interferon alpha/beta receptor gene.

PubMed

Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

1992-02-05

Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

Analysis of the Transcriptome of Erigeron breviscapus Uncovers Putative Scutellarin and Chlorogenic Acids Biosynthetic Genes and Genetic Markers

PubMed Central

Zhang, Jia-Jin; Shu, Li-Ping; Zhang, Wei; Long, Guang-Qiang; Liu, Tao; Meng, Zheng-Gui; Chen, Jun-Wen; Yang, Sheng-Chao

2014-01-01

Background Erigeron breviscapus (Vant.) Hand-Mazz. is a famous medicinal plant. Scutellarin and chlorogenic acids are the primary active components in this herb. However, the mechanisms of biosynthesis and regulation for scutellarin and chlorogenic acids in E. breviscapus are considerably unknown. In addition, genomic information of this herb is also unavailable. Principal Findings Using Illumina sequencing on GAIIx platform, a total of 64,605,972 raw sequencing reads were generated and assembled into 73,092 non-redundant unigenes. Among them, 44,855 unigenes (61.37%) were annotated in the public databases Nr, Swiss-Prot, KEGG, and COG. The transcripts encoding the known enzymes involved in flavonoids and in chlorogenic acids biosynthesis were discovered in the Illumina dataset. Three candidate cytochrome P450 genes were discovered which might encode flavone 6-hydroase converting apigenin to scutellarein. Furthermore, 4 unigenes encoding the homologues of maize P1 (R2R3-MYB transcription factors) were defined, which might regulate the biosynthesis of scutellarin. Additionally, a total of 11,077 simple sequence repeat (SSR) were identified from 9,255 unigenes. Of SSRs, tri-nucleotide motifs were the most abundant motif. Thirty-six primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism. The result revealed that 34 (94.40%) primer pairs were successfully amplified and 19 (52.78%) primer pairs exhibited polymorphisms. Conclusion Using next generation sequencing (NGS) technology, this study firstly provides abundant genomic data for E. breviscapus. The candidate genes involved in the biosynthesis and transcriptional regulation of scutellarin and chlorogenic acids were obtained in this study. Additionally, a plenty of genetic makers were generated by identification of SSRs, which is a powerful tool for molecular breeding and genetics applications in this herb. PMID:24956277

Analysis of the transcriptome of Erigeron breviscapus uncovers putative scutellarin and chlorogenic acids biosynthetic genes and genetic markers.

PubMed

Jiang, Ni-Hao; Zhang, Guang-Hui; Zhang, Jia-Jin; Shu, Li-Ping; Zhang, Wei; Long, Guang-Qiang; Liu, Tao; Meng, Zheng-Gui; Chen, Jun-Wen; Yang, Sheng-Chao

2014-01-01

Erigeron breviscapus (Vant.) Hand-Mazz. is a famous medicinal plant. Scutellarin and chlorogenic acids are the primary active components in this herb. However, the mechanisms of biosynthesis and regulation for scutellarin and chlorogenic acids in E. breviscapus are considerably unknown. In addition, genomic information of this herb is also unavailable. Using Illumina sequencing on GAIIx platform, a total of 64,605,972 raw sequencing reads were generated and assembled into 73,092 non-redundant unigenes. Among them, 44,855 unigenes (61.37%) were annotated in the public databases Nr, Swiss-Prot, KEGG, and COG. The transcripts encoding the known enzymes involved in flavonoids and in chlorogenic acids biosynthesis were discovered in the Illumina dataset. Three candidate cytochrome P450 genes were discovered which might encode flavone 6-hydroase converting apigenin to scutellarein. Furthermore, 4 unigenes encoding the homologues of maize P1 (R2R3-MYB transcription factors) were defined, which might regulate the biosynthesis of scutellarin. Additionally, a total of 11,077 simple sequence repeat (SSR) were identified from 9,255 unigenes. Of SSRs, tri-nucleotide motifs were the most abundant motif. Thirty-six primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism. The result revealed that 34 (94.40%) primer pairs were successfully amplified and 19 (52.78%) primer pairs exhibited polymorphisms. Using next generation sequencing (NGS) technology, this study firstly provides abundant genomic data for E. breviscapus. The candidate genes involved in the biosynthesis and transcriptional regulation of scutellarin and chlorogenic acids were obtained in this study. Additionally, a plenty of genetic makers were generated by identification of SSRs, which is a powerful tool for molecular breeding and genetics applications in this herb.

Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material

PubMed Central

Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.

2000-01-01

A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

PubMed

David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

2017-01-04

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

PubMed

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity.

PubMed

Dwivedi, Bhakti; Schmieder, Robert; Goldsmith, Dawn B; Edwards, Robert A; Breitbart, Mya

2012-03-04

Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.

PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity

PubMed Central

2012-01-01

Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976

In silico mining and characterization of simple sequence repeats from gilthead sea bream (Sparus aurata) expressed sequence tags (EST-SSRs); PCR amplification, polymorphism evaluation and multiplexing and cross-species assays.

PubMed

Vogiatzi, Emmanouella; Lagnel, Jacques; Pakaki, Victoria; Louro, Bruno; Canario, Adelino V M; Reinhardt, Richard; Kotoulas, Georgios; Magoulas, Antonios; Tsigenopoulos, Costas S

2011-06-01

We screened for simple sequence repeats (SSRs) found in ESTs derived from an EST-database development project ('Marine Genomics Europe' Network of Excellence). Different motifs of di-, tri-, tetra-, penta- and hexanucleotide SSRs were evaluated for variation in length and position in the expressed sequences, relative abundance and distribution in gilthead sea bream (Sparus aurata). We found 899 ESTs that harbor 997 SSRs (4.94%). On average, one SSR was found per 2.95 kb of EST sequence and the dinucleotide SSRs are the most abundant accounting for 47.6% of the total number. EST-SSRs were used as template for primer design. 664 primer pairs could be successfully identified and a subset of 206 pairs of primers was synthesized, PCR-tested and visualized on ethidium bromide stained agarose gels. The main objective was to further assess the potential of EST-SSRs as informative markers and investigate their cross-species amplification in sixteen teleost fish species: seven sparid species and nine other species from different families. Approximately 78% of the primer pairs gave PCR products of expected size in gilthead sea bream, and as expected, the rate of successful amplification of sea bream EST-SSRs was higher in sparids, lower in other perciforms and even lower in species of the Clupeiform and Gadiform orders. We finally determined the polymorphism and the heterozygosity of 63 markers in a wild gilthead sea bream population; fifty-eight loci were found to be polymorphic with the expected heterozygosity and the number of alleles ranging from 0.089 to 0.946 and from 2 to 27, respectively. These tools and markers are expected to enhance the available genetic linkage map in gilthead sea bream, to assist comparative mapping and genome analyses for this species and further with other model fish species and finally to help advance genetic analysis for cultivated and wild populations and accelerate breeding programs. Copyright © 2011 Elsevier B.V. All rights reserved.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

PubMed

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

PubMed Central

2012-01-01

Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

Microsatellite Markers for Raspberries and Blackberries

USDA-ARS?s Scientific Manuscript database

Twelve microsatellites were isolated from SSR-enriched genomic libraries of Rubus idaeus L.‘Meeker’ red raspberry (diploid) and R. loganobaccus L. H. Bailey ‘Marion’ blackberry-raspberry hybrid (hexaploid). These primer pairs, with the addition of one developed from a GenBank R. idaeus sequence, w...

Evaluation of Diversity Based on Morphological Variabilities and ISSR Molecular Markers in Iranian Cynodon dactylon (L.) Pers. Accessions to Select and Introduce Cold-Tolerant Genotypes.

PubMed

Akbari, M; Salehi, H; Niazi, A

2018-04-01

The main goals of the present study were to screen Iranian common bermudagrasses to find cold-tolerant accessions and evaluate their genetic and morphological variabilities. In this study, 49 accessions were collected from 18 provinces of Iran. One foreign cultivar of common bermudagrass was used as control. Morphological variation was evaluated based on 14 morphological traits to give information about taxonomic position of Iranian common bermudagrass. Data from morphological traits were evaluated to categorize all accessions as either cold sensitive or tolerant using hierarchical clustering with Ward's method in SPSS software. Inter-Simple Sequence Repeat (ISSR) primers were employed to evaluate genetic variability of accessions. The results of our taxonomic investigation support the existence of two varieties of Cynodon dactylon in Iran: var. dactylon (hairless plant) and var. villosous (plant with hairs at leaf underside and/or upper side surfaces or exterior surfaces of sheath). All 15 primers amplified and gave clear and highly reproducible DNA fragments. In total, 152 fragments were produced, of which 144 (94.73%) being polymorphic. The polymorphic information content (PIC) values ranged from 0.700 to 0.928. The average PIC value obtained with 15 ISSR primers was 0.800, which shows that all primers were informative. Probability identity (PI) and discriminating power between all primers ranged from 0.029 to 0.185 and 0.815 to 0.971, respectively. Genetic data were converted into a binary data matrix. NTSYS software was used for data analysis. Clustering was done by the unweighted pair-group method with arithmetic averages and principle coordinate analysis, separated the accessions into six main clusters. According to both morphological and genetic diversity investigations of accessions, they can be clustered into three groups: cold sensitive, cold semi-tolerant, and cold tolerant. The most cold-tolerant accessions were: Taft, Malayear, Gorgan, Safashahr, Naein, Aligoudarz, and the foreign cultivar. This study may provide useful information for further breeding programs on common bermudagrass. Selected genotypes can be evaluated for other abiotic stresses such as drought and salinity.

An evaluation of a new approach to the regeneration of Helichrysum italicum (Roth) G. Don, and the molecular characterization of the variation among sets of differently derived regenerants.

PubMed

Perrini, Rosaria; Alba, Vittorio; Ruta, Claudia; Morone-Fortunato, Irene; Blanco, Antonio; Montemurro, Cinzia

2009-01-01

A protocol for the induction of regeneration from leaves of Helichrysum italicum was established. Calli were found to form on the basal medium only when it was supplemented with thidiazuron (TDZ) alone or in combination with naphthalene acetic acid (NAA), with a percentage ranking of at least 80%. The hormone-free medium showed the highest percentage of shoot regeneration (62%) even though no callus formed. AFLP markers were employed to verify tissue culture-induced variation in the regenerated plantlets obtained by direct shoot regeneration or the indirect shoot regeneration process (callus formation). Seven out of the eleven AFLP primer pairs yielded polymorphic patterns. The average number of fragments per primer pair was 64.1. Singletons were represented by 12 (2.7%) fragments. Student's T-test was performed both on the average number of shared fragments and on the nucleotide diversity, and no significant statistical difference was observed between the two regeneration treatments.

Reverse transcription multiplex PCR for differentiation between polio- and enteroviruses from clinical and environmental samples.

PubMed

Egger, D; Pasamontes, L; Ostermayer, M; Bienz, K

1995-06-01

For the rapid detection of polioviruses and their differentiation from nonpoliovirus enteroviruses, we developed a protocol in which clinical or environmental specimens are first inoculated onto cell cultures in tubes. After overnight incubation, the cultures are subjected to reverse transcription multiplex PCR with a primer pair which detects all enteroviruses (T. Hyypiä, P. Auvinen, and M. Maaronen, J. Gen. Virol. 70:3261-3268 1989) and two newly designed primer pairs specific for all 36 poliovirus strains tested. The PCR products can unequivocally be identified by their lengths in agarose gels, whereas the genetic heterogeneity of the poliovirus strains precludes identification by back-hybridization with internal probes. The proposed protocol is highly insensitive to the inhibitory effects of substances in the sample (stool, sewage). It allows for the detection of polioviruses and for polioviruses to be distinguished from nonpoliovirus enteroviruses within 24 h, and it allows for the concomitant isolation of a viable strain suitable for further typing.

Template Dimerization Promotes an Acceptor Invasion-Induced Transfer Mechanism during Human Immunodeficiency Virus Type 1 Minus-Strand Synthesis

PubMed Central

Balakrishnan, Mini; Roques, Bernard P.; Fay, Philip J.; Bambara, Robert A.

2003-01-01

The biochemical mechanism of template switching by human immunodeficiency virus type 1 (HIV-1) reverse transcriptase and the role of template dimerization were examined. Homologous donor-acceptor template pairs derived from the HIV-1 untranslated leader region and containing the wild-type and mutant dimerization initiation sequences (DIS) were used to examine the efficiency and distribution of transfers. Inhibiting donor-acceptor interaction was sufficient to reduce transfers in DIS-containing template pairs, indicating that template dimerization, and not the mere presence of the DIS, promotes efficient transfers. Additionally, we show evidence that the overall transfer process spans an extended region of the template and proceeds through a two-step mechanism. Transfer is initiated through an RNase H-facilitated acceptor invasion step, while synthesis continues on the donor template. The invasion then propagates towards the primer terminus by branch migration. Transfer is completed with the translocation of the primer terminus at a site distant from the invasion point. In our system, most invasions initiated before synthesis reached the DIS. However, transfer of the primer terminus predominantly occurred after synthesis through the DIS. The two steps were separated by 60 to 80 nucleotides. Sequence markers revealed the position of primer terminus switch, whereas DNA oligomers designed to block acceptor-cDNA interactions defined sites of invasion. Within the region of homology, certain positions on the template were inherently more favorable for invasion than others. In templates with DIS, the proximity of the acceptor facilitates invasion, thereby enhancing transfer efficiency. Nucleocapsid protein enhanced the overall efficiency of transfers but did not alter the mechanism. PMID:12663778

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products.

