Isolation and characterization of novel microsatellite markers from the sika deer (Cervus nippon) genome.

PubMed

Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H

2015-09-28

Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.

Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

PubMed

Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

2018-02-01

The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

Amplification of the Gp41 gene for detection of mutations conferring resistance to HIV-1 fusion inhibitors on genotypic assay

NASA Astrophysics Data System (ADS)

Tanumihardja, J.; Bela, B.

2017-08-01

Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.

PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

PubMed

Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

2017-01-24

The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

PubMed

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Sex identification of four penguin species using locus-specific PCR.

PubMed

Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

2013-01-01

Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

PubMed

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-11-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

PubMed Central

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-01-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

PubMed Central

Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

2013-01-01

We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

PubMed

Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

2014-09-01

Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

PubMed Central

Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

2014-01-01

Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

Microsatellite primers for red drum (Sciaenops ocellatus)

USDA-ARS?s Scientific Manuscript database

In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

Dual Priming Oligonucleotides for Broad-Range Amplification of the Bacterial 16S rRNA Gene Directly from Human Clinical Specimens

PubMed Central

Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.

2012-01-01

Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or negative. We evaluated two conventional primer pairs in common use and a new primer pair based on the dual priming oligonucleotide (DPO) principle. Cross-reactivity was observed when both conventional primer pairs were used, resulting in interpretation difficulties. No cross-reactivity was observed using the DPOs even in specimens with a high ratio of human to bacterial DNA. In addition to reducing cross-reactivity, the DPO principle also offers a high degree of flexibility in the design of primers and should be considered for any PCR assay intended for detection and identification of pathogens directly from human clinical specimens. PMID:22278843

Development of highly polymorphic EST-SSR markers and segregation in F₁ hybrid population of Vitis vinifera L.

PubMed

Kayesh, E; Zhang, Y Y; Liu, G S; Bilkish, N; Sun, X; Leng, X P; Fang, J G

2013-09-23

The objectives of this investigation were to develop and validate the expressed sequence tag (EST)-simple sequence repeat (SSR) markers from large EST sequences, and to study the segregation and distribution of SSRs within two grapevine parental lines. In total, 94 F₁ lines crossed between "Early Rose" and "Red Globe" were studied. Approximately 2100 EST-SSR sequences of Vitis vinifera L. were searched for SSRs and analyzed for the design of polymerase chain reaction (PCR) primers amplifying the SSR-rich regions. Trinucleotide repeats were found to be the most abundant, followed by other nucleotide repeats. A total of 182 SSR primer pairs were first developed for the study on the parental polymorphism. Among the 182 SSR primers, 142 primer pairs (78%) could amplify the anticipated PCR products, among which only 52 primer pairs (36.62%) showed polymorphism between the two parents. These polymorphic bands were further surveyed among the 94 F₁ lines, and the results showed that a total of 162 bands were amplified, and 98 of them were polymorphic in both parents (60.86% polymorphism), with an average of 1.88 polymorphic DNA bands for each primer pair. After testing with the chi-square test, 33 of the clearly amplified polymorphic bands followed a 3:1 ratio, and 37 followed a 1:1 ratio. The rest showed distorted segregation ratios.

Genome-Wide Identification and Transferability of Microsatellite Markers between Palmae Species

PubMed Central

Xiao, Yong; Xia, Wei; Ma, Jianwei; Mason, Annaliese S.; Fan, Haikuo; Shi, Peng; Lei, Xintao; Ma, Zilong; Peng, Ming

2016-01-01

The Palmae family contains 202 genera and approximately 2800 species. Except for Elaeis guineensis and Phoenix dactylifera, almost no genetic and genomic information is available for Palmae species. Therefore, this is an obstacle to the conservation and genetic assessment of Palmae species, especially those that are currently endangered. The study was performed to develop a large number of microsatellite markers which can be used for genetic analysis in different Palmae species. Based on the assembled genome of E. guineensis and P. dactylifera, a total of 814 383 and 371 629 microsatellites were identified. Among these microsatellites identified in E. guineensis, 734 509 primer pairs could be designed from the flanking sequences of these microsatellites. The majority (618 762) of these designed primer pairs had in silico products in the genome of E. guineensis. These 618 762 primer pairs were subsequently used to in silico amplify the genome of P. dactylifera. A total of 7 265 conserved microsatellites were identified between E. guineensis and P. dactylifera. One hundred and thirty-five primer pairs flanking the conserved SSRs were stochastically selected and validated to have high cross-genera transferability, varying from 16.7 to 93.3% with an average of 73.7%. These genome-wide conserved microsatellite markers will provide a useful tool for genetic assessment and conservation of different Palmae species in the future. PMID:27826307

[SSR loci information analysis in transcriptome of Andrographis paniculata].

PubMed

Li, Jun-Ren; Chen, Xiu-Zhen; Tang, Xiao-Ting; He, Rui; Zhan, Ruo-Ting

2018-06-01

To study the SSR loci information and develop molecular markers, a total of 43 683 Unigenes in transcriptome of Andrographis paniculata were used to explore SSR. The distribution frequency of SSR and the basic characteristics of repeat motifs were analyzed using MicroSAtellite software, SSR primers were designed by Primer 3.0 software and then validated by PCR. Moreover, the gene function analysis of SSR Unigene was obtained by Blast. The results showed that 14 135 SSR loci were found in the transcriptome of A. paniculata, which distributed in 9 973 Unigenes with a distribution frequency of 32.36%. Di-nucleotide and Tri-nucleotide repeat were the main types, accounted for 75.54% of all SSRs. The repeat motifs of AT/AT and CCG/CGG were the predominant repeat types of Di-nucleotide and Tri-nucleotide, respectively. A total of 4 740 pairs of SSR primers with the potential to produce polymorphism were designed for maker development. Ten pairs of primers in 20 pairs of randomly picked primers produced fragments with expected molecular size. The gene function of Unigenes containing SSR were mostly related to the basic metabolism function of A. paniculata. The SSR markers in transcriptome of A. paniculata show rich type, strong specificity and high potential of polymorphism, which will benefit the candidate gene mining and marker-assisted breeding. Copyright© by the Chinese Pharmaceutical Association.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

PubMed Central

2014-01-01

Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

PubMed Central

2009-01-01

Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

Optimization of polymerase chain reaction for detection of Clostridium botulinum type C and D in bovine samples.

PubMed

Prévot, V; Tweepenninckx, F; Van Nerom, E; Linden, A; Content, J; Kimpe, A

2007-01-01

Botulism is a rare but serious paralytic illness caused by a nerve toxin that is produced by the bacterium Clostridium botulinum. The economic, medical and alimentary consequences can be catastrophic in case of an epizooty. A polymerase chain reaction (PCR)-based assay was developed for the detection of C. botulinum toxigenic strains type C and D in bovine samples. This assay has proved to be less expensive, faster and simpler to use than the mouse bioassay, the current reference method for diagnosis of C. botulinum toxigenic strains. Three pairs of primers were designed, one for global detection of C. botulinum types C and D (primer pair Y), and two strain-specific pairs specifically designed for types C (primer pair VC) and D (primer pair VD). The PCR amplification conditions were optimized and evaluated on 13 bovine and two duck samples that had been previously tested by the mouse bioassay. In order to assess the impact of sample treatment, both DNA extracted from crude samples and three different enrichment broths (TYG, CMM, CMM followed by TYG) were tested. A 100% sensitivity was observed when samples were enriched for 5 days in CMM followed by 1 day in TYG broth. False-negative results were encountered when C. botulinum was screened for in crude samples. These findings indicate that the current PCR is a reliable method for the detection of C. botulinum toxigenic strains type C and D in bovine samples but only after proper enrichment in CMM and TYG broth.

A PMB Primer.

ERIC Educational Resources Information Center

Whetstone, B. D.; Yates, Benny

This primer introduces the basics of Program Management and Budgeting (PMB) in an effort to demonstrate how PMB can benefit school systems. Short quotes from previous publications on the topic are paired with cartoons designed to clarify the purposes and workings of the program. The publication begins by defining PMB as an alternative financial…

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

PubMed Central

2013-01-01

Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

Transcriptional Analysis of In vivo Plasmodium yoelii Liver Stage Gene Expression

DTIC Science & Technology

2005-04-26

reaction was added to a PCR master mix with one of several oligonucleotide primer pairs (Table S6). The primers were designed and the specific conditions ...Koonin EV. Using the COG database to improve gene recognition in complete genomes. Genetica 2000;108:9–17. 26] Florens L, Washburn MP, Raine JD, et al

Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

PubMed Central

Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

2013-01-01

Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

PubMed

Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

2014-11-01

To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

The development and mapping of functional markers in Fragaria and their transferability and potential for mapping in other genera.

PubMed

Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R

2007-01-01

We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.

One-Tube-Only Standardized Site-Directed Mutagenesis: An Alternative Approach to Generate Amino Acid Substitution Collections

PubMed Central

Mingo, Janire; Erramuzpe, Asier; Luna, Sandra; Aurtenetxe, Olaia; Amo, Laura; Diez, Ibai; Schepens, Jan T. G.; Hendriks, Wiljan J. A. J.; Cortés, Jesús M.; Pulido, Rafael

2016-01-01

Site-directed mutagenesis (SDM) is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis. PMID:27548698

A blackberry (Rubus L.) expressed sequence tag library for the development of simple sequence repeat markers

PubMed Central

Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P

2008-01-01

Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry. PMID:18570660

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities.

PubMed

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-11-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* #

PubMed Central

Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

2014-01-01

Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

DNA barcoding amphibians and reptiles.

PubMed

Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

2012-01-01

Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

PubMed

Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

2009-08-01

Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

Species-Specific Detection of Mycosphaerella polygoni-cuspidati as a Biological Control Agent for Fallopia japonica by PCR Assay.

PubMed

Kurose, Daisuke; Furuya, Naruto; Saeki, Tetsuya; Tsuchiya, Kenichi; Tsushima, Seiya; Seier, Marion K

2016-10-01

The ascomycete fungus Mycosphaerella polygoni-cuspidati has been undergoing evaluation as a potential classical biological control agent for the invasive weed Fallopia japonica (Japanese knotweed), which has become troublesome in Europe and North America. In advance of the potential release of a biocontrol agent into a new environment, it is crucial to develop an effective monitoring system to enable the evaluation of agent establishment and dispersal within the target host population, as well as any potential attacks on non-target species. Therefore, a primer pair was designed for direct, rapid, and specific detection of the Japanese knotweed pathogen M. polygoni-cuspidati based on the sequences of the internal transcribed spacer regions including the 5.8S rDNA. A PCR product of approximately 298 bp was obtained only when the DNA extracted from mycelial fragments of M. polygoni-cuspidati was used. The lower limit of detection of the PCR method was 100 fg of genomic DNA. Using the specific primer pair, M. polygoni-cuspidati could be detected from both naturally and artificially infected Japanese knotweed plants. No amplification was observed for other Mycosphaerella spp. or fungal endophytes isolated from F. japonica. The designed primer pair is thus effective for the specific detection of M. polygoni-cuspidati in planta.

A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize.

PubMed

Matsuoka, T; Kuribara, H; Akiyama, H; Miura, H; Goda, Y; Kusakabe, Y; Isshiki, K; Toyoda, M; Hino, A

2001-02-01

Seven lines of genetically modified (GM) maize have been authorized in Japan as foods and feeds imported from the USA. We improved a multiplex PCR method described in the previous report in order to distinguish the five lines of GM maize. Genomic DNA was extracted from GM maize with a silica spin column kit, which could reduce experimental time and improve safety in the laboratory and potentially in the environment. We sequenced recombinant DNA (r-DNA) introduced into GM maize, and re-designed new primer pairs to increase the specificity of PCR to distinguish five lines of GM maize by multiplex PCR. A primer pair for the maize intrinsic zein gene (Ze1) was also designed to confirm the presence of amplifiable maize DNA. The lengths of PCR products using these six primer pairs were different. The Ze1 and the r-DNAs from the five lines of GM maize were qualitatively detected in one tube. The specific PCR bands were distinguishable from each other on the basis of the expected length. The r-DNA could be detected from maize samples containing 0.5% of each of the five lines of GM maize. The sensitivity would be acceptable to secure the verification of non-GMO materials and to monitor the reliability of the labeling system.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

PubMed

Kokosková, B; Mráz, I; Fousek, J

2010-05-01

Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

Isolation and characterization of microsatellite markers for Cotinus coggygria Scop. (Anacardiaceae) by 454 pyrosequencing.

PubMed

Wang, Wei; Li, Zhuo; Li, Yong

2014-03-24

Cotinus coggygria Scop. (Anacardiaceae) is a deciduous shrub or small tree that is native to a large area covering from southern Europe, east across central Asia, and the Himalayas in northern China. Shotgun 454 pyrosequencing was used to develop microsatellite markers from the genome of C. coggygria. In this study, 349 microsatellite loci were identified from 40,074 individual sequence reads produced by one-sixteenth run, and primer pairs were designed for these loci. To test the primer amplification efficiency, 50 microsatellite primer pairs were tested across 12 individuals from two C. coggygria populations (Wuzhi Mountain: 36°30'N, 113°39'E; Tianlong Mountain: 37°42'N, 112°26'E). Among the 50 tested primer pairs, eight were found to be polymorphic. The average allele number of the microsatellites was 3.5 per locus, with a range from two to five. The inbreeding coefficient ranged from -0.478 to 0.222. The observed and expected heterozygosities varied from 0.167 to 0.750 and from 0.163 to 0.743, respectively. This set of markers is potentially useful for assessing the genetic diversity, as well as for understanding the population structure and phylogeographical and landscape genetic patterns, of C. coggygria.

A rapid method for differentiating Saccharomyces sensu stricto strains from other yeast species in an enological environment.

PubMed

Nardi, Tiziana; Carlot, Milena; De Bortoli, Elena; Corich, Viviana; Giacomini, Alessio

2006-11-01

During programs for the selection of enological yeasts, several hundred natural isolates are usually screened. The scope of these operations is to isolate strains possessing good fermentative properties without necessarily arriving at a precise species designation: in other words, to detect strains belonging to the Saccharomyces sensu stricto complex. In the present study, a pair of primers, designed within the variable D1/D2 region of the 26S subunit of ribosomal yeast RNA, have been constructed. These generate an amplification fragment of 471 bp that is specific for the seven Saccharomyces sensu stricto species, while no signal was obtained for Saccharomyces sensu lato strains (17 species) or for another 18 selected species commonly found in enological environments. A second pair of primers was also constructed, within the 18S rRNA gene, composed of perfectly conserved sequences common for all 42 yeast species examined, which generate a 900 bp (c.) band for all strains. This was used as a positive experimental control in multiplex PCR analysis using all four primers.

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

PubMed

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.

PubMed

Prevost, S; Andre, S; Remize, F

2010-12-01

Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.

Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

PubMed

Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

2016-07-01

The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

PubMed

Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

1996-04-15

A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

The Choice of PCR Primers Has Great Impact on Assessments of Bacterial Community Diversity and Dynamics in a Wastewater Treatment Plant

PubMed Central

Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie

2013-01-01

Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498

Host-associated bacterial taxa from Chlorobi, Chloroflexi, GN02, Synergistetes, SR1, TM7, and WPS-2 Phyla/candidate divisions

PubMed Central

Camanocha, Anuj; Dewhirst, Floyd E.

2014-01-01

Background and objective In addition to the well-known phyla Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, Spirochaetes, Fusobacteria, Tenericutes, and Chylamydiae, the oral microbiomes of mammals contain species from the lesser-known phyla or candidate divisions, including Synergistetes, TM7, Chlorobi, Chloroflexi, GN02, SR1, and WPS-2. The objectives of this study were to create phyla-selective 16S rDNA PCR primer pairs, create selective 16S rDNA clone libraries, identify novel oral taxa, and update canine and human oral microbiome databases. Design 16S rRNA gene sequences for members of the lesser-known phyla were downloaded from GenBank and Greengenes databases and aligned with sequences in our RNA databases. Primers with potential phylum level selectivity were designed heuristically with the goal of producing nearly full-length 16S rDNA amplicons. The specificity of primer pairs was examined by making clone libraries from PCR amplicons and determining phyla identity by BLASTN analysis. Results Phylum-selective primer pairs were identified that allowed construction of clone libraries with 96–100% specificity for each of the lesser-known phyla. From these clone libraries, seven human and two canine novel oral taxa were identified and added to their respective taxonomic databases. For each phylum, genome sequences closest to human oral taxa were identified and added to the Human Oral Microbiome Database to facilitate metagenomic, transcriptomic, and proteomic studies that involve tiling sequences to the most closely related taxon. While examining ribosomal operons in lesser-known phyla from single-cell genomes and metagenomes, we identified a novel rRNA operon order (23S-5S-16S) in three SR1 genomes and the splitting of the 23S rRNA gene by an I-CeuI-like homing endonuclease in a WPS-2 genome. Conclusions This study developed useful primer pairs for making phylum-selective 16S rRNA clone libraries. Phylum-specific libraries were shown to be useful for identifying previously unrecognized taxa in lesser-known phyla and would be useful for future environmental and host-associated studies. PMID:25317252

Diversity Measures in Environmental Sequences Are Highly Dependent on Alignment Quality—Data from ITS and New LSU Primers Targeting Basidiomycetes

PubMed Central

Fischer, Christiane; Daniel, Rolf; Wubet, Tesfaye

2012-01-01

The ribosomal DNA comprised of the ITS1-5.8S-ITS2 regions is widely used as a fungal marker in molecular ecology and systematics but cannot be aligned with confidence across genetically distant taxa. In order to study the diversity of Agaricomycotina in forest soils, we designed primers targeting the more alignable 28S (LSU) gene, which should be more useful for phylogenetic analyses of the detected taxa. This paper compares the performance of the established ITS1F/4B primer pair, which targets basidiomycetes, to that of two new pairs. Key factors in the comparison were the diversity covered, off-target amplification, rarefaction at different Operational Taxonomic Unit (OTU) cutoff levels, sensitivity of the method used to process the alignment to missing data and insecure positional homology, and the congruence of monophyletic clades with OTU assignments and BLAST-derived OTU names. The ITS primer pair yielded no off-target amplification but also exhibited the least fidelity to the expected phylogenetic groups. The LSU primers give complementary pictures of diversity, but were more sensitive to modifications of the alignment such as the removal of difficult-to align stretches. The LSU primers also yielded greater numbers of singletons but also had a greater tendency to produce OTUs containing sequences from a wider variety of species as judged by BLAST similarity. We introduced some new parameters to describe alignment heterogeneity based on Shannon entropy and the extent and contents of the OTUs in a phylogenetic tree space. Our results suggest that ITS should not be used when calculating phylogenetic trees from genetically distant sequences obtained from environmental DNA extractions and that it is inadvisable to define OTUs on the basis of very heterogeneous alignments. PMID:22363808

Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

PubMed

Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

2016-09-01

Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

Development of a PCR protocol to detect aflatoxigenic molds in food products.

PubMed

Luque, M Isabel; Rodríguez, Alicia; Andrade, María J; Martín, Alberto; Córdoba, Juan J

2012-01-01

Aflatoxins are secondary metabolites produced mainly by Aspergillus species growing in foodstuffs. Because aflatoxins have important health effects, the detection of early contamination of foods by aflatoxigenic molds should be useful. In the present work, a reliable conventional PCR method for detecting aflatoxigenic molds of various species was developed. Fifty-six aflatoxigenic and nonaflatoxigenic strains commonly reported in foodstuffs were tested. Aflatoxin production was first confirmed by micellar electrokinetic capillary electrophoresis or/and high-pressure liquid chromatography-mass spectrometry. Based on the conserved regions of the O-methyltransferase gene (omt-1) involved in the aflatoxin biosynthetic pathway, six primer pairs were designed. With only the designed primer pair AFF1-AFR3, the expected PCR product (381 bp) was obtained in all of the tested aflatoxigenic strains of various species and genera. Amplification products were not obtained with this primer pair for any of the nonaflatoxigenic reference molds. However, an amplicon of 453 bp was obtained for all aflatoxigenic and nonaflatoxigenic mold reference strains with a PCR protocol based on the constitutive fungal β-tubulin gene, which was used as a positive fungal control. The PCR protocol based on omt-1 detected as little as 15 pg of DNA from aflatoxigenic molds and 10(2) to 10(3) CFU/g in contaminated food samples. This PCR protocol should be used as a routine technique to detect aflatoxigenic molds in foods.

Evaluation of a computer-based approach to teaching acid/base physiology.

PubMed

Rawson, Richard E; Quinlan, Kathleen M

2002-12-01

Because acid/base physiology is a difficult subject for most medical and veterinary students, the first author designed a software program, Acid/Base Primer, that would help students with this topic. The Acid/Base Primer was designed and evaluated within a conceptual framework of basic educational principles. Seventy-five first-year veterinary students (of 81; 93% response rate) participated in this study. Students took both a pre- and posttest of content understanding. After completing the Acid/Base Primer in pairs, each student filled out a survey evaluating the features of the program and describing his/her use and experience of it. Four pairs of students participated in interviews that elaborated on the surveys. Scores improved from 53 +/- 2% on the pretest to 74 +/- 1% on an immediate posttest. On surveys and in interviews, students reported that the program helped them construct their own understanding of acid/base physiology and prompted discussions in pairs of students when individual understandings differed. The case-based format provided anchors and a high degree of relevance. Repetition of concepts helped students develop a more complex network of understanding. Questions in the program served to scaffold the learning process by providing direction, accentuating the relevant features of the cases, and provoking discussion. Guidelines for software development were generated on the basis of the findings and relevant educational literature.

MRPrimerV: a database of PCR primers for RNA virus detection

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

2017-01-01

Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan.

PubMed

Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro

2016-10-11

Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.

Matrilineage differentiation of the genus Tetragonisca using mitochondrial DNA markers and the polymerase chain reaction-restriction fragment length polymorphism technique.

PubMed

Santos, S A; Bronzato, A R; Moreira, B M T; Araujo, K F; Ronqui, L; Mangolin, C A; Toledo, V A A; Ruvolo-Takasusuki, M C C

2015-10-21

The Meliponinae are important pollinators of plant species, and one of the most managed species is Tetragonisca angustula. Initially, two subspecies were identified in T. angustula: T. angustula angustula and T. angustula fiebrigi. Subsequently, T. a. fiebrigi was considered a species, based on the coloration of its mesepisternum. The objective of the present study was to obtain genetic markers that could differentiate the two species by amplifying regions of mitochondrial DNA and conducting polymerase chain reaction-restriction fragment length polymorphism analysis. Worker bees were collected in three Brazilian states: Paraná (Maringá, Altônia, and Foz do Iguaçu), São Paulo (Dracena, São Carlos, and Santa Cruz do Rio Pardo), and Rondônia (Ariquemes). Ten pairs of insect heterologous primers were tested and four were used (primer pair 1, ND2 and COI; primer pair 2, COI; primer pair 8, 16S and 12S; and primer pair 9, COII). For the restriction analysis, 13 enzymes were tested: EcoRI, EcoRV, HindIII, HinfI, RsaI, PstI, XbaI, HaeIII, ClaI, XhoI, BglII, PvuII, and ScaI. Markers were obtained (primer pair 8 cleaved with EcoRV and XbaI and primer pair 9 cleaved with HaeIII, RsaI, and XbaI) that enabled matrilineage identification in the nests studied, which confirmed that hybridization could occur between both Tetragonisca species. The beginning of speciation was probably recent, and secondary contact has resulted in crosses between T. angustula females and T. fiebrigi males. Because of this hybridization, it would be appropriate to consider them as two subspecies of T. angustula.

Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

PubMed

Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

2014-11-01

In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

Significant variance in genetic diversity among populations of Schistosoma haematobium detected using microsatellite DNA loci from a genome-wide database.

PubMed

Glenn, Travis C; Lance, Stacey L; McKee, Anna M; Webster, Bonnie L; Emery, Aidan M; Zerlotini, Adhemar; Oliveira, Guilherme; Rollinson, David; Faircloth, Brant C

2013-10-17

Urogenital schistosomiasis caused by Schistosoma haematobium is widely distributed across Africa and is increasingly being targeted for control. Genome sequences and population genetic parameters can give insight into the potential for population- or species-level drug resistance. Microsatellite DNA loci are genetic markers in wide use by Schistosoma researchers, but there are few primers available for S. haematobium. We sequenced 1,058,114 random DNA fragments from clonal cercariae collected from a snail infected with a single Schistosoma haematobium miracidium. We assembled and aligned the S. haematobium sequences to the genomes of S. mansoni and S. japonicum, identifying microsatellite DNA loci across all three species and designing primers to amplify the loci in S. haematobium. To validate our primers, we screened 32 randomly selected primer pairs with population samples of S. haematobium. We designed >13,790 primer pairs to amplify unique microsatellite loci in S. haematobium, (available at http://www.cebio.org/projetos/schistosoma-haematobium-genome). The three Schistosoma genomes contained similar overall frequencies of microsatellites, but the frequency and length distributions of specific motifs differed among species. We identified 15 primer pairs that amplified consistently and were easily scored. We genotyped these 15 loci in S. haematobium individuals from six locations: Zanzibar had the highest levels of diversity; Malawi, Mauritius, Nigeria, and Senegal were nearly as diverse; but the sample from South Africa was much less diverse. About half of the primers in the database of Schistosoma haematobium microsatellite DNA loci should yield amplifiable and easily scored polymorphic markers, thus providing thousands of potential markers. Sequence conservation among S. haematobium, S. japonicum, and S. mansoni is relatively high, thus it should now be possible to identify markers that are universal among Schistosoma species (i.e., using DNA sequences conserved among species), as well as other markers that are specific to species or species-groups (i.e., using DNA sequences that differ among species). Full genome-sequencing of additional species and specimens of S. haematobium, S. japonicum, and S. mansoni is desirable to better characterize differences within and among these species, to develop additional genetic markers, and to examine genes as well as conserved non-coding elements associated with drug resistance.

Quantitative phenotyping of X-disease resistance in chokecherry using real-time PCR.