PubMed

Dorn-In, Samart; Hölzel, Christina S; Janke, Tobias; Schwaiger, Karin; Balsliemke, Joachim; Bauer, Johann

2013-03-01

Food processing of spoiled meat is prohibited by law, since it is a deception and does not comply with food safety aspects. In general, spoilage of meat is mostly caused by bacteria. However, a high contamination level of fungi could be also found in some meat or meat products with certain preserving conditions. In case that unhygienic meat is used to produce heat processed products, the microorganisms will be deactivated by heat, so that they cannot be detected by a standard cultivation method. Therefore, this study aimed to develop and apply a molecular biological method--polymerase chain reaction and single strand conformation polymorphism (PCR-SSCP)--to reconstruct the original fungal flora of heat processed meat. Twenty primer pairs were tested for their specificity for fungal DNA. Since none of them fully complied with all study criteria (such as high specificity and sensitivity for fungal DNA; suitability of the products for PCR-SSCP) in the matrix "meat", we designed a new reverse primer, ITS5.8R. The primer pair ITS1/ITS5.8R amplified DNA from all tested fungal species, but not DNA from meat-producing animals or from ingredients of plant origin (spices). For the final test, 32 DNA bands in acrylamide gel from 15 meat products and 1 soy sauce were sequenced-all originating from fungal species, which were, in other studies, reported to contaminate meat e.g. Alternaria alternata, Aureobasidium pullulans, Candida rugosa, C. tropicalis, C. zeylanoides, Eurotium amstelodami and Pichia membranifaciens, and/or spices such as Botrytis aclada, Guignardia mangiferae, Itersonilia perplexans, Lasiodiplodia theobromae, Lewia infectoria, Neofusicoccum parvum and Pleospora herbarum. This confirms the suitability of PCR-SSCP to specifically detect fungal DNA in heat processed meat products, and thus provides an overview of fungal species contaminating raw material such as meat and spices. Copyright © 2013 Elsevier B.V. All rights reserved.

Comparative Analyses of Plastid Sequences between Native and Introduced Populations of Aquatic Weeds Elodea canadensis and E. nuttallii

PubMed Central

Huotari, Tea; Korpelainen, Helena

2013-01-01

Non-indigenous species (NIS) are species living outside their historic or native range. Invasive NIS often cause severe environmental impacts, and may have large economical and social consequences. Elodea (Hydrocharitaceae) is a New World genus with at least five submerged aquatic angiosperm species living in fresh water environments. Our aim was to survey the geographical distribution of cpDNA haplotypes within the native and introduced ranges of invasive aquatic weeds Elodea canadensis and E. nuttallii and to reconstruct the spreading histories of these invasive species. In order to reveal informative chloroplast (cp) genome regions for phylogeographic analyses, we compared the plastid sequences of native and introduced individuals of E. canadensis. In total, we found 235 variable sites (186 SNPs, 47 indels and two inversions) between the two plastid sequences consisting of 112,193 bp and developed primers flanking the most variable genomic areas. These 29 primer pairs were used to compare the level and pattern of intraspecific variation within E. canadensis to interspecific variation between E. canadensis and E. nuttallii. Nine potentially informative primer pairs were used to analyze the phylogeographic structure of both Elodea species, based on 70 E. canadensis and 25 E. nuttallii individuals covering native and introduced distributions. On the whole, the level of variation between the two Elodea species was 53% higher than that within E. canadensis. In our phylogeographic analysis, only a single haplotype was found in the introduced range in both species. These haplotypes H1 (E. canadensis) and A (E. nuttallii) were also widespread in the native range, covering the majority of native populations analyzed. Therefore, we were not able to identify either the geographic origin of the introduced populations or test the hypothesis of single versus multiple introductions. The divergence between E. canadensis haplotypes was surprisingly high, and future research may clarify mechanisms that structure native E. canadensis populations. PMID:23620722

Tensile bond strength of an adhesive resin cement to different alloys having various surface treatments.

PubMed

Abreu, Amara; Loza, Maria A; Elias, Augusto; Mukhopadhyay, Siuli; Looney, Stephen; Rueggeberg, Frederick A

2009-02-01

The ability of a resin cement to bond to a restorative alloy is critical for maximal crown retention to nonideal preparations. Surface treatment and metal type may have an important role in optimizing resin-to-metal strength. The purpose of this study was to examine the effect of surface pretreatment on the tensile strength of base and noble metals bonded using a conventional resin cement. Cylindrical plastic rods (9.5 mm in diameter), cast in base (Rexillium NBF) or noble metal (IPS d.SIGN 53), were divided into rods 10 mm in length (n=10-12). Specimens were heated in a porcelain furnace to create an oxide layer. Test specimens were further subjected to airborne-particle abrasion (50-microm Al(2)O(3) particles) alone or with the application of a metal primer (Alloy Primer). Similarly treated rod ends were joined using resin cement (RelyX ARC), thermocycled (x500, 5 degrees -55 degrees C) and stored (24 hours, 37 degrees C) before debonding using a universal testing machine. Debond strength and failure site were recorded. Rank-based ANOVA for unbalanced designs was used to test for significant interaction (alpha=.050). Each pair of treatments was compared separately for each metal (Bonferroni-adjusted significance level of .0083, overall error rate for comparisons, .05). The 2 metals were compared separately for each of the 3 treatments using an adjusted significance level of .017, maintaining an overall error rate of .05. A multinomial logit model was used to describe the effect of metal type and surface pretreatment on failure site location (alpha=.05). Interaction between metal type and surface pretreatment was significant for stress values (P=.019). Metal type did not significantly affect tensile bond strength for any of the compared surface pretreatments. Metal primer significantly improved tensile bond strength for each metal type. Most failures tended to occur as either adhesive or mixed in nature. Metal primer application significantly enhanced tensile bond strength to base and noble metal. No significant differences in tensile strength were found between alloys. Differences in failure site incidence were found to be related to metal type and surface pretreatment.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

NASA Astrophysics Data System (ADS)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Development of microsatellite markers of vandaceous orchids for species and variety identification.

PubMed

Peyachoknagul, S; Nettuwakul, C; Phuekvilai, P; Wannapinpong, S; Srikulnath, K

2014-07-24

Vandaceous orchids are a group of orchid genera in the subfamily Vandoideae. Among this group, Mokara, Phalaenopsis, and Vanda are the most popular and commercially important orchids in Thailand. Novel microsatellite markers were developed from Mokara, the intergeneric hybrid from 3 genera Vanda, Ascocentrum, and Arachnis by using enriched method. Six primers from this study plus one primer previously developed from Vanda genome, a total of 7 markers, were selected to characterize 4 orchid genera (Mokara, Vanda, Rhynchostylis, and Ascocenda). The observed and expected heterozygosities varied in the 4 genera from 0.0000-1.0000 and 0.0000-0.8765, respectively. The transferability of these primers was also investigated in 76 vandaceous orchids from 12 genera. Three primer pairs, MOK26, MOK29, and MOK62, could successfully amplify the DNA of all samples, while MOK103 could be used with most of the samples. The total number of alleles from 76 samples ranged from 3 to 19 alleles per locus, with an average of 8.5714. Therefore, these markers could be used for variety/ species identification, certification and protection, genetic diversity, and evolutionary studies.

Analysis of genetic diversity and population structure of oil palm (Elaeis guineensis) from China and Malaysia based on species-specific simple sequence repeat markers.

PubMed

Zhou, L X; Xiao, Y; Xia, W; Yang, Y D

2015-12-08

Genetic diversity and patterns of population structure of the 94 oil palm lines were investigated using species-specific simple sequence repeat (SSR) markers. We designed primers for 63 SSR loci based on their flanking sequences and conducted amplification in 94 oil palm DNA samples. The amplification result showed that a relatively high level of genetic diversity was observed between oil palm individuals according a set of 21 polymorphic microsatellite loci. The observed heterozygosity (Ho) was 0.3683 and 0.4035, with an average of 0.3859. The Ho value was a reliable determinant of the discriminatory power of the SSR primer combinations. The principal component analysis and unweighted pair-group method with arithmetic averaging cluster analysis showed the 94 oil palm lines were grouped into one cluster. These results demonstrated that the oil palm in Hainan Province of China and the germplasm introduced from Malaysia may be from the same source. The SSR protocol was effective and reliable for assessing the genetic diversity of oil palm. Knowledge of the genetic diversity and population structure will be crucial for establishing appropriate management stocks for this species.

Hybridization in the section Mentha (Lamiaceae) inferred from AFLP markers.

PubMed

Gobert, V; Moja, S; Colson, M; Taberlet, P

2002-12-01

The amplified fragment length polymorphism (AFLP) method was used to evaluate genetic diversity and to assess genetic relationships within the section Mentha in order to clarify the taxonomy of several interspecific mint hybrids with molecular markers. To this end, genetic diversity of 62 Mentha accessions from different geographic origins, representing five species and three hybrids, was assessed. Three EcoRI/MseI AFLP primer combinations generated an average of 40 AFLP markers per primer combination, ranging in size from 50 to 500 base pairs (bp). The percentage of markers polymorphic ranged from 50% to 60% across all accessions studied. According to phenetic and cladistic analysis, the 62 mint accessions were grouped into two major clusters. Principal coordinates analysis separated species into well-defined groups, and clear relationships between species and hybrids could be described. Our AFLP analysis supports taxonomic classification established among Mentha species by conventional (morphological, cytological, and chemical) methods. It allows the assessment of phenetic relationships between species and the hybrids M. spicata and M. × piperita, largely cultivated all over the world for their menthol source, and provides new insights into the subdivision of M. spicata, based for the first time on molecular markers.

High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers.

PubMed

Hou, Weiguo; Wang, Shang; Briggs, Brandon R; Li, Gaoyuan; Xie, Wei; Dong, Hailiang

2018-01-01

Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

Real-time PCR quantification of the plant growth promoting bacteria Herbaspirillum seropedicae strain SmR1 in maize roots.

PubMed

Pereira, Tomás Pellizzaro; do Amaral, Fernanda Plucani; Dall'Asta, Pamela; Brod, Fábio Cristiano Angonesi; Arisi, Ana Carolina Maisonnave

2014-07-01

The plant growth promoting bacteria Herbaspirillum seropedicae SmR1 is an endophytic diazotroph found in several economically important crops. Considering that methods to monitor the plant-bacteria interaction are required, our objective was to develop a real-time PCR method for quantification of PGPB H. seropedicae in the rhizosphere of maize seedlings. Primer pairs were designed, and their specificity was verified using DNA from 12 different bacterial species. Ten standard curves of qPCR assay using HERBAS1 primers and tenfold serial dilutions of H. seropedicae SmR1 DNA were performed, and PCR efficiency of 91 % and correlation coefficient of 0.99 were obtained. H. seropedicae SmR1 limit of detection was 10(1) copies (corresponding to 60.3 fg of bacterial DNA). qPCR assay using HERBAS1 was used to detect and quantify H. seropedicae strain SmR1 in inoculated maize roots, cultivated in vitro and in pots, harvested 1, 4, 7, and 10 days after inoculation. The estimated bacterial DNA copy number per gram of root was in the range 10(7)-10(9) for plants grown in vitro and it was around 10(6) for plants grown in pots. Primer pair HERBAS1 was able to quantify H. seropedicae SmR1, and this assay can be useful for monitoring plant-bacteria interaction.

High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers

PubMed Central

Hou, Weiguo; Wang, Shang; Briggs, Brandon R.; Li, Gaoyuan; Xie, Wei; Dong, Hailiang

2018-01-01

Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

New PCR primers targeting hydrazine synthase and cytochrome c biogenesis proteins in anammox bacteria.

PubMed

Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong

2017-02-01

PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH 4 + and NH 4 + /Σ(NO 3 - + NO 2 - ) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox bacteria within wider coverage of genera in Mai Po wetland indicates this unique niche is very complex, and species of anammox bacteria are niche-specific with different physiological properties towards substrates competing and chemical tolerance capability.

Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

PubMed

Kim, S A; Park, S H; Lee, S I; Ricke, S C

2017-12-01

The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in food and environmental samples. © 2017 The Society for Applied Microbiology.

EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

PubMed

Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

2017-10-01

Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

PubMed

Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

2015-07-01

Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Development of SSR markers from Citrus clementina (Rutaceae) BAC end sequences and interspecific transferability in Citrus.

PubMed

Ollitrault, Frédérique; Terol, Javier; Pina, Jose Antonio; Navarro, Luis; Talon, Manuel; Ollitrault, Patrick

2010-11-01

Microsatellite primers were developed from bacterial artificial chromosome (BAC) end sequences of Citrus clementina and their transferability and polymorphism tested in the genus Citrus for future anchorage of physical and genetic maps and comparative interspecific genetic mapping. • Using PAGE and DNA silver staining, 79 primer pairs were selected for their transferability and polymorphism among 526 microsatellites mined in BES. A preliminary diversity study in Citrus was conducted with 18 of them, in C. reticulata, C. maxima, C. medica, C. sinensis, C. aurantium, C. paradisi, C. lemon, C. aurantifolia, and some papedas (wild citrus), using a capillary electrophoresis fragment analyzer. Intra- and interspecific polymorphism was observed, and heterozygous markers were identified for the different genotypes to be used for genetic mapping. • These results indicate the utility of the developed primers for comparative mapping studies and the integration of physical and genetic maps.

Recent sequence variation in probe binding site affected detection of respiratory syncytial virus group B by real-time RT-PCR.

PubMed

Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James

2017-03-01

Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

Development and preliminary evaluation of a multiplexed amplification and next generation sequencing method for viral hemorrhagic fever diagnostics

PubMed Central

Radonić, Aleksandar; Kocak Tufan, Zeliha; Domingo, Cristina

2017-01-01

Background We describe the development and evaluation of a novel method for targeted amplification and Next Generation Sequencing (NGS)-based identification of viral hemorrhagic fever (VHF) agents and assess the feasibility of this approach in diagnostics. Methodology An ultrahigh-multiplex panel was designed with primers to amplify all known variants of VHF-associated viruses and relevant controls. The performance of the panel was evaluated via serially quantified nucleic acids from Yellow fever virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever (CCHF) virus, Ebola virus, Junin virus and Chikungunya virus in a semiconductor-based sequencing platform. A comparison of direct NGS and targeted amplification-NGS was performed. The panel was further tested via a real-time nanopore sequencing-based platform, using clinical specimens from CCHF patients. Principal findings The multiplex primer panel comprises two pools of 285 and 256 primer pairs for the identification of 46 virus species causing hemorrhagic fevers, encompassing 6,130 genetic variants of the strains involved. In silico validation revealed that the panel detected over 97% of all known genetic variants of the targeted virus species. High levels of specificity and sensitivity were observed for the tested virus strains. Targeted amplification ensured viral read detection in specimens with the lowest virus concentration (1–10 genome equivalents) and enabled significant increases in specific reads over background for all viruses investigated. In clinical specimens, the panel enabled detection of the causative agent and its characterization within 10 minutes of sequencing, with sample-to-result time of less than 3.5 hours. Conclusions Virus enrichment via targeted amplification followed by NGS is an applicable strategy for the diagnosis of VHFs which can be adapted for high-throughput or nanopore sequencing platforms and employed for surveillance or outbreak monitoring. PMID:29155823

Development and preliminary evaluation of a multiplexed amplification and next generation sequencing method for viral hemorrhagic fever diagnostics.

PubMed

Brinkmann, Annika; Ergünay, Koray; Radonić, Aleksandar; Kocak Tufan, Zeliha; Domingo, Cristina; Nitsche, Andreas

2017-11-01

We describe the development and evaluation of a novel method for targeted amplification and Next Generation Sequencing (NGS)-based identification of viral hemorrhagic fever (VHF) agents and assess the feasibility of this approach in diagnostics. An ultrahigh-multiplex panel was designed with primers to amplify all known variants of VHF-associated viruses and relevant controls. The performance of the panel was evaluated via serially quantified nucleic acids from Yellow fever virus, Rift Valley fever virus, Crimean-Congo hemorrhagic fever (CCHF) virus, Ebola virus, Junin virus and Chikungunya virus in a semiconductor-based sequencing platform. A comparison of direct NGS and targeted amplification-NGS was performed. The panel was further tested via a real-time nanopore sequencing-based platform, using clinical specimens from CCHF patients. The multiplex primer panel comprises two pools of 285 and 256 primer pairs for the identification of 46 virus species causing hemorrhagic fevers, encompassing 6,130 genetic variants of the strains involved. In silico validation revealed that the panel detected over 97% of all known genetic variants of the targeted virus species. High levels of specificity and sensitivity were observed for the tested virus strains. Targeted amplification ensured viral read detection in specimens with the lowest virus concentration (1-10 genome equivalents) and enabled significant increases in specific reads over background for all viruses investigated. In clinical specimens, the panel enabled detection of the causative agent and its characterization within 10 minutes of sequencing, with sample-to-result time of less than 3.5 hours. Virus enrichment via targeted amplification followed by NGS is an applicable strategy for the diagnosis of VHFs which can be adapted for high-throughput or nanopore sequencing platforms and employed for surveillance or outbreak monitoring.

Potential use of random amplified polymorphic DNA (RAPD) technique to study the genetic diversity in Indian mustard (Brassica juncea) and its relationship to heterosis.

PubMed

Jain, A; Bhatia, S; Banga, S S; Prakash, S; Lakshmikumaran, M

1994-04-01

RAPD assays were performed, using 34 arbitrary decamer oligonucleotide primers and six combinations of two primers, to detect inherent variations and genetic relationships among 12 Indian and 11 exotic B. juncea genotypes. Of 595 amplification products identified, 500 of them were polymorphic across all genotypes. A low level of genetic variability was detected among the Indian genotypes, while considerable polymorphism was present among the exotic ones. Based on the pair-wise comparisons of amplification products the genetic similarity was calculated using Jaccard's similarity coefficients and a dendrogram was constructed using an unweighted pair group method was arithmetical averages (UPGMA). On the basis of this analysis the genotypes were clustered into two groups, A and B. Group A comprised only exotic genotypes, whereas all the Indian genotypes and four of the exotic genotypes were clustered in group B. Almost similar genotypic rankings could also be established by computing as few as 200 amplification products. In general, a high per cent of heterosis was recorded in crosses involving Indian x exotic genotypes. On the other hand, when crosses were made amongst Indian or exotic genotypes, about 80% of them exhibited negative heterosis. Results from this study indicate that, despite the lack of direct correlation between the genetic distance and the degree of heterosis, genetic diversity forms a very useful guide not only for investigating the relationships among Brassica genotypes but also in the selection of parents for heterotic hybrid combinations.

Application of myostatin in sheep breeding programs: A review

PubMed Central

Miar, Younes; Salehi, Abdolreza; Kolbehdari, Davood; Aleyasin, Seyed Ahmad

2014-01-01

Plasma membrane H+-ATPase is a major integral membrane protein with a role in various physiological processes including abiotic stress response. To study the effect of NaCl on the expression pattern of a gene encoding the plasma membrane H+-ATPase, an experiment was carried out in a completely random design with three replications. A pair of specific primers was designed based on the sequence of the gene encoding plasma membrane H+-ATPase in Aeluropus littoralis to amplify a 259 bp fragment from the target gene by PCR. A gene encoding actin was used as reference gene to normalize the expression level of the target gene. A pair of specific primers was designed to amplify a 157 bp fragment from the actin gene by PCR. Plants were treated with different concentrations of NaCl, 0, 50, 100, 150, 200, 250, 500 and 1000 mM, for two days. Our results showed that the expression level of the plasma membrane H+-ATPase gene increased dramatically at 500 mM and then decreased with increasing concentrations of NaCl. The results also indicated that the leaves of plants, were treated with high concentrations of NaCl changed morphologically, but those grown under low concentrations of NaCl as well as the control plants did not show morphological changes in their leaves. Our results suggest a relation between morphological changes of treated plants and the expression level of the plasma membrane H+-ATPase gene in Aeluropus littoralis. PMID:27843975

Characterization of the global transcriptome for cotton (Gossypium hirsutum L.) anther and development of SSR marker.

PubMed

Zhang, Xianwen; Ye, Zhenwei; Wang, Tiankang; Xiong, Hairong; Yuan, Xiaoling; Zhang, Zhigang; Yuan, Youlu; Liu, Zhi

2014-11-10

Cotton is an important fiber plant, and it's attractive to elucidate the molecular mechanism of anther development due to the close relationship between the anther fertility and boll-setting, and also fiber yield. In the present paper, 47.2 million paired-end reads with average length of 82.87 bp from the anthers of TM-1 (Gossypium hirsutum L.), a genetic standard line, were generated through transcriptome sequencing, and 210,965 unigenes of more than 100 bp were obtained. BLAST, KEGG, COG, and GO analyses showed that the genes were enriched in the processes of transcription, translation, and post-translation as well as hormone signal transduction, the transcription factor families, and cell wall-related genes mainly participating in cell expansion and carbohydrate metabolism. Further analysis identified 11,153 potential SSRs. A suit of 5122 primer pair sequences were designed, and 82 of 300 randomly selected primer pairs produced reproducible amplicons that were polymorphic among 22 cotton accessions from G. hirsutum, Gossypium barbadense and Gossypium arboreum. The UPGMA clustering analysis further confirmed high quality and effectiveness of these novel SSR markers. The present study provided insights into the transcriptome profile of the cotton and established a public information platform for functional genomics and molecular breeding. Copyright © 2014 Elsevier B.V. All rights reserved.

De Novo Transcriptome Sequencing Analysis of cDNA Library and Large-Scale Unigene Assembly in Japanese Red Pine (Pinus densiflora)

PubMed Central

Liu, Le; Zhang, Shijie; Lian, Chunlan

2015-01-01

Japanese red pine (Pinus densiflora) is extensively cultivated in Japan, Korea, China, and Russia and is harvested for timber, pulpwood, garden, and paper markets. However, genetic information and molecular markers were very scarce for this species. In this study, over 51 million sequencing clean reads from P. densiflora mRNA were produced using Illumina paired-end sequencing technology. It yielded 83,913 unigenes with a mean length of 751 bp, of which 54,530 (64.98%) unigenes showed similarity to sequences in the NCBI database. Among which the best matches in the NCBI Nr database were Picea sitchensis (41.60%), Amborella trichopoda (9.83%), and Pinus taeda (4.15%). A total of 1953 putative microsatellites were identified in 1784 unigenes using MISA (MicroSAtellite) software, of which the tri-nucleotide repeats were most abundant (50.18%) and 629 EST-SSR (expressed sequence tag- simple sequence repeats) primer pairs were successfully designed. Among 20 EST-SSR primer pairs randomly chosen, 17 markers yielded amplification products of the expected size in P. densiflora. Our results will provide a valuable resource for gene-function analysis, germplasm identification, molecular marker-assisted breeding and resistance-related gene(s) mapping for pine for P. densiflora. PMID:26690126

Construction of a high-density genetic map and lint percentage and cottonseed nutrient trait QTL identification in upland cotton (Gossypium hirsutum L.).

PubMed

Liu, Dexin; Liu, Fang; Shan, Xiaoru; Zhang, Jian; Tang, Shiyi; Fang, Xiaomei; Liu, Xueying; Wang, Wenwen; Tan, Zhaoyun; Teng, Zhonghua; Zhang, Zhengsheng; Liu, Dajun

2015-10-01

Upland cotton plays a critical role not only in the textile industry, but also in the production of important secondary metabolites, such as oil and proteins. Construction of a high-density linkage map and identifying yield and seed trait quantitative trail loci (QTL) are prerequisites for molecular marker-assisted selective breeding projects. Here, we update a high-density upland cotton genetic map from recombinant inbred lines. A total of 25,313 SSR primer pairs were screened for polymorphism between Yumian 1 and T586, and 1712 SSR primer pairs were used to genotype the mapping population and construct a map. An additional 1166 loci have been added to our previously published map with 509 SSR markers. The updated genetic map spans a total recombinant length of 3338.2 cM and contains 1675 SSR loci and nine morphological markers, with an average interval of 1.98 cM between adjacent markers. Green lint (Lg) mapped on chromosome 15 in a previous report is mapped in an interval of 2.6 cM on chromosome 21. Based on the map and phenotypic data from multiple environments, 79 lint percentage and seed nutrient trait QTL are detected. These include 8 lint percentage, 13 crude protein, 15 crude oil, 8 linoleic, 10 oleic, 13 palmitic, and 12 stearic acid content QTL. They explain 3.5-62.7 % of the phenotypic variation observed. Four morphological markers identified have a major impact on lint percentage and cottonseed nutrients traits. In this study, our genetic map provides new sights into the tetraploid cotton genome. Furthermore, the stable QTL and morphological markers could be used for fine-mapping and map-based cloning.

Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

PubMed

Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2016-09-01

Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

A Phylogenomic Approach Based on PCR Target Enrichment and High Throughput Sequencing: Resolving the Diversity within the South American Species of Bartsia L. (Orobanchaceae)

PubMed Central

Tank, David C.

2016-01-01

Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929

DNA barcode based wildlife forensics for resolving the origin of claw samples using a novel primer cocktail.

PubMed

Khedkar, Gulab D; Abhayankar, Shil Bapurao; Nalage, Dinesh; Ahmed, Shaikh Nadeem; Khedkar, Chandraprakash D

2016-11-01

Excessive wildlife hunting for commercial purposes can have negative impacts on biodiversity and may result in species extinction. To ensure compliance with legal statutes, forensic identification approaches relying on molecular markers may be used to identify the species of origin of animal material from hairs, claw, blood, bone, or meat. Using this approach, DNA sequences from the COI "barcoding" gene have been used to identify material from a number of domesticated animal species. However, many wild species of carnivores still present great challenges in generating COI barcodes using standard "universal" primer pairs. In the work presented here, the mitochondrial COI gene was successfully amplified using a novel primer cocktail, and the products were sequenced to determine the species of twenty one unknown samples of claw material collected as part of forensic wildlife case investigations. Sixteen of the unknown samples were recognized to have originated from either Panthera leo or P. pardus individuals. The remaining five samples could be identified only to the family level due to the absence of reference animal sequences. This is the first report on the use of COI sequences for the identification of P. pardus and P. leo from claw samples as part of forensic investigations in India. The study also highlights the need for adequate reference material to aid in the resolution of suspected cases of illegal wildlife harvesting.

Molecular characterization of three common olive (Olea europaea L.) cultivars in Palestine, using simple sequence repeat (SSR) markers.

PubMed

Obaid, Ramiz; Abu-Qaoud, Hassan; Arafeh, Rami

2014-09-03

Eight accessions of olive trees from three common varieties in Palestine, Nabali Baladi, Nabali Mohassan and Surri, were genetically evaluated using five simple sequence repeat (SSR) markers. A total of 17 alleles from 5 loci were observed in which 15 (88.2%) were polymorphic and 2 (11.8%) were monomorphic. An average of 3.4 alleles per locus was found ranging from 2.0 alleles with the primers GAPU-103 and DCA-9 to 5.0 alleles with U9932 and DCA-16. The smallest amplicon size observed was 50 bp with the primer DCA-16, whereas the largest one (450 bp) with the primer U9932. Cluster analysis with the unweighted pair group method with arithmetic average (UPGMA) showed three clusters: a cluster with four accessions from the 'Nabali Baladi' cultivar, another cluster with three accessions that represents the 'Nabali Mohassen' cultivar and finally the 'Surri' cultivar. The similarity coefficient for the eight olive tree samples ranged from a maximum of 100% between two accessions from Nabali Baladi and also in two other samples from Nabali Mohassan, to a minimum similarity coefficient (0.315) between the Surri and two Nabali Baladi accessions. The results in this investigation clearly highlight the genetic dissimilarity between the three main olive cultivars that have been misidentified and mixed up in the past, based on conventional morphological characters.