PubMed

Huang, Danqiong; Walla, James A; Dai, Wenhao

2014-03-01

A quantitative real-time SYBR Green PCR (qPCR) assay has been developed to detect and quantify X-disease phytoplasmas in chokecherry. An X-disease phytoplasma-specific and high sensitivity primer pair was designed based on the 16S rRNA gene sequence of X-disease phytoplasmas. This primer pair was specific to the 16SrIII group (X-disease) phytoplasmas. The qPCR method can quantify phytoplasmas from a DNA mix (a mix of both chokecherry and X-disease phytoplasma DNA) at as low as 0.001 ng, 10-fold lower than conventional PCR using the same primer pair. A significant correlation between the copy number of phytoplasmas and visual phenotypic rating scores of X-disease resistance in chokecherry plants was observed. Disease resistant chokecherries had a significantly lower titer of X-disease phytoplasmas than susceptible plants. This suggests that the qPCR assay provides a more objective tool to phenotype phytoplasma disease severity, particularly for early evaluation of host resistance; therefore, this method will facilitate quantitative phenotyping of disease resistance and has great potential in enhancing plant breeding. Copyright © 2013 Elsevier B.V. All rights reserved.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

PubMed Central

Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

2016-01-01

Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

The skin microbiome in psoriatic arthritis: methodology development and pilot data.

PubMed

Castelino, Madhura; Eyre, Stephen; Moat, John; Fox, Graeme; Martin, Paul; Ijaz, Umer; Quince, Christopher; Ho, Pauline; Upton, Mathew; Barton, Anne

2015-02-26

Skin microbiota are likely to be important in the development of conditions such as psoriatic arthritis. Profiling the bacterial community in the psosriatic plaques will contribute to our understanding of the role of the skin microbiome in these conditions. The aim of this work was to determine the optimum study design for work on the skin microbiome with use of the MiSeq platform. The objectives were to compare data generated from two platforms for two primer pairs in a low density mock bacterial community. DNA was obtained from two low density mock communities of 11 diverse bacterial strains (with and without human DNA supplementation) and from swabs taken from the skin of four healthy volunteers. The DNA was amplified with primer pairs covering hypervariable regions of the 16S rRNA gene: primers 63F and 519R (V1-V3), and 347F and 803R (V3-V4). The resultant libraries were indexed for the MiSeq and Roche454 platforms and sequenced. Both datasets were de-noised, cleaned of chimeras, and analysed by use of QIIME software (version 1.8.0). No significant difference in the diversity indices at the phylum and the genus level between the platforms was seen. Comparison of the diversity indices for the mock community data for the two primer pairs demonstrated that the V3-V4 hypervariable region had significantly better capture of bacterial diversity than did the V1-V3 region. Amplification with the same primer pairs showed strong concordance within each platform (98·9-99·8%), with negligible effect of spiked human DNA contamination. Comparison at the family level classification between samples processed on the MiSeq and Roche454 platforms using the V3-V4 hypervariable region also showed a high level of concordance (87%), although less so for the V1-V3 primers (10%). The pilot data from healthy volunteers were similar. Results obtained from the V3-V4 16S rRNA hypervariable region, sequencing on the MiSeq and Roche454 platforms, were concordant between replicates, and between each other. These findings suggest that the MiSeq platform, and these primers, is a comparable method for determining skin microbiota to the widely used Roche454 methodology. NIHR Manchester Musculoskeletal Biomedical Research Unit. Copyright © 2015 Elsevier Ltd. All rights reserved.

Nucleic acid amplification of HIV-1 integrase sequence subtypes CRF01_AE and B for development of HIV anti-integrase drug resistance genotyping assay

NASA Astrophysics Data System (ADS)

Adlar, F. R.; Bela, B.

2017-08-01

To anticipate the potential use of anti-integrase drugs in Indonesia for treatment of HIV-1 infection, the development of a drug resistance genotyping assay for anti-integrase is crucial in identifying the genetic drug resistance profile of Indonesian HIV-1 strains. This experiment aimed to amplify a target region in the integrase gene of Indonesian HIV-1 subtypes CRF01_AE and B that contain genetic mutations known to confer resistance to anti-integrase drug. Eleven archived plasma samples from individuals living with HIV-1 were obtained from the Virology and Cancer Pathobiology Research Center for Health Service (VCPRC FKUI-RSCM) laboratory. One of the plasma samples contained HIV-1 subtype B, and the remaining plasma samples contained subtype CRF01_AE. The target regions for all samples were amplified through RT-PCR, with an annealing temperature of 55 °C, using the primer pair AE_POL 4086F and AE_POL 5232R that were designed by VCPRC FKUI-RSCM. The results of this experiment show that 18.2% (2/11) of the samples were successfully amplified using the one-step RT-PCR. While the primer pair was effective in amplifying the target region in the integrase gene sequence for subtype B (100%; 1/1), it had a low efficacy (10%, 1/10) for subtype CRF01_AE. In conclusion, the primer pair can be used to amplify the target region in Indonesian HIV-1 strain subtypes CRF01_AE and B. However, optimization of the PCR condition and an increased number of samples would help to determine an accurate representation of the efficacy of the primer pair.

Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

PubMed Central

Huang, M M; Arnheim, N; Goodman, M F

1992-01-01

Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE PAGES

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

2015-12-09

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing.

PubMed

Li, Yong; Zhang, Weirui

2015-10-01

Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker-assisted breeding.

Evaluation of Primers Targeting the Diazotroph Functional Gene and Development of NifMAP – A Bioinformatics Pipeline for Analyzing nifH Amplicon Data

PubMed Central

Angel, Roey; Nepel, Maximilian; Panhölzl, Christopher; Schmidt, Hannes; Herbold, Craig W.; Eichorst, Stephanie A.; Woebken, Dagmar

2018-01-01

Diazotrophic microorganisms introduce biologically available nitrogen (N) to the global N cycle through the activity of the nitrogenase enzyme. The genetically conserved dinitrogenase reductase (nifH) gene is phylogenetically distributed across four clusters (I–IV) and is widely used as a marker gene for N2 fixation, permitting investigators to study the genetic diversity of diazotrophs in nature and target potential participants in N2 fixation. To date there have been limited, standardized pipelines for analyzing the nifH functional gene, which is in stark contrast to the 16S rRNA gene. Here we present a bioinformatics pipeline for processing nifH amplicon datasets – NifMAP (“NifH MiSeq Illumina Amplicon Analysis Pipeline”), which as a novel aspect uses Hidden-Markov Models to filter out homologous genes to nifH. By using this pipeline, we evaluated the broadly inclusive primer pairs (Ueda19F–R6, IGK3–DVV, and F2–R6) that target the nifH gene. To evaluate any systematic biases, the nifH gene was amplified with the aforementioned primer pairs in a diverse collection of environmental samples (soils, rhizosphere and roots samples, biological soil crusts and estuarine samples), in addition to a nifH mock community consisting of six phylogenetically diverse members. We noted that all primer pairs co-amplified nifH homologs to varying degrees; up to 90% of the amplicons were nifH homologs with IGK3–DVV in some samples (rhizosphere and roots from tall oat-grass). In regards to specificity, we observed some degree of bias across the primer pairs. For example, primer pair F2–R6 discriminated against cyanobacteria (amongst others), yet captured many sequences from subclusters IIIE and IIIL-N. These aforementioned subclusters were largely missing by the primer pair IGK3–DVV, which also tended to discriminate against Alphaproteobacteria, but amplified sequences within clusters IIIC (affiliated with Clostridia) and clusters IVB and IVC. Primer pair Ueda19F–R6 exhibited the least bias and successfully captured diazotrophs in cluster I and subclusters IIIE, IIIL, IIIM, and IIIN, but tended to discriminate against Firmicutes and subcluster IIIC. Taken together, our newly established bioinformatics pipeline, NifMAP, along with our systematic evaluations of nifH primer pairs permit more robust, high-throughput investigations of diazotrophs in diverse environments. PMID:29760683

Characterization of the Kenaf (Hibiscus cannabinus) Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers

PubMed Central

Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi

2016-01-01

Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies. PMID:26960153

Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

PubMed Central

Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

2005-01-01

A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

Gene Polymorphism Studies in a Teaching Laboratory

NASA Astrophysics Data System (ADS)

Shultz, Jeffry

2009-02-01

I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this example, students used genes annotated for the steroid biosynthesis pathway in soybean. The authoritative Kyoto encyclopedia of genes and genomes (KEGG) interactive database and other online resources were used to design primers based first on soybean expressed sequence tags (ESTs), then on ESTs from an alternate organism if soybean sequence was unavailable. Students designed a total of 50 gene-based primer pairs (37 soybean, 13 alternative) and tested these for polymorphism state and similarity between two soybean and two pea lines. Student assessment was based on acquisition of laboratory skills and successful project completion. This simple procedure illustrates conservation of genes and is not limited to soybean or pea. Cost per student estimates are included, along with a detailed protocol and flow diagram of the procedure.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

PubMed

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing1

PubMed Central

Li, Yong; Zhang, Weirui

2015-01-01

Premise of the study: Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Methods and Results: Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. Conclusions: This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding. PMID:26504683

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

Rapid identification of red-flesh loquat cultivars using EST-SSR markers based on manual cultivar identification diagram strategy.

PubMed

Li, X Y; Xu, H X; Chen, J W

2014-04-29

Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.

Development of SCoT-Based SCAR Marker for Rapid Authentication of Taxus Media.

PubMed

Hao, Juan; Jiao, Kaili; Yu, Chenliang; Guo, Hong; Zhu, Yujia; Yang, Xiao; Zhang, Siyang; Zhang, Lei; Feng, Shangguo; Song, Yaobin; Dong, Ming; Wang, Huizhong; Shen, Chenjia

2018-06-01

Taxus media is an important species in the family Taxaceae with high medicinal and commercial value. Overexploitation and illegal trade have led T. media to a severe threat of extinction. In addition, T. media and other Taxus species have similar morphological traits and are easily misidentified, particularly during the seedling stage. The purpose of this study is to develop a species-specific marker for T. media. Through a screening of 36 start codon targeted (SCoT) polymorphism primers, among 15 individuals of 4 Taxus species (T. media, T. chinensis, T. cuspidate and T. fuana), a clear species-specific DNA fragment (amplified by primer SCoT3) for T. media was identified. After isolation and sequencing, a DNA sequence with 530 bp was obtained. Based on this DNA fragment, a primer pair for the sequence-characterized amplified region marker was designed and named MHSF/MHSR. PCR analysis with primer pair MHSF/MHSR revealed a clear amplified band for all individuals of T. media but not for T. chinensis, T. cuspidate and T. fuana. Therefore, this marker can be used as a quick, efficient and reliable tool to identify T. media among other related Taxus species. The results of this study will lay an important foundation for the protection and management of T. media as a natural resource.

Transcriptome characterization and SSR discovery in large-scale loach Paramisgurnus dabryanus (Cobitidae, Cypriniformes).

PubMed

Li, Caijuan; Ling, Qufei; Ge, Chen; Ye, Zhuqing; Han, Xiaofei

2015-02-25

The large-scale loach (Paramisgurnus dabryanus, Cypriniformes) is a bottom-dwelling freshwater species of fish found mainly in eastern Asia. The natural germplasm resources of this important aquaculture species has been recently threatened due to overfishing and artificial propagation. The objective of this study is to obtain the first functional genomic resource and candidate molecular markers for future conservation and breeding research. Illumina paired-end sequencing generated over one hundred million reads that resulted in 71,887 assembled transcripts, with an average length of 1465bp. 42,093 (58.56%) protein-coding sequences were predicted; and 43,837 transcripts had significant matches to NCBI nonredundant protein (Nr) database. 29,389 and 14,419 transcripts were assigned into gene ontology (GO) categories and Eukaryotic Orthologous Groups (KOG), respectively. 22,102 (31.14%) transcripts were mapped to 302 KEGG pathways. In addition, 15,106 candidate SSR markers were identified, with 11,037 pairs of PCR primers designed. 400 primers pairs of SSR selected randomly were validated, of which 364 (91%) pairs of primers were able to produce PCR products. Further test with 41 loci and 20 large-scale loach specimens collected from the four largest lakes in China showed that 36 (87.8%) loci were polymorphic. The transcriptomic profile and SSR repertoire obtained in this study will facilitate population genetic studies and selective breeding of large-scale loach in the future. Copyright © 2015. Published by Elsevier B.V.

DIFFERENTIATION OF SCHISTOSOMA HAEMATOBIUM FROM RELATED SCHISTOSOMES BY PCR AMPLIFYING AN INTER-REPEAT SEQUENCE

PubMed Central

ABBASI, IBRAHIM; KING, CHARLES H.; STURROCK, ROBERT F.; KARIUKI, CURTIS; MUCHIRI, ERIC; HAMBURGER, JOSEPH

2008-01-01

Schistosoma haematobium infects nearly 150 million people, primarily in Africa, and is transmitted by select species of local bulinid snails. These snails can host other related trematode species as well, so that effective detection and monitoring of snails infected with S. haematobium requires a successful differentiation between S. haematobium and any closely related schistosome species. To enable differential detection of S. haematobium DNA by simple polymerase chain reaction (PCR), we designed and tested primer pairs from numerous newly identified Schistosoma DNA repeat sequences. However, all pairs tested were found unsuitable for this purpose. Differentiation of S. haematobium from S. bovis, S. mattheei, S. curassoni, and S. intercalatum (but not from S. margrebowiei) was ultimately accomplished by PCR using one primer from a newly identified repeat, Sh110, and a second primer from a known schistosomal splice-leader sequence. For evaluation of residual S. haematobium transmission after control interventions, this differentiation tool will enable accurate monitoring of infected snails in areas where S. haematobium is sympatric with the most prevalent other schistosome species. PMID:17488921

Mining and characterization of EST-SSR markers for Zingiber officinale Roscoe with transferability to other species of Zingiberaceae.

PubMed

Awasthi, Praveen; Singh, Ashish; Sheikh, Gulfam; Mahajan, Vidushi; Gupta, Ajai Prakash; Gupta, Suphla; Bedi, Yashbir S; Gandhi, Sumit G

2017-10-01

Zingiber officinale is a model spice herb, well known for its medicinal value. It is primarily a vegetatively propagated commercial crop. However, considerable diversity in its morphology, fiber content and chemoprofiles has been reported. The present study explores the utility of EST-derived markers in studying genetic diversity in different accessions of Z. officinale and their cross transferability within the Zingiberaceae family. A total of 38,115 ESTs sequences were assembled to generate 7850 contigs and 10,762 singletons. SSRs were searched in the unigenes and 515 SSR-containing ESTs were identified with a frequency of 1 SSR per 25.21 kb of the genome. These ESTs were also annotated using BLAST2GO. Primers were designed for 349 EST-SSRs and 25 primer pairs were randomly picked for EST SSR study. Out of these, 16 primer pairs could be optimized for amplification in different accessions of Z. officinale as well as other species belonging to Zingiberaceae. GES454, GES466, GES480 and GES486 markers were found to exhibit 100% cross-transferability among different members of Zingiberaceae.

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

PubMed Central

Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

2012-01-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223

Design of new genome- and gene-sourced primers and identification of QTL for seed oil content in a specially high-oil Brassica napus cultivar.

PubMed

Sun, Meiyu; Hua, Wei; Liu, Jing; Huang, Shunmou; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

2012-01-01

Rapeseed (Brassica napus L.) is one of most important oilseed crops in the world. There are now various rapeseed cultivars in nature that differ in their seed oil content because they vary in oil-content alleles and there are high-oil alleles among the high-oil rapeseed cultivars. For these experiments, we generated doubled haploid (DH) lines derived from the cross between the specially high-oil cultivar zy036 whose seed oil content is approximately 50% and the specially low-oil cultivar 51070 whose seed oil content is approximately 36%. First, to address the deficiency in polymorphic markers, we designed 5944 pairs of newly developed genome-sourced primers and 443 pairs of newly developed primers related to oil-content genes to complement the 2244 pairs of publicly available primers. Second, we constructed a new DH genetic linkage map using 527 molecular markers, consisting of 181 publicly available markers, 298 newly developed genome-sourced markers and 48 newly developed markers related to oil-content genes. The map contained 19 linkage groups, covering a total length of 2,265.54 cM with an average distance between markers of 4.30 cM. Third, we identified quantitative trait loci (QTL) for seed oil content using field data collected at three sites over 3 years, and found a total of 12 QTL. Of the 12 QTL associated with seed oil content identified, 9 were high-oil QTL which derived from the specially high-oil cultivar zy036. Two high-oil QTL on chromosomes A2 and C9 co-localized in two out of three trials. By QTL mapping for seed oil content, we found four candidate genes for seed oil content related to four gene markers: GSNP39, GSSR161, GIFLP106 and GIFLP046. This information will be useful for cloning functional genes correlated with seed oil content in the future.

Design of New Genome- and Gene-Sourced Primers and Identification of QTL for Seed Oil Content in a Specially High-Oil Brassica napus Cultivar

PubMed Central

Liu, Jing; Huang, Shunmou; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

2012-01-01

Rapeseed (Brassica napus L.) is one of most important oilseed crops in the world. There are now various rapeseed cultivars in nature that differ in their seed oil content because they vary in oil-content alleles and there are high-oil alleles among the high-oil rapeseed cultivars. For these experiments, we generated doubled haploid (DH) lines derived from the cross between the specially high-oil cultivar zy036 whose seed oil content is approximately 50% and the specially low-oil cultivar 51070 whose seed oil content is approximately 36%. First, to address the deficiency in polymorphic markers, we designed 5944 pairs of newly developed genome-sourced primers and 443 pairs of newly developed primers related to oil-content genes to complement the 2244 pairs of publicly available primers. Second, we constructed a new DH genetic linkage map using 527 molecular markers, consisting of 181 publicly available markers, 298 newly developed genome-sourced markers and 48 newly developed markers related to oil-content genes. The map contained 19 linkage groups, covering a total length of 2,265.54 cM with an average distance between markers of 4.30 cM. Third, we identified quantitative trait loci (QTL) for seed oil content using field data collected at three sites over 3 years, and found a total of 12 QTL. Of the 12 QTL associated with seed oil content identified, 9 were high-oil QTL which derived from the specially high-oil cultivar zy036. Two high-oil QTL on chromosomes A2 and C9 co-localized in two out of three trials. By QTL mapping for seed oil content, we found four candidate genes for seed oil content related to four gene markers: GSNP39, GSSR161, GIFLP106 and GIFLP046. This information will be useful for cloning functional genes correlated with seed oil content in the future. PMID:23077542

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

PubMed

Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

2017-12-02

DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Improving molecular tools for global surveillance of measles virus⋆

PubMed Central

Bankamp, Bettina; Byrd-Leotis, Lauren A.; Lopareva, Elena N.; Woo, Gibson K.S.; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W.; Ramamurty, Nalini; Mulders, Mick N.; Featherstone, David; Bellini, William J.; Rota, Paul A.

2017-01-01

Background The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. Objectives The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. Study design A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. Results A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. Conclusions These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. PMID:23806666

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

Characterization of 14 microsatellite markers for genetic analysis and cultivar identification of walnut

USDA-ARS?s Scientific Manuscript database

One hundred and forty-seven primer pairs originally designed to amplify microsatellites, also known as simple sequence repeats (SSR), in black walnut (Juglans nigra L.) were screened for utility in persian walnut (J. regia L.). Based on scorability and number of informative polymorphisms, the best 1...

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

Expressed Sequence Reference Standards for Evaluating Stage-specific Gene Expression in Southern Green Lacewings, Chrysoperla rufilabris

USDA-ARS?s Scientific Manuscript database

Five developmental stages of Chrysoperla rufilabris were tested using nine primer pairs. Three sequences were highly expressed at all life stages and six were differentially expressed. These primer pairs may be used as standards to quantitate functional gene expression associated with physiological ...

Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

PubMed

Liu, Ning; Tian, Ru; Loeb, Daniel D

2003-02-18

Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

Recent sequence variation in probe binding site affected detection of respiratory syncytial virus group B by real-time RT-PCR.

PubMed

Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James

2017-03-01

Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

New Arsenate Reductase Gene (arrA) PCR Primers for Diversity Assessment and Quantification in Environmental Samples

PubMed Central

Sorensen, Darwin L.; Dupont, R. Ryan

2016-01-01

ABSTRACT The extent of arsenic contamination in drinking water and its potential threat to human health have resulted in considerable research interest in the microbial species responsible for arsenic reduction. The arsenate reductase gene (arrA), an important component of the microbial arsenate reduction system, has been widely used as a biomarker to study arsenate-reducing microorganisms. A new primer pair was designed and evaluated for quantitative PCR (qPCR) and high-throughput sequencing of the arrA gene, because currently available PCR primers are not suitable for these applications. The primers were evaluated in silico and empirically tested for amplification of arrA genes in clones and for amplification and high-throughput sequencing of arrA genes from soil and groundwater samples. In silico, this primer pair matched (≥90% DNA identity) 86% of arrA gene sequences from GenBank. Empirical evaluation showed successful amplification of arrA gene clones of diverse phylogenetic groups, as well as amplification and high-throughput sequencing of independent soil and groundwater samples without preenrichment, suggesting that these primers are highly specific and can amplify a broad diversity of arrA genes. The arrA gene diversity from soil and groundwater samples from the Cache Valley Basin (CVB) in Utah was greater than anticipated. We observed a significant correlation between arrA gene abundance, quantified through qPCR, and reduced arsenic (AsIII) concentrations in the groundwater samples. Furthermore, we demonstrated that these primers can be useful for studying the diversity of arsenate-reducing microbial communities and the ways in which their relative abundance in groundwater may be associated with different groundwater quality parameters. IMPORTANCE Arsenic is a major drinking water contaminant that threatens the health of millions of people worldwide. The extent of arsenic contamination and its potential threat to human health have resulted in considerable interest in the study of microbial species responsible for the reduction of arsenic, i.e., the conversion of AsV to AsIII. In this study, we developed a new primer pair to evaluate the diversity and abundance of arsenate-reducing microorganisms in soil and groundwater samples from the CVB in Utah. We observed significant arrA gene diversity in the CVB soil and groundwater samples, and arrA gene abundance was significantly correlated with the reduced arsenic (AsIII) concentrations in the groundwater samples. We think that these primers are useful for studying the ecology of arsenate-reducing microorganisms in different environments. PMID:27913413

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

PubMed

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

SMM-system: A mining tool to identify specific markers in Salmonella enterica.

PubMed

Yu, Shuijing; Liu, Weibing; Shi, Chunlei; Wang, Dapeng; Dan, Xianlong; Li, Xiao; Shi, Xianming

2011-03-01

This report presents SMM-system, a software package that implements various personalized pre- and post-BLASTN tasks for mining specific markers of microbial pathogens. The main functionalities of SMM-system are summarized as follows: (i) converting multi-FASTA file, (ii) cutting interesting genomic sequence, (iii) automatic high-throughput BLASTN searches, and (iv) screening target sequences. The utility of SMM-system was demonstrated by using it to identify 214 Salmonella enterica-specific protein-coding sequences (CDSs). Eighteen primer pairs were designed based on eighteen S. enterica-specific CDSs, respectively. Seven of these primer pairs were validated with PCR assay, which showed 100% inclusivity for the 101 S. enterica genomes and 100% exclusivity of 30 non-S. enterica genomes. Three specific primer pairs were chosen to develop a multiplex PCR assay, which generated specific amplicons with a size of 180bp (SC1286), 238bp (SC1598) and 405bp (SC4361), respectively. This study demonstrates that SMM-system is a high-throughput specific marker generation tool that can be used to identify genus-, species-, serogroup- and even serovar-specific DNA sequences of microbial pathogens, which has a potential to be applied in food industries, diagnostics and taxonomic studies. SMM-system is freely available and can be downloaded from http://foodsafety.sjtu.edu.cn/SMM-system.html. Copyright © 2011 Elsevier B.V. All rights reserved.

High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers.

PubMed

Hou, Weiguo; Wang, Shang; Briggs, Brandon R; Li, Gaoyuan; Xie, Wei; Dong, Hailiang

2018-01-01

Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers

PubMed Central

Hou, Weiguo; Wang, Shang; Briggs, Brandon R.; Li, Gaoyuan; Xie, Wei; Dong, Hailiang

2018-01-01

Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

PubMed

Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

1999-01-01

A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

Loblolly pine SSR markers for shortleaf pine genetics

Treesearch

C. Dana Nelson; Sedley Josserand; Craig S. Echt; Jeff Koppelman

2007-01-01

Simple sequence repeats (SSR) are highly informative DNA-based markers widely used in population genetic and linkage mapping studies. We have been developing PCR primer pairs for amplifying SSR markers for loblolly pine (Pinus taeda L.) using loblolly pine DNA and EST sequence data as starting materials. Fifty primer pairs known to reliably amplify...

Ligase Detection Reaction Generation of Reverse Molecular Beacons for Near Real-Time Analysis of Bacterial Pathogens Using Single-Pair Fluorescence Resonance Energy Transfer and a Cyclic Olefin Copolymer Microfluidic Chip

PubMed Central

Peng, Zhiyong; Soper, Steven A.; Pingle, Maneesh R.; Barany, Francis; Davis, Lloyd M.

2015-01-01

Detection of pathogenic bacteria and viruses require strategies that can signal the presence of these targets in near real-time due to the potential threats created by rapid dissemination into water and/or food supplies. In this paper, we report an innovative strategy that can rapidly detect bacterial pathogens using reporter sequences found in their genome without requiring polymerase chain reaction (PCR). A pair of strain-specific primers was designed based on the 16S rRNA gene and were end-labeled with a donor (Cy5) or acceptor (Cy5.5) dye. In the presence of the target bacterium, the primers were joined using a ligase detection reaction (LDR) only when the primers were completely complementary to the target sequence to form a reverse molecular beacon (rMB), thus bringing Cy5 (donor) and Cy5.5 (acceptor) into close proximity to allow fluorescence resonance energy transfer (FRET) to occur. These rMBs were subsequently analyzed using single-molecule detection of the FRET pairs (single-pair FRET; spFRET). The LDR was performed using a continuous flow thermal cycling process configured in a cyclic olefin copolymer (COC) microfluidic device using either 2 or 20 thermal cycles. Single-molecule photon bursts from the resulting rMBs were detected on-chip and registered using a simple laser-induced fluorescence (LIF) instrument. The spFRET signatures from the target pathogens were reported in as little as 2.6 min using spFRET. PMID:21047095

Development of Pineapple Microsatellite Markers and Germplasm Genetic Diversity Analysis

PubMed Central

Tong, Helin; Chen, You; Wang, Jingyi; Chen, Yeyuan; Sun, Guangming; He, Junhu; Wu, Yaoting

2013-01-01

Two methods were used to develop pineapple microsatellite markers. Genomic library-based SSR development: using selectively amplified microsatellite assay, 86 sequences were generated from pineapple genomic library. 91 (96.8%) of the 94 Simple Sequence Repeat (SSR) loci were dinucleotide repeats (39 AC/GT repeats and 52 GA/TC repeats, accounting for 42.9% and 57.1%, resp.), and the other three were mononucleotide repeats. Thirty-six pairs of SSR primers were designed; 24 of them generated clear bands of expected sizes, and 13 of them showed polymorphism. EST-based SSR development: 5659 pineapple EST sequences obtained from NCBI were analyzed; among 1397 nonredundant EST sequences, 843 were found containing 1110 SSR loci (217 of them contained more than one SSR locus). Frequency of SSRs in pineapple EST sequences is 1SSR/3.73 kb, and 44 types were found. Mononucleotide, dinucleotide, and trinucleotide repeats dominate, accounting for 95.6% in total. AG/CT and AGC/GCT were the dominant type of dinucleotide and trinucleotide repeats, accounting for 83.5% and 24.1%, respectively. Thirty pairs of primers were designed for each of randomly selected 30 sequences; 26 of them generated clear and reproducible bands, and 22 of them showed polymorphism. Eighteen pairs of primers obtained by the one or the other of the two methods above that showed polymorphism were selected to carry out germplasm genetic diversity analysis for 48 breeds of pineapple; similarity coefficients of these breeds were between 0.59 and 1.00, and they can be divided into four groups accordingly. Amplification products of five SSR markers were extracted and sequenced, corresponding repeat loci were found and locus mutations are mainly in copy number of repeats and base mutations in the flanking region. PMID:24024187

Development of chloroplast simple sequence repeats (cpSSRs) for the intraspecific study of Gracilaria tenuistipitata (Gracilariales, Rhodophyta) from different populations

PubMed Central

2014-01-01

Background Gracilaria tenuistipitata is an agarophyte with substantial economic potential because of its high growth rate and tolerance to a wide range of environment factors. This red seaweed is intensively cultured in China for the production of agar and fodder for abalone. Microsatellite markers were developed from the chloroplast genome of G. tenuistipitata var. liui to differentiate G. tenuistipitata obtained from six different localities: four from Peninsular Malaysia, one from Thailand and one from Vietnam. Eighty G. tenuistipitata specimens were analyzed using eight simple sequence repeat (SSR) primer-pairs that we developed for polymerase chain reaction (PCR) amplification. Findings Five mononucleotide primer-pairs and one trinucleotide primer-pair exhibited monomorphic alleles, whereas the other two primer-pairs separated the G. tenuistipitata specimens into two main clades. G. tenuistipitata from Thailand and Vietnam were grouped into one clade, and the populations from Batu Laut, Middle Banks and Kuah (Malaysia) were grouped into another clade. The combined dataset of these two primer-pairs separated G. tenuistipitata obtained from Kelantan, Malaysia from that obtained from other localities. Conclusions Based on the variations in repeated nucleotides of microsatellite markers, our results suggested that the populations of G. tenuistipitata were distributed into two main geographical regions: (i) populations in the west coast of Peninsular Malaysia and (ii) populations facing the South China Sea. The correct identification of G. tenuistipitata strains with traits of high economic potential will be advantageous for the mass cultivation of seaweeds. PMID:24490797

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesismore » at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.« less

Analysis of sequence diversity through internal transcribed spacers and simple sequence repeats to identify Dendrobium species.

PubMed

Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y

2014-04-08

The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.

Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

PubMed Central

Liu, Ning; Tian, Ru; Loeb, Daniel D.

2003-01-01

Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

PubMed

van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

2008-09-01

To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

PubMed

Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

2015-07-01

Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Isolation, characterization, and development of WRKY genes as useful genetic markers in Theobroma cacao.

PubMed

Borrone, James W; Kuhn, David N; Schnell, Raymond J

2004-08-01

There is currently an international effort in improving disease resistance and crop yield in Theobroma cacao L., an economically important crop of the tropics, using marker-assisted selection for breeding. We are developing molecular genetic markers focusing upon gene families involved with disease resistance. One such family is the WRKY proteins, which are plant-specific transcriptional factors associated with regulating defense responses to both abiotic and biotic stresses. Degenerate PCR primers were designed to the highly conserved DNA-binding domain and other conserved motifs of group I and group II, subgroups a-c, WRKY genes. Sixteen individual WRKY fragments were isolated from a mixture of T. cacao DNA using one pair of primers. Of the 16 WRKY loci investigated, seven contained single nucleotide polymorphisms within the intron as detected by sequence comparison of the PCR products. Four of these were successfully converted into molecular markers and mapped in an F2 population by capillary electrophoresis-single strand conformation polymorphism analysis. This is the first report of a pair of degenerate primers amplifying WRKY loci directly from genomic DNA and demonstrates a simple method for developing useful genetic markers from members of a large gene family. Copyright 2004 Springer-Verlag

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

Microsatellite DNA as shared genetic markers among conifer species

Treesearch

C.S. Echt; G.G. Vendramin; C. D. Nelson; Paula E. Marquardt

1999-01-01

Polymerase chain reaction (PCR) primer pairs for 21 simple sequence repeat (SSR) loci in Pinus strobus L, and 6 in Pinus radiata D. Don were evaluated to determine whether SSR marker amplification could be achieved in 1O other conifer species. Eighty percent of SSR primer pairs for (AC) loci that were polymorphic in P. ...

Microsatellite DNA as shared genetic markers among conifer species

Treesearch

Craig S. Echt; G.G. Vendramin; C.D. Nelson; P. Marquardt

1999-01-01

Polymerase chain reaction (PCR) primer pairs for 21 simple sequence repeat (SSR) loci in Pinus strobus L. and 6 in Pinus radiata D. Don. were evaluated to determine whether SSR marker amplification could be achieved in 10 other conifer species. Eighty percent of SSR primer pairs for (AC)n loci that were polymorphic in P. ...

A teat papillomatosis case in a Damascus goat (Shami goat) in Hatay province, Turkey: a new putative papillomavirus?

PubMed

Dogan, Fırat; Dorttas, Selvi Deniz; Bilge Dagalp, Seval; Ataseven, Veysel Soydal; Alkan, Feray

2018-06-01

Papillomaviruses (PVs) are epitheliotropic viruses that cause benign proliferative lesions in the skin (warts or papillomas) and mucous membranes of their natural hosts. Recently, new PVs have been found in many animal species. The most common current approach for identifying novel PV types is based on PCR, using various consensus or degenerated primer (broad-range primers), designed on the basis of the multiple alignment of nucleotide or amino acid sequences of a large number of different human papillomaviruses (HPV). PVs have been classified according to the sequence similarity of one of their capsid proteins, L1, without taking into account other regions of the genome and without considering the phenotypic characteristics of the viral infection. In this study, we performed molecular detection and typing of a PV in a goat with teat papillomatosis. Firstly, PCR was performed using the FAP59/FAP64 and MY09/MY11 primer pairs for the L1 gene region. The PV DNA was found to be positive only with the FAP59/FAP64 primer pair. PV DNA was then tested with three primer sets in four different combinations (L2Bf/FAP64, L2Bf/L1Br, FAP59/FAP64, L1Bf/LCRBr) for the gene region encoding the L1, L2 and LCR proteins. The goat teat papilloma sample was amplified using FAP59/FAP64 primers and two primer pairs (L2Bf/FAP64 and L2Bf/L1Br). We obtained products matching approximately 604 bp of the L1 region of the virus. PV DNA was used for typing using sequence analysis/PCR with some type-specific primers for bovids, caprids and cervids. The results of the sequence analysis suggested one new putative PV type with sequence identity ranging from 46.45 to 80.09% to other known papillomaviruses, including Capra hircus papillomavirus (ChPV-2), bovine papillomavirus (BPV) 6, 7, 10, 11 and 12, Rangifer tarandus papillomavirus 3 (RtPV-3) and BPV-7Z (Alpine wild ruminant papillomavirus; Cervus elaphus papillomavirus). We therefore propose that this is the first identification of a new putative type, MG523274 (HTY-goat-TR2016), in a goat with teat papillomatosis. It is essential to identify PV types in different animal species and investigate their prevalence/distribution and clinical consequences in order to develop appropriate prophylactic and/or therapeutic procedures and to determine the interspecies transmission potential and evolution of PVs.

Hindering the illegal trade in dog and cat furs through a DNA-based protocol for species identification.

PubMed

Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita

2018-01-01

In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.

Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

PubMed

Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

2014-07-01

In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

PubMed Central

Jarausch, W; Saillard, C; Dosba, F; Bové, J M

1994-01-01

A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

PubMed

Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

2003-03-01

SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

PubMed

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

PubMed Central

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

A PCR-based tool for the cultivation-independent monitoring of Pandora neoaphidis.

PubMed

Fournier, A; Enkerli, J; Keller, S; Widmer, F

2008-09-01

Pandora neoaphidis is one of the most important fungal pathogens of aphids and has a great potential for use in biocontrol. Little is known on how this fungus persists in an area and in particular on its overwintering strategies. It is hypothesized that natural areas play an important role for survival and that soil may serve as a source of inoculum for new aphid populations in spring. To test these hypotheses, a cultivation-independent PCR-based diagnostic tool was developed, that allows the detection of P. neoaphidis in the environment. Two P. neoaphidis specific PCR primer pairs were designed, targeting sequences in the ribosomal RNA gene cluster. Specificity of both primer pairs was demonstrated with P. neoaphidis and non-target close entomophthoralean relatives. Moreover, single amplicons of expected sizes were obtained with both primer pairs from various environmental sample types, including aphid cadavers, plant material, and soil. The PCR-based diagnostic tool was applied to investigate the persistence of P. neoaphidis in soil samples obtained in 2004/2005 from a nettle field harboring infected aphids in fall 2004. P. neoaphidis was detected in every sample collected in November 2004 and March 2005, suggesting an overwintering stage of P. neoaphidis in top soil layers. The developed cultivation-independent PCR-based tool will be valuable for further investigation of the ecology of P. neoaphidis and for the development and future implementation of management strategies against aphids involving conservation biocontrol.

Ancient DNA analyses of museum specimens from selected Presbytis (primate: Colobinae) based on partial Cyt b sequences

NASA Astrophysics Data System (ADS)

Aifat, N. R.; Yaakop, S.; Md-Zain, B. M.

2016-11-01

The IUCN Red List of Threatened Species has categorized Malaysian primates from being data deficient to critically endanger. Thus, ancient DNA analyses hold great potential to understand phylogeny, phylogeography and population history of extinct and extant species. Museum samples are one of the alternatives to provide important sources of biological materials for a large proportion of ancient DNA studies. In this study, a total of six museum skin samples from species Presbytis hosei (4 samples) and Presbytis frontata (2 samples), aged between 43 and 124 years old were extracted to obtain the DNA. Extraction was done by using QIAGEN QIAamp DNA Investigator Kit and the ability of this kit to extract museum skin samples was tested by amplification of partial Cyt b sequence using species-specific designed primer. Two primer pairs were designed specifically for P. hosei and P. frontata, respectively. These primer pairs proved to be efficient in amplifying 200bp of the targeted species in the optimized PCR conditions. The performance of the sequences were tested to determine genetic distance of genus Presbytis in Malaysia. From the analyses, P. hosei is closely related to P. chrysomelas and P. frontata with the value of 0.095 and 0.106, respectively. Cyt b gave a clear data in determining relationships among Bornean species. Thus, with the optimized condition, museum specimens can be used for molecular systematic studies of the Malaysian primates.

Early diagnosis of a Mexican variant of Papaya meleira virus (PMeV-Mx) by RT-PCR.

PubMed

Zamudio-Moreno, E; Ramirez-Prado, J H; Moreno-Valenzuela, O A; Lopez-Ochoa, L A

2015-02-06

Papaya meleira disease was identified in Brazil in the 1980s. The disease is caused by a double-stranded RNA virus known as Papaya meleira virus (PMeV), which has also been recently reported in Mexico. However, previously reported PMeV primers failed to diagnose the Mexican form of the disease. A genomic approach was used to identify sequences of the Mexican virus isolate, referred here to as PMeV-Mx, to develop a diagnostic method. A mini cDNA library was generated using total RNA from the latex of fruits; this RNA was also sequenced using the Illumina platform. Sequences corresponding to the previously reported 669-base pair sequence for PMeV from Brazil (PMeV-Br) were identified within the PMeV-Mx genome, exhibiting 79-92% identity with PMeV-Br. In addition, a new sequence of 1154-base pairs encoding a putative RNA-dependent RNA polymerase was identified in PMeV-Mx. Primers designed against this sequence detected both virus isolates, 2 amplicons of 173 and 491 base pairs from PMeV-Br and PMeV-Mx, and shared 100 and 98% identity, respectively. PMeV-Mx was found in the latex of fruits, in seedlings, and in the leaves, flowers, petioles, and seeds of mature plants. PMeV-Mx was more abundant in the latex of fruits than in the leaves. The limit of detection of the CB38/CB39 primer pair was 1 fg and 1 pg using total RNA extracted from the latex of fruits and from seedlings, respectively. A sensitive and early diagnosis protocol was developed; this method will enable the certification of seeds and seedlings prior to transplantation to the field.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†

PubMed Central

Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

2000-01-01

We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

PubMed Central

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

PubMed Central

David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

2017-01-01

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

Characterization of EST-derived and non-EST simple sequence repeats in an F₁ hybrid population of Vitis vinifera L.

PubMed

Kayesh, E; Bilkish, N; Liu, G S; Chen, W; Leng, X P; Fang, J G

2014-03-31

Among different classes of molecular markers, expressed sequence tags (ESTs) are a new resource for developing simple sequence repeat (SSR) functional markers for genotyping and genetic mapping in F1 hybrid populations of Vitis vinifera L. Recently, because of the availability of an enormous amount of data for ESTs in the public domain, the emphasis has shifted from genomic SSRs to EST-SSRs, which belong to transcribed regions of the genome and may have a role in gene expression or function. The objective of this study was to assess the polymorphisms among 94 F1 hybrids from "Early Rose" and "Red Globe" using 25 EST-derived and 25 non-EST SSR markers. A total collection of 362,375 grape ESTs that were retrieved from the National Center for Biotechnology Information (NCBI) and 2522 EST-SSR sequences were identified. From them, 205 primer pairs were randomly selected, including 176 pairs that were EST-derived and 29 non-EST SSR primer pairs, for polymerase chain reaction amplification. A total of 131 alleles were amplified using 50 pairs of primers; 78 alleles were amplified using EST-derived SSR primers and 53 were from non-EST SSR primers. At most, 6 and 5 alleles were amplified by EST-derived and non-EST SSR primers, respectively. The EST-derived SSR markers showed a maximum polymorphic information content (PIC) value of 1 and a minimum of 0.33 while non-EST SSR markers had maximum and minimum PIC values of 1 and 0.25, respectively. The average PIC value was 0.56 for EST-derived SSR markers and 0.45 for non-EST SSR markers.

Tetranucleotide microsatellite loci from the black bear (Ursus americanus)

USGS Publications Warehouse

Sanderlin, J.S.; Faircloth, B.C.; Shamblin, B.; Conroy, M.J.

2009-01-01

We describe primers and polymerase chain reaction conditions to amplify 21 tetranucleotide microsatellite DNA loci in black bears (Ursus americanus). We tested primers using individuals from two populations, one each in Georgia and Florida. Among individuals from Georgia (n = 29), primer pairs yielded an average of 2.9 alleles (range, one to four) and an average observed heterozygosity (HO) of 0.50 (range, 0.00 to 0.79). Among individuals from Florida (n = 19), primer pairs yielded an average of 5.7 alleles (range, one to 14) and an HO of 0.55 (range, 0.00 to 1.00). A comparison of previously developed markers with individuals from Georgia suggests that bear populations in Georgia and Florida have reduced allelic diversity relative to other populations. ?? 2008 The Authors.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

PubMed

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

PubMed Central

2004-01-01

With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225

Detection and identification of genetically modified EE-1 brinjal (Solanum melongena) by single, multiplex and SYBR® real-time PCR.

PubMed

Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R

2013-01-01

Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

PubMed Central

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

Development of a molecular approach to describe the composition of Trichoderma communities.

PubMed

Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele

2010-01-01

Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.

Development and characterization of microsatellite markers for the Pacific abalone ( Haliotis discus) via EST database mining

NASA Astrophysics Data System (ADS)

Zhan, Aibin; Bao, Zhenmin; Wang, Mingling; Chang, Dan; Yuan, Jian; Wang, Xiaolong; Hu, Xiaoli; Liang, Chengzhu; Hu, Jingjie

2008-05-01

The EST database of the Pacific abalone ( Haliotis discus) was mined for developing microsatellite markers. A total of 1476 EST sequences were registered in GenBank when data mining was performed. Fifty sequences (approximately 3.4%) were found to contain one or more microsatellites. Based on the length and GC content of the flanking regions, cluster analysis and BLASTN, 13 microsatellite-containing ESTs were selected for PCR primer design. The results showed that 10 out of 13 primer pairs could amplify scorable PCR products and showed polymorphism. The number of alleles ranged from 2 to 13 and the values of H o and H e varied from 0.1222 to 0.8611 and 0.2449 to 0.9311, respectively. No significant linkage disequilibrium (LD) between any pairs of these loci was found, and 6 of 10 loci conformed to the Hardy-Weinberg equilibrium (HWE). These EST-SSRs are therefore potential tools for studies of intraspecies variation and hybrid identification.

Reverse transcription multiplex PCR for differentiation between polio- and enteroviruses from clinical and environmental samples.

PubMed

Egger, D; Pasamontes, L; Ostermayer, M; Bienz, K

1995-06-01

For the rapid detection of polioviruses and their differentiation from nonpoliovirus enteroviruses, we developed a protocol in which clinical or environmental specimens are first inoculated onto cell cultures in tubes. After overnight incubation, the cultures are subjected to reverse transcription multiplex PCR with a primer pair which detects all enteroviruses (T. Hyypiä, P. Auvinen, and M. Maaronen, J. Gen. Virol. 70:3261-3268 1989) and two newly designed primer pairs specific for all 36 poliovirus strains tested. The PCR products can unequivocally be identified by their lengths in agarose gels, whereas the genetic heterogeneity of the poliovirus strains precludes identification by back-hybridization with internal probes. The proposed protocol is highly insensitive to the inhibitory effects of substances in the sample (stool, sewage). It allows for the detection of polioviruses and for polioviruses to be distinguished from nonpoliovirus enteroviruses within 24 h, and it allows for the concomitant isolation of a viable strain suitable for further typing.

PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

DOE PAGES

Yoon, Hyejin; Leitner, Thomas

2014-12-17

Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

Characterization of Aspergillus flavus strains from Brazilian Brazil nuts and cashew by RAPD and ribosomal DNA analysis.

PubMed

Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G

2008-07-01

The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.

Marker-assisted selection for recognizing wheat mutant genotypes carrying HMW glutenin alleles related to baking quality.

PubMed

Zamani, Mohammad Javad; Bihamta, Mohammad Reza; Naserian Khiabani, Behnam; Tahernezhad, Zahra; Hallajian, Mohammad Taher; Shamsi, Marzieh Varasteh

2014-01-01

Allelic diversity of HMW glutenin loci in several studies revealed that allelic combinations affect dough quality. Dx5 + Dy10 subunits are related to good baking quality and Dx2 + Dy12 are related to undesirable baking quality. One of the most regular methods to evaluate the baking quality is SDS-PAGE which is used to improve baking quality labs. Marker-assisted selection is the method which can recognize the alleles related to baking quality and this method is based on polymerase chain reaction. 10 pairs of specific primers related to Dx2, Dx2.1, Dx5, Dy10, and Dy12 subunits were used for recognizing baking quality of some wheat varieties and some mutant genotypes. Only 5 pairs of them could show the specific bands. All subunits were recognized by the primers except Dx2.1. Some of the primers were extracted from previous studies and the others were designed based on D genome subunits of wheat. SDS-PAGE method accomplished having confidence in these marker's results. To realize the effect of mutation, seed storage proteins were measured. It showed that mutation had effect on the amount of seed storage protein on the mutant seeds (which showed polymorphism).

Identification of apple cultivars on the basis of simple sequence repeat markers.

PubMed

Liu, G S; Zhang, Y G; Tao, R; Fang, J G; Dai, H Y

2014-09-12

DNA markers are useful tools that play an important role in plant cultivar identification. They are usually based on polymerase chain reaction (PCR) and include simple sequence repeats (SSRs), inter-simple sequence repeats, and random amplified polymorphic DNA. However, DNA markers were not used effectively in the complete identification of plant cultivars because of the lack of known DNA fingerprints. Recently, a novel approach called the cultivar identification diagram (CID) strategy was developed to facilitate the use of DNA markers for separate plant individuals. The CID was designed whereby a polymorphic maker was generated from each PCR that directly allowed for cultivar sample separation at each step. Therefore, it could be used to identify cultivars and varieties easily with fewer primers. In this study, 60 apple cultivars, including a few main cultivars in fields and varieties from descendants (Fuji x Telamon) were examined. Of the 20 pairs of SSR primers screened, 8 pairs gave reproducible, polymorphic DNA amplification patterns. The banding patterns obtained from these 8 primers were used to construct a CID map. Each cultivar or variety in this study was distinguished from the others completely, indicating that this method can be used for efficient cultivar identification. The result contributed to studies on germplasm resources and the seedling industry in fruit trees.

Polymerase Spiral Reaction (PSR): A novel isothermal nucleic acid amplification method.

PubMed

Liu, Wei; Dong, Derong; Yang, Zhan; Zou, Dayang; Chen, Zeliang; Yuan, Jing; Huang, Liuyu

2015-07-29

In this study, we report a novel isothermal nucleic acid amplification method only requires one pair of primers and one enzyme, termed Polymerase Spiral Reaction (PSR) with high specificity, efficiency, and rapidity under isothermal condition. The recombinant plasmid of blaNDM-1 was imported to Escherichia coli BL21, and selected as the microbial target. PSR method employs a Bst DNA polymerase and a pair of primers designed targeting the blaNDM-1 gene sequence. The forward and reverse Tab primer sequences are reverse to each other at their 5' end (Nr and N), whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The PSR method was performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure. PSR assay was monitored continuously in a real-time turbidimeter instrument or visually detected with the aid of a fluorescent dye (SYBR Greenı), and could be finished within 1 h with a high accumulation of 10(9) copies of the target and a fine sensitivity of 6 CFU per reaction. Clinical evaluation was also conducted using PSR, showing high specificity of this method. The PSR technique provides a convenient and cost-effective alternative for clinical screening, on-site diagnosis and primary quarantine purposes.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

USGS Publications Warehouse

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 – 30 November 2011

PubMed Central

ABREU, ALUANA G.; ALBAINA, A.; ALPERMANN, TILMAN J.; APKENAS, VANESSA E.; BANKHEAD-DRONNET, S.; BERGEK, SARA; BERUMEN, MICHAEL L.; CHO, CHANG-HUNG; CLOBERT, JEAN; COULON, AURÉLIE; DE FERAUDY, D.; ESTONBA, A.; HANKELN, THOMAS; HOCHKIRCH, AXEL; HSU, TSAI-WEN; HUANG, TSURNG-JUHN; IRIGOIEN, X.; IRIONDO, M.; KAY, KATHLEEN M.; KINITZ, TIM; KOTHERA, LINDA; LE HÉNANFF, MAXIME; LIEUTIER, F.; LOURDAIS, OLIVIER; MACRINI, CAMILA M. T.; MANZANO, C.; MARTIN, C.; MORRIS, VERONICA R. F.; NANNINGA, GERRIT; PARDO, M. A.; PLIESKE, JÖRG; POINTEAU, S.; PRESTEGAARD, TORE; QUACK, MARKUS; RICHARD, MURIELLE; SAVAGE, HARRY M.; SCHWARCZ, KAISER D.; SHADE, JESSICA; SIMMS, ELLEN L.; SOLFERINI, VERA N.; STEVENS, VIRGINIE M.; VEITH, MICHAEL; WEN, MEI-JUAN; WICKER, FLORIAN; YOST, JENNIFER M.; ZARRAONAINDIA, I.

2017-01-01

This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. PMID:22296658

Sequetyping: Serotyping Streptococcus pneumoniae by a Single PCR Sequencing Strategy

PubMed Central

Leung, Marcus H.; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Gillespie, Stephen H.

2012-01-01

The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future. PMID:22553238

A SSR-based composite genetic linkage map for the cultivated peanut (Arachis hypogaea L.) genome

PubMed Central

2010-01-01

Background The construction of genetic linkage maps for cultivated peanut (Arachis hypogaea L.) has and continues to be an important research goal to facilitate quantitative trait locus (QTL) analysis and gene tagging for use in a marker-assisted selection in breeding. Even though a few maps have been developed, they were constructed using diploid or interspecific tetraploid populations. The most recently published intra-specific map was constructed from the cross of cultivated peanuts, in which only 135 simple sequence repeat (SSR) markers were sparsely populated in 22 linkage groups. The more detailed linkage map with sufficient markers is necessary to be feasible for QTL identification and marker-assisted selection. The objective of this study was to construct a genetic linkage map of cultivated peanut using simple sequence repeat (SSR) markers derived primarily from peanut genomic sequences, expressed sequence tags (ESTs), and by "data mining" sequences released in GenBank. Results Three recombinant inbred lines (RILs) populations were constructed from three crosses with one common female parental line Yueyou 13, a high yielding Spanish market type. The four parents were screened with 1044 primer pairs designed to amplify SSRs and 901 primer pairs produced clear PCR products. Of the 901 primer pairs, 146, 124 and 64 primer pairs (markers) were polymorphic in these populations, respectively, and used in genotyping these RIL populations. Individual linkage maps were constructed from each of the three populations and a composite map based on 93 common loci were created using JoinMap. The composite linkage maps consist of 22 composite linkage groups (LG) with 175 SSR markers (including 47 SSRs on the published AA genome maps), representing the 20 chromosomes of A. hypogaea. The total composite map length is 885.4 cM, with an average marker density of 5.8 cM. Segregation distortion in the 3 populations was 23.0%, 13.5% and 7.8% of the markers, respectively. These distorted loci tended to cluster on LG1, LG3, LG4 and LG5. There were only 15 EST-SSR markers mapped due to low polymorphism. By comparison, there were potential synteny, collinear order of some markers and conservation of collinear linkage groups among the maps and with the AA genome but not fully conservative. Conclusion A composite linkage map was constructed from three individual mapping populations with 175 SSR markers in 22 composite linkage groups. This composite genetic linkage map is among the first "true" tetraploid peanut maps produced. This map also consists of 47 SSRs that have been used in the published AA genome maps, and could be used in comparative mapping studies. The primers described in this study are PCR-based markers, which are easy to share for genetic mapping in peanuts. All 1044 primer pairs are provided as additional files and the three RIL populations will be made available to public upon request for quantitative trait loci (QTL) analysis and linkage map improvement. PMID:20105299

Kinetoplast DNA minicircles of phloem-restricted Phytomonas associated with wilt diseases of coconut and oil palms have a two-domain structure.