The first report of detection of a phytoplasma in olive trees in a botanic collection in Iran.

PubMed

Ahangaran, A; Khezri, S; Habibi, M Koohi; Alizadeh, A; Mohammadi, Gh Mosahebi

2006-01-01

In a survey in 2005 some symptoms were observed on three olive trees in a collection of different olive cultivars in one of the central provinces in Iran (Yazd Province). Affected trees exhibited a variable range of symptoms: dwarfing, shoot proliferation, internode shortening, small leaves, leaf rolling, abortive buds, appearance of very small shoots, hypertrophied, and die- back. The possibility of association of a phytoplasma with the disease was evaluated using polymerase chain reaction (PCR). Total DNA was extracted from midribs of symptomatic and healthy olive plants using phytoplasma enriched procedure and tested for the presence of phytoplasma by nested-PCR using phytoplasmal- universal primers R16F2/R16R2, followed by primers fU5/rU3 which amplify 1200 and 880bp DNA fragments of 16SrDNA, respectively. PCR resulted in amplification of expected DNA fragments in symptomatic but not in healthy olive by both primer pairs. On the basis of symptoms and positive reaction in PCR, these plants can be infected with a phytoplasma. This is the first report of olive trees phytoplasmal disease in Iran. Identification of the agent and its comparison with other phytoplasmal isolates reported from other plants (hosts) in Iran are being studied. Based on the quarantine requirements, one of these trees was eradicated and two of them were transplanted in an isolated green house for further studies.

Isolation and characterization of microsatellite markers for carolina hemlock (Tsuga caroliniana)

Treesearch

S.A. Josserand; K.M. Potter; C.S. Echt; C.D. Nelson

2008-01-01

We describe the isolation and characterization of 31 polymorphic di- and trinucleotide microsatellite marker loci for Carolina hemlock (Tsuga caroliniana Englem.). In addition, primer pairs for 16 loci amplified scoreable alleles in six other Euga species. In eastern North America, both Carolina hemlock and eastern hemlock (Tsuga canadensis...

Allelic divergence and cultivar-specific SSR alleles revealed by capillary electrophoresis using fluorescence-labeled SSR markers in sugarcane

USDA-ARS?s Scientific Manuscript database

Though sugarcane cultivars (Saccharum spp. hybrids) are complex aneu-polyploid hybrids, genetic evaluation and tracking of clone- or cultivar-specific alleles become possible due to capillary electrophoregrams (CE) using fluorescence-labeled SSR primer pairs. Twenty-four sugarcane cultivars, 12 each...

A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

PubMed

Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

2013-03-11

Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

Study Of Genetic Diversity Between Grasspea Landraces Using Morphological And Molecular Marker

NASA Astrophysics Data System (ADS)

Sedehi, Abbasali Vahabi; Lotfi, Asefeh; Solooki, Mahmood

2008-01-01

Grass pea is a beneficial crop to Iran since it has some major advantageous such as high grain and forage quality, high drought tolerance and medium level of salinity tolerance and a good native germplasm variation which accessible for breeding programs. This study was carried out to evaluate morphological traits of the grass pea landraces using a randomized complete block design with 3 replications at Research Farm of Isfahan University of Technology. To evaluate genetic diversity of 14 grass pea landraces from various locations in Iran were investigated using 32 RAPD & ISJ primers at Biocenter of University of Zabol. Analysis of variance indicated a highly significant differences among 14 grass pea landrace for the morphological traits. Average of polymorphism percentage of RAPD primer was 73.9%. Among used primer, 12 random primers showed polymorphism and a total of 56 different bands were observed in the genotypes. Jafar-abad and Sar-chahan genotypes with similarity coefficient of 66% and Khoram-abad 2 and Khoram-abad 7 genotypes with similarity coefficient of 3% were the most related and the most distinct genotypes, respectively. Fourteen primers out of 17 semi random primers produced 70 polymorphic bands which included 56% of the total 126 produced bands. Genetic relatedness among population was investigated using Jacard coefficient and unweighted pair group mean analysis (UPGMA) algorithm. The result of this research verified possibility of use of RAPD & ISJ markers for estimation of genetic diversity, management of genetic resources and determination of repetitive accessions in grass pea.

Evaluation of LSSP-PCR for identification of Leptospira spp. in urine samples of cattle with clinical suspicion of leptospirosis.

PubMed

Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota

2006-12-20

We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.

Synthesis and polymerase activity of a fluorescent cytidine TNA triphosphate analogue

PubMed Central

Mei, Hui; Shi, Changhua; Jimenez, Randi M.; Wang, Yajun; Kardouh, Miramar

2017-01-01

Abstract Threose nucleic acid (TNA) is an artificial genetic polymer capable of undergoing Darwinian evolution to produce aptamers with affinity to specific targets. This property, coupled with a backbone structure that is refractory to nuclease digestion, makes TNA an attractive biopolymer system for diagnostic and therapeutic applications. Expanding the chemical diversity of TNA beyond the natural bases would enable the development of functional TNA molecules with enhanced physiochemical properties. Here, we describe the synthesis and polymerase activity of a fluorescent cytidine TNA triphosphate analogue (1,3-diaza-2-oxo-phenothiazine, tCfTP) that maintains Watson-Crick base pairing with guanine. Polymerase-mediated primer-extension assays reveal that tCfTP is efficiently added to the growing end of a TNA primer. Detailed kinetic assays indicate that tCfTP and tCTP have comparable rates for the first nucleotide incorporation step (kobs1). However, addition of the second nucleotide (kobs2) is 700-fold faster for tCfTP than tCTP due the increased effects of base stacking. Last, we found that TNA replication using tCfTP in place of tCTP exhibits 98.4% overall fidelity for the combined process of TNA transcription and reverse transcription. Together, these results expand the chemical diversity of enzymatically generated TNA molecules to include a hydrophobic base analogue with strong fluorescent properties that is compatible with in vitro selection. PMID:28472363

ITS1: a DNA barcode better than ITS2 in eukaryotes?

PubMed

Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin

2015-05-01

A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species. © 2014 John Wiley & Sons Ltd.

Genome-wide distribution comparative and composition analysis of the SSRs in Poaceae.

PubMed

Wang, Yi; Yang, Chao; Jin, Qiaojun; Zhou, Dongjie; Wang, Shuangshuang; Yu, Yuanjie; Yang, Long

2015-02-15

The Poaceae family is of great importance to human beings since it comprises the cereal grasses which are the main sources for human food and animal feed. With the rapid growth of genomic data from Poaceae members, comparative genomics becomes a convinent method to study genetics of diffierent species. The SSRs (Simple Sequence Repeats) are widely used markers in the studies of Poaceae for their high abundance and stability. In this study, using the genomic sequences of 9 Poaceae species, we detected 11,993,943 SSR loci and developed 6,799,910 SSR primer pairs. The results show that SSRs are distributed on all the genomic elements in grass. Hexamer is the most frequent motif and AT/TA is the most frequent motif in dimer. The abundance of the SSRs has a positive linear relationship with the recombination rate. SSR sequences in the coding regions involve a higher GC content in the Poaceae than that in the other species. SSRs of 70-80 bp in length showed the highest AT/GC base ratio among all of these loci. The result shows the highest polymorphism rate belongs to the SSRs ranged from 30 bp to 40 bp. Using all the SSR primers of Japonica, nineteen universal primers were selected and located on the genome of the grass family. The information of SSR loci, the SSR primers and the tools of mining and analyzing SSR are provided in the PSSRD (Poaceae SSR Database, http://biodb.sdau.edu.cn/pssrd/). Our study and the PSSRD database provide a foundation for the comparative study in the Poaceae and it will accelerate the study on markers application, gene mapping and molecular breeding.

Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

PubMed

Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

2014-12-01

The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.

PubMed

Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng

2005-08-01

Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.

Assessment of genetic diversity of Bermudagrass (Cynodon dactylon) using ISSR markers.

PubMed

Farsani, Tayebeh Mohammadi; Etemadi, Nematollah; Sayed-Tabatabaei, Badraldin Ebrahim; Talebi, Majid

2012-01-01

Bermudagrass (Cynodon spp.) is a major turfgrass for home lawns, public parks, golf courses and sport fields and is known to have originated in the Middle East. Morphological and physiological characteristics are not sufficient to differentiate some bermudagrass genotypes because the differences between them are often subtle and subjected to environmental influences. In this study, twenty seven bermudagrass accessions and introductions, mostly from different parts of Iran, were assayed by inter-simple sequence repeat (ISSR) markers to differentiate and explore their genetic relationships. Fourteen ISSR primers amplified 389 fragments of which 313 (80.5%) were polymorphic. The average polymorphism information content (PIC) was 0.328, which shows that the majority of primers are informative. Cluster analysis using the un-weighted paired group method with arithmetic average (UPGMA) method and Jaccard's similarity coefficient (r = 0.828) grouped the accessions into six main clusters according to some degree to geographical origin, their chromosome number and some morphological characteristics. It can be concluded that there exists a wide genetic base of bermudograss in Iran and that ISSR markers are effective in determining genetic diversity and relationships among them.

Assessment of Genetic Diversity of Bermudagrass (Cynodon dactylon) Using ISSR Markers

PubMed Central

Farsani, Tayebeh Mohammadi; Etemadi, Nematollah; Sayed-Tabatabaei, Badraldin Ebrahim; Talebi, Majid

2012-01-01

Bermudagrass (Cynodon spp.) is a major turfgrass for home lawns, public parks, golf courses and sport fields and is known to have originated in the Middle East. Morphological and physiological characteristics are not sufficient to differentiate some bermudagrass genotypes because the differences between them are often subtle and subjected to environmental influences. In this study, twenty seven bermudagrass accessions and introductions, mostly from different parts of Iran, were assayed by inter-simple sequence repeat (ISSR) markers to differentiate and explore their genetic relationships. Fourteen ISSR primers amplified 389 fragments of which 313 (80.5%) were polymorphic. The average polymorphism information content (PIC) was 0.328, which shows that the majority of primers are informative. Cluster analysis using the un-weighted paired group method with arithmetic average (UPGMA) method and Jaccard’s similarity coefficient (r = 0.828) grouped the accessions into six main clusters according to some degree to geographical origin, their chromosome number and some morphological characteristics. It can be concluded that there exists a wide genetic base of bermudograss in Iran and that ISSR markers are effective in determining genetic diversity and relationships among them. PMID:22312259

High-Performance Multiplex SNP Analysis of Three Hemochromatosis-Related Mutations With Capillary Array Electrophoresis Microplates

PubMed Central

Medintz, Igor; Wong, Wendy W.; Berti, Lorenzo; Shiow, Lawrence; Tom, Jennifer; Scherer, James; Sensabaugh, George; Mathies, Richard A.

2001-01-01

An assay is described for high-throughput single nucleotide polymorphism (SNP) genotyping on a microfabricated capillary array electrophoresis (CAE) microchip. The assay targets the three common variants at the HFE locus associated with the genetic disease hereditary hemochromatosis (HHC). The assay employs allele-specific PCR (ASPCR) for the C282Y (845g->a), H63D (187c->g), and S65C (193a->t) variants using fluorescently-labeled energy-transfer (ET) allele-specific primers. Using a 96-channel radial CAE microplate, the labeled ASPCR products generated from 96 samples in a reference Caucasian population are simultaneously separated with single-base-pair resolution and genotyped in under 10 min. Detection is accomplished with a laser-excited rotary four-color fluorescence scanner. The allele-specific amplicons are differentiated on the basis of both their size and the color of the label emission. This study is the first demonstration of the combined use of ASPCR with ET primers and microfabricated radial CAE microplates to perform multiplex SNP analyses in a clinically relevant population. PMID:11230165

800,000 year old mammoth DNA, modern elephant DNA or PCR artefact?

PubMed

Binladen, Jonas; Gilbert, M Thomas P; Willerslev, Eske

2007-02-22

Poulakakis and colleagues (Poulakakis et al. 2006: Biol. Lett. 2, 451-454), report the recovery of 'authentic' mammoth DNA from an 800,000-year-old fragment of bone excavated on the island of Crete. In light of results from other ancient DNA studies that indicate how DNA survival is unlikely in samples, which are recovered from warm environments and are relatively old (e.g. more than 100,000 years), these findings come as a great surprise. Here, we show that problems exist with the methodological approaches used in the study. First, the nested PCR technique as reported is nonsensical--one of the second round 'nested' primers falls outside the amplicon of the first round PCR. More worryingly, the binding region of one of the first round primers (Elcytb320R) falls within the short 43 base pair reported mammoth sequence, specifically covering two of the three reportedly diagnostic Elephas polymorphisms. Finally, we demonstrate using a simple BLAST search in GenBank that the claimed 'uniquely derived character state' for mammoths is in fact also found within modern elephants.

[Detection of the introgression of genome elements of the Aegilops cylindrica host. into the Triticum aestivum L. genome by ISSR and SSR analysis].