PubMed

Dollet, M; Sturm, N R; Ahomadegbe, J C; Campbell, D A

2001-11-27

We report the cloning and sequencing of the first minicircle from a phloem-restricted, pathogenic Phytomonas sp. (Hart 1) isolated from a coconut palm with hartrot disease. The minicircle possessed a two-domain structure of two conserved regions, each containing three conserved sequence blocks (CSB). Based on the sequence around CSB 3 from Hart 1, PCR primers were designed to allow specific amplification of Phytomonas minicircles. This primer pair demonstrated specificity for at least six groups of plant trypanosomatids and did not amplify from insect trypanosomatids. The PCR results were consistent with a two-domain structure for other plant trypanosomatids.

A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

PubMed

Bisset, S A; Knight, J S; Bouchet, C L G

2014-02-24

A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

Tetranucleotide microsatellite loci from the black bear (Ursus americanus).

PubMed

Sanderlin, Jamie Skvarla; Faircloth, Brant C; Shamblin, Brian; Conroy, Michael J

2009-01-01

We describe primers and polymerase chain reaction conditions to amplify 21 tetranucleotide microsatellite DNA loci in black bears (Ursus americanus). We tested primers using individuals from two populations, one each in Georgia and Florida. Among individuals from Georgia (n = 29), primer pairs yielded an average of 2.9 alleles (range, one to four) and an average observed heterozygosity (H(O) ) of 0.50 (range, 0.00 to 0.79). Among individuals from Florida (n = 19), primer pairs yielded an average of 5.7 alleles (range, one to 14) and an H(O) of 0.55 (range, 0.00 to 1.00). A comparison of previously developed markers with individuals from Georgia suggests that bear populations in Georgia and Florida have reduced allelic diversity relative to other populations. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.

PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity.

PubMed

Dwivedi, Bhakti; Schmieder, Robert; Goldsmith, Dawn B; Edwards, Robert A; Breitbart, Mya

2012-03-04

Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.

PhiSiGns: an online tool to identify signature genes in phages and design PCR primers for examining phage diversity

PubMed Central

2012-01-01

Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976

Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

USGS Publications Warehouse

Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

2011-01-01

Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

Development and validation of microsatellite markers for Brachiaria ruziziensis obtained by partial genome assembly of Illumina single-end reads

PubMed Central

2013-01-01

Background Brachiaria ruziziensis is one of the most important forage species planted in the tropics. The application of genomic tools to aid the selection of superior genotypes can provide support to B. ruziziensis breeding programs. However, there is a complete lack of information about the B. ruziziensis genome. Also, the availability of genomic tools, such as molecular markers, to support B. ruziziensis breeding programs is rather limited. Recently, next-generation sequencing technologies have been applied to generate sequence data for the identification of microsatellite regions and primer design. In this study, we present a first validated set of SSR markers for Brachiaria ruziziensis, selected from a de novo partial genome assembly of single-end Illumina reads. Results A total of 85,567 perfect microsatellite loci were detected in contigs with a minimum 10X coverage. We selected a set of 500 microsatellite loci identified in contigs with minimum 100X coverage for primer design and synthesis, and tested a subset of 269 primer pairs, 198 of which were polymorphic on 11 representative B. ruziziensis accessions. Descriptive statistics for these primer pairs are presented, as well as estimates of marker transferability to other relevant brachiaria species. Finally, a set of 11 multiplex panels containing the 30 most informative markers was validated and proposed for B. ruziziensis genetic analysis. Conclusions We show that the detection and development of microsatellite markers from genome assembled Illumina single-end DNA sequences is highly efficient. The developed markers are readily suitable for genetic analysis and marker assisted selection of Brachiaria ruziziensis. The use of this approach for microsatellite marker development is promising for species with limited genomic information, whose breeding programs would benefit from the use of genomic tools. To our knowledge, this is the first set of microsatellite markers developed for this important species. PMID:23324172

A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

PubMed

Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

2002-12-01

The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

Improving molecular tools for global surveillance of measles virus.

PubMed

Bankamp, Bettina; Byrd-Leotis, Lauren A; Lopareva, Elena N; Woo, Gibson K S; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W; Ramamurty, Nalini; Mulders, Mick N; Featherstone, David; Bellini, William J; Rota, Paul A

2013-09-01

The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. Published by Elsevier B.V.

Cross-species amplification of microsatellite markers in the Great Horned Owl Bubo virginianus, Short-eared Owl Asio flammeus and Snowy Owl B. scandiacus for use in population genetics, individual identification and parentage studies

USGS Publications Warehouse

Dial, Cody R.; Talbot, Sandra L.; Sage, George K.; Seidensticker, M.T.; Holt, D.W.

2012-01-01

Using DNA from blood and feathers, we screened twenty-four microsatellite primer pairs initially developed for six strigid owls, and four primer pairs shown to be polymorphic across avian taxa, for their utility in Great Horned Owl (Bubo virginianus), Short-eared Owl (Asio flammeus), and Snowy Owl (Bubo scandiacus). Eight of these primers reliably amplified polymorphic fragments in Great Horned Owl, eleven in Short-eared owl, and ten in Snowy Owl. Analyses of results from presumably unrelated owls demonstrate the utility of these loci for individual identification, parentage assignment, and population genetics studies.

GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

PubMed

David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

2017-01-04

GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

PubMed

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

PubMed Central

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

An expanded nuclear phylogenomic PCR toolkit for Sapindales1

PubMed Central

Collins, Elizabeth S.; Gostel, Morgan R.; Weeks, Andrea

2016-01-01

Premise of the study: We tested PCR amplification of 91 low-copy nuclear gene loci in taxa from Sapindales using primers developed for Bursera simaruba (Burseraceae). Methods and Results: Cross-amplification of these markers among 10 taxa tested was related to their phylogenetic distance from B. simaruba. On average, each Sapindalean taxon yielded product for 53 gene regions (range: 16–90). Arabidopsis thaliana (Brassicales), by contrast, yielded product for two. Single representatives of Anacardiaceae and Rutacaeae yielded 34 and 26 products, respectively. Twenty-six primer pairs worked for all Burseraceae species tested if highly divergent Aucoumea klaineana is excluded, and eight of these amplified product in every Sapindalean taxon. Conclusions: Our study demonstrates that customized primers for Bursera can amplify product in a range of Sapindalean taxa. This collection of primer pairs, therefore, is a valuable addition to the toolkit for nuclear phylogenomic analyses of Sapindales and warrants further investigation. PMID:28101434

A sequence-based genetic map of Medicago truncatula and comparison of marker colinearity with M. sativa.

PubMed Central

Choi, Hong-Kyu; Kim, Dongjin; Uhm, Taesik; Limpens, Eric; Lim, Hyunju; Mun, Jeong-Hwan; Kalo, Peter; Penmetsa, R Varma; Seres, Andrea; Kulikova, Olga; Roe, Bruce A; Bisseling, Ton; Kiss, Gyorgy B; Cook, Douglas R

2004-01-01

A core genetic map of the legume Medicago truncatula has been established by analyzing the segregation of 288 sequence-characterized genetic markers in an F(2) population composed of 93 individuals. These molecular markers correspond to 141 ESTs, 80 BAC end sequence tags, and 67 resistance gene analogs, covering 513 cM. In the case of EST-based markers we used an intron-targeted marker strategy with primers designed to anneal in conserved exon regions and to amplify across intron regions. Polymorphisms were significantly more frequent in intron vs. exon regions, thus providing an efficient mechanism to map transcribed genes. Genetic and cytogenetic analysis produced eight well-resolved linkage groups, which have been previously correlated with eight chromosomes by means of FISH with mapped BAC clones. We anticipated that mapping of conserved coding regions would have utility for comparative mapping among legumes; thus 60 of the EST-based primer pairs were designed to amplify orthologous sequences across a range of legume species. As an initial test of this strategy, we used primers designed against M. truncatula exon sequences to rapidly map genes in M. sativa. The resulting comparative map, which includes 68 bridging markers, indicates that the two Medicago genomes are highly similar and establishes the basis for a Medicago composite map. PMID:15082563

Utility of EST-derived SSR in cultivated peanut (Arachis hypogaea L.) and Arachis wild species

PubMed Central

Liang, Xuanqiang; Chen, Xiaoping; Hong, Yanbin; Liu, Haiyan; Zhou, Guiyuan; Li, Shaoxiong; Guo, Baozhu

2009-01-01

Background Lack of sufficient molecular markers hinders current genetic research in peanuts (Arachis hypogaea L.). It is necessary to develop more molecular markers for potential use in peanut genetic research. With the development of peanut EST projects, a vast amount of available EST sequence data has been generated. These data offered an opportunity to identify SSR in ESTs by data mining. Results In this study, we investigated 24,238 ESTs for the identification and development of SSR markers. In total, 881 SSRs were identified from 780 SSR-containing unique ESTs. On an average, one SSR was found per 7.3 kb of EST sequence with tri-nucleotide motifs (63.9%) being the most abundant followed by di- (32.7%), tetra- (1.7%), hexa- (1.0%) and penta-nucleotide (0.7%) repeat types. The top six motifs included AG/TC (27.7%), AAG/TTC (17.4%), AAT/TTA (11.9%), ACC/TGG (7.72%), ACT/TGA (7.26%) and AT/TA (6.3%). Based on the 780 SSR-containing ESTs, a total of 290 primer pairs were successfully designed and used for validation of the amplification and assessment of the polymorphism among 22 genotypes of cultivated peanuts and 16 accessions of wild species. The results showed that 251 primer pairs yielded amplification products, of which 26 and 221 primer pairs exhibited polymorphism among the cultivated and wild species examined, respectively. Two to four alleles were found in cultivated peanuts, while 3–8 alleles presented in wild species. The apparent broad polymorphism was further confirmed by cloning and sequencing of amplified alleles. Sequence analysis of selected amplified alleles revealed that allelic diversity could be attributed mainly to differences in repeat type and length in the microsatellite regions. In addition, a few single base mutations were observed in the microsatellite flanking regions. Conclusion This study gives an insight into the frequency, type and distribution of peanut EST-SSRs and demonstrates successful development of EST-SSR markers in cultivated peanut. These EST-SSR markers could enrich the current resource of molecular markers for the peanut community and would be useful for qualitative and quantitative trait mapping, marker-assisted selection, and genetic diversity studies in cultivated peanut as well as related Arachis species. All of the 251 working primer pairs with names, motifs, repeat types, primer sequences, and alleles tested in cultivated and wild species are listed in Additional File 1. PMID:19309524

Real-time PCR quantification of the plant growth promoting bacteria Herbaspirillum seropedicae strain SmR1 in maize roots.

PubMed

Pereira, Tomás Pellizzaro; do Amaral, Fernanda Plucani; Dall'Asta, Pamela; Brod, Fábio Cristiano Angonesi; Arisi, Ana Carolina Maisonnave

2014-07-01

The plant growth promoting bacteria Herbaspirillum seropedicae SmR1 is an endophytic diazotroph found in several economically important crops. Considering that methods to monitor the plant-bacteria interaction are required, our objective was to develop a real-time PCR method for quantification of PGPB H. seropedicae in the rhizosphere of maize seedlings. Primer pairs were designed, and their specificity was verified using DNA from 12 different bacterial species. Ten standard curves of qPCR assay using HERBAS1 primers and tenfold serial dilutions of H. seropedicae SmR1 DNA were performed, and PCR efficiency of 91 % and correlation coefficient of 0.99 were obtained. H. seropedicae SmR1 limit of detection was 10(1) copies (corresponding to 60.3 fg of bacterial DNA). qPCR assay using HERBAS1 was used to detect and quantify H. seropedicae strain SmR1 in inoculated maize roots, cultivated in vitro and in pots, harvested 1, 4, 7, and 10 days after inoculation. The estimated bacterial DNA copy number per gram of root was in the range 10(7)-10(9) for plants grown in vitro and it was around 10(6) for plants grown in pots. Primer pair HERBAS1 was able to quantify H. seropedicae SmR1, and this assay can be useful for monitoring plant-bacteria interaction.

Characterization of the global transcriptome for cotton (Gossypium hirsutum L.) anther and development of SSR marker.

PubMed

Zhang, Xianwen; Ye, Zhenwei; Wang, Tiankang; Xiong, Hairong; Yuan, Xiaoling; Zhang, Zhigang; Yuan, Youlu; Liu, Zhi

2014-11-10

Cotton is an important fiber plant, and it's attractive to elucidate the molecular mechanism of anther development due to the close relationship between the anther fertility and boll-setting, and also fiber yield. In the present paper, 47.2 million paired-end reads with average length of 82.87 bp from the anthers of TM-1 (Gossypium hirsutum L.), a genetic standard line, were generated through transcriptome sequencing, and 210,965 unigenes of more than 100 bp were obtained. BLAST, KEGG, COG, and GO analyses showed that the genes were enriched in the processes of transcription, translation, and post-translation as well as hormone signal transduction, the transcription factor families, and cell wall-related genes mainly participating in cell expansion and carbohydrate metabolism. Further analysis identified 11,153 potential SSRs. A suit of 5122 primer pair sequences were designed, and 82 of 300 randomly selected primer pairs produced reproducible amplicons that were polymorphic among 22 cotton accessions from G. hirsutum, Gossypium barbadense and Gossypium arboreum. The UPGMA clustering analysis further confirmed high quality and effectiveness of these novel SSR markers. The present study provided insights into the transcriptome profile of the cotton and established a public information platform for functional genomics and molecular breeding. Copyright © 2014 Elsevier B.V. All rights reserved.

De Novo Transcriptome Sequencing Analysis of cDNA Library and Large-Scale Unigene Assembly in Japanese Red Pine (Pinus densiflora)

PubMed Central

Liu, Le; Zhang, Shijie; Lian, Chunlan

2015-01-01

Japanese red pine (Pinus densiflora) is extensively cultivated in Japan, Korea, China, and Russia and is harvested for timber, pulpwood, garden, and paper markets. However, genetic information and molecular markers were very scarce for this species. In this study, over 51 million sequencing clean reads from P. densiflora mRNA were produced using Illumina paired-end sequencing technology. It yielded 83,913 unigenes with a mean length of 751 bp, of which 54,530 (64.98%) unigenes showed similarity to sequences in the NCBI database. Among which the best matches in the NCBI Nr database were Picea sitchensis (41.60%), Amborella trichopoda (9.83%), and Pinus taeda (4.15%). A total of 1953 putative microsatellites were identified in 1784 unigenes using MISA (MicroSAtellite) software, of which the tri-nucleotide repeats were most abundant (50.18%) and 629 EST-SSR (expressed sequence tag- simple sequence repeats) primer pairs were successfully designed. Among 20 EST-SSR primer pairs randomly chosen, 17 markers yielded amplification products of the expected size in P. densiflora. Our results will provide a valuable resource for gene-function analysis, germplasm identification, molecular marker-assisted breeding and resistance-related gene(s) mapping for pine for P. densiflora. PMID:26690126

Amplification of DNA of Xanthomonas axonopodis pv. citri from historic citrus canker herbarium specimens.

PubMed

Li, Wenbin; Brlansky, Ronald H; Hartung, John S

2006-05-01

Herbaria are important resources for the study of the origins and dispersal of plant pathogens, particularly bacterial plant pathogens that incite local lesions in which large numbers of pathogen genomes are concentrated. Xanthomonas axonopodis pv. citri (Xac), the causal agent of citrus bacterial canker disease, is a notable example of such a pathogen. The appearance of novel strains of the pathogen in Florida and elsewhere make it increasingly important to understand the relationships among strains of this pathogen. USDA-ARS at Beltsville, Maryland maintains approximately 700 herbarium specimens with citrus canker disease lesions up to 90 years old, originally collected from all over the world, and so is an important resource for phytogeographic studies of this bacterium. Unfortunately, DNA in herbarium specimens is degraded and may contain high levels of inhibitors of PCR. In this study, we compared a total of 23 DNA isolation techniques in combination with 31 novel primer pairs in order to develop an efficient protocol for the analysis of Xac DNA in herbarium specimens. We identified the most reliable extraction method, identified in terms of successful amplification by our panel of 31 primer pairs. We also identified the most robust primer pairs, identified as successful in the largest number of extracts prepared by different methods. We amplified Xac genomic sequences up to 542 bp long from herbarium samples up to 89 years old. Primers varied in effectiveness, with some primer pairs amplifying Xac DNA from a 1/10,000 dilution of extract from a single lesion from a citrus canker herbarium specimen. Our methodology will be useful to identify pathogens and perform molecular analyses of bacterial and possibly fungal genomes from herbarium specimens.

Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.

PubMed

Khadhair, A H; Evans, I R; Choban, B

2002-01-01

In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

Development of a real-time TaqMan assay to detect mendocina sublineage Pseudomonas species in contaminated metalworking fluids.

PubMed

Saha, Ratul; Donofrio, Robert S; Bagley, Susan T

2010-08-01

A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.

Identification and characterization of gene-based SSR markers in date palm (Phoenix dactylifera L.).

PubMed

Zhao, Yongli; Williams, Roxanne; Prakash, C S; He, Guohao

2012-12-15

Date palm (Phoenix dactylifera L.) is an important tree in the Middle East and North Africa due to the nutritional value of its fruit. Molecular Breeding would accelerate genetic improvement of fruit tree through marker assisted selection. However, the lack of molecular markers in date palm restricts the application of molecular breeding. In this study, we analyzed 28,889 EST sequences from the date palm genome database to identify simple-sequence repeats (SSRs) and to develop gene-based markers, i.e. expressed sequence tag-SSRs (EST-SSRs). We identified 4,609 ESTs as containing SSRs, among which, trinucleotide motifs (69.7%) were the most common, followed by tetranucleotide (10.4%) and dinucleotide motifs (9.6%). The motif AG (85.7%) was most abundant in dinucleotides, while motifs AGG (26.8%), AAG (19.3%), and AGC (16.1%) were most common among trinucleotides. A total of 4,967 primer pairs were designed for EST-SSR markers from the computational data. In a follow up laboratory study, we tested a sample of 20 random selected primer pairs for amplification and polymorphism detection using genomic DNA from date palm cultivars. Nearly one-third of these primer pairs detected DNA polymorphism to differentiate the twelve date palm cultivars used. Functional categorization of EST sequences containing SSRs revealed that 3,108 (67.4%) of such ESTs had homology with known proteins. Date palm EST sequences exhibits a good resource for developing gene-based markers. These genic markers identified in our study may provide a valuable genetic and genomic tool for further genetic research and varietal development in date palm, such as diversity study, QTL mapping, and molecular breeding.

Pentaplex PCR as screening assay for jellyfish species identification in food products.

PubMed

Armani, Andrea; Giusti, Alice; Castigliego, Lorenzo; Rossi, Aurelio; Tinacci, Lara; Gianfaldoni, Daniela; Guidi, Alessandra

2014-12-17

Salted jellyfish, a traditional food in Asian Countries, is nowadays spreading on the Western markets. In this work, we developed a Pentaplex PCR for the identification of five edible species (Nemopilema nomurai, Rhopilema esculentum, Rhizostoma pulmo, Pelagia noctiluca, and Cotylorhiza tuberculata), which cannot be identified by a mere visual inspection in jellyfish products sold as food. A common degenerated forward primer and five specie-specific reverse primers were designed to amplify COI gene regions of different lengths. Another primer pair targeted the 28SrRNA gene and was intended as common positive reaction control. Considering the high level of degradation in the DNA extracted from acidified and salted products, the maximum length of the amplicons was set at 200 bp. The PCR was developed using 66 reference DNA samples. It gave successful amplifications in 85.4% of 48 ready to eat products (REs) and in 60% of 30 classical salted products (CPs) collected on the market.

Short communication: development and characterization of novel transcriptome-derived microsatellites for genetic analysis of persimmon.

PubMed

Luo, C; Zhang, Q L; Luo, Z R

2014-04-16

Oriental persimmon (Diospyros kaki Thunb.) (2n = 6x = 90) is a major commercial and deciduous fruit tree that is believed to have originated in China. However, rare transcriptomic and genomic information on persimmon is available. Using Roche 454 sequencing technology, the transcriptome from RNA of the flowers of D. kaki was analyzed. A total of 1,250,893 reads were generated and 83,898 unigenes were assembled. A total of 42,711 SSR loci were identified from 23,494 unigenes and 289 polymerase chain reaction primer pairs were designed. Of these 289 primers, 155 (53.6%) showed robust PCR amplification and 98 revealed polymorphism between 15 persimmon genotypes, indicating a polymorphic rate of 63.23% of the productive primers for characterization and genotyping of the genus Diospyros. Transcriptome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no genomic sequence information available.

Isolation and characterization of 14 tetranucleotide microsatellite loci for the cannonball jellyfish (Stomolophus sp.) by next generation sequencing.

PubMed

Getino-Mamet, Leandro Nicolás; Valdivia-Carrillo, Tania; Gómez Daglio, Liza; García-De León, Francisco Javier

2017-04-01

The Cannonball jellyfish (Stomolophus sp.) is a species of jellyfish with high relevance in artisanal fishing. Studies of their populations do not extend beyond the morphological descriptions knowing that presents a great morphological variability. However, there are no genetic studies to determine the number of independent populations, so microsatellite markers become a suitable option. Since there are no species-specific microsatellite loci, in this paper, 14 new microsatellite loci are characterized. Microsatellite loci were isolated de novo through next generation sequencing, by two runs on Illumina MiSeq. A total of 506,771,269 base pair were obtained, from which 142,616 were microsatellite loci, and 1546 of them could design primers. We tested 14 primer pairs on 32 individuals from Bahía de La Paz, Gulf of California. We observed low genetic variation among loci (mean number of alleles per locus = 4.33, mean observed heterozygosity 0.381, mean expected heterozygosity 0.501). These loci are the first ones described for the species and will be helpful to carry out genetic diversity and population genetics studies.

PrimerZ: streamlined primer design for promoters, exons and human SNPs.

PubMed

Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

2007-07-01

PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

Biogeochemical and Molecular Signatures of Anaerobic Methane Oxidation in a Marine Sediment

PubMed Central

Thomsen, Trine R.; Finster, Kai; Ramsing, Niels B.

2001-01-01

Anaerobic methane oxidation was investigated in 6-m-long cores of marine sediment from Aarhus Bay, Denmark. Measured concentration profiles for methane and sulfate, as well as in situ rates determined with isotope tracers, indicated that there was a narrow zone of anaerobic methane oxidation about 150 cm below the sediment surface. Methane could account for 52% of the electron donor requirement for the peak sulfate reduction rate detected in the sulfate-methane transition zone. Molecular signatures of organisms present in the transition zone were detected by using selective PCR primers for sulfate-reducing bacteria and for Archaea. One primer pair amplified the dissimilatory sulfite reductase (DSR) gene of sulfate-reducing bacteria, whereas another primer (ANME) was designed to amplify archaeal sequences found in a recent study of sediments from the Eel River Basin, as these bacteria have been suggested to be anaerobic methane oxidizers (K. U. Hinrichs, J. M. Hayes, S. P. Sylva, P. G. Brewer, and E. F. DeLong, Nature 398:802–805, 1999). Amplification with the primer pairs produced more amplificate of both target genes with samples from the sulfate-methane transition zone than with samples from the surrounding sediment. Phylogenetic analysis of the DSR gene sequences retrieved from the transition zone revealed that they all belonged to a novel deeply branching lineage of diverse DSR gene sequences not related to any previously described DSR gene sequence. In contrast, DSR gene sequences found in the top sediment were related to environmental sequences from other estuarine sediments and to sequences of members of the genera Desulfonema, Desulfococcus, and Desulfosarcina. Phylogenetic analysis of 16S rRNA sequences obtained with the primers targeting the archaeal group of possible anaerobic methane oxidizers revealed two clusters of ANME sequences, both of which were affiliated with sequences from the Eel River Basin. PMID:11282617

Biogeochemical and molecular signatures of anaerobic methane oxidation in a marine sediment.

PubMed

Thomsen, T R; Finster, K; Ramsing, N B

2001-04-01

Anaerobic methane oxidation was investigated in 6-m-long cores of marine sediment from Aarhus Bay, Denmark. Measured concentration profiles for methane and sulfate, as well as in situ rates determined with isotope tracers, indicated that there was a narrow zone of anaerobic methane oxidation about 150 cm below the sediment surface. Methane could account for 52% of the electron donor requirement for the peak sulfate reduction rate detected in the sulfate-methane transition zone. Molecular signatures of organisms present in the transition zone were detected by using selective PCR primers for sulfate-reducing bacteria and for Archaea. One primer pair amplified the dissimilatory sulfite reductase (DSR) gene of sulfate-reducing bacteria, whereas another primer (ANME) was designed to amplify archaeal sequences found in a recent study of sediments from the Eel River Basin, as these bacteria have been suggested to be anaerobic methane oxidizers (K. U. Hinrichs, J. M. Hayes, S. P. Sylva, P. G. Brewer, and E. F. DeLong, Nature 398:802-805, 1999). Amplification with the primer pairs produced more amplificate of both target genes with samples from the sulfate-methane transition zone than with samples from the surrounding sediment. Phylogenetic analysis of the DSR gene sequences retrieved from the transition zone revealed that they all belonged to a novel deeply branching lineage of diverse DSR gene sequences not related to any previously described DSR gene sequence. In contrast, DSR gene sequences found in the top sediment were related to environmental sequences from other estuarine sediments and to sequences of members of the genera Desulfonema, Desulfococcus, and Desulfosarcina. Phylogenetic analysis of 16S rRNA sequences obtained with the primers targeting the archaeal group of possible anaerobic methane oxidizers revealed two clusters of ANME sequences, both of which were affiliated with sequences from the Eel River Basin.

Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Lee, H.K.; Flanders, D.J.

The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

Identification and authentication of Rosa species through development of species-specific SCAR marker(s).

PubMed

Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M

2014-05-30

Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.

A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts

PubMed Central

Ealba, Erin L.; Schneider, Richard A.

2013-01-01

Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056

A simple and rapid method for detection of Trypanosoma evansi in the dromedary camel using a nested polymerase chain reaction

PubMed Central

Aradaib, Imadeldin E; Majid, Ali A

2006-01-01

A nested polymerase chain reaction (nPCR)-based assay, was developed and evaluated for rapid detection of Trypanosoma evansi in experimentally infected mice and naturally infected camels (Camelus dromedarius). Four oligonucleotide primers (TE1, TE2, TE3 and TE4), selected from nuclear repetitive gene of T. evansi, were designed and used for PCR amplifications. The first amplification, using a pair of outer primers TE1 and TE2, produced a 821-bp primary PCR product from T. evansi DNA. The second amplification, using nested (internal) pair of primers TE3 and TE4, produced a 270-bp PCR product. T. evansi DNAs extracted from blood samples of experimentally infected mice and naturally infected Sudanese breed of dromedary camels were detected by this nested PCR-based assay. The nested primers TE3 and TE4 increased the sensitivity of the PCR assay and as little as 10 fg of T. evansi DNA (equivalent to a single copy of the putative gene of the parasite) was amplified and visualized onto ethidium bromide-stained agarose gels. Amplification products were not detected when the PCR-based assay was applied to DNA from other blood parasites including Thieleria annulata, Babesia bigemina or nucleic acid free samples. Application of this nPCR-based assay to clinical samples resulted in direct detection of T. evansi from a variety of tissue samples collected from experimentally infected mice and blood from naturally infected camels. The described nPCR-based assay provides a valuable tool to study the epidemiology of T. evansi infection in camels and other susceptible animal populations. PMID:16712737

Template Dimerization Promotes an Acceptor Invasion-Induced Transfer Mechanism during Human Immunodeficiency Virus Type 1 Minus-Strand Synthesis

PubMed Central

Balakrishnan, Mini; Roques, Bernard P.; Fay, Philip J.; Bambara, Robert A.

2003-01-01

The biochemical mechanism of template switching by human immunodeficiency virus type 1 (HIV-1) reverse transcriptase and the role of template dimerization were examined. Homologous donor-acceptor template pairs derived from the HIV-1 untranslated leader region and containing the wild-type and mutant dimerization initiation sequences (DIS) were used to examine the efficiency and distribution of transfers. Inhibiting donor-acceptor interaction was sufficient to reduce transfers in DIS-containing template pairs, indicating that template dimerization, and not the mere presence of the DIS, promotes efficient transfers. Additionally, we show evidence that the overall transfer process spans an extended region of the template and proceeds through a two-step mechanism. Transfer is initiated through an RNase H-facilitated acceptor invasion step, while synthesis continues on the donor template. The invasion then propagates towards the primer terminus by branch migration. Transfer is completed with the translocation of the primer terminus at a site distant from the invasion point. In our system, most invasions initiated before synthesis reached the DIS. However, transfer of the primer terminus predominantly occurred after synthesis through the DIS. The two steps were separated by 60 to 80 nucleotides. Sequence markers revealed the position of primer terminus switch, whereas DNA oligomers designed to block acceptor-cDNA interactions defined sites of invasion. Within the region of homology, certain positions on the template were inherently more favorable for invasion than others. In templates with DIS, the proximity of the acceptor facilitates invasion, thereby enhancing transfer efficiency. Nucleocapsid protein enhanced the overall efficiency of transfers but did not alter the mechanism. PMID:12663778

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

PubMed

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

PubMed Central

2012-01-01

Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

Design of primers and probes for quantitative real-time PCR methods.

PubMed

Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

2015-01-01

Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

PubMed

Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

2013-03-11

Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

Study Of Genetic Diversity Between Grasspea Landraces Using Morphological And Molecular Marker

NASA Astrophysics Data System (ADS)

Sedehi, Abbasali Vahabi; Lotfi, Asefeh; Solooki, Mahmood

2008-01-01

Grass pea is a beneficial crop to Iran since it has some major advantageous such as high grain and forage quality, high drought tolerance and medium level of salinity tolerance and a good native germplasm variation which accessible for breeding programs. This study was carried out to evaluate morphological traits of the grass pea landraces using a randomized complete block design with 3 replications at Research Farm of Isfahan University of Technology. To evaluate genetic diversity of 14 grass pea landraces from various locations in Iran were investigated using 32 RAPD & ISJ primers at Biocenter of University of Zabol. Analysis of variance indicated a highly significant differences among 14 grass pea landrace for the morphological traits. Average of polymorphism percentage of RAPD primer was 73.9%. Among used primer, 12 random primers showed polymorphism and a total of 56 different bands were observed in the genotypes. Jafar-abad and Sar-chahan genotypes with similarity coefficient of 66% and Khoram-abad 2 and Khoram-abad 7 genotypes with similarity coefficient of 3% were the most related and the most distinct genotypes, respectively. Fourteen primers out of 17 semi random primers produced 70 polymorphic bands which included 56% of the total 126 produced bands. Genetic relatedness among population was investigated using Jacard coefficient and unweighted pair group mean analysis (UPGMA) algorithm. The result of this research verified possibility of use of RAPD & ISJ markers for estimation of genetic diversity, management of genetic resources and determination of repetitive accessions in grass pea.

Evaluation of LSSP-PCR for identification of Leptospira spp. in urine samples of cattle with clinical suspicion of leptospirosis.

PubMed

Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota

2006-12-20

We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Development and validation of the first SSR markers for Mimosa scabrella Benth.

PubMed

Saiki, F A; Bernardi, A P; Reis, M S; Faoro, H; Souza, E M; Pedrosa, F O; Mantovani, A; Guidolin, A F

2017-02-16

Mimosa scabrella Benth., popularly known as ''bracatinga'', is a pioneer and endemic species of Brazil, occurring in Mixed Ombrophilous Forest associated with Brazilian Atlantic Rainforest biomes. It is a fast-growing tree of the Fabaceae family that facilitates the dynamics of ecological succession. SSR development, when there is no genome sequence, is time and labor intensive and there are no molecular markers for M. scabrella. We developed and validated the first microsatellite markers for this tetraploid species, evaluating mother trees and progenies. Using Illumina sequencing, we identified 290 SSR loci and 211 primer pairs. After 31 SSR loci PCR/agarose electrophoresis selection, a subset of 11 primer pairs was synthetized with fluorescence in the forward primer for PCR and capillary electrophoresis validation with leaf DNA of 33 adult and 411 progeny individuals. Polymorphic locus percentage was 36, 4 in 11 loci, 3 chloroplast SSRs, and 1 nuclear SSR. Allele number of polymorphic loci ranged from 2 to 11 alleles considering all sampling. All 11 primer pairs were also tested for cross-species amplification for five Fabaceae-Mimosoideae species, ranging from 2 loci transferred to Calliandra tweedii Benth. and all 11 loci transferred to Mimosa taimbensis Burkart. The assessed and validated SSR markers for M. scabrella are suitable and useful for analysis and population genetic studies.

A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

PubMed

Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

2015-10-30

Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

Construction of a primary DNA fingerprint database for cotton cultivars.

PubMed

Zhang, Y C; Kuang, M; Yang, W H; Xu, H X; Zhou, D Y; Wang, Y Q; Feng, X A; Su, C; Wang, F

2013-06-13

Forty core primers were used to construct a DNA fingerprint database of 132 cotton species based on multiplex fluorescence detection technology. A high first successful ratio of 99.04% was demonstrated with tetraplex polymerase chain reaction. Forty primer pairs amplified a total of 262 genotypes among 132 species, with an average of 6.55 per primer and values of polymorphism information content varying from 0.340 to 0.882. Conflicting DNA homozygous ratios were found in various species. The highest DNA homozygous ratio was found in landrace standard cultivars, which had an 81.46% DNA homozygous ratio. The lowest occurred in a group of 2010 leading cultivars with a homozygous ratio of 63.04%. Genetic diversity of the 132 species was briefly analyzed using unweighted pair-group method with arithmetic means.

MethPrimer: designing primers for methylation PCRs.

PubMed

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Application of myostatin in sheep breeding programs: A review

PubMed Central

Miar, Younes; Salehi, Abdolreza; Kolbehdari, Davood; Aleyasin, Seyed Ahmad

2014-01-01

Plasma membrane H+-ATPase is a major integral membrane protein with a role in various physiological processes including abiotic stress response. To study the effect of NaCl on the expression pattern of a gene encoding the plasma membrane H+-ATPase, an experiment was carried out in a completely random design with three replications. A pair of specific primers was designed based on the sequence of the gene encoding plasma membrane H+-ATPase in Aeluropus littoralis to amplify a 259 bp fragment from the target gene by PCR. A gene encoding actin was used as reference gene to normalize the expression level of the target gene. A pair of specific primers was designed to amplify a 157 bp fragment from the actin gene by PCR. Plants were treated with different concentrations of NaCl, 0, 50, 100, 150, 200, 250, 500 and 1000 mM, for two days. Our results showed that the expression level of the plasma membrane H+-ATPase gene increased dramatically at 500 mM and then decreased with increasing concentrations of NaCl. The results also indicated that the leaves of plants, were treated with high concentrations of NaCl changed morphologically, but those grown under low concentrations of NaCl as well as the control plants did not show morphological changes in their leaves. Our results suggest a relation between morphological changes of treated plants and the expression level of the plasma membrane H+-ATPase gene in Aeluropus littoralis. PMID:27843975

Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

PubMed

Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

2015-08-14

In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena

trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPsmore » to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N{sub 2}-dGuo lesion remained in the ring-closed conformation at the active site. The incoming dNTP, either dGTP or dATP, was positioned with Watson-Crick pairing opposite the template 5'-neighbor base, dCyt or dThy, respectively. In contrast, for the 18-mer:14-mer template-primers with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, ring opening of the adduct to the corresponding N{sub 2}-dGuo aldehyde species occurred. This allowed Watson-Crick base pairing at the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair.« less

Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

PubMed Central

Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

2005-01-01

Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

In silico mining and characterization of simple sequence repeats from gilthead sea bream (Sparus aurata) expressed sequence tags (EST-SSRs); PCR amplification, polymorphism evaluation and multiplexing and cross-species assays.

PubMed

Vogiatzi, Emmanouella; Lagnel, Jacques; Pakaki, Victoria; Louro, Bruno; Canario, Adelino V M; Reinhardt, Richard; Kotoulas, Georgios; Magoulas, Antonios; Tsigenopoulos, Costas S

2011-06-01

We screened for simple sequence repeats (SSRs) found in ESTs derived from an EST-database development project ('Marine Genomics Europe' Network of Excellence). Different motifs of di-, tri-, tetra-, penta- and hexanucleotide SSRs were evaluated for variation in length and position in the expressed sequences, relative abundance and distribution in gilthead sea bream (Sparus aurata). We found 899 ESTs that harbor 997 SSRs (4.94%). On average, one SSR was found per 2.95 kb of EST sequence and the dinucleotide SSRs are the most abundant accounting for 47.6% of the total number. EST-SSRs were used as template for primer design. 664 primer pairs could be successfully identified and a subset of 206 pairs of primers was synthesized, PCR-tested and visualized on ethidium bromide stained agarose gels. The main objective was to further assess the potential of EST-SSRs as informative markers and investigate their cross-species amplification in sixteen teleost fish species: seven sparid species and nine other species from different families. Approximately 78% of the primer pairs gave PCR products of expected size in gilthead sea bream, and as expected, the rate of successful amplification of sea bream EST-SSRs was higher in sparids, lower in other perciforms and even lower in species of the Clupeiform and Gadiform orders. We finally determined the polymorphism and the heterozygosity of 63 markers in a wild gilthead sea bream population; fifty-eight loci were found to be polymorphic with the expected heterozygosity and the number of alleles ranging from 0.089 to 0.946 and from 2 to 27, respectively. These tools and markers are expected to enhance the available genetic linkage map in gilthead sea bream, to assist comparative mapping and genome analyses for this species and further with other model fish species and finally to help advance genetic analysis for cultivated and wild populations and accelerate breeding programs. Copyright © 2011 Elsevier B.V. All rights reserved.

Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

PubMed Central

Watkins, Norman E.; SantaLucia, John

2005-01-01

Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

PubMed

Meena, Ram Prasnna; Baranwal, V K

2016-09-01

Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

PubMed

Boehm; Gibson; Lubzens

2000-01-01

This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

Next-Generation Sequencing of the Chrysanthemum nankingense (Asteraceae) Transcriptome Permits Large-Scale Unigene Assembly and SSR Marker Discovery

PubMed Central

Wang, Haibin; Jiang, Jiafu; Chen, Sumei; Qi, Xiangyu; Peng, Hui; Li, Pirui; Song, Aiping; Guan, Zhiyong; Fang, Weimin; Liao, Yuan; Chen, Fadi

2013-01-01

Background Simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Chrysanthemum is one of the largest genera in the Asteraceae family. Only few Chrysanthemum expressed sequence tag (EST) sequences have been acquired to date, so the number of available EST-SSR markers is very low. Methodology/Principal Findings Illumina paired-end sequencing technology produced over 53 million sequencing reads from C. nankingense mRNA. The subsequent de novo assembly yielded 70,895 unigenes, of which 45,789 (64.59%) unigenes showed similarity to the sequences in NCBI database. Out of 45,789 sequences, 107 have hits to the Chrysanthemum Nr protein database; 679 and 277 sequences have hits to the database of Helianthus and Lactuca species, respectively. MISA software identified a large number of putative EST-SSRs, allowing 1,788 primer pairs to be designed from the de novo transcriptome sequence and a further 363 from archival EST sequence. Among 100 primer pairs randomly chosen, 81 markers have amplicons and 20 are polymorphic for genotypes analysis in Chrysanthemum. The results showed that most (but not all) of the assays were transferable across species and that they exposed a significant amount of allelic diversity. Conclusions/Significance SSR markers acquired by transcriptome sequencing are potentially useful for marker-assisted breeding and genetic analysis in the genus Chrysanthemum and its related genera. PMID:23626799

Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas

PubMed Central

2014-01-01

Background Grasspea (Lathyrus sativus L., 2n = 14), a member of the family Leguminosae, holds great agronomic potential as grain and forage legume crop in the arid areas for its superb resilience to abiotic stresses such as drought, flood and salinity. The crop could not make much progress through conventional breeding in the past, and there are hardly any detailed molecular biology studies due to paucity of reliable molecular markers representative of the entire genome. Results Using the 454 FLX Titanium pyrosequencing technique, 651,827 simple sequence repeat (SSR) loci were identified and 50,144 nonredundant primer pairs were successfully designed, of which 288 were randomly selected for validation among 23 L. sativus and one L. cicera accessions of diverse provenance. 74 were polymorphic, 70 monomorphic, and 144 with no PCR product. The number of observed alleles ranged from two to five, the observed heterozygosity from 0 to 0.9545, and Shannon’s information index ranged from 0.1013 to 1.0980, respectively. The dendrogram constructed by using unweighted pair group method with arithmetic mean (UPGMA) based on Nei's genetic distance, showed obvious distinctions and understandable relationships among the 24 accessions. Conclusions The large number of SSR primer pairs developed in this study would make a significant contribution to genomics enabled improvement of grasspea. PMID:24635905

The Role of SncN and Ski in Mammary Epithelial Cell Transformation

DTIC Science & Technology

2005-07-01

cellular activities through the Smad proteins. Upon phosphorylation by the active TGFβ receptor kinases, Smad2 and Smad3 oligomerize with Smad4, translocate...sequence in sense and antisense orientation with an intervening linker . Primer pairs were designed to generate single-strand overhangs upon annealing...nuclear protein, based on studies of ectopically expressed SnoN and endogenous SnoN in cancer cell lines. In the nucleus, SnoN binds to Smad2, Smad3 , and

Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

PubMed

Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

2015-07-01

Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

PubMed Central

2013-01-01

Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

PubMed Central

O’Halloran, Damien M.

2016-01-01

Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

PubMed Central

2012-01-01

Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

Primer3_masker: integrating masking of template sequence with primer design software.

PubMed

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

[Contamination with genetically modified maize MON863 of processed foods on the market].

PubMed

Ohgiya, Yoko; Sakai, Masaaki; Miyashita, Taeko; Yano, Koichi

2009-06-01

Genetically modified maize MON863 (MON863), which has passed a safety examination in Japan, is commercially cultivated in the United States as a food and a resource for fuel. Maize is an anemophilous flower, which easily hybridizes. However, an official method for quantifying the content of MON863 has not been provided yet in Japan. We here examined MON863 contamination in maize-processed foods that had no labeling indicating of the use of genetically modified maize.From March 2006 to July 2008, we purchased 20 frozen maize products, 8 maize powder products, 7 canned maize products and 4 other maize processed foods. Three primer pairs named MON 863 primer, MON863-1, and M3/M4 for MON863-specific integrated cassette were used for qualitative polymerase chain reaction (PCR). A primer pair "SSIIb-3" for starch synthase gene was used to confirm the quality of extracted DNA. The starch synthase gene was detected in all samples. In qualitative tests, the MON863-specific fragments were detected in 7 (18%) maize powder products out of the 39 processed foods with all the three primer pairs.We concluded that various maize processed foods on the market were contaminated with MON863. It is important to accumulate further information on MON863 contamination in maize-processed foods that have no label indication of the use of genetically modified maize.

Non-invasive assessment of parasitic nematode species diversity in wild Soay sheep using molecular markers.

PubMed

Wimmer, B; Craig, B H; Pilkington, J G; Pemberton, J M

2004-04-01

Considerable effort has been put into detecting and identifying parasitic nematodes in live ruminants, but to date most studies are limited to a small group of nematodes and/or to experimentally infected sheep. In this study, a PCR-based assay using species-specific primer pairs, located in the second internal transcribed spacer ribosomal DNA, was developed to identify nine different species from six different families of parasitic nematodes in a wild, unmanaged and naturally infected population of sheep. Each primer pair was tested for its specificity and sensitivity and it exclusively amplified the species it was designed for and exhibited a high degree of sensitivity. The method was applied to eggs and cultured larvae to identify the parasitic nematodes present in a pooled faecal sample from several host individuals with unknown parasite burden. To test detection reliability, a faecal sample from an individual with known parasite burden (through post-mortem analysis) was also examined. All species present could be correctly identified by PCR, but detecting very low levels and/or early stages of infection proved to be difficult. The method was also tested for its applicability to high through-put screening of faecal samples.

A nested multiplex polymerase chain reaction assay for the differential identification of three zooanthroponotic chlamydial strains in porcine swab samples.

PubMed

Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo

2011-07-01

Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.

Qualitative PCR method for Roundup Ready soybean: interlaboratory study.

PubMed

Kodama, Takashi; Kasahara, Masaki; Minegishi, Yasutaka; Futo, Satoshi; Sawada, Chihiro; Watai, Masatoshi; Akiyama, Hiroshi; Teshima, Reiko; Kurosawa, Yasunori; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2011-01-01

Quantitative and qualitative methods based on PCR have been developed for genetically modified organisms (GMO). Interlaboratory studies were previously conducted for GMO quantitative methods; in this study, an interlaboratory study was conducted for a qualitative method for a GM soybean, Roundup Ready soy (RR soy), with primer pairs designed for the quantitative method of RR soy studied previously. Fourteen laboratories in Japan participated. Each participant extracted DNA from 1.0 g each of the soy samples containing 0, 0.05, and 0.10% of RR soy, and performed PCR with primer pairs for an internal control gene (Le1) and RR soy followed by agarose gel electrophoresis. The PCR product amplified in this PCR system for Le1 was detected from all samples. The sensitivity, specificity, and false-negative and false-positive rates of the method were obtained from the results of RR soy detection. False-negative rates at the level of 0.05 and 0.10% of the RR soy samples were 6.0 and 2.3%, respectively, revealing that the LOD of the method was somewhat below 0.10%. The current study demonstrated that the qualitative method would be practical for monitoring the labeling system of GM soy in kernel lots.

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

PubMed

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

Use of novel species-specific PCR primers targeted to DNA gyrase subunit B (gyrB) gene for species identification of the Cronobacter sakazakii and Cronobacter dublinensis.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina

2013-02-01

Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.

Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

PubMed Central

Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

1996-01-01

Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

De novo transcriptomic analysis and development of EST-SSR markers in the Siberian tiger (Panthera tigris altaica).

PubMed

Lu, Taofeng; Sun, Yujiao; Ma, Qin; Zhu, Minghao; Liu, Dan; Ma, Jianzhang; Ma, Yuehui; Chen, Hongyan; Guan, Weijun

2016-12-01

The Siberian tiger, Panthera tigris altaica, is an endangered species, and much more work is needed to protect this species, which is still vulnerable to extinction. Conservation efforts may be supported by the genetic assessment of wild populations, for which highly specific microsatellite markers are required. However, only a limited amount of genetic sequence data is available for this species. To identify the genes involved in the lung transcriptome and to develop additional simple sequence repeat (SSR) markers for the Siberian tiger, we used high-throughput RNA-Seq to characterize the Siberian tiger transcriptome in lung tissue (designated 'PTA-lung') and a pooled tissue sample (designated 'PTA'). Approximately 47.5 % (33,187/69,836) of the lung transcriptome was annotated in four public databases (Nr, Swiss-Prot, KEGG, and COG). The annotated genes formed a potential pool for gene identification in the tiger. An analysis of the genes differentially expressed in the PTA lung, and PTA samples revealed that the tiger may have suffered a series of diseases before death. In total, 1062 non-redundant SSRs were identified in the Siberian tiger transcriptome. Forty-three primer pairs were randomly selected for amplification reactions, and 26 of the 43 pairs were also used to evaluate the levels of genetic polymorphism. Fourteen primer pairs (32.56 %) amplified products that were polymorphic in size in P. tigris altaica. In conclusion, the transcriptome sequences will provide a valuable genomic resource for genetic research, and these new SSR markers comprise a reasonable number of loci for the genetic analysis of wild and captive populations of P. tigris altaica.

Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

PubMed

Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

2007-06-01

The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

PubMed Central

Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

2015-01-01

Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

Real-Time PCR for the Detection and Quantification of Geodermatophilaceae from Stone Samples and Identification of New Members of the Genus Blastococcus†

PubMed Central

Salazar, Oscar; Valverde, Aranzazu; Genilloud, Olga

2006-01-01

Real-time PCR (RT-PCR) technology was used for the specific detection and quantification of members of the family Geodermatophilaceae in stone samples. Differences in the nucleotide sequences of the 16S rRNA gene region were used to design a pair of family-specific primers that were used to detect and quantify by RT-PCR DNA from members of this family in stone samples from different geographical origins in Spain. These primers were applied later to identify by PCR-specific amplification new members of the family Geodermatophilaceae isolated from the same stone samples. The diversity and taxonomic position of the wild-type strains identified from ribosomal sequence analysis suggest the presence of a new lineage within the genus Blastococcus. PMID:16391063

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

PubMed

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Development of Genomic Microsatellite Markers in Carthamus tinctorius L. (Safflower) Using Next Generation Sequencing and Assessment of Their Cross-Species Transferability and Utility for Diversity Analysis

PubMed Central

Variath, Murali Tottekkad; Joshi, Gopal; Bali, Sapinder; Agarwal, Manu; Kumar, Amar; Jagannath, Arun; Goel, Shailendra

2015-01-01

Background Safflower (Carthamus tinctorius L.), an Asteraceae member, yields high quality edible oil rich in unsaturated fatty acids and is resilient to dry conditions. The crop holds tremendous potential for improvement through concerted molecular breeding programs due to the availability of significant genetic and phenotypic diversity. Genomic resources that could facilitate such breeding programs remain largely underdeveloped in the crop. The present study was initiated to develop a large set of novel microsatellite markers for safflower using next generation sequencing. Principal Findings Low throughput genome sequencing of safflower was performed using Illumina paired end technology providing ~3.5X coverage of the genome. Analysis of sequencing data allowed identification of 23,067 regions harboring perfect microsatellite loci. The safflower genome was found to be rich in dinucleotide repeats followed by tri-, tetra-, penta- and hexa-nucleotides. Primer pairs were designed for 5,716 novel microsatellite sequences with repeat length ≥ 20 bases and optimal flanking regions. A subset of 325 microsatellite loci was tested for amplification, of which 294 loci produced robust amplification. The validated primers were used for assessment of 23 safflower accessions belonging to diverse agro-climatic zones of the world leading to identification of 93 polymorphic primers (31.6%). The numbers of observed alleles at each locus ranged from two to four and mean polymorphism information content was found to be 0.3075. The polymorphic primers were tested for cross-species transferability on nine wild relatives of cultivated safflower. All primers except one showed amplification in at least two wild species while 25 primers amplified across all the nine species. The UPGMA dendrogram clustered C. tinctorius accessions and wild species separately into two major groups. The proposed progenitor species of safflower, C. oxyacantha and C. palaestinus were genetically closer to cultivated safflower and formed a distinct cluster. The cluster analysis also distinguished diploid and tetraploid wild species of safflower. Conclusion Next generation sequencing of safflower genome generated a large set of microsatellite markers. The novel markers developed in this study will add to the existing repertoire of markers and can be used for diversity analysis, synteny studies, construction of linkage maps and marker-assisted selection. PMID:26287743

Isolation and characterization of microsatellite markers for red elm (Ulmus rubra Muhl.) and cross-species amplification with Siberian elm (Ulmus pumila L.).

PubMed

Zalapa, J E; Brunet, J; Guries, R P

2008-01-01

Ulmus pumila is an elm species, non-native to the USA that hybridizes with Ulmus rubra. In order to study the genetic structure and hybridization patterns between these two elm species, we developed 15 primer pairs for microsatellite loci in U. rubra and tested their cross-amplification in U. pumila. All 15 primers amplified in both species, 11 of which possessed species-specific alleles. Eight loci were polymorphic in U. pumila and eight in U. rubra, each with two to eight alleles per locus. In addition, five primer pairs previously developed in U. laevis and U. carpinifolia (syn. U. minor) cross-amplified and showed polymorphic loci in U. pumila and/or U. rubra. These markers will facilitate the study of genetic structure and gene flow between U. rubra and exotic, invasive U. pumila. © 2007 Blackwell Publishing Ltd No claim to original US government works.