PubMed

Galaev, A V; Babaiants, L T; Sivolap, Iu M

2004-12-01

To reveal sites of the donor genome in wheat crossed with Aegilops cylindrica, which acquired conferred resistance to fungal diseases, a comparative analysis of introgressive and parental forms was conducted. Two systems of PCR analysis, ISSR and SSR-PCR, were employed. Upon use of 7 ISSR primers in genotypes of 30 individual plants BC1 F9 belonging to lines 5/55-91 and 5/20-91, 19 ISSR loci were revealed and assigned to introgressive fragments of Aegilops cylindrica genome in Triticum aestivum. The 40 pairs of SSR primers allowed the detection of seven introgressive alleles; three of these alleles were located on common wheat chromosomes in the B genome, while four alleles, in the D genome. Based on data of microsatellite analysis, it was assumed that the telomeric region of the long arm of common wheat chromosome 6A also changed. ISSR and SSR methods were shown to be effective for detecting variability caused by introgression of foreign genetic material into the genome of common wheat.

PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates.

PubMed Central

Barnes, W M

1994-01-01

A target length limitation to PCR amplification of DNA has been identified and addressed. Concomitantly, the base-pair fidelity, the ability to use PCR products as primers, and the maximum yield of target fragment were increased. These improvements were achieved by the combination of a high level of an exonuclease-free, N-terminal deletion mutant of Taq DNA polymerase, Klentaq1, with a very low level of a thermostable DNA polymerase exhibiting a 3'-exonuclease activity (Pfu, Vent, or Deep Vent). At least 35 kb can be amplified to high yields from 1 ng of lambda DNA template. Images PMID:8134376

PCR-Based Method for the Detection of Toxic Mushrooms Causing Food-Poisoning Incidents.

PubMed

Nomura, Chie; Masayama, Atsushi; Yamaguchi, Mizuka; Sakuma, Daisuke; Kajimura, Keiji

2017-01-01

In this study, species-specific identification of five toxic mushrooms, Chlorophyllum molybdites, Gymnopilus junonius, Hypholoma fasciculare, Pleurocybella porrigens, and Tricholoma ustale, which have been involved in food-poisoning incidents in Japan, was investigated. Specific primer pairs targeting internal transcribed spacer (ITS) regions were designed for PCR detection. The specific amplicons were obtained from fresh, cooked, and simulated gastric fluid (SGF)-treated samples. No amplicons were detected from other mushrooms with similar morphology. Our method using one-step extraction of mushrooms allows rapid detection within 2.5 hr. It could be utilized for rapid identification or screening of toxic mushrooms.

Novel ITS1 Fungal Primers for Characterization of the Mycobiome

PubMed Central

Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

2017-01-01

ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

Transcriptome Analysis of Houttuynia cordata Thunb. by Illumina Paired-End RNA Sequencing and SSR Marker Discovery

PubMed Central

Wei, Lin; Li, Shenghua; Liu, Shenggui; He, Anna; Wang, Dan; Wang, Jie; Tang, Yulian; Wu, Xianjin

2014-01-01

Background Houttuynia cordata Thunb. is an important traditional medical herb in China and other Asian countries, with high medicinal and economic value. However, a lack of available genomic information has become a limitation for research on this species. Thus, we carried out high-throughput transcriptomic sequencing of H. cordata to generate an enormous transcriptome sequence dataset for gene discovery and molecular marker development. Principal Findings Illumina paired-end sequencing technology produced over 56 million sequencing reads from H. cordata mRNA. Subsequent de novo assembly yielded 63,954 unigenes, 39,982 (62.52%) and 26,122 (40.84%) of which had significant similarity to proteins in the NCBI nonredundant protein and Swiss-Prot databases (E-value <10−5), respectively. Of these annotated unigenes, 30,131 and 15,363 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. In addition, 24,434 (38.21%) unigenes were mapped onto 128 pathways using the KEGG pathway database and 17,964 (44.93%) unigenes showed homology to Vitis vinifera (Vitaceae) genes in BLASTx analysis. Furthermore, 4,800 cDNA SSRs were identified as potential molecular markers. Fifty primer pairs were randomly selected to detect polymorphism among 30 samples of H. cordata; 43 (86%) produced fragments of expected size, suggesting that the unigenes were suitable for specific primer design and of high quality, and the SSR marker could be widely used in marker-assisted selection and molecular breeding of H. cordata in the future. Conclusions This is the first application of Illumina paired-end sequencing technology to investigate the whole transcriptome of H. cordata and to assemble RNA-seq reads without a reference genome. These data should help researchers investigating the evolution and biological processes of this species. The SSR markers developed can be used for construction of high-resolution genetic linkage maps and for gene-based association analyses in H. cordata. This work will enable future functional genomic research and research into the distinctive active constituents of this genus. PMID:24392108

“Gate-keeper” Residues and Active-Site Rearrangements in DNA Polymerase μ Help Discriminate Non-cognate Nucleotides

PubMed Central

Li, Yunlang; Schlick, Tamar

2013-01-01

Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP

WGSSAT: A High-Throughput Computational Pipeline for Mining and Annotation of SSR Markers From Whole Genomes.

PubMed

Pandey, Manmohan; Kumar, Ravindra; Srivastava, Prachi; Agarwal, Suyash; Srivastava, Shreya; Nagpure, Naresh S; Jena, Joy K; Kushwaha, Basdeo

2018-03-16

Mining and characterization of Simple Sequence Repeat (SSR) markers from whole genomes provide valuable information about biological significance of SSR distribution and also facilitate development of markers for genetic analysis. Whole genome sequencing (WGS)-SSR Annotation Tool (WGSSAT) is a graphical user interface pipeline developed using Java Netbeans and Perl scripts which facilitates in simplifying the process of SSR mining and characterization. WGSSAT takes input in FASTA format and automates the prediction of genes, noncoding RNA (ncRNA), core genes, repeats and SSRs from whole genomes followed by mapping of the predicted SSRs onto a genome (classified according to genes, ncRNA, repeats, exonic, intronic, and core gene region) along with primer identification and mining of cross-species markers. The program also generates a detailed statistical report along with visualization of mapped SSRs, genes, core genes, and RNAs. The features of WGSSAT were demonstrated using Takifugu rubripes data. This yielded a total of 139 057 SSR, out of which 113 703 SSR primer pairs were uniquely amplified in silico onto a T. rubripes (fugu) genome. Out of 113 703 mined SSRs, 81 463 were from coding region (including 4286 exonic and 77 177 intronic), 7 from RNA, 267 from core genes of fugu, whereas 105 641 SSR and 601 SSR primer pairs were uniquely mapped onto the medaka genome. WGSSAT is tested under Ubuntu Linux. The source code, documentation, user manual, example dataset and scripts are available online at https://sourceforge.net/projects/wgssat-nbfgr.

Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure

PubMed Central

Shen, Manli; Bellaousov, Stanislav; Hiller, Michael; de La Grange, Pierre; Creamer, Trevor P.; Malina, Orit; Sperling, Ruth; Mathews, David H.; Stoilov, Peter; Stamm, Stefan

2013-01-01

The serotonin receptor 2C plays a central role in mood and appetite control. It undergoes pre-mRNA editing as well as alternative splicing. The RNA editing suggests that the pre-mRNA forms a stable secondary structure in vivo. To identify substances that promote alternative exons inclusion, we set up a high-throughput screen and identified pyrvinium pamoate as a drug-promoting exon inclusion without editing. Circular dichroism spectroscopy indicates that pyrvinium pamoate binds directly to the pre-mRNA and changes its structure. SHAPE (selective 2′-hydroxyl acylation analysed by primer extension) assays show that part of the regulated 5′-splice site forms intramolecular base pairs that are removed by this structural change, which likely allows splice site recognition and exon inclusion. Genome-wide analyses show that pyrvinium pamoate regulates >300 alternative exons that form secondary structures enriched in A–U base pairs. Our data demonstrate that alternative splicing of structured pre-mRNAs can be regulated by small molecules that directly bind to the RNA, which is reminiscent to an RNA riboswitch. PMID:23393189

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

Permanent genetic resources added to Molecular Ecology Resources Database 1 August 2011-30 September 2011.

PubMed

A'Hara, S W; Amouroux, P; Argo, Emily E; Avand-Faghih, A; Barat, Ashoktaru; Barbieri, Luiz; Bert, Theresa M; Blatrix, R; Blin, Aurélie; Bouktila, D; Broome, A; Burban, C; Capdevielle-Dulac, C; Casse, N; Chandra, Suresh; Cho, Kyung Jin; Cottrell, J E; Crawford, Charles R; Davis, Michelle C; Delatte, H; Desneux, Nicolas; Djieto-Lordon, C; Dubois, M P; El-Mergawy, R A A M; Gallardo-Escárate, C; Garcia, M; Gardiner, Mary M; Guillemaud, Thomas; Haye, P A; Hellemans, B; Hinrichsen, P; Jeon, Ji Hyun; Kerdelhué, C; Kharrat, I; Kim, Ki Hwan; Kim, Yong Yul; Kwan, Ye-Seul; Labbe, Ellen M; LaHood, Eric; Lee, Kyung Mi; Lee, Wan-Ok; Lee, Yat-Hung; Legoff, Isabelle; Li, H; Lin, Chung-Ping; Liu, S S; Liu, Y G; Long, D; Maes, G E; Magnoux, E; Mahanta, Prabin Chandra; Makni, H; Makni, M; Malausa, Thibaut; Matura, Rakesh; McKey, D; McMillen-Jackson, Anne L; Méndez, M A; Mezghani-Khemakhem, M; Michel, Andy P; Paul, Moran; Muriel-Cunha, Janice; Nibouche, S; Normand, F; Palkovacs, Eric P; Pande, Veena; Parmentier, K; Peccoud, J; Piatscheck, F; Puchulutegui, Cecilia; Ramos, R; Ravest, G; Richner, Heinz; Robbens, J; Rochat, D; Rousselet, J; Saladin, Verena; Sauve, M; Schlei, Ora; Schultz, Thomas F; Scobie, A R; Segovia, N I; Seyoum, Seifu; Silvain, J-F; Tabone, Elisabeth; Van Houdt, J K J; Vandamme, S G; Volckaert, F A M; Wenburg, John; Willis, Theodore V; Won, Yong-Jin; Ye, N H; Zhang, W; Zhang, Y X

2012-01-01

This article documents the addition of 299 microsatellite marker loci and nine pairs of single-nucleotide polymorphism (SNP) EPIC primers to the Molecular Ecology Resources (MER) Database. Loci were developed for the following species: Alosa pseudoharengus, Alosa aestivalis, Aphis spiraecola, Argopecten purpuratus, Coreoleuciscus splendidus, Garra gotyla, Hippodamia convergens, Linnaea borealis, Menippe mercenaria, Menippe adina, Parus major, Pinus densiflora, Portunus trituberculatus, Procontarinia mangiferae, Rhynchophorus ferrugineus, Schizothorax richardsonii, Scophthalmus rhombus, Tetraponera aethiops, Thaumetopoea pityocampa, Tuta absoluta and Ugni molinae. These loci were cross-tested on the following species: Barilius bendelisis, Chiromantes haematocheir, Eriocheir sinensis, Eucalyptus camaldulensis, Eucalyptus cladocalix, Eucalyptus globulus, Garra litaninsis vishwanath, Garra para lissorhynchus, Guindilla trinervis, Hemigrapsus sanguineus, Luma chequen. Guayaba, Myrceugenia colchagüensis, Myrceugenia correifolia, Myrceugenia exsucca, Parasesarma plicatum, Parus major, Portunus pelagicus, Psidium guayaba, Schizothorax richardsonii, Scophthalmus maximus, Tetraponera latifrons, Thaumetopoea bonjeani, Thaumetopoea ispartensis, Thaumetopoea libanotica, Thaumetopoea pinivora, Thaumetopoea pityocampa ena clade, Thaumetopoea solitaria, Thaumetopoea wilkinsoni and Tor putitora. This article also documents the addition of nine EPIC primer pairs for Euphaea decorata, Euphaea formosa, Euphaea ornata and Euphaea yayeyamana. © 2011 Blackwell Publishing Ltd.

A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

PubMed

Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

2015-07-07

Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

Identification of SSR and retrotransposon-based molecular markers linked to morphological characters in oily sunfl ower (Helianthus annuus L.) under natural and water-limited states.

PubMed

Ali, Soleimani Gezeljeh; Darvishzadeh, Reza; Ebrahimi, Asa; Bihamta, Mohammad Reza

2018-03-01

Sunflower is an important source of edible oil. Drought is known as an important factor limiting the growth and productivity of field crops in most parts of the world. Agricultural biotechnology mainly aims at developing crops with higher tolerance to the challenging environmental conditions, such as drought. This study examined a number of morphological characters, along with relative water content (RWC) in 100 inbred sunflower lines. A 10 × 10 simple lattice design with two replications was employed to measure the mentioned parameters under natural and water-limited states during two successive years. In molecular trial, 30 simple sequence repeat (SSR) primer pairs, as well as 14 inter-retrotransposon amplified polymorphism (IRAP) and 14 retrotransposon-microsatellite amplified polymorphism (REMAP) primer combinations were used for DNA fingerprinting of the lines. Most of the examined characters had lower average values under water-limited than natural states. Maximum and minimum reductions were observed in the cases of yield and oil percentage, respectively. The broad-sense heritabilities for all the examined characters were 0.20-0.73 and 0.10-0.34 under natural and water-limited states, respectively. In the studied samples, 8.97% of the 435 possible locus pairs of the SSRs represented significant linkage disequilibrium (LD) levels. In the association analysis using SSR markers, 22 and 21 markers were identified (P ≤ 0.05) for the studied characters under natural and water-limited states, respectively. The corresponding values were 50 and 37 using retrotransposon-based molecular markers. Some detected markers were communal between the characters under water-limited and natural states. This was in line with the phenotypic correlations detected between the characters. Communal markers facilitate the simultaneous selection of several characters and can thus improve the efficacy of selection based on markers in the plant-breeding activities.

Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

PubMed Central

2012-01-01

Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

rpoB Gene Sequence-Based Identification of Aerobic Gram-Positive Cocci of the Genera Streptococcus, Enterococcus, Gemella, Abiotrophia, and Granulicatella

PubMed Central

Drancourt, Michel; Roux, Véronique; Fournier, Pierre-Edouard; Raoult, Didier

2004-01-01

We developed a new molecular tool based on rpoB gene (encoding the beta subunit of RNA polymerase) sequencing to identify streptococci. We first sequenced the complete rpoB gene for Streptococcus anginosus, S. equinus, and Abiotrophia defectiva. Sequences were aligned with these of S. pyogenes, S. agalactiae, and S. pneumoniae available in GenBank. Using an in-house analysis program (SVARAP), we identified a 740-bp variable region surrounded by conserved, 20-bp zones and, by using these conserved zones as PCR primer targets, we amplified and sequenced this variable region in an additional 30 Streptococcus, Enterococcus, Gemella, Granulicatella, and Abiotrophia species. This region exhibited 71.2 to 99.3% interspecies homology. We therefore applied our identification system by PCR amplification and sequencing to a collection of 102 streptococci and 60 bacterial isolates belonging to other genera. Amplicons were obtained in streptococci and Bacillus cereus, and sequencing allowed us to make a correct identification of streptococci. Molecular signatures were determined for the discrimination of closely related species within the S. pneumoniae-S. oralis-S. mitis group and the S. agalactiae-S. difficile group. These signatures allowed us to design a S. pneumoniae-specific PCR and sequencing primer pair. PMID:14766807

Identification of genetically diverse genotypes for photoperiod insensitivity in soybean using RAPD markers.

PubMed

Singh, R K; Bhatia, V S; Yadav, Sanjeev; Athale, Rashmi; Lakshmi, N; Guruprasad, K N; Chauhan, G S

2008-10-01

Most of the Indian soybean varieties were found to be highly sensitive to photoperiod, which limits their cultivation in only localized area. Identification of genetically diverse source of photoperiod insensitive would help to broaden the genetic base for this trait. Present study was undertaken with RAPD markers for genetic diversity estimation in 44 accessions of soybean differing in response to photoperiod sensitivity. The selected twenty-five RAPD primers produced a total of 199 amplicons, which generated 89.9 % polymorphism. The number of amplification products ranged from 2 to 13 for different primers. The polymorphism information content ranged from 0.0 for monomorphic loci to 0.5 with an average of 0.289. Genetic diversity between pairs of genotypes was 37.7% with a range of 3.9 to 71.6%. UPGMA cluster analysis placed all the accessions of soybean into four major clusters. No discernable geographical patterns were observed in clustering however; the smaller groups corresponded well with pedigree. Mantel's test (r = 0.915) indicates very good fit for clustering pattern. Two genotypes, MACS 330 and 111/2/1939 made a very divergent group from other accessions of soybean and highly photoperiod insensitive that may be potential source for broadening the genetic base of soybean for this trait.

Next-Generation Sequencing of the Chrysanthemum nankingense (Asteraceae) Transcriptome Permits Large-Scale Unigene Assembly and SSR Marker Discovery

PubMed Central

Wang, Haibin; Jiang, Jiafu; Chen, Sumei; Qi, Xiangyu; Peng, Hui; Li, Pirui; Song, Aiping; Guan, Zhiyong; Fang, Weimin; Liao, Yuan; Chen, Fadi

2013-01-01

Background Simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Chrysanthemum is one of the largest genera in the Asteraceae family. Only few Chrysanthemum expressed sequence tag (EST) sequences have been acquired to date, so the number of available EST-SSR markers is very low. Methodology/Principal Findings Illumina paired-end sequencing technology produced over 53 million sequencing reads from C. nankingense mRNA. The subsequent de novo assembly yielded 70,895 unigenes, of which 45,789 (64.59%) unigenes showed similarity to the sequences in NCBI database. Out of 45,789 sequences, 107 have hits to the Chrysanthemum Nr protein database; 679 and 277 sequences have hits to the database of Helianthus and Lactuca species, respectively. MISA software identified a large number of putative EST-SSRs, allowing 1,788 primer pairs to be designed from the de novo transcriptome sequence and a further 363 from archival EST sequence. Among 100 primer pairs randomly chosen, 81 markers have amplicons and 20 are polymorphic for genotypes analysis in Chrysanthemum. The results showed that most (but not all) of the assays were transferable across species and that they exposed a significant amount of allelic diversity. Conclusions/Significance SSR markers acquired by transcriptome sequencing are potentially useful for marker-assisted breeding and genetic analysis in the genus Chrysanthemum and its related genera. PMID:23626799

Properties of targeted preamplification in DNA and cDNA quantification.

PubMed

Andersson, Daniel; Akrap, Nina; Svec, David; Godfrey, Tony E; Kubista, Mikael; Landberg, Göran; Ståhlberg, Anders

2015-01-01

Quantification of small molecule numbers often requires preamplification to generate enough copies for accurate downstream enumerations. Here, we studied experimental parameters in targeted preamplification and their effects on downstream quantitative real-time PCR (qPCR). To evaluate different strategies, we monitored the preamplification reaction in real-time using SYBR Green detection chemistry followed by melting curve analysis. Furthermore, individual targets were evaluated by qPCR. The preamplification reaction performed best when a large number of primer pairs was included in the primer pool. In addition, preamplification efficiency, reproducibility and specificity were found to depend on the number of template molecules present, primer concentration, annealing time and annealing temperature. The amount of nonspecific PCR products could also be reduced about 1000-fold using bovine serum albumin, glycerol and formamide in the preamplification. On the basis of our findings, we provide recommendations how to perform robust and highly accurate targeted preamplification in combination with qPCR or next-generation sequencing.

Pentaplex PCR as screening assay for jellyfish species identification in food products.

PubMed

Armani, Andrea; Giusti, Alice; Castigliego, Lorenzo; Rossi, Aurelio; Tinacci, Lara; Gianfaldoni, Daniela; Guidi, Alessandra

2014-12-17

Salted jellyfish, a traditional food in Asian Countries, is nowadays spreading on the Western markets. In this work, we developed a Pentaplex PCR for the identification of five edible species (Nemopilema nomurai, Rhopilema esculentum, Rhizostoma pulmo, Pelagia noctiluca, and Cotylorhiza tuberculata), which cannot be identified by a mere visual inspection in jellyfish products sold as food. A common degenerated forward primer and five specie-specific reverse primers were designed to amplify COI gene regions of different lengths. Another primer pair targeted the 28SrRNA gene and was intended as common positive reaction control. Considering the high level of degradation in the DNA extracted from acidified and salted products, the maximum length of the amplicons was set at 200 bp. The PCR was developed using 66 reference DNA samples. It gave successful amplifications in 85.4% of 48 ready to eat products (REs) and in 60% of 30 classical salted products (CPs) collected on the market.

Short communication: development and characterization of novel transcriptome-derived microsatellites for genetic analysis of persimmon.

PubMed

Luo, C; Zhang, Q L; Luo, Z R

2014-04-16

Oriental persimmon (Diospyros kaki Thunb.) (2n = 6x = 90) is a major commercial and deciduous fruit tree that is believed to have originated in China. However, rare transcriptomic and genomic information on persimmon is available. Using Roche 454 sequencing technology, the transcriptome from RNA of the flowers of D. kaki was analyzed. A total of 1,250,893 reads were generated and 83,898 unigenes were assembled. A total of 42,711 SSR loci were identified from 23,494 unigenes and 289 polymerase chain reaction primer pairs were designed. Of these 289 primers, 155 (53.6%) showed robust PCR amplification and 98 revealed polymorphism between 15 persimmon genotypes, indicating a polymorphic rate of 63.23% of the productive primers for characterization and genotyping of the genus Diospyros. Transcriptome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no genomic sequence information available.

Genetic diversity and structure of tea plant in Qinba area in China by three types of molecular markers.

PubMed

Zhang, Yu; Zhang, Xiaojuan; Chen, Xi; Sun, Wang; Li, Jiao

2018-01-01

Qinba area has a long history of tea planting and is a northernmost region in China where Camellia sinensis L. is grown. In order to provide basic data for selection and optimization of molecular markers of tea plants. 118 markers, including 40 EST-SSR, 40 SRAP and 38 SCoT markers were used to evaluate the genetic diversity of 50 tea plant ( Camellia sinensis. ) samples collected from Qinb. tea germplasm, assess population structure. In this study, a total of 414 alleles were obtained using 38 pairs of SCoT primers, with an average of 10.89 alleles per primer. The percentage of polymorphic bands (PPB), polymorphism information content (PIC), resolving power (Rp), effective multiplex ratio (EMR), average band informativeness (Ib av ), and marker index (MI) were 96.14%, 0.79, 6.71, 10.47, 0.58, and 6.07 respectively. 338 alleles were amplified via 40 pairs of SRAP (8.45 per primer), with PPB, PIC, Rp, EMR, Ib av, and MI values of 89.35%, 0.77, 5.11, 7.55, 0.61, and 4.61, respectively. Furthermore, 320 alleles have been detected using 40 EST-SSR primers (8.00 per primer), with PPB, PIC, Rp, EMR, Ib av , and MI values of 94.06%, 0.85, 4.48, 7.53, 0.56, and 4.22 respectively. These results indicated that SCoT markers had higher efficiency.Mantel test was used to analyze the genetic distance matrix generated by EST-SSRs, SRAPs and SCoTs. The results showed that the correlation between the genetic distance matrix based on EST-SSR and that based on SRAP was very small ( r  = 0.01), followed by SCoT and SRAP ( r  = 0.17), then by SCoT and EST-SSR ( r  = 0.19).The 50 tea samples were divided into two sub-populations using STRUCTURE, Neighbor-joining (NJ) method and principal component analyses (PCA). The results produced by STRUCTURE were completely consistent with the PCA analysis. Furthermore, there is no obvious relationship between the results produced using sub-populational and geographical data. Among the three types of markers, SCoT markers has many advantages in terms of NPB, PPB, Rp, EMR, and MI. Nevertheless, the values of PIC showed different trends, with the highest values generated with EST-SSR, followed by SCoT and SRAP. The average band informativeness showed similar trends. Correlation between genetic distances produced by three different molecular markers were very small, thus it is not recommended to use a single marker to evaluate genetic diversity and population structure. It is hence suggested that combining of different types of molecular markers should be used to evaluate the genetic diversity and population structure. It also seems crucial to screen out, for each type of molecular markers, core markers of Camellia sinensis . This study revealed that genes of exotic plant varieties have been constantly integrated into the gene pool of Qinba area tea. A low level of genetic diversity was observed; this is shown by an average coefficient of genetic similarity of 0.74.

Rapid nested PCR-based detection of Ramularia collo-cygni direct from barley.

PubMed

Havis, Neil D; Oxley, Simonj P; Piper, Stephen R; Langrell, Stephen R H

2006-03-01

Ramularia collo-cygni is a barley pathogen of increasing importance in Northern and Central Europe, New Zealand and South America. Accurate visual and microscopic identification of the pathogen from diseased tissue is difficult. A nested PCR-based diagnostic test has been developed as part of an initiative to map the distribution of the pathogen in Scotland. The entire nuclear ribosomal internal transcribed spacer and 5.8S rRNA gene regions from 14 isolates of diverse global origin exhibited complete homology following sequence characterization. Two pairs of species-specific primers, based on inter-specific sequence divergence with closely related species, were designed and empirically evaluated for diagnostic nested PCR. Nested primers Rcc3 and Rcc4 consistently amplified a single product of 256 bp from DNA of 24 R. collo-cygni isolates of diverse global provenance, but not from other Ramularia species, or other fungi commonly encountered in cereal pathosystems, as well as Hordeum or Secale DNA preparations. Using this approach, R. collo-cygni was successfully identified from naturally infected barley leaf, awn and grain samples of diverse geographical provenance, in particular from symptoms that lacked the presence of characteristic conidiophores. It is envisaged that this assay will become established as an important tool in continuing studies into the ecology, aetiology and epidemiology of this poorly understood yet economically damaging plant pathogen.

Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

PubMed

Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

2008-07-22

Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

Basis of Miscoding of the DNA Adduct N2,3-Ethenoguanine by Human Y-family DNA Polymerases*

PubMed Central

Zhao, Linlin; Pence, Matthew G.; Christov, Plamen P.; Wawrzak, Zdzislaw; Choi, Jeong-Yun; Rizzo, Carmelo J.; Egli, Martin; Guengerich, F. Peter

2012-01-01

N2,3-Ethenoguanine (N2,3-ϵG) is one of the exocyclic DNA adducts produced by endogenous processes (e.g. lipid peroxidation) and exposure to bioactivated vinyl monomers such as vinyl chloride, which is a known human carcinogen. Existing studies exploring the miscoding potential of this lesion are quite indirect because of the lability of the glycosidic bond. We utilized a 2′-fluoro isostere approach to stabilize this lesion and synthesized oligonucleotides containing 2′-fluoro-N2,3-ϵ-2′-deoxyarabinoguanosine to investigate the miscoding potential of N2,3-ϵG by Y-family human DNA polymerases (pols). In primer extension assays, pol η and pol κ replicated through N2,3-ϵG, whereas pol ι and REV1 yielded only 1-base incorporation. Steady-state kinetics revealed that dCTP incorporation is preferred opposite N2,3-ϵG with relative efficiencies in the order of pol κ > REV1 > pol η ≈ pol ι, and dTTP misincorporation is the major miscoding event by all four Y-family human DNA pols. Pol ι had the highest dTTP misincorporation frequency (0.71) followed by pol η (0.63). REV1 misincorporated dTTP and dGTP with much lower frequencies. Crystal structures of pol ι with N2,3-ϵG paired to dCTP and dTTP revealed Hoogsteen-like base pairing mechanisms. Two hydrogen bonds were observed in the N2,3-ϵG:dCTP base pair, whereas only one appears to be present in the case of the N2,3-ϵG:dTTP pair. Base pairing mechanisms derived from the crystal structures explain the slightly favored dCTP insertion for pol ι in steady-state kinetic analysis. Taken together, these results provide a basis for the mutagenic potential of N2,3-ϵG. PMID:22910910

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum.