FUNGAL BIOGEOGRAPHY. Response to Comment on "Global diversity and geography of soil fungi".

PubMed

Tedersoo, Leho; Bahram, Mohammad; Põlme, Sergei; Anslan, Sten; Riit, Taavi; Kõljalg, Urmas; Nilsson, R Henrik; Hildebrand, Falk; Abarenkov, Kessy

2015-08-28

Schadt and Rosling (Technical Comment, 26 June 2015, p. 1438) argue that primer-template mismatches neglected the fungal class Archaeorhizomycetes in a global soil survey. Amplicon-based metabarcoding of nine barcode-primer pair combinations and polymerase chain reaction (PCR)-free shotgun metagenomics revealed that barcode and primer choice and PCR bias drive the diversity and composition of microorganisms in general, but the Archaeorhizomycetes were little affected in the global study. We urge that careful choice of DNA markers and primers is essential for ecological studies using high-throughput sequencing for identification. Copyright © 2015, American Association for the Advancement of Science.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

PubMed

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko

Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less

Microsatellites for Carpotroche brasiliensis (Flacourtiaceae), a useful species for agroforestry and ecosystem conservation.

PubMed

Bittencourt, Flora; Alves, Jackeline S; Gaiotto, Fernanda A

2015-12-01

We developed microsatellite markers for Carpotroche brasiliensis (Flacourtiaceae), a dioecious tree that is used as a food resource by midsize animals of the Brazilian fauna. We designed 30 primer pairs using next-generation sequencing and classified 25 pairs as polymorphic. Observed heterozygosity ranged from 0.5 to 1.0, and expected heterozygosity ranged from 0.418 to 0.907. The combined probability of exclusion was greater than 0.999 and the combined probability of identity was less than 0.001, indicating that these microsatellites are appropriate for investigations of genetic structure, individual identification, and paternity testing. The developed molecular tools may contribute to future studies of population genetics, answering ecological and evolutionary questions regarding efficient conservation strategies for C. brasiliensis.

Quantification of Azospirillum brasilense FP2 Bacteria in Wheat Roots by Strain-Specific Quantitative PCR.

PubMed

Stets, Maria Isabel; Alqueres, Sylvia Maria Campbell; Souza, Emanuel Maltempi; Pedrosa, Fábio de Oliveira; Schmid, Michael; Hartmann, Anton; Cruz, Leonardo Magalhães

2015-10-01

Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft genome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possible matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth conditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile conditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell numbers (∼10(7) CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used here can be applied to other organisms whose genome sequences are available. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Quantification of Azospirillum brasilense FP2 Bacteria in Wheat Roots by Strain-Specific Quantitative PCR

PubMed Central

Stets, Maria Isabel; Alqueres, Sylvia Maria Campbell; Souza, Emanuel Maltempi; Pedrosa, Fábio de Oliveira; Schmid, Michael

2015-01-01

Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft genome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possible matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth conditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile conditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell numbers (∼107 CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used here can be applied to other organisms whose genome sequences are available. PMID:26187960

A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

PubMed

Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

2015-06-01

Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

PubMed Central

Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S; Pedersen, Susanne K; Leekitcharoenphon, Pimlapas; Hansen, Inge M; Guerra, Beatriz; Malorny, Burkhard; Borowiak, Maria; Hammerl, Jens Andre; Battisti, Antonio; Franco, Alessia; Alba, Patricia; Perrin-Guyomard, Agnes; Granier, Sophie A; De Frutos Escobar, Cristina; Malhotra-Kumar, Surbhi; Villa, Laura; Carattoli, Alessandra; Hendriksen, Rene S

2018-01-01

Background and aim Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriaceae was developed for surveillance or research purposes. Methods: We designed four new primer pairs to amplify mcr-1, mcr-2, mcr-3 and mcr-4 gene products and used the originally described primers for mcr-5 to obtain a stepwise separation of ca 200 bp between amplicons. The primer pairs and amplification conditions allow for single or multiple detection of all currently described mcr genes and their variants present in Enterobacteriaceae. The protocol was validated testing 49 European Escherichia coli and Salmonella isolates of animal origin. Results: Multiplex PCR results in bovine and porcine isolates from Spain, Germany, France and Italy showed full concordance with whole genome sequence data. The method was able to detect mcr-1, mcr-3 and mcr-4 as singletons or in different combinations as they were present in the test isolates. One new mcr-4 variant, mcr-4.3, was also identified. Conclusions: This method allows rapid identification of mcr-positive bacteria and overcomes the challenges of phenotypic detection of colistin resistance. The multiplex PCR should be particularly interesting in settings or laboratories with limited resources for performing genetic analysis as it provides information on the mechanism of colistin resistance without requiring genome sequencing. PMID:29439754

De novo characterization of Larimichthys crocea transcriptome for growth-/immune-related gene identification and massive microsatellite (SSR) marker development

NASA Astrophysics Data System (ADS)

Han, Zhaofang; Xiao, Shijun; Liu, Xiande; Liu, Yang; Li, Jiakai; Xie, Yangjie; Wang, Zhiyong

2017-03-01

The large yellow croaker, Larimichthys crocea is an important marine fish in China with a high economic value. In the last decade, the stock conservation and aquaculture industry of this species have been facing severe challenges because of wild population collapse and degeneration of important economic traits. However, genes contributing to growth and immunity in L. crocea have not been thoroughly analyzed, and available molecular markers are still not sufficient for genetic resource management and molecular selection. In this work, we sequenced the transcriptome in L. crocea liver tissue with a Roche 454 sequencing platform and assembled the transcriptome into 93 801 transcripts. Of them, 38 856 transcripts were successfully annotated in nt, nr, Swiss-Prot, InterPro, COG, GO and KEGG databases. Based on the annotation information, 3 165 unigenes related to growth and immunity were identified. Additionally, a total of 6 391 simple sequence repeats (SSRs) were identified from the transcriptome, among which 4 498 SSRs had enough flanking regions to design primers for polymerase chain reactions (PCR). To access the polymorphism of these markers, 30 primer pairs were randomly selected for PCR amplification and validation in 30 individuals, and 12 primer pairs (40.0%) exhibited obvious length polymorphisms. This work applied RNA-Seq to assemble and analyze a live transcriptome in L. crocea. With gene annotation and sequence information, genes related to growth and immunity were identified and massive SSR markers were developed, providing valuable genetic resources for future gene functional analysis and selective breeding of L. crocea.

Microsatellites for the genus Cucurbita and an SSR-based genetic linkage map of Cucurbita pepo L.

PubMed Central

Gong, L.; Stift, G.; Kofler, R.; Pachner, M.

2008-01-01

Until recently, only a few microsatellites have been available for Cucurbita, thus their development is highly desirable. The Austrian oil-pumpkin variety Gleisdorfer Ölkürbis (C. pepo subsp. pepo) and the C. moschata cultivar Soler (Puerto Rico) were used for SSR development. SSR-enriched partial genomic libraries were established and 2,400 clones were sequenced. Of these 1,058 (44%) contained an SSR at least four repeats long. Primers were designed for 532 SSRs; 500 primer pairs produced fragments of expected size. Of these, 405 (81%) amplified polymorphic fragments in a set of 12 genotypes: three C. moschata, one C. ecuadorensis, and eight C. pepo representing all eight cultivar groups. On an average, C. pepo and C. moschata produced 3.3 alleles per primer pair, showing high inter-species transferability. There were 187 SSR markers detecting polymorphism between the USA oil-pumpkin variety “Lady Godiva” (O5) and the Italian crookneck variety “Bianco Friulano” (CN), which are the parents of our previous F2 mapping population. It has been used to construct the first published C. pepo map, containing mainly RAPD and AFLP markers. Now the updated map comprises 178 SSRs, 244 AFLPs, 230 RAPDs, five SCARs, and two morphological traits (h and B). It contains 20 linkage groups with a map density of 2.9 cM. The observed genome coverage (Co) is 86.8%. Electronic supplementary material The online version of this article (doi:10.1007/s00122-008-0750-2) contains supplementary material, which is available to authorized users. PMID:18379753

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-01-01

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

A novel copro-diagnostic molecular method for qualitative detection and identification of parasitic nematodes in amphibians and reptiles.

PubMed

Huggins, Lucas G; Michaels, Christopher J; Cruickshank, Sheena M; Preziosi, Richard F; Else, Kathryn J

2017-01-01

Anthropogenic disturbance via resource acquisition, habitat fragmentation and climate change, amongst other factors, has led to catastrophic global biodiversity losses and species extinctions at an accelerating rate. Amphibians are currently one of the worst affected classes with at least a third of species categorised as being threatened with extinction. At the same time, they are also critically important for many habitats and provide man with a powerful proxy for ecosystem health by acting as a bioindicator group. Whilst the causes of synchronised amphibian losses are varied recent research has begun to highlight a growing role that macroparasites are playing in amphibian declines. However, diagnosing parasite infection in the field can be problematic, principally relying on collection and euthanasia of hosts, followed by necropsy and morphological identification of parasites in situ. The current study developed a non-invasive PCR-based methodology for sensitive detection and identification of parasitic nematode DNA released in the faeces of infected amphibians as egg or tissue fragments (environmental DNA). A DNA extraction protocol optimised for liberation of DNA from resilient parasite eggs was developed alongside the design of a novel, nematode universal, degenerate primer pair, thus avoiding the difficulties of using species specific primers in situations where common parasite species are unknown. Used in conjunction this protocol and primer pair was tested on a wide range of faecal samples from captive and wild amphibians. The primers and protocol were validated and detected infections, including a Railletnema nematode infection in poison dart frogs from ZSL London Zoo and Mantella cowani frogs in the wild. Furthermore, we demonstrate the efficacy of our PCR-based protocol for detecting nematode infection in other hosts, such as the presence of pinworm (Aspiculuris) in two tortoise species and whipworm (Trichuris muris) in mice. Our environmental DNA approach mitigates problems associated with microscopic identification and can be applied to detect nematode parasitoses in wild and captive hosts for infection surveillance and maintenance of healthy populations.

A novel copro-diagnostic molecular method for qualitative detection and identification of parasitic nematodes in amphibians and reptiles

PubMed Central

Michaels, Christopher J.

2017-01-01

Anthropogenic disturbance via resource acquisition, habitat fragmentation and climate change, amongst other factors, has led to catastrophic global biodiversity losses and species extinctions at an accelerating rate. Amphibians are currently one of the worst affected classes with at least a third of species categorised as being threatened with extinction. At the same time, they are also critically important for many habitats and provide man with a powerful proxy for ecosystem health by acting as a bioindicator group. Whilst the causes of synchronised amphibian losses are varied recent research has begun to highlight a growing role that macroparasites are playing in amphibian declines. However, diagnosing parasite infection in the field can be problematic, principally relying on collection and euthanasia of hosts, followed by necropsy and morphological identification of parasites in situ. The current study developed a non-invasive PCR-based methodology for sensitive detection and identification of parasitic nematode DNA released in the faeces of infected amphibians as egg or tissue fragments (environmental DNA). A DNA extraction protocol optimised for liberation of DNA from resilient parasite eggs was developed alongside the design of a novel, nematode universal, degenerate primer pair, thus avoiding the difficulties of using species specific primers in situations where common parasite species are unknown. Used in conjunction this protocol and primer pair was tested on a wide range of faecal samples from captive and wild amphibians. The primers and protocol were validated and detected infections, including a Railletnema nematode infection in poison dart frogs from ZSL London Zoo and Mantella cowani frogs in the wild. Furthermore, we demonstrate the efficacy of our PCR-based protocol for detecting nematode infection in other hosts, such as the presence of pinworm (Aspiculuris) in two tortoise species and whipworm (Trichuris muris) in mice. Our environmental DNA approach mitigates problems associated with microscopic identification and can be applied to detect nematode parasitoses in wild and captive hosts for infection surveillance and maintenance of healthy populations. PMID:28934299

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

[DNA marker-assisted selection of medicinal plants (Ⅰ) .Breeding research of disease-resistant cultivars of Panax notoginseng].

PubMed

Li, Qing; Li, Biao; Guo, Shun-Xing

2017-01-01

SSR is one of the most important molecular markers used in molecular identification and genetic diversity research of Dendrobium nobile. In order to enrich the library of SSR and establish a method for rapid identification of D. nobile, the SSR information was analyzed in the transcriptome of D. nobile. A total of 32 709 SSRs were obtained from the transcriptome of D. nobile, distributed in 26 742 unigenes with the distribution frequency of 12.90%. SSR loci occurred every 3 748 bp. Mono-nucleotide repeat was the main type, account for as much as 72.18% of all SSRs, followed by di-nucleotide (15.97%) and tri-nucleotide (11.19%). Among all repeat types, A/T was the predominant one followed by AG/CT. Finally a total of 62 157 primer pairs were designed for marker development. Randomly 20 pairs of primers were selected for PCR amplification, 17 amplified on clear and reproducible bands, the amplification rate was 85.0%.Thirteen pairs were polymorphic among the 3 Dendrobium plants. The results indicated that the unigenes generated from transcriptome sequencing in D. nobile can be used as effective source to develop SSR markers. The SSR loci in the transcriptome of D. nobile have the characteristics of type riches, high density and high potential of polymorphism, and these characteristics might applied in the study of molecular identification, genetic diversity and marker-assisted breeding of D. nobile and its closely related species. Copyright© by the Chinese Pharmaceutical Association.

[Oligonucleotide microarray for subtyping avian influenza virus].

PubMed

Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

2008-09-01

Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

PubMed

Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

2015-08-01

Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Development of a species-diagnostic marker for identification of the stingless bee Trigona pagdeni in Thailand.

PubMed

Thummajitsakul, Sirikul; Klinbunga, Sirawut; Sittipraneed, Siriporn

2010-04-01

A species-diagnostic SCAR marker for identification of the stingless bee (Trigona pagdeni Schwarz) was successfully developed. Initially, amplified fragment length polymorphism analysis was carried out across representatives of 12 stingless bee species using 64 primer combinations. A 284 bp band restrictively found in T. pagdeni was cloned and sequenced. A primer pair (CUTP1-F/R) was designed and tested for species-specificity in 15 stingless bees. The expected 163 bp fragment was successfully amplified in all examined individuals of T. pagdeni (129/129). Nevertheless, cross-species amplification was also observed in T. fimbriata (1/3), T. collina (11/112), T. laeviceps (1/12), and T. fuscobalteata (15/15), but not in other species. SSCP analysis of CUTP1 further differentiated T. fuscobalteata and T. collina from T. pagdeni. Although T. laeviceps, T. fimbriata, and T. pagdeni shared an identical SSCP genotype, they are not taxonomically problematic species.

[Analysis on genetic polymorphism of 5 STR loci selected from X chromosome].

PubMed

Liu, Qi-ji; Gong, Yao-qin; Zhang, Xi-yu; Gao, Gui-min; Li, Jiang-xia; Guo, Yi-shou

2005-02-01

To select short tandem repeats(STR) from X chromosome. STR is a universal genetic marker that has changeable polymorphism and stable heredity in human genome. It is a specific DNA segment composed of 2-6 base pairs as its core sequence. It is an ideal DNA marker used in linkage analysis and gene mapping. In this study, 8 short tandem repeats were selected from two genomic clones on X chromosome by using BCM Search Launcher. Primers amplifying the STR loci were designed by using Primer 3.0 according to the unique sequence flanking the STRs. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five of these STRs were polymorphic. Chi-square test indicated that the distribution of genotypes agreed with Hardy-Weinberg equilibrium (P>0.05). Five polymorphic short tandem repeats have been identified on chromosome X and will be useful for linkage analysis and gene mapping.

Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

PubMed

Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

2012-04-01

Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

Development and Characterization of a Psathyrostachys huashanica Keng 7Ns Chromosome Addition Line with Leaf Rust Resistance

PubMed Central

Du, Wanli; Wang, Jing; Wang, Liangming; Zhang, Jun; Chen, Xinhong; Zhao, Jixin; Yang, Qunhui; Wu, Jun

2013-01-01

The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs) disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH), EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422) were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s). Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs. PMID:23976963

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

PubMed

Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

2016-10-01

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

A tool for design of primers for microRNA-specific quantitative RT-qPCR.

PubMed

Busk, Peter K

2014-01-28

MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

PubMed

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-07-08

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Development of a nested-PCR assay for the rapid detection of Pilidiella granati in pomegranate fruit

PubMed Central

Yang, Xue; Hameed, Uzma; Zhang, Ai-Fang; Zang, Hao-Yu; Gu, Chun-Yan; Chen, Yu; Xu, Yi-Liu

2017-01-01

Pilidiella granati, a causal agent of twig blight and crown rot of pomegranate, is an emerging threat that may cause severe risk to the pomegranate industry in the future. Development of a rapid assay for the timely and accurate detection of P. granati will be helpful in the active surveillance and management of the disease caused by this pathogen. In this study, a nested PCR method was established for the detection of P. granati. Comparative analysis of genetic diversity within 5.8S rDNA internal transcribed spacer (ITS) sequences of P. granati and 21 other selected fungal species was performed to design species-specific primers (S1 and S2). This primer pair successfully amplified a 450 bp product exclusively from the genomic DNA of P. granati. The developed method can detect 10 pg genomic DNA of the pathogen in about 6 h. This technique was successfully applied to detect the natural infection of P. granati in the pomegranate fruit. The designed protocol is rapid and precise with a high degree of sensitivity. PMID:28106107

Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions

PubMed Central

Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli

2001-01-01

Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067

The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

PubMed

Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

2003-06-01

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

PubMed

Abdulmawjood, A; Roth, S; Bülte, M

2002-10-01

For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

Sequence analysis of Chinese and Japanese Curcuma drugs on the 18S rRNA gene and trnK gene and the application of amplification-refractory mutation system analysis for their authentication.

PubMed

Sasaki, Yohei; Fushimi, Hirotoshi; Cao, Hui; Cai, Shao-Qing; Komatsu, Katsuko

2002-12-01

The botanical origins of Chinese and Japanese Curcuma drugs were determined to be Curcuma longa, C. phaeocaulis, the Japanese population of C. zedoaria, C. kwangsiensis, C. wenyujin, and C. aromatica based on a comparison of their 18S rRNA gene and trnK gene sequences with those of six Curcuma species reported previously. Moreover, to develop a more convenient identification method, amplification-refractory mutation system (ARMS) analysis of both gene regions was performed on plants. The ARMS method for the 18S rRNA gene was established using two types of forward primers designed based on the nucleotide difference at position 234. When DNAs of four Curcuma species were used as templates, PCR amplification with either of the two primers only generated a fragment of 912 base pairs (bp). However, when DNAs of the purple-cloud type of C. kwangsiensis and C. wenyujin were used, PCR amplifications with both primers unexpectedly generated the fragment, suggesting that these two were heterozygotes. The ARMS method for the trnK gene was also established using a mixture of four types of specific reverse primers designed on the basis of base substitutions and indels among six species, and common reverse and forward primers. C. phaeocaulis or the Chinese population of C. zedoaria, the Japanese population of C. zedoaria or the purple-cloud type of C. kwangsiensis, the pubescent type of C. kwangsiensis or C. wenyujin, and C. aromatica were found to show specific fragments of 730, 185, 527 or 528, and 641 or 642 bp, respectively. All species including C. longa also showed a common fragment of 897-904 bp. Using both ARMS methods, together with information on producing areas, the identification of Curcuma plants was achieved. Moreover, the ARMS method for the trnK gene was also useful for authentication of Curcuma drugs.

Novel ITS1 Fungal Primers for Characterization of the Mycobiome

PubMed Central

Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

2017-01-01

ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

AFLP marking and polymorphism among progenies of Gymnema sylvestre: an important medicinal plant of India.

PubMed

Osman, Magda Abbaker; Dhawan, Sunita Singh; Bahl, Janak Raj; Darokar, Mahendra P; Khanuja, Suman P S

2011-11-01

The level of polymorphism among twelve selected progenies of Gymnema sylvestre was investigated through AFLP markers by multiplexing PCR reactions using 64 (8x8) primer combinations. Fourteen primer combinations were selected as the most suitable combination for G. sylvestre. Analysis of the 12 progenies with these 14 primer pairs produced 1689 fragments of which 972 (57.5%) were polymorphic and 485 (28.7%) were unique to a particular genotype. The number of fragments produced by individual primer pairs was in the range of 55 to 225. Out of these, polymorphic fragments were in the range of 34 (E-ACC/M-CAC) to 157 (E-AGG/M-CAG) and unique bands observed were 8 (E-ACC / M-CAC) to 69 (E-AGG/M-CAC). Different primer combinations detected different levels of polymorphism, ranging from 33% (E-AGG/ M-CAC) to 69.8% (E-AGG/ M-CAC). From the observations, it appears that the primer combinations E-AGG/M-CAC, E-AGG/CTG, E-AGG/CAG and E-ACA/CAT were the most informative for the detection of polymorphism among the progenies compared with others, since they produced a high number of unique fragments. The similarity coefficient ranged from 0.212 to 0.731. High similarity was observed between progeny S8 and S9 (73%) and high divergence between progenies S3 and S11. Among the selected progeny, S9 was found to be the most similar to the parent (63%), while genotype S11 was the most distant (36.9%).

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

PubMed Central

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

PubMed

Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

2017-10-01

Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

Monitoring the freshness of fish: development of a qPCR method applied to MAP chilled whiting.

PubMed

Dehaut, Alexandre; Krzewinski, Frédéric; Grard, Thierry; Chollet, Marlène; Jacques, Philippe; Brisabois, Anne; Duflos, Guillaume

2016-04-01

Monitoring of early stages of freshness decay is a major issue for the fishery industry to guarantee the best quality for this highly perishable food matrix. Numerous techniques have been developed, but most of them have the disadvantage of being reliable only either in the last stages of fish freshness or for the analysis of whole fish. This study describes the development of a qPCR method targeting the torA gene harboured by fish spoilage microorganisms. torA encodes an enzyme that leads to the production of trimethylamine responsible for the characteristic spoiled-fish odour. A degenerate primer pair was designed. It amplified torA gene of both Vibrio and Photobacterium with good efficiencies on 7-log DNA dilutions. The primer pair was used during a shelf-life monitoring study achieved on modified atmosphere packed, chilled, whiting (Merlangius merlangus) fillets. The qPCR approach allows the detection of an increase of torA copies throughout the storage of fillets in correlation with the evolution of both total volatile basic nitrogen (-0.86) and trimethylamine concentrations (-0.81), known as spoilage markers. This study described a very promising, sensitive, reliable, time-effective, technique in the field of freshness characterisation of processed fish. © 2015 Society of Chemical Industry.

One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products.

PubMed

Hubalkova, Zora; Rencova, Eva

2011-10-01

A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.

Molecular DNA-based detection of ionising radiation in meat.

PubMed

Şakalar, Ergün

2017-05-01

Ionising radiation induces molecular alterations, such as formation of ions, free radicals, and new stable molecules, and cleavage of the chemical bonds of the molecules present in food. Irradiation-treated meat should be labelled to control the process and to ensure free consumer choice. Therefore, sensitive analytical methods are required to detect the irradiation dose. Meat samples were exposed to radiation doses of 0, 0.272, 0.497, 1.063, 3.64, 8.82 and 17.42 kGy in an industrial 60 Co gamma cell. Primers were designed to amplify 998, 498 and 250-base pair (bp) regions of the 18S rRNA gene of nuclear DNA from the irradiated samples. A new DNA-based method was developed to quantify the radiation exposed to the unstored meat and the meat stored at -20 °C for 3 and 6 months. The method was able to detect meat samples stored and unstored with dose limits of 1.063 and 3.64 kGy, respectively. The level of irradiation can be detected using primer pairs that target particularly different-sized sequences for DNA amplification by PCR. This method can be widely used for the analysis of not only meat samples, but also all biological materials containing DNA. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Enhanced Reliability and Accuracy for Field Deployable Bioforensic Detection and Discrimination of Xylella fastidiosa subsp. pauca, Causal Agent of Citrus Variegated Chlorosis Using Razor Ex Technology and TaqMan Quantitative PCR

PubMed Central

Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333

Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

PubMed

Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

PubMed Central

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

2006-01-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

PubMed

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

2006-07-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

PubMed

Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

2010-05-01

A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

Two molecular markers based on mitochondrial genomes for varieties identification of the northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids.

PubMed

Xincheng, Zhang; Kunci, Chen; Xinping, Zhu; Jian, Zhao; Qing, Luo; Xiaoyou, Hong; Wei, Li; Fengfang, Xiao

2015-08-01

The northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids have played important roles in the Chinese freshwater aquaculture industry, with an annual production in China exceeding 400 thousand tons. While these are popular aquaculture breeds in China, it is not easy to identify northern snakehead, blotched snakehead, and their hybrids. Thus, a method should be developed to identify these varieties. To distinguish between the reciprocal hybrids (C. argus ♀ × C. maculata ♂ and C. maculata ♀ × C. argus ♂), the mitochondrial genome sequences of northern snakehead and blotched snakehead and their reciprocal hybrids were compared. Following the alignment and analysis of mtDNA sequences of northern snakehead, blotched snakehead and their hybrids, two pairs of specific primers were designed based on identified differences ranging from 12S rRNA to 16S rRNA gene. The BY1 primers amplified the same bands in the blotched snakehead and the hybrid (C. maculata ♀ × C. argus ♂), while producing no products in northern snakehead and the hybrid (C. argus ♀ × C. maculata ♂). Amplification with WY1 yielded the opposite results. Then, 30 individuals per fish were randomized to verify the primers, and the results showed that the primers were specific for breeds, as intended. The specific primers can not only simply distinguish between two kinds of hybrids, but also rapidly identify the two parents. This study provides a method of molecular marker identification to identify reciprocal hybrids.

Development and cross-species/genera transferability of microsatellite markers discovered using 454 genome sequencing in chokecherry (Prunus virginiana L.).