PubMed

Ren, Xingxing; Fu, Ying; Xu, Chenggang; Feng, Zhou; Li, Miao; Zhang, Lina; Zhang, Jianmin; Liao, Ming

2017-05-01

Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum represent the most common causative agents of chicken salmonellosis, which result in high mortality and morbidity throughout the world. It is difficult and laborious to discriminate these diseases based on biochemical or phenotypic methods. Herein, we report the development of a single nucleotide polymorphism (SNP) PCR-high resolution melt (PCR-HRM) assay for the detection and discrimination of both S. Pullorum and S. Gallinarun. The gene rfbS, which encodes a factor involved in the biosynthesis of ADP paratose in serogroup D of Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598. Therefore, PCR-HRM analyses were used to characterize this gene. A total of 15 reference and 33 clinical isolates of Salmonella and related Gram-negative bacteria were detected using 2 sets of primers. Our PCR-HRM assay could distinguish S. Pullorum from S. Gallinarun and other strains using the primer pair SP-237F/237R. Similarly, S. Gallinarun could be distinguished from S. Pullorum and other strains using primer set SG-598F/598R. These 2 assays showed high specificity (100%) for both S. Pullorum and S. Gallinarun; the sensitivity of these 2 assays was at least 100-fold greater than that of the allele-specific PCR assay. This present study demonstrated that HRM analysis represents a potent, simple, and economic tool for the rapid, specific, and sensitive detection of S. Pullorum and S. Gallinarun. Our approach also may aid efforts for purification of Avian Salmonella disease. © 2016 Poultry Science Association Inc.

Binary electrokinetic separation of target DNA from background DNA primers.

DOE Office of Scientific and Technical Information (OSTI.GOV)

James, Conrad D.; Derzon, Mark Steven

2005-10-01

This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting themore » entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.« less

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

PubMed Central

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

2006-01-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

PubMed

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

2006-07-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

DOE PAGES

Yoon, Hyejin; Leitner, Thomas

2014-12-17

Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

Development and validation of microsatellite markers for Brachiaria ruziziensis obtained by partial genome assembly of Illumina single-end reads

PubMed Central

2013-01-01

Background Brachiaria ruziziensis is one of the most important forage species planted in the tropics. The application of genomic tools to aid the selection of superior genotypes can provide support to B. ruziziensis breeding programs. However, there is a complete lack of information about the B. ruziziensis genome. Also, the availability of genomic tools, such as molecular markers, to support B. ruziziensis breeding programs is rather limited. Recently, next-generation sequencing technologies have been applied to generate sequence data for the identification of microsatellite regions and primer design. In this study, we present a first validated set of SSR markers for Brachiaria ruziziensis, selected from a de novo partial genome assembly of single-end Illumina reads. Results A total of 85,567 perfect microsatellite loci were detected in contigs with a minimum 10X coverage. We selected a set of 500 microsatellite loci identified in contigs with minimum 100X coverage for primer design and synthesis, and tested a subset of 269 primer pairs, 198 of which were polymorphic on 11 representative B. ruziziensis accessions. Descriptive statistics for these primer pairs are presented, as well as estimates of marker transferability to other relevant brachiaria species. Finally, a set of 11 multiplex panels containing the 30 most informative markers was validated and proposed for B. ruziziensis genetic analysis. Conclusions We show that the detection and development of microsatellite markers from genome assembled Illumina single-end DNA sequences is highly efficient. The developed markers are readily suitable for genetic analysis and marker assisted selection of Brachiaria ruziziensis. The use of this approach for microsatellite marker development is promising for species with limited genomic information, whose breeding programs would benefit from the use of genomic tools. To our knowledge, this is the first set of microsatellite markers developed for this important species. PMID:23324172

Molecular characterization of three common olive (Olea europaea L.) cultivars in Palestine, using simple sequence repeat (SSR) markers

PubMed Central

Obaid, Ramiz; Abu-Qaoud, Hassan; Arafeh, Rami

2014-01-01

Eight accessions of olive trees from three common varieties in Palestine, Nabali Baladi, Nabali Mohassan and Surri, were genetically evaluated using five simple sequence repeat (SSR) markers. A total of 17 alleles from 5 loci were observed in which 15 (88.2%) were polymorphic and 2 (11.8%) were monomorphic. An average of 3.4 alleles per locus was found ranging from 2.0 alleles with the primers GAPU-103 and DCA-9 to 5.0 alleles with U9932 and DCA-16. The smallest amplicon size observed was 50 bp with the primer DCA-16, whereas the largest one (450 bp) with the primer U9932. Cluster analysis with the unweighted pair group method with arithmetic average (UPGMA) showed three clusters: a cluster with four accessions from the ‘Nabali Baladi’ cultivar, another cluster with three accessions that represents the ‘Nabali Mohassen’ cultivar and finally the ‘Surri’ cultivar. The similarity coefficient for the eight olive tree samples ranged from a maximum of 100% between two accessions from Nabali Baladi and also in two other samples from Nabali Mohassan, to a minimum similarity coefficient (0.315) between the Surri and two Nabali Baladi accessions. The results in this investigation clearly highlight the genetic dissimilarity between the three main olive cultivars that have been misidentified and mixed up in the past, based on conventional morphological characters. PMID:26019564

Temperature Rise during Primer, Adhesive, and Composite Resin Photopolymerization of a Low-Shrinkage Composite Resin under Caries-Like Dentin Lesions

PubMed Central

Mousavinasab, Sayed-Mostafa; Khoroushi, Maryam; Moharreri, Mohammadreza

2012-01-01

Objective. This study evaluated temperature rise of low-shrinkage (LS) self-etch primer (P), LS self-etch adhesive (A), and P90 silorane-based composite resin systems, photopolymerized under normal and artificially demineralized dentin. Methods. Forty 1.5 mm-thick dentin discs were prepared from sound human molars, half of which were demineralized. Temperature rise was measured during photopolymerization using a K-type thermocouple under the discs: 10 s and 40 s irradiation of the discs (controls/groups 1 and 2); 10 s irradiation of primer (P), 10 s irradiation of adhesive (A), 40 s irradiation of P90 without P and A, and 40 s irradiation of P90 with P and A (groups 3 to 6, resp.). The samples were photopolymerized using an LED unit under 550 mW/cm2 light intensity. Data was analyzed using repeated measures ANOVA and paired-sample t-test (α = 0.05). Results. There were no significant differences in temperature rise means between the two dentin samples for each irradiation duration (P > 0.0001), with significant differences between the two irradiation durations (P > 0.0001). Temperature rise measured with 40 s irradiation was significantly higher than that of 10 s duration for undemineralized and demineralized dentin P < 0.0001). Conclusions. Light polymerization of P90 low-shrinkage composite resin resulted in temperature rise approaching threshold value under artificially demineralized and undemineralized dentin. PMID:23320185

A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

PubMed

Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

2012-06-01

The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice

PubMed Central

Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain

2013-01-01

Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

Accurate SHAPE-directed RNA secondary structure modeling, including pseudoknots.

PubMed

Hajdin, Christine E; Bellaousov, Stanislav; Huggins, Wayne; Leonard, Christopher W; Mathews, David H; Weeks, Kevin M

2013-04-02

A pseudoknot forms in an RNA when nucleotides in a loop pair with a region outside the helices that close the loop. Pseudoknots occur relatively rarely in RNA but are highly overrepresented in functionally critical motifs in large catalytic RNAs, in riboswitches, and in regulatory elements of viruses. Pseudoknots are usually excluded from RNA structure prediction algorithms. When included, these pairings are difficult to model accurately, especially in large RNAs, because allowing this structure dramatically increases the number of possible incorrect folds and because it is difficult to search the fold space for an optimal structure. We have developed a concise secondary structure modeling approach that combines SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) experimental chemical probing information and a simple, but robust, energy model for the entropic cost of single pseudoknot formation. Structures are predicted with iterative refinement, using a dynamic programming algorithm. This melded experimental and thermodynamic energy function predicted the secondary structures and the pseudoknots for a set of 21 challenging RNAs of known structure ranging in size from 34 to 530 nt. On average, 93% of known base pairs were predicted, and all pseudoknots in well-folded RNAs were identified.

Identification of new polymorphic microsatellite markers in the NA1 and NA2 lineages of Phytophthora ramorum

Treesearch

A. Vercauteren; M. Larsen; E. Goss; N. Grunwald; M. Maes; K. Heungens

2011-01-01

Phytophthora ramorum is a recently introduced pathogen in Europe and North America consisting of three clonal lineages. Due to the limited intralineage genetic variation, only a few polymorphic markers are available for use in studies involving the epidemiology and evolution of P. ramorum. A total of 159 primer pairs for...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yazhen; Musser, Sarah K.; Saleh, Sam

1,N{sup 2}-Propanodeoxyguanosine (PdG) is a stable structural analogue for the 3-(2'-deoxy-{beta}-d-erythro-pentofuranosyl)pyrimido[1,2-?]purin-10(3H)-one (M{sub 1}dG) adduct derived from exposure of DNA to base propenals and to malondialdehyde. The structures of ternary polymerase-DNA-dNTP complexes for three template-primer DNA sequences were determined, with the Y-family Sulfolobus solfataricus DNA polymerase IV (Dpo4), at resolutions between 2.4 and 2.7 {angstrom}. Three template 18-mer-primer 13-mer sequences, 5'-d(TCACXAAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTT)-3' (template I), 5'-d(TCACXGAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTC)-3' (template II), and 5'-d(TCATXGAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTC)-3' (template III), where X is PdG, were analyzed. With templates I and II, diffracting ternary complexes including dGTP were obtained. The dGTP did not pair with PdG, but instead with the 5'-neighboring templatemore » dC, utilizing Watson-Crick geometry. Replication bypass experiments with the template-primer 5?-TCACXAAATCCTTACGAGCATCGCCCCC-3'{center_dot}5'-GGGGGCGATGCTCGTAAGGATTT-3', where X is PdG, which includes PdG in the 5'-CXA-3' template sequence as in template I, showed that the Dpo4 polymerase inserted dGTP and dATP when challenged by the PdG adduct. For template III, in which the template sequence was 5'-TXG-3', a diffracting ternary complex including dATP was obtained. The dATP did not pair with PdG, but instead with the 5'-neighboring T, utilizing Watson-Crick geometry. Thus, all three ternary complexes were of the 'type II' structure described for ternary complexes with native DNA [Ling, H., Boudsocq, F., Woodgate, R., and Yang, W. (2001) Cell 107, 91--102]. The PdG adduct remained in the anti conformation about the glycosyl bond in each of these threee ternary complexes. These results provide insight into how -1 frameshift mutations might be generated for the PdG adduct, a structural model for the exocylic M{sub 1}dG adduct formed by malondialdehyde.« less

Isolation and characterization of novel microsatellite markers and their application for diversity assessment in cultivated groundnut (Arachis hypogaea)

PubMed Central

Cuc, Luu M; Mace, Emma S; Crouch, Jonathan H; Quang, Vu D; Long, Tran D; Varshney, Rajeev K

2008-01-01

Background Cultivated peanut or groundnut (Arachis hypogaea L.) is the fourth most important oilseed crop in the world, grown mainly in tropical, subtropical and warm temperate climates. Due to its origin through a single and recent polyploidization event, followed by successive selection during breeding efforts, cultivated groundnut has a limited genetic background. In such species, microsatellite or simple sequence repeat (SSR) markers are very informative and useful for breeding applications. The low level of polymorphism in cultivated germplasm, however, warrants a need of larger number of polymorphic microsatellite markers for cultivated groundnut. Results A microsatellite-enriched library was constructed from the genotype TMV2. Sequencing of 720 putative SSR-positive clones from a total of 3,072 provided 490 SSRs. 71.2% of these SSRs were perfect type, 13.1% were imperfect and 15.7% were compound. Among these SSRs, the GT/CA repeat motifs were the most common (37.6%) followed by GA/CT repeat motifs (25.9%). The primer pairs could be designed for a total of 170 SSRs and were optimized initially on two genotypes. 104 (61.2%) primer pairs yielded scorable amplicon and 46 (44.2%) primers showed polymorphism among 32 cultivated groundnut genotypes. The polymorphic SSR markers detected 2 to 5 alleles with an average of 2.44 per locus. The polymorphic information content (PIC) value for these markers varied from 0.12 to 0.75 with an average of 0.46. Based on 112 alleles obtained by 46 markers, a phenogram was constructed to understand the relationships among the 32 genotypes. Majority of the genotypes representing subspecies hypogaea were grouped together in one cluster, while the genotypes belonging to subspecies fastigiata were grouped mainly under two clusters. Conclusion Newly developed set of 104 markers extends the repertoire of SSR markers for cultivated groundnut. These markers showed a good level of PIC value in cultivated germplasm and therefore would be very useful for germplasm analysis, linkage mapping, diversity studies and phylogenetic relationships in cultivated groundnut as well as related Arachis species. PMID:18482440

Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

PubMed

Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

2016-10-01

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

PubMed

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular genetic variation and structure of Southeast Asian crocodile (Tomistoma schlegelii): Comparative potentials of SSRs versus ISSRs.