PubMed

Wang, Hongxia; Walla, James A; Zhong, Shaobin; Huang, Danqiong; Dai, Wenhao

2012-11-01

Chokecherry (Prunus virginiana L.) (2n = 4x = 32) is a unique Prunus species for both genetics and disease-resistance research due to its tetraploid nature and X-disease resistance. However, no genetic and genomic information on chokecherry is available. A partial chokecherry genome was sequenced using Roche 454 sequencing technology. A total of 145,094 reads covering 4.8 Mbp of the chokecherry genome were generated and 15,113 contigs were assembled, of which 11,675 contigs were larger than 100 bp in size. A total of 481 SSR loci were identified from 234 (out of 11,675) contigs and 246 polymerase chain reaction (PCR) primer pairs were designed. Of 246 primers, 212 (86.2 %) effectively produced amplification from the genomic DNA of chokecherry. All 212 amplifiable chokecherry primers were used to amplify genomic DNA from 11 other rosaceous species (sour cherry, sweet cherry, black cherry, peach, apricot, plum, apple, crabapple, pear, juneberry, and raspberry). Thus, chokecherry SSR primers can be transferable across Prunus species and other rosaceous species. An average of 63.2 and 58.7 % of amplifiable chokecherry primers amplified DNA from cherry and other Prunus species, respectively, while 47.2 % of amplifiable chokecherry primers amplified DNA from other rosaceous species. Using random genome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no sequence information available. Sequence information and confirmed transferability of the identified chokecherry SSRs among species will be valuable for genetic research in Prunus and other rosaceous species. Key message A total of 246 SSR primers were identified from chokecherry genome sequences. Of which, 212 were confirmed amplifiable both in chokecherry and other 11 other rosaceous species.

Detection and discrimination of five E. coli pathotypes using a combinatory SYBR® Green qPCR screening system.

PubMed

Barbau-Piednoir, Elodie; Denayer, Sarah; Botteldoorn, Nadine; Dierick, Katelijne; De Keersmaecker, Sigrid C J; Roosens, Nancy H

2018-04-01

A detection and discrimination system for five Escherichia coli pathotypes, based on a combination of 13 SYBR® Green qPCR, has been developed, i.e., combinatory SYBR® Green qPCR screening system for pathogenic E. coli (CoSYPS Path E. coli). It allows the discrimination on isolates and the screening of potential presence in food of the following pathotypes of E. coli: shigatoxigenic (STEC) (including enterohemorrhagic (EHEC)), enteropathogenic (EPEC), enteroaggregative (EAggEC), enteroaggregative shigatoxigenic (EAggSTEC), and enteroinvasive (EIEC) E. coli. The SYBR® Green qPCR assays target the uidA, ipaH, eae, aggR, aaiC, stx1, and stx2 genes. uidA controls for E. coli presence and all the other genes are specific targets of E. coli pathotypes. For each gene, two primer pairs have been designed to guarantee a sufficient detection even in case of deletion or polymorphisms in the target gene. Moreover, all the qPCR have been designed to be run together in a single analytical PCR plate. This study includes the primer pairs' design, in silico and in situ selectivity, sensitivity, repeatability, and reproducibility evaluation of the 13 SYBR® Green qPCR assays. Each target displayed a selectivity of 100%. The limit of detection of the 13 assays is between 1 and 10 genomic copies. Their repeatability and reproducibility comply with the European requirements. As a preliminary feasibility study on food, the CoSYPS Path E. coli system was subsequently evaluated on four food matrices artificially contaminated with pathogenic E. coli. It allowed the detection of an initial contamination level as low as 2 to 7 cfu of STEC/25 g of food matrix after 24 h of enrichment.

Genetic diversity and relationship analysis of Gossypium arboreum accessions.

PubMed

Liu, F; Zhou, Z L; Wang, C Y; Wang, Y H; Cai, X Y; Wang, X X; Zhang, Z S; Wang, K B

2015-11-19

Simple sequence repeat techniques were used to identify the genetic diversity of 101 Gossypium arboreum accessions collected from India, Vietnam, and the southwest of China (Guizhou, Guangxi, and Yunnan provinces). Twenty-six pairs of SSR primers produced a total of 103 polymorphic loci with an average of 3.96 polymorphic loci per primer. The average of the effective number of alleles, Nei's gene diversity, and Shannon's information index were 0.59, 0.2835, and 0.4361, respectively. The diversity varied among different geographic regions. The result of principal component analysis was consistent with that of unweighted pair group method with arithmetic mean clustering analysis. The 101 G. arboreum accessions were clustered into 2 groups.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rechkoblit, Olga; Delaney, James C.; Essigmann, John M.

DNA is susceptible to alkylation damage by a number of environmental agents that modify the Watson-Crick edge of the bases. Such lesions, if not repaired, may be bypassed by Y-family DNA polymerases. The bypass polymerase Dpo4 is strongly inhibited by 1-methylguanine (m1G) and 3-methylcytosine (m3C), with nucleotide incorporation opposite these lesions being predominantly mutagenic. Further, extension after insertion of both correct and incorrect bases, introduces additional base substitution and deletion errors. Crystal structures of the Dpo4 ternary extension complexes with correct and mismatched 3'-terminal primer bases opposite the lesions reveal that both m1G and m3C remain positioned within the DNAmore » template/primer helix. However, both correct and incorrect pairing partners exhibit pronounced primer terminal nucleotide distortion, being primarily evicted from the DNA helix when opposite m1G or misaligned when pairing with m3C. Our studies provide insights into mechanisms related to hindered and mutagenic bypass of methylated lesions and models associated with damage recognition by repair demethylases.« less

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2009-30 November 2009.

PubMed

An, Junghwa; Bechet, Arnaud; Berggren, Asa; Brown, Sarah K; Bruford, Michael W; Cai, Qingui; Cassel-Lundhagen, Anna; Cezilly, Frank; Chen, Song-Lin; Cheng, Wei; Choi, Sung-Kyoung; Ding, X Y; Fan, Yong; Feldheim, Kevin A; Feng, Z Y; Friesen, Vicki L; Gaillard, Maria; Galaraza, Juan A; Gallo, Leonardo; Ganeshaiah, K N; Geraci, Julia; Gibbons, John G; Grant, William S; Grauvogel, Zac; Gustafsson, S; Guyon, Jeffrey R; Han, L; Heath, Daniel D; Hemmilä, S; Hogan, J Derek; Hou, B W; Jakse, Jernej; Javornik, Branka; Kaňuch, Peter; Kim, Kyung-Kil; Kim, Kyung-Seok; Kim, Sang-Gyu; Kim, Sang-In; Kim, Woo-Jin; Kim, Yi-Kyung; Klich, Maren A; Kreiser, Brian R; Kwan, Ye-Seul; Lam, Athena W; Lasater, Kelly; Lascoux, M; Lee, Hang; Lee, Yun-Sun; Li, D L; Li, Shao-Jing; Li, W Y; Liao, Xiaolin; Liber, Zlatko; Lin, Lin; Liu, Shaoying; Luo, Xin-Hui; Ma, Y H; Ma, Yajun; Marchelli, Paula; Min, Mi-Sook; Moccia, Maria Domenica; Mohana, Kumara P; Moore, Marcelle; Morris-Pocock, James A; Park, Han-Chan; Pfunder, Monika; Ivan, Radosavljević; Ravikanth, G; Roderick, George K; Rokas, Antonis; Sacks, Benjamin N; Saski, Christopher A; Satovic, Zlatko; Schoville, Sean D; Sebastiani, Federico; Sha, Zhen-Xia; Shin, Eun-Ha; Soliani, Carolina; Sreejayan, N; Sun, Zhengxin; Tao, Yong; Taylor, Scott A; Templin, William D; Shaanker, R Uma; Vasudeva, R; Vendramin, Giovanni G; Walter, Ryan P; Wang, Gui-Zhong; Wang, Ke-Jian; Wang, Y Q; Wattier, Rémi A; Wei, Fuwen; Widmer, Alex; Woltmann, Stefan; Won, Yong-Jin; Wu, Jing; Xie, M L; Xu, Genbo; Xu, Xiao-Jun; Ye, Hai-Hui; Zhan, Xiangjiang; Zhang, F; Zhong, J

2010-03-01

This article documents the addition of 411 microsatellite marker loci and 15 pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Acanthopagrus schlegeli, Anopheles lesteri, Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus oryzae, Aspergillus terreus, Branchiostoma japonicum, Branchiostoma belcheri, Colias behrii, Coryphopterus personatus, Cynogolssus semilaevis, Cynoglossus semilaevis, Dendrobium officinale, Dendrobium officinale, Dysoxylum malabaricum, Metrioptera roeselii, Myrmeciza exsul, Ochotona thibetana, Neosartorya fischeri, Nothofagus pumilio, Onychodactylus fischeri, Phoenicopterus roseus, Salvia officinalis L., Scylla paramamosain, Silene latifo, Sula sula, and Vulpes vulpes. These loci were cross-tested on the following species: Aspergillus giganteus, Colias pelidne, Colias interior, Colias meadii, Colias eurytheme, Coryphopterus lipernes, Coryphopterus glaucofrenum, Coryphopterus eidolon, Gnatholepis thompsoni, Elacatinus evelynae, Dendrobium loddigesii Dendrobium devonianum, Dysoxylum binectariferum, Nothofagus antarctica, Nothofagus dombeyii, Nothofagus nervosa, Nothofagus obliqua, Sula nebouxii, and Sula variegata. This article also documents the addition of 39 sequencing primer pairs and 15 allele specific primers or probes for Paralithodes camtschaticus. © 2010 Blackwell Publishing Ltd.

Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea)

PubMed Central

Gimenes, Marcos A; Hoshino, Andrea A; Barbosa, Andrea VG; Palmieri, Dario A; Lopes, Catalina R

2007-01-01

Background The genus Arachis includes Arachis hypogaea (cultivated peanut) and wild species that are used in peanut breeding or as forage. Molecular markers have been employed in several studies of this genus, but microsatellite markers have only been used in few investigations. Microsatellites are very informative and are useful to assess genetic variability, analyze mating systems and in genetic mapping. The objectives of this study were to develop A. hypogaea microsatellite loci and to evaluate the transferability of these markers to other Arachis species. Results Thirteen loci were isolated and characterized using 16 accessions of A. hypogaea. The level of variation found in A. hypogaea using microsatellites was higher than with other markers. Cross-transferability of the markers was also high. Sequencing of the fragments amplified using the primer pair Ah11 from 17 wild Arachis species showed that almost all wild species had similar repeated sequence to the one observed in A. hypogaea. Sequence data suggested that there is no correlation between taxonomic relationship of a wild species to A. hypogaea and the number of repeats found in its microsatellite loci. Conclusion These results show that microsatellite primer pairs from A. hypogaea have multiple uses. A higher level of variation among A. hypogaea accessions can be detected using microsatellite markers in comparison to other markers, such as RFLP, RAPD and AFLP. The microsatellite primers of A. hypogaea showed a very high rate of transferability to other species of the genus. These primer pairs provide important tools to evaluate the genetic variability and to assess the mating system in Arachis species. PMID:17326826

Development of Species-Specific SCAR Markers, Based on a SCoT Analysis, to Authenticate Physalis (Solanaceae) Species

PubMed Central

Feng, Shangguo; Zhu, Yujia; Yu, Chenliang; Jiao, Kaili; Jiang, Mengying; Lu, Jiangjie; Shen, Chenjia; Ying, Qicai; Wang, Huizhong

2018-01-01

Physalis is an important genus in the Solanaceae family. It includes many species of significant medicinal value, edible value, and ornamental value. However, many Physalis species are easily confused because of their similar morphological traits, which hinder the utilization and protection of Physalis resources. Therefore, it is necessary to create fast, sensitive, and reliable methods for the Physalis species authentication. Intended for that, in this study, species-specific sequence-characterized amplified region (SCAR) markers were developed for accurate identification of the closely related Physalis species P. angulata, P. minima, P. pubescens, and P. alkekengi var. franchetii, based on a simple and novel marker system, start codon targeted (SCoT) marker. A total of 34 selected SCoT primers yielded 289 reliable SCoT loci, of which 265 were polymorphic. Four species-specific SCoT fragments (SCoT3-1404, SCoT3-1589, SCoT5-550, and SCoT36-520) from Physalis species were successfully identified, cloned, and sequenced. Based on these selected specific DNA fragments, four SCAR primers pairs were developed and named ST3KZ, ST3MSJ, ST5SJ, and ST36XSJ. PCR analysis of each of these primer pairs clearly demonstrated a specific amplified band in all samples of the target Physalis species, but no amplification was observed in other Physalis species. Therefore, the species-specific SCAR primer pairs developed in this study could be used as powerful tools that can rapidly, effectively, and reliably identify and differentiate Physalis species.

A qRT-PCR assay for the expression of all Mal d 1 isoallergen genes

PubMed Central

2013-01-01

Background A considerable number of individuals suffer from oral allergy syndrome (OAS) to apple, resulting in the avoidance of apple consumption. Apple cultivars differ greatly in their allergenic properties, but knowledge of the causes for such differences is incomplete. Mal d 1 is considered the major apple allergen. For Mal d 1, a wide range of isoallergens and variants exist, and they are encoded by a large gene family. To identify the specific proteins/genes that are potentially involved in the allergy, we developed a PCR assay to monitor the expression of each individual Mal d 1 gene. Gene-specific primer pairs were designed for the exploitation of sequence differences among Mal d 1 genes. The specificity of these primers was validated using both in silico and in vitro techniques. Subsequently, this assay was applied to the peel and flesh of fruits from the two cultivars ‘Florina’ and ‘Gala’. Results We successfully developed gene-specific primer pairs for each of the 31 Mal d 1 genes and incorporated them into a qRT-PCR assay. The results from the application of the assay showed that 11 genes were not expressed in fruit. In addition, differential expression was observed among the Mal d 1 genes that were expressed in the fruit. Moreover, the expression levels were tissue and cultivar dependent. Conclusion The assay developed in this study facilitated the first characterisation of the expression levels of all known Mal d 1 genes in a gene-specific manner. Using this assay on different fruit tissues and cultivars, we obtained knowledge concerning gene relevance in allergenicity. This study provides new perspectives for research on both plant breeding and immunotherapy. PMID:23522122

Diversity analysis in Cannabis sativa based on large-scale development of expressed sequence tag-derived simple sequence repeat markers.

PubMed

Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

2014-01-01

Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.

Diversity Analysis in Cannabis sativa Based on Large-Scale Development of Expressed Sequence Tag-Derived Simple Sequence Repeat Markers

PubMed Central

Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

2014-01-01

Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis. PMID:25329551

Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.

PubMed

Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L

1990-08-01

To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

Detection of Canine Distemper Virus Nucleoprotein RNA by Reverse Transcription-PCR Using Serum, Whole Blood, and Cerebrospinal Fluid from Dogs with Distemper

PubMed Central

Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.

1999-01-01

Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

PubMed Central

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus.

PubMed

Raue, R; Hess, M

1998-08-01

Three different polymerase chain reactions (PCRs), two of them combined with restriction enzyme analysis (REA), were developed for detection and differentiation of all 12 fowl adenovirus (FAV) serotypes and the egg drop syndrome (EDS) virus. For primer construction FAV1, FAV10 and EDS virus hexon proteins were aligned and conserved and variable regions were determined. Two primer sets (H1/H2 and H3/H4) for single use were constructed which hybridize in three conserved regions of hexon genes. Each primer pair amplifies approximately half of the hexon gene including two loop regions. An amplification product was detected with both primer sets using purified DNA from all FAV1-12 reference strains. Viral EDS DNA was negative using the H1/H2 or H3/H4 primer pair. HaeII digestion of the H1/H2 amplification products differentiates between all viruses except FAV4 and FAV5. In comparison, much more clustering among genomic closely related FAV serotypes was seen after HpaII digestion of the H3/H4 PCR products. Oligonucleotides H5/H6 located in the variable regions of EDS virus hexon gene do not detect any of the FAV serotypes. The PCRs and REA described are suitable to detect all avian adenoviruses infecting chickens, to distinguish all 12 FAV reference strains and to differentiate FAVs from the EDS virus.

Development and use of polymerase chain reaction for the specific detection of Salmonella Typhimurium in stool and food samples.

PubMed

Lin, J S; Tsen, H Y

1999-10-01

Salmonella Typhimurium is one of the most important Salmonella serovars that may cause foodborne disease and human salmonellosis infection. Detection of this organism in the clinical samples of persons with gastroenteritis and the food samples associated with such persons may allow us to trace the cause of disease. Because malic acid dehydrogenase, an enzyme of the citric acid cycle, is common to organisms, the gene (mdh) coding for this enzyme was selected for the design of Salmonella Typhimurium-specific polymerase chain reaction (PCR) primers. By comparison of the mdh gene sequences of Salmonella Typhimurium and other Salmonella serotypes and of some isolates of other genera, two oligonucleotides were designed and used as PCR primers for the specific detection of Salmonella Typhimurium. The molecular weight of the PCR product was 261 bp as expected. Salmonella serovars other than Salmonella Typhimurium and isolates of other genera in the Enterobacteriaceae that is closely related to Salmonella did not generate any false-positive results. When this primer pair was used for the detection of Salmonella Typhimurium cells artificially inoculated into human stool specimens and food samples, such as milk and raw chicken meat, levels as low as 10(0) CFU per 0.1 g of stool specimen or per ml of milk or food homogenate could be detected if an 8- to 12-h preculture step using combined lactose-tetrathionate broth was performed prior to the PCR.

PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers

Treesearch

M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga

2004-01-01

The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

PubMed

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 May 2009-31 July 2009.

PubMed

Almany, Glenn R; DE Arruda, Maurício P; Arthofer, Wolfgang; Atallah, Z K; Beissinger, Steven R; Berumen, Michael L; Bogdanowicz, S M; Brown, S D; Bruford, Michael W; Burdine, C; Busch, Jeremiah W; Campbell, Nathan R; Carey, D; Carstens, Bryan C; Chu, K H; Cubeta, Marc A; Cuda, J P; Cui, Zhaoxia; Datnoff, L E; Dávila, J A; Davis, Emily S; Davis, R M; Diekmann, Onno E; Eizirik, Eduardo; Fargallo, J A; Fernandes, Fabiano; Fukuda, Hideo; Gale, L R; Gallagher, Elizabeth; Gao, Yongqiang; Girard, Philippe; Godhe, Anna; Gonçalves, Evonnildo C; Gouveia, Licinia; Grajczyk, Amber M; Grose, M J; Gu, Zhifeng; Halldén, Christer; Härnström, Karolina; Hemmingsen, Amanda H; Holmes, Gerald; Huang, C H; Huang, Chuan-Chin; Hudman, S P; Jones, Geoffrey P; Kanetis, Loukas; Karunasagar, Iddya; Karunasagar, Indrani; Keyghobadi, Nusha; Klosterman, S J; Klug, Page E; Koch, J; Koopman, Margaret M; Köppler, Kirsten; Koshimizu, Eriko; Krumböck, Susanne; Kubisiak, T; Landis, J B; Lasta, Mario L; Lee, Chow-Yang; Li, Qianqian; Li, Shou-Hsien; Lin, Rong-Chien; Liu, M; Liu, Na; Liu, W C; Liu, Yuan; Loiseau, A; Luan, Weisha; Maruthachalam, K K; McCormick, Helen M; Mellick, Rohan; Monnahan, P J; Morielle-Versute, Eliana; Murray, Tomás E; Narum, Shawn R; Neufeld, Katie; De Nova, P J G; Ojiambo, Peter S; Okamoto, Nobuaki; Othman, Ahmad Sofiman; Overholt, W A; Pardini, Renata; Paterson, Ian G; Patty, Olivia A; Paxton, Robert J; Planes, Serge; Porter, Carolyn; Pratchett, Morgan S; Püttker, Thomas; Rasic, Gordana; Rasool, Bilal; Rey, O; Riegler, Markus; Riehl, C; Roberts, John M K; Roberts, P D; Rochel, Elisabeth; Roe, Kevin J; Rossetto, Maurizio; Ruzzante, Daniel E; Sakamoto, Takashi; Saravanan, V; Sarturi, Cladinara Roberts; Schmidt, Anke; Schneider, Maria Paula Cruz; Schuler, Hannes; Serb, Jeanne M; Serrão, Ester T A; Shi, Yaohua; Silva, Artur; Sin, Y W; Sommer, Simone; Stauffer, Christian; Strüssmann, Carlos Augusto; Subbarao, K V; Syms, Craig; Tan, Feng; Tejedor, Eugenio Daniel; Thorrold, Simon R; Trigiano, Robert N; Trucco, María I; Tsuchiya-Jerep, Mirian Tieko Nunes; Vergara, P; Van De Vliet, Mirjam S; Wadl, Phillip A; Wang, Aimin; Wang, Hongxia; Wang, R X; Wang, Xinwang; Wang, Yan; Weeks, Andrew R; Wei, Fuwen; Werner, William J; Wiley, E O; Williams, D A; Wilkins, Richard J; Wisely, Samantha M; With, Kimberly A; Wu, Danhua; Yao, Cheng-Te; Yau, Cynthia; Yeap, Beng-Keok; Zhai, Bao-Ping; Zhan, Xiangjiang; Zhang, Guo-Yan; Zhang, S Y; Zhao, Ru; Zhu, Lifeng

2009-11-01

This article documents the addition of 512 microsatellite marker loci and nine pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Alcippe morrisonia morrisonia, Bashania fangiana, Bashania fargesii, Chaetodon vagabundus, Colletes floralis, Coluber constrictor flaviventris, Coptotermes gestroi, Crotophaga major, Cyprinella lutrensis, Danaus plexippus, Fagus grandifolia, Falco tinnunculus, Fletcherimyia fletcheri, Hydrilla verticillata, Laterallus jamaicensis coturniculus, Leavenworthia alabamica, Marmosops incanus, Miichthys miiuy, Nasua nasua, Noturus exilis, Odontesthes bonariensis, Quadrula fragosa, Pinctada maxima, Pseudaletia separata, Pseudoperonospora cubensis, Podocarpus elatus, Portunus trituberculatus, Rhagoletis cerasi, Rhinella schneideri, Sarracenia alata, Skeletonema marinoi, Sminthurus viridis, Syngnathus abaster, Uroteuthis (Photololigo) chinensis, Verticillium dahliae, Wasmannia auropunctata, and Zygochlamys patagonica. These loci were cross-tested on the following species: Chaetodon baronessa, Falco columbarius, Falco eleonorae, Falco naumanni, Falco peregrinus, Falco subbuteo, Didelphis aurita, Gracilinanus microtarsus, Marmosops paulensis, Monodelphis Americana, Odontesthes hatcheri, Podocarpus grayi, Podocarpus lawrencei, Podocarpus smithii, Portunus pelagicus, Syngnathus acus, Syngnathus typhle,Uroteuthis (Photololigo) edulis, Uroteuthis (Photololigo) duvauceli and Verticillium albo-atrum. This article also documents the addition of nine sequencing primer pairs and sixteen allele specific primers or probes for Oncorhynchus mykiss and Oncorhynchus tshawytscha; these primers and assays were cross-tested in both species. © 2009 Blackwell Publishing Ltd.

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

PubMed

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

PD5: a general purpose library for primer design software.

PubMed

Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

2013-01-01

Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

PubMed

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

PubMed Central

Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-01-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

PubMed

Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-08-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

Development of SSR Markers and Genetic Diversity in White Birch (Betula platyphylla)

PubMed Central

Hao, Wei; Wang, Shengji; Liu, Huajing; Zhou, Boru; Wang, Xinwang; Jiang, Tingbo

2015-01-01

In order to study genetic diversity of white birch (Betula platyphylla), 544 primer pairs were designed based on the genome-wide Solexa sequences. Among them, 215 primer pairs showed polymorphism between five genotypes and 111 primer pairs that presented clear visible bands in genotyping 41 white birch plants that were collected from 6 different geographical regions. A total of 717 alleles were obtained at 111 loci with a range of 2 to 12 alleles per locus. The results of statistic analysis showed that polymorphic frequency of the alleles ranged from 17% to 100% with a mean of 55.85%; polymorphism information content (PIC) of the loci was from 0.09 to 0.58 with a mean of 0.30; and gene diversity between the tested genotypes was from 0.01 to 0.66 with a mean of 0.36. The results also indicated that major allele frequency ranged from 0.39 to 1.00 with an mean of 0.75; expected heterozygosity from 0.22 to 0.54 with a mean of 0.46; observed heterozygosity from 0.02 to 0.95 with a mean of 0.26; Nei's index from 0.21 to 0.54 with a mean of 0.46; and Shannon's Information from 0.26 to 0.87 with a mean of 0.66. The 41 white birch genotypes at the 111 selected SSR loci showed low to moderate similarity (0.025-0.610), indicating complicated genetic diversity among the white birch collections. The UPGMA-based clustering analysis of the allelic constitution of 41 white birch genotypes at 111 SSR loci suggested that the six different geographical regions can be further separated into four clusters at a similarity coefficient of 0.22. Genotypes from Huanren and Liangshui provenances were grouped into Cluster I, genotypes from Xiaobeihu and Qingyuan provenances into Cluster II, genotypes from Finland provenance into Cluster III, and genotypes from Maoershan into Cluster IV. The information provided in this study could help for genetic improvement and germplasm conservation, evaluation and utilization in white birch tree breeding program. PMID:25923698

Next generation DNA sequencing technology delivers valuable genetic markers for the genomic orphan legume species, Bituminaria bituminosa

PubMed Central

2011-01-01

Background Bituminaria bituminosa is a perennial legume species from the Canary Islands and Mediterranean region that has potential as a drought-tolerant pasture species and as a source of pharmaceutical compounds. Three botanical varieties have previously been identified in this species: albomarginata, bituminosa and crassiuscula. B. bituminosa can be considered a genomic 'orphan' species with very few genomic resources available. New DNA sequencing technologies provide an opportunity to develop high quality molecular markers for such orphan species. Results 432,306 mRNA molecules were sampled from a leaf transcriptome of a single B. bituminosa plant using Roche 454 pyrosequencing, resulting in an average read length of 345 bp (149.1 Mbp in total). Sequences were assembled into 3,838 isotigs/contigs representing putatively unique gene transcripts. Gene ontology descriptors were identified for 3,419 sequences. Raw sequence reads containing simple sequence repeat (SSR) motifs were identified, and 240 primer pairs flanking these motifs were designed. Of 87 primer pairs developed this way, 75 (86.2%) successfully amplified primarily single fragments by PCR. Fragment analysis using 20 primer pairs in 79 accessions of B. bituminosa detected 130 alleles at 21 SSR loci. Genetic diversity analyses confirmed that variation at these SSR loci accurately reflected known taxonomic relationships in original collections of B. bituminosa and provided additional evidence that a division of the botanical variety bituminosa into two according to geographical origin (Mediterranean region and Canary Islands) may be appropriate. Evidence of cross-pollination was also found between botanical varieties within a B. bituminosa breeding programme. Conclusions B. bituminosa can no longer be considered a genomic orphan species, having now a large (albeit incomplete) repertoire of expressed gene sequences that can serve as a resource for future genetic studies. This experimental approach was effective in developing codominant and polymorphic SSR markers for application in diverse genetic studies. These markers have already given new insight into genetic variation in B. bituminosa, providing evidence that a division of the botanical variety bituminosa may be appropriate. This approach is commended to those seeking to develop useful markers for genomic orphan species. PMID:22171578

Characterization and classification of one new cytoplasmic male sterility (CMS) line based on morphological, cytological and molecular markers in non-heading Chinese cabbage (Brassica rapa L.).