PubMed

Shafiei-Astani, Behnam; Ong, Alan Han Kiat; Valdiani, Alireza; Tan, Soon Guan; Yien, Christina Yong Seok; Ahmady, Fatemeh; Alitheen, Noorjahan Banu; Ng, Wei Lun; Kuar, Taranjeet

2015-10-15

Tomistoma schlegelii, also referred to as the "false gharial", is one of the most exclusive and least known of the world's fresh water crocodilians, limited to Southeast Asia. Indeed, lack of economic value for its skin has led to neglect the biodiversity of the species. The current study aimed to investigate the mentioned case using 40 simple sequence repeat (SSR) primer pairs and 45 inter-simple sequence repeat (ISSR) primers. DNA analysis of 17 T. schlegelii samples using the SSR and ISSR markers resulted in producing a total of 49 and 108 polymorphic bands, respectively. Furthermore, the SSR- and ISSR-based cluster analyses both generated two main clusters. However, the SSR based results were found to be more in line with the geographical distributions of the crocodile samples collected across the country as compared with the ISSR-based results. The observed heterozygosity (HO) and expected heterozygosity (HE) of the polymorphic SSRs ranged between 0.588-1 and 0.470-0.891, respectively. The present results suggest that the Malaysian T. schlegelii populations had originated from a core population of crocodiles. In cooperation with the SSR markers, the ISSRs showed high potential for studying the genetic variation of T. schlegelii, and these markers are suitable to be employed in conservation genetic programs of this endangered species. Both SSR- and ISSR-based STRUCTURE analyses suggested that all the individuals of T. schlegelii are genetically similar with each other. Copyright © 2015 Elsevier B.V. All rights reserved.

Genetic Diversity Analysis of Medicinally Important Horticultural Crop Aegle marmelos by ISSR Markers.

PubMed

Mujeeb, Farina; Bajpai, Preeti; Pathak, Neelam; Verma, Smita Rastogi

2017-01-01

Inter simple sequence repeat (ISSR) markers help in identifying and determining the extent of genetic diversity in cultivars. Here, we describe their application in determining the genetic diversity of bael (Aegle marmelos Corr.). Universal ISSR primers are selected and their marker characteristics such as polymorphism information content, effective multiplex ratio and marker index have been evaluated. ISSR-PCR is then performed using universal ISSR primers to generate polymorphic bands. This information is used to determine the degree of genetic similarity among the bael varieties/accessions by cluster analysis using unweighted pair-group method with arithmetic averages (UPGMA). This technology is valuable for biodiversity conservation and for making an efficient choice of parents in breeding programs.

Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

PubMed Central

Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S; Pedersen, Susanne K; Leekitcharoenphon, Pimlapas; Hansen, Inge M; Guerra, Beatriz; Malorny, Burkhard; Borowiak, Maria; Hammerl, Jens Andre; Battisti, Antonio; Franco, Alessia; Alba, Patricia; Perrin-Guyomard, Agnes; Granier, Sophie A; De Frutos Escobar, Cristina; Malhotra-Kumar, Surbhi; Villa, Laura; Carattoli, Alessandra; Hendriksen, Rene S

2018-01-01

Background and aim Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriaceae was developed for surveillance or research purposes. Methods: We designed four new primer pairs to amplify mcr-1, mcr-2, mcr-3 and mcr-4 gene products and used the originally described primers for mcr-5 to obtain a stepwise separation of ca 200 bp between amplicons. The primer pairs and amplification conditions allow for single or multiple detection of all currently described mcr genes and their variants present in Enterobacteriaceae. The protocol was validated testing 49 European Escherichia coli and Salmonella isolates of animal origin. Results: Multiplex PCR results in bovine and porcine isolates from Spain, Germany, France and Italy showed full concordance with whole genome sequence data. The method was able to detect mcr-1, mcr-3 and mcr-4 as singletons or in different combinations as they were present in the test isolates. One new mcr-4 variant, mcr-4.3, was also identified. Conclusions: This method allows rapid identification of mcr-positive bacteria and overcomes the challenges of phenotypic detection of colistin resistance. The multiplex PCR should be particularly interesting in settings or laboratories with limited resources for performing genetic analysis as it provides information on the mechanism of colistin resistance without requiring genome sequencing. PMID:29439754

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

DNA damage and genetic methylation changes caused by Cd in Arabidopsis thaliana seedlings.

PubMed

Li, Zhaoling; Liu, Zhihong; Chen, Ruijuan; Li, Xiaojun; Tai, Peidong; Gong, Zongqiang; Jia, Chunyun; Liu, Wan

2015-09-01

Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MASP) techniques are sensitive to deoxyribonucleic acid (DNA) damage and genetic methylation, respectively. Using these 2 techniques, Arabidopsis thaliana cultured with 0 mg/L (control), 0.5 mg/L, 1.5 mg/L, and 5.0 mg/L Cd(2+) for 16 d was used to analyze the DNA damage and methylation changes as a result of cadmium (Cd). The DNA was amplified by 14 AFLP primer pairs and 13 MSAP primer combinations. In the AFLP experiment, 62 polymorphic sites were found in the patterns of 11 primer combinations and a total of 1116 fragments were obtained in these patterns. There were no polymorphic bands in the remaining 3 pairs. The proportions of polymorphic sites in the 0.5-mg/L Cd(2+) and 5.0-mg/L Cd(2+) treatments were significantly different. Seven polymorphic fragments were then separated and successfully sequenced, yielding 6 nucleobase substitutions and 1 nucleobase deletion. Similarly, in the MSAP experiment, the MSAP% and number of demethylated-type bands were unchanged after Cd treatment, but the number of methylated-type bands was increased significantly in the 5.0-mg/L Cd(2+) treatment group, a finding that may be associated with the AFLP results. The polymorphic bands were also sequenced and the functions of their homologous genes were determined. The DNA damage and methylation changes may be the primary cause of certain pathology changes as a result of Cd uptake in plants. © 2015 SETAC.

Detection of norovirus (GI, GII), Sapovirus and astrovirus in fecal samples using reverse transcription single-round multiplex PCR.

PubMed

Yan, Hainian; Yagyu, Fumihiro; Okitsu, Shoko; Nishio, Osamu; Ushijima, Hiroshi

2003-12-01

A reverse transcription (RT) single-round multiplex polymerase chain reaction (smPCR) assay was developed to detect simultaneously Norovirus genogroup I and II, Sapovirus and astrovirus. A total of 377 diarrhea stool samples (screened for rotavirus- and adenorivus-negative) from four regions in Japan during July 2000 to June 2001 were examined by RT-smPCR. The positive rate was 16.4% (62 out of 377 stool samples). Norovirus, Sapovirus and astrovirus were detected in 42, 16, 4 of 60 positive samples, respectively. Coinfection was not found in these samples. Infections occurred mainly in November, December and January. The key elements of the RT-smPCR are (i) the cDNA synthesis with the Superscript RTII and random primer at 42 degrees C for 1 h, at 99 degrees C for 5 min, and (ii) single-round multiplex PCR by using Taq polymerase mixed together with a mixture of four different primer pairs (G1-SKF/G1-SKR for Norovirus genogroup I, COG2F/G2-SKR for Norovirus genogroup II, SLV5317/SLV5749 for Sapovirus, PreCAP1/82b for astrovirus). All of the four primer pairs amplify the capsid region of target viral genome, produce four size-specific amplicons of 330, 387, 434, 719 bp for Norovirus genogroup I and II, Sapovirus and astrovirus, respectively. This assay provides a more rapid and efficient way to detect these viruses from fecal samples in a single test, and also offers the potential for their molecular detection in food and environmental samples.

A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

PubMed

Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2017-02-01

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

PubMed Central

Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

1996-01-01

Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

Characterization and application of a quantitative DNA marker that discriminates sex in Chinook salmon (Oncorhynchus tshawytscha)

USGS Publications Warehouse

Clifton, D.R.; Rodriguez, R.J.

1997-01-01

A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

Characterization and application of a quantitative DNA marker that discriminates sex in chinook salmon (Oncorhynchus tshawytscha)

USGS Publications Warehouse

Clifton, D.R.; Rodriguez, R.J.

1997-01-01

A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

Application of RAPD for molecular characterization of plant species of medicinal value from an arid environment.

PubMed

Arif, I A; Bakir, M A; Khan, H A; Al Farhan, A H; Al Homaidan, A A; Bahkali, A H; Al Sadoon, M; Shobrak, M

2010-11-09

The use of highly discriminatory methods for the identification and characterization of genotypes is essential for plant protection and appropriate use. We utilized the RAPD method for the genetic fingerprinting of 11 plant species of desert origin (seven with known medicinal value). Andrachne telephioides, Zilla spinosa, Caylusea hexagyna, Achillea fragrantissima, Lycium shawii, Moricandia sinaica, Rumex vesicarius, Bassia eriophora, Zygophyllum propinquum subsp migahidii, Withania somnifera, and Sonchus oleraceus were collected from various areas of Saudi Arabia. The five primers used were able to amplify the DNA from all the plant species. The amplified products of the RAPD profiles ranged from 307 to 1772 bp. A total of 164 bands were observed for 11 plant species, using five primers. The number of well-defined and major bands for a single plant species for a single primer ranged from 1 to 10. The highest pair-wise similarities (0.32) were observed between A. fragrantissima and L. shawii, when five primers were combined. The lowest similarities (0) were observed between A. telephioides and Z. spinosa; Z. spinosa and B. eriophora; B. eriophora and Z. propinquum. In conclusion, the RAPD method successfully discriminates among all the plant species, therefore providing an easy and rapid tool for identification, conservation and sustainable use of these plants.

Efficacy of species-specific recA PCR tests in the identification of Burkholderia cepacia complex environmental isolates.

PubMed

Dalmastri, Claudia; Pirone, Luisa; Tabacchioni, Silvia; Bevivino, Annamaria; Chiarini, Luigi

2005-05-01

In this study, we evaluated if recA species-specific PCR assays could be successfully applied to identify environmental isolates of the widespread Burkholderia cepacia complex (Bcc) species. A total of 729 Bcc rhizosphere isolates collected in different samplings were assigned to the species B. cepacia genomovar I (61), B. cenocepacia recA lineage IIIB (514), B. ambifaria (124) and B. pyrrocinia (30), by means of recA (RFLP) analysis, and PCR tests were performed to assess sensitivity and specificity of recA species-specific primers pairs. B. cepacia genomovar I specific primers produced the expected amplicon with all isolates of the corresponding species (sensitivity, 100%), and cross-reacted with all B. pyrrocinia isolates. On the contrary, B. cenocepacia IIIB primers did not give the expected amplicon in 164 B. cenocepacia IIIB isolates (sensitivity, 68.1%), and isolates of distinct populations showed different sensitivity. B. ambifaria primers failed to amplify a recA-specific fragment only in a few isolates of this species (sensitivity, 93.5%). The absence of specific amplification in a high number of B. cenocepacia rhizosphere isolates indicates that recA specific PCR assays can lead to an underestimation of environmental microorganisms belonging to this bacterial species.

454 Pyrosequencing to Describe Microbial Eukaryotic Community Composition, Diversity and Relative Abundance: A Test for Marine Haptophytes

PubMed Central

Egge, Elianne; Bittner, Lucie; Andersen, Tom; Audic, Stéphane; de Vargas, Colomban; Edvardsen, Bente

2013-01-01

Next generation sequencing of ribosomal DNA is increasingly used to assess the diversity and structure of microbial communities. Here we test the ability of 454 pyrosequencing to detect the number of species present, and assess the relative abundance in terms of cell numbers and biomass of protists in the phylum Haptophyta. We used a mock community consisting of equal number of cells of 11 haptophyte species and compared targeting DNA and RNA/cDNA, and two different V4 SSU rDNA haptophyte-biased primer pairs. Further, we tested four different bioinformatic filtering methods to reduce errors in the resulting sequence dataset. With sequencing depth of 11000–20000 reads and targeting cDNA with Haptophyta specific primers Hap454 we detected all 11 species. A rarefaction analysis of expected number of species recovered as a function of sampling depth suggested that minimum 1400 reads were required here to recover all species in the mock community. Relative read abundance did not correlate to relative cell numbers. Although the species represented with the largest biomass was also proportionally most abundant among the reads, there was generally a weak correlation between proportional read abundance and proportional biomass of the different species, both with DNA and cDNA as template. The 454 sequencing generated considerable spurious diversity, and more with cDNA than DNA as template. With initial filtering based only on match with barcode and primer we observed 100-fold more operational taxonomic units (OTUs) at 99% similarity than the number of species present in the mock community. Filtering based on quality scores, or denoising with PyroNoise resulted in ten times more OTU99% than the number of species. Denoising with AmpliconNoise reduced the number of OTU99% to match the number of species present in the mock community. Based on our analyses, we propose a strategy to more accurately depict haptophyte diversity using 454 pyrosequencing. PMID:24069303

Development and Characterization of a Psathyrostachys huashanica Keng 7Ns Chromosome Addition Line with Leaf Rust Resistance

PubMed Central

Du, Wanli; Wang, Jing; Wang, Liangming; Zhang, Jun; Chen, Xinhong; Zhao, Jixin; Yang, Qunhui; Wu, Jun

2013-01-01

The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs) disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH), EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422) were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s). Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs. PMID:23976963