PubMed

Heng, Shuangping; Shi, Dianyi; Hu, Zhenhua; Huang, Tao; Li, Jinping; Liu, Liyan; Xia, Chunxiu; Yuan, Zhenzhen; Xu, Yuejin; Fu, Tingdong; Wan, Zhengjie

2015-09-01

A new non-heading Chinese cabbage CMS line M119A was characterized and specific molecular markers were developed to classify different CMS types. One new non-heading Chinese cabbage (Brassica rapa L.) cytoplasmic male sterile (CMS) line M119A was obtained by interspecific crosses between the recently discovered hau CMS line of Brassica juncea and B. rapa. Furthermore, the line was characterized and compared with other five isonuclear-alloplasmic CMS lines. The M119A line produced six stamens without pollen and only two stamen fused together in fewer flowers. Tissue section indicated that anther abortion in M119A may have occurred during differentiation of the archesporial cells without pollen sac. All the six CMS lines were grouped into three types based on the presence of three PCR fragments of 825, 465 and 772 bp amplified with different mitochondrial genes specific primers. The 825-bp fragment was amplified both in 09-10A and H201A using the specific primer pair P-orf224-atp6, and showed 100 % identity with the mitochondrial gene of pol CMS. The 465-bp fragment was amplified in 30A and 105A using the primer pair P-orf138 and shared 100 % identity with the mitochondrial gene of ogu CMS. The 772-bp fragment was amplified in M119A and H203A using the primer pair P-orf288 and showed 100 % identity with the mitochondrial gene of hau CMS. Therefore, these markers could efficiently distinguish different types of isonuclear-alloplasmic CMS lines of non-heading Chinese cabbage, which were useful for improving the efficiency of cross-breeding and heterosis utilization in cruciferous vegetables.

CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

PubMed Central

Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

2003-01-01

We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

Multiplex PCR for the detection and identification of dairy bacteriophages in milk.

PubMed

del Rio, B; Binetti, A G; Martín, M C; Fernández, M; Magadán, A H; Alvarez, M A

2007-02-01

Bacteriophage infections of starter lactic acid bacteria are a serious risk in the dairy industry. Phage infection can lead to slow lactic acid production or even the total failure of fermentation. The associated economic losses can be substantial. Rapid and sensitive methods are therefore required to detect and identify phages at all stages of the manufacture of fermented dairy products. This study describes a simple and rapid multiplex PCR method that, in a single reaction, detects the presence of bacteriophages infecting Streptococcus thermophilus and Lactobacillus delbrueckii, plus three genetically distinct 'species' of Lactococcus lactis phages commonly found in dairy plants (P335, 936 and c2). Available bacteriophage genome sequences were examined and the conserved regions used to design five pairs of primers, one for each of the above bacteriophage species. These primers were designed to generate specific fragments of different size depending on the species. Since this method can detect the above phages in untreated milk and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms or for use in those that involve phage-deactivating conditions.

DEVELOPMENT OF CRASSPHAGE-BASED QPCR ASSAYS ...

EPA Pesticide Factsheets

A newly discovered bacteriophage, “crAssphage”, is predicted to be both highlyabundant and predominantly human-associated, both ideal characteristics for a human-specific fecal indicator. A total of 384 end-point PCR primers were designed along the length of the crAssphage genome, eliminating regions suspected to be hypervariable or react with other animal sources. The primer pairs were rigorously tested in three rounds of screening for specificity, geographic variability, limit of detection, and environmental water performance. The two best performing assays, crAss056 and crAss064, were adapted to a qPCR platform and exhibited a specificity of 98.0% and 98.9%, respectively. The markers’ abundance was compared with two bacterial based assays and were found at concentrations at or above the bacterial based assays in wastewater influent and impacted environmental waters. This poster will present the methodology of the novel marker development and the potential uses for this technology in maintaining sustainable waterways in the future. To inform the public.

Detection and widespread distribution of the nrfA gene encoding nitrite reduction to ammonia, a short circuit in the biological nitrogen cycle that competes with denitrification.

PubMed

Mohan, Sudesh B; Schmid, Markus; Jetten, Mike; Cole, Jeff

2004-09-01

Degenerate primers to detect nrfA were designed by aligning six nrfA sequences including Escherichia coli K-12, Sulfurospirillum deleyianum and Wolinella succinogenes. These primers amplified a 490 bp fragment of nrfA. The ability of these primers to detect nrfA was tested with chromosomal DNA isolated from a variety of bacteria: they could distinguish between bacteria in which the gene is known to be present or absent. The positive reference organisms spanned the various classes of Proteobacteria, suggesting that these primers are probably generic. The primer pair F1 and R1 was also used successfully to analyse nrfA diversity from community DNA isolated from a sulphate reducing bioreactor, and from two established Anammox reactors (for an aerobic ammonia oxidation, in which nitrite is reduced by ammonia to dinitrogen gas). The nrfA clones isolated from these three sources grouped with the Bacteroidetes phylum. The nrfA primers also amplified 570 bp fragments from the Anammox community DNA. These fragments encoded a protein with four haem-binding motifs typical of a c-type cytochrome, but were unrelated to the NrfA nitrite reductase. A BLAST search failed to reveal similarity to any known proteins. However, similarity was found to one sequence, which was annotated as rapC (response regulator aspartate phosphatase), in the genome of the planctomycete Rhodopirellula baltica. These sequences possibly belong to a new class of c-type cytochrome that might be specific to members of the order Planctomycetales. The data are consistent with the proposal that cytochrome c nitrite reductases, present in the periplasm of Gram-negative bacteria, are widely distributed in many different environments where they provide a short circuit in the biological nitrogen cycle by reducing nitrite directly to ammonia.

Development of a gene-centered ssr atlas as a resource for papaya (Carica papaya) marker-assisted selection and population genetic studies.

PubMed

Vidal, Newton Medeiros; Grazziotin, Ana Laura; Ramos, Helaine Christine Cancela; Pereira, Messias Gonzaga; Venancio, Thiago Motta

2014-01-01

Carica papaya (papaya) is an economically important tropical fruit. Molecular marker-assisted selection is an inexpensive and reliable tool that has been widely used to improve fruit quality traits and resistance against diseases. In the present study we report the development and validation of an atlas of papaya simple sequence repeat (SSR) markers. We integrated gene predictions and functional annotations to provide a gene-centered perspective for marker-assisted selection studies. Our atlas comprises 160,318 SSRs, from which 21,231 were located in genic regions (i.e. inside exons, exon-intron junctions or introns). A total of 116,453 (72.6%) of all identified repeats were successfully mapped to one of the nine papaya linkage groups. Primer pairs were designed for markers from 9,594 genes (34.5% of the papaya gene complement). Using papaya-tomato orthology assessments, we assembled a list of 300 genes (comprising 785 SSRs) potentially involved in fruit ripening. We validated our atlas by screening 73 SSR markers (including 25 fruit ripening genes), achieving 100% amplification rate and uncovering 26% polymorphism rate between the parental genotypes (Sekati and JS12). The SSR atlas presented here is the first comprehensive gene-centered collection of annotated and genome positioned papaya SSRs. These features combined with thousands of high-quality primer pairs make the atlas an important resource for the papaya research community.

Development of a quantitative PCR assay for monitoring Streptococcus agalactiae colonization and tissue tropism in experimentally infected tilapia.

PubMed

Su, Y-L; Feng, J; Li, Y-W; Bai, J-S; Li, A-X

2016-02-01

Streptococcus agalactiae has become one of the most important emerging pathogens in the aquaculture industry and has resulted in large economic losses for tilapia farms in China. In this study, three pairs of specific primers were designed and tested for their specificities and sensitivities in quantitative real-time polymerase chain reactions (qPCRs) after optimization of the annealing temperature. The primer pair IGS-s/IGS-a, which targets the 16S-23S rRNA intergenic spacer region, was finally chosen, having a detection limit of 8.6 copies of S. agalactiae DNA in a 20 μL reaction mixture. Bacterial tissue tropism was demonstrated by qPCR in Oreochromis niloticus 5 days post-injection with a virulent S. agalactiae strain. Bacterial loads were detected at the highest level in brain, followed by moderately high levels in kidney, heart, spleen, intestines, and eye. Significantly lower bacterial loads were observed in muscle, gill and liver. In addition, significantly lower bacterial loads were observed in the brain of convalescent O. niloticus 14 days post-injection with several different S. agalactiae strains. The qPCR for the detection of S. agalactiae developed in this study provides a quantitative tool for investigating bacterial tissue tropism in infected fish, as well as for monitoring bacterial colonization in convalescent fish. © 2015 John Wiley & Sons Ltd.

Distribution, function and evolution characterization of microsatellite in Sargassum thunbergii (Fucales, Phaeophyta) transcriptome and their application in marker development

PubMed Central

Liu, Fuli; Hu, Zimin; Liu, Wenhui; Li, Jingjing; Wang, Wenjun; Liang, Zhourui; Wang, Feijiu; Sun, Xiutao

2016-01-01

Using transcriptome data to mine microsatellite and develop markers has growingly become prevalent. However, characterizing the possible function of microsatellite is relatively rare. In this study, we explored microsatellites in the transcriptome of the brown alga Sargassum thunbergii and characterized the frequencies, distribution, function and evolution, and developed primers to validate these microsatellites. Our results showed that Tri-nucleotide is the most abundant, followed by di- and mono-nucleotide. The length of microsatellite was significantly affected by the repeat motif size. The density of microsatellite in the CDS region is significantly lower than that in the UTR region. The annotation of the transcripts containing microsatellite showed that 573 transcripts have GO terms and can be categorized into 42 groups. Pathways enrichment showed that microsatellites were significantly overrepresented in the genes involved in pathways such as Ubiquitin mediated proteolysis, RNA degradation, Spliceosome, etc. Primers flanking 961 microsatellite loci were designed, and among the 30 pairs of primer selected randomly for availability test, 23 were proved to be efficient. These findings provided new insight into the function and evolution of microsatellite in transcriptome, and the identified microsatellite loci within the annotated gene will be useful for developing functional markers in S. thunbergii. PMID:26732855

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

GSP: A web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Rapid combined assay for Salmonella detection in food samples.

PubMed

Gadó, I; Major, P; Király, M; Pláveczky, M G

2000-01-01

A rapid method was developed to detect salmonellae in food samples. The method gave a possibility to obtain results after 28 h 30 min. The preenrichment in buffered peptone water lasted for 6 h, the enrichment in Rappaport-Vassiliadis medium was applied for 18 h followed by PCR with INVA1-INVA2 primer pair, adapting Chiu and Ou's method. This procedure was suitable to demonstrate salmonella contamination at min. 10 cfu/25 g sample. Out of 18 samples there was a good agreement between the results of the conventional and rapid methods in case of 17 samples. PCR with SPVC1-SPVC2 primer pair informing about the presence of virulence plasmid was performed in separate tubes, because decreased sensitivity was observed in case of multiplex PCR.

Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.

PubMed

Kimoto, Michiko; Hirao, Ichiro

2017-10-20

Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.

Crystallographic observation of nonenzymatic RNA primer extension.

PubMed

Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W

2018-05-31

The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.

Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

PubMed

Robertson, Amber L; Phillips, Allison R

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

Real-time PCR (qPCR) primer design using free online software.

PubMed

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

NASA Astrophysics Data System (ADS)

Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

2016-03-01

Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

Molecular identification and genetic variation of varieties of Styphnolobium japonicum (Fabaceae) using SRAP markers.

PubMed

Sun, R X; Zhang, C H; Zheng, Y Q; Zong, Y C; Yu, X D; Huang, P

2016-05-06

Thirty-four Styphnolobium japonicum varieties were analyzed using sequence-related amplified polymorphism (SRAP) markers, to investigate genetic variation and test the effectiveness of SRAP markers in DNA fingerprint establishment. Twelve primer pairs were selected from 120 primer combinations for their reproducibility and high polymorphism. We found a total of 430 amplified fragments, of which 415 fragments were considered polymorphic with an average of 34.58 polymorphic fragments for each primer combination. The percentage of polymorphic fragments was 96.60%, and four primer pairs showed 100% polymorphism. Moreover, simple matched coefficients ranged between 0.68 and 0.89, with an average of 0.785, indicating that the genetic variation among varieties was relatively low. This could be because of the narrow genetic basis of the selected breeding material. Based on the similarity coefficient value of 0.76, the varieties were divided into four major groups. In addition, abundant and clear SRAP fingerprints were obtained and could be used to establish DNA fingerprints. In the DNA fingerprints, each variety had its unique pattern that could be easily distinguished from others. The results demonstrated that 34 varieties of S. japonicum had a relatively narrow genetic variation. Hence, a broadening of the genetic basis of breeding material is necessary. We conclude that establishment of DNA fingerprint is feasible by means of SRAP markers.

In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

PubMed Central

Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

2016-01-01

Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

Transcriptome analysis of Houttuynia cordata Thunb. by Illumina paired-end RNA sequencing and SSR marker discovery.

PubMed

Wei, Lin; Li, Shenghua; Liu, Shenggui; He, Anna; Wang, Dan; Wang, Jie; Tang, Yulian; Wu, Xianjin

2014-01-01

Houttuynia cordata Thunb. is an important traditional medical herb in China and other Asian countries, with high medicinal and economic value. However, a lack of available genomic information has become a limitation for research on this species. Thus, we carried out high-throughput transcriptomic sequencing of H. cordata to generate an enormous transcriptome sequence dataset for gene discovery and molecular marker development. Illumina paired-end sequencing technology produced over 56 million sequencing reads from H. cordata mRNA. Subsequent de novo assembly yielded 63,954 unigenes, 39,982 (62.52%) and 26,122 (40.84%) of which had significant similarity to proteins in the NCBI nonredundant protein and Swiss-Prot databases (E-value <10(-5)), respectively. Of these annotated unigenes, 30,131 and 15,363 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. In addition, 24,434 (38.21%) unigenes were mapped onto 128 pathways using the KEGG pathway database and 17,964 (44.93%) unigenes showed homology to Vitis vinifera (Vitaceae) genes in BLASTx analysis. Furthermore, 4,800 cDNA SSRs were identified as potential molecular markers. Fifty primer pairs were randomly selected to detect polymorphism among 30 samples of H. cordata; 43 (86%) produced fragments of expected size, suggesting that the unigenes were suitable for specific primer design and of high quality, and the SSR marker could be widely used in marker-assisted selection and molecular breeding of H. cordata in the future. This is the first application of Illumina paired-end sequencing technology to investigate the whole transcriptome of H. cordata and to assemble RNA-seq reads without a reference genome. These data should help researchers investigating the evolution and biological processes of this species. The SSR markers developed can be used for construction of high-resolution genetic linkage maps and for gene-based association analyses in H. cordata. This work will enable future functional genomic research and research into the distinctive active constituents of this genus.

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

PubMed

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Simple sequence repeat markers useful for sorghum downy mildew (Peronosclerospora sorghi) and related species

PubMed Central

Perumal, Ramasamy; Nimmakayala, Padmavathi; Erattaimuthu, Saradha R; No, Eun-Gyu; Reddy, Umesh K; Prom, Louis K; Odvody, Gary N; Luster, Douglas G; Magill, Clint W

2008-01-01

Background A recent outbreak of sorghum downy mildew in Texas has led to the discovery of both metalaxyl resistance and a new pathotype in the causal organism, Peronosclerospora sorghi. These observations and the difficulty in resolving among phylogenetically related downy mildew pathogens dramatically point out the need for simply scored markers in order to differentiate among isolates and species, and to study the population structure within these obligate oomycetes. Here we present the initial results from the use of a biotin capture method to discover, clone and develop PCR primers that permit the use of simple sequence repeats (microsatellites) to detect differences at the DNA level. Results Among the 55 primers pairs designed from clones from pathotype 3 of P. sorghi, 36 flanked microsatellite loci containing simple repeats, including 28 (55%) with dinucleotide repeats and 6 (11%) with trinucleotide repeats. A total of 22 microsatellites with CA/AC or GT/TG repeats were the most abundant (40%) and GA/AG or CT/TC types contribute 15% in our collection. When used to amplify DNA from 19 isolates from P. sorghi, as well as from 5 related species that cause downy mildew on other hosts, the number of different bands detected for each SSR primer pair using a LI-COR- DNA Analyzer ranged from two to eight. Successful cross-amplification for 12 primer pairs studied in detail using DNA from downy mildews that attack maize (P. maydis & P. philippinensis), sugar cane (P. sacchari), pearl millet (Sclerospora graminicola) and rose (Peronospora sparsa) indicate that the flanking regions are conserved in all these species. A total of 15 SSR amplicons unique to P. philippinensis (one of the potential threats to US maize production) were detected, and these have potential for development of diagnostic tests. A total of 260 alleles were obtained using 54 microsatellites primer combinations, with an average of 4.8 polymorphic markers per SSR across 34 Peronosclerospora, Peronospora and Sclerospora spp isolates studied. Cluster analysis by UPGMA as well as principal coordinate analysis (PCA) grouped the 34 isolates into three distinct groups (all 19 isolates of Peronosclerospora sorghi in cluster I, five isolates of P. maydis and three isolates of P. sacchari in cluster II and five isolates of Sclerospora graminicola in cluster III). Conclusion To our knowledge, this is the first attempt to extensively develop SSR markers from Peronosclerospora genomic DNA. The newly developed SSR markers can be readily used to distinguish isolates within several species of the oomycetes that cause downy mildew diseases. Also, microsatellite fragments likely include retrotransposon regions of DNA and these sequences can serve as useful genetic markers for strain identification, due to their degree of variability and their widespread occurrence among sorghum, maize, sugarcane, pearl millet and rose downy mildew isolates. PMID:19040756

PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

PubMed Central

Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

2006-01-01

PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

PubMed Central

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Generic and sequence-variant specific molecular assays for the detection of the highly variable Grapevine leafroll-associated virus 3.

PubMed

Chooi, Kar Mun; Cohen, Daniel; Pearson, Michael N

2013-04-01

Grapevine leafroll-associated virus 3 (GLRaV-3) is an economically important virus, which is found in all grapevine growing regions worldwide. Its accurate detection in nursery and field samples is of high importance for certification schemes and disease management programmes. To reduce false negatives that can be caused by sequence variability, a new universal primer pair was designed against a divergent sequence data set, targeting the open reading frame 4 (heat shock protein 70 homologue gene), and optimised for conventional one-step RT-PCR and one-step SYBR Green real-time RT-PCR assays. In addition, primer pairs for the simultaneous detection of specific GLRaV-3 variants from groups 1, 2, 6 (specifically NZ-1) and the outlier NZ2 variant, and the generic detection of variants from groups 1 to 5 were designed and optimised as a conventional one-step multiplex RT-PCR assay using the plant nad5 gene as an internal control (i.e. one-step hexaplex RT-PCR). Results showed that the generic and variant specific assays detected in vitro RNA transcripts from a range of 1×10(1)-1×10(8) copies of amplicon per μl diluted in healthy total RNA from Vitis vinifera cv. Cabernet Sauvignon. Furthermore, the assays were employed effectively to screen 157 germplasm and 159 commercial field samples. Thus results demonstrate that the GLRaV-3 generic and variant-specific assays are prospective tools that will be beneficial for certification schemes and disease management programmes, as well as biological and epidemiological studies of the divergent GLRaV-3 populations. Copyright © 2013 Elsevier B.V. All rights reserved.

UniPrime2: a web service providing easier Universal Primer design.

PubMed

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

PubMed

Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

2015-03-01

A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

PubMed Central

Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

2010-01-01

A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

Rapid and sensitive detection of Curvularia lunata associated with maize leaf spot based on its Clg2p gene using semi-nested PCR.

PubMed

Hou, J M; Ma, B C; Zuo, Y H; Guo, L L; Gao, S G; Wang, Y Y; Liu, T

2013-04-01

Curvularia lunata (Wakker) Boed, the causative agent of Curvularia leaf spot in maize, was determined according to conidiophore and conidium morphology in a previous study. In the current study, a sensitive polymerase chain reaction assay was developed for the detection of C. lunata. Two specific forward (ClgD1/ClgD2) and one reverse primers (ClgD3) were designed based on a Ras-related (Clg2p) gene. Eight C. lunata isolates that represent different virulent strains in maize, six other Curvularia spp., and 22 fungal plant pathogens were used to test the specificity of the primers. PCR amplification using ClgD1/ClgD3 as the first-round primers resulted in an 870-bp band from the C. lunata isolates. The detection sensitivity using ClgD1/ClgD3 was 100 pg of genomic DNA. In the second round of PCR, a 1 : 50 dilution of the first-round PCR products was used as a template with the ClgD2/ClgD3 primer pair, which increased the detection sensitivity to 1 fg. This semi-nested PCR procedure could also be used to detect C. lunata from infected maize leaves. The proposed PCR-based assay may be used for diagnosing and monitoring maize Curvularia leaf spot. The semi-nested PCR assay may provide researchers and laboratory technologists a tool to rapidly detect C. lunata, which causes maize Curvularia leaf spot, compared with histological examination. © 2012 The Society for Applied Microbiology.

Distribution of Bathyarchaeota (MCG) archaea in the South China Sea sediments and implication of its ecological roles

NASA Astrophysics Data System (ADS)

Tiantian, Y.; Wang, F.; MingYang, N.

2015-12-01

Tiantian Yu1,2, Mingyang Niu1,2 and Fengping Wang1,2 1State Key Laboratory of Microbial Metabolism, School of Life Sciences and Biotechnology, Shanghai, 200240, China; 2State Key Laboratory of Ocean Engineering, Shanghai Jiao Tong University, Shanghai, 200240, China ABSTRACT: Archaea of Bathyarchaeota Phylum (Miscellaneous Crenarchaeotal Group, MCG) are widespread and abundant in various marine and continental environments. However, very little is understood on the metabolisms and ecological roles of this cosmopolitan sedimentary archaea , partly due to obstacles of cultivation. Bathyarchaeota could be divided into large members of subgroups with potentially high genetic heterogeneity, implying different metabolic capabilities and functions in different subgroups. Here, we report our work on investigating Bathyarchaeota abundance and types of subgroups in the South China Sea(SCS) sediments, aim to understand their ecological roles in the carbon cycling. Bathyarchaeota were found the most dominant archaeal group in the sediments of SCS , most of which belong to subgroups MCG-8, MCG-15, MCG-17 and MCG-3. A new pair of 16S rRNA gene primers was designed as the published primers could not cover MCG-15 and MCG-17, which are the most dominant subgroups in the SCS sediments. Comparing with previous primers which used for quantifying the abundance of Bathyarchaeota via Q-PCR, the new primer revealed about an order of magnitude higher abundance in all South China Sea sediments. The relationship of geochemical parameters and MCG subgroups will further be explored to provide the basis for further understanding the metabolic function and biogeochemical roles of these poor-understood sedimentary archaea.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F. William

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F.W.

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.

ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

PubMed

Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

2017-10-01

ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Designing for transportation management and operations : a primer.

DOT National Transportation Integrated Search

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Wiesner, G.; Laken, S.

The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

Simple sequence repeat marker loci discovery using SSR primer.

PubMed

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Genomic typing of canine parvovirus circulating in the State of Rio de Janeiro, Brazil from 1995 to 2001 using polymerase chain reaction assay.

PubMed

Costa, A P; Leite, J P G; Labarthe, N V; Garcia, R C N Cubel

2005-11-01

In this study, the genomic types of canine parvovirus (CPV) circulating in the State of Rio de Janeiro, Brazil, from 1995 to 2001, were investigated using the polymerase chain reaction assay (PCR). A total of 78 faecal samples from gastroenteritic puppies, confirmed as positive for canine parvovirus by haemagglutination/haemagglutination inhibition tests or virus isolation in cell culture (MDCK), were examined. The viral DNA was extracted from faecal samples using a combination of phenol- chloroform and silica-guanidine thiocyanate methods. PCR was carried out with differential pairs of primers to distinguish the old (CPV-2) and new types of virus (CPv-2a or CPV-2b). Specific amplicons were observed for all samples using the primer pair P2ab, which detects CPV-2a and CPV-2b. Seventy-six from a total of 78 samples (97%) were considered as CPV-2b because of their reaction with the primer pair P2b. Thirty samples (30/78) were from previously vaccinated puppies and in 15 of them the enteritis symptoms began from 1 to 12 days after vaccination. PCR confirmed the infection by wild virus (CPV-2b) in 5 of these 15 puppies who had received old-type vaccines. Our results show that CPV-2b was the prevalent type circulating in the State of Rio de Janeiro from 1995 to 2001.

Bacterial community structure analysis of sediment in the Sagami River, Japan using a rapid approach based on two-dimensional DNA gel electrophoresis mapping with selective primer pairs.

PubMed

Liu, Guo-hua; Rajendran, Narasimmalu; Amemiya, Takashi; Itoh, Kiminori

2011-11-01

A rapid approach based on two-dimensional DNA gel electrophroesis (2-DGE) mapping with selective primer pairs was employed to analyze bacterial community structure in sediments from upstream, midstream and downstream of Sagami River in Japan. The 2-DGE maps indicated that Alpha- and Delta-proteobacteria were major bacterial populations in the upstream and midstream sediments. Further bacterial community structure analysis showed that richness proportion of Alpha- and Delta-proteobacterial groups reflected a trend toward decreasing from the upstream to downstream sediments. The biomass proportion of bacterial populations in the midstream sediment showed a significantly difference from that in the other sediments, suggesting that there may be an environmental pressure on the midstream bacterial community. Lorenz curves, together with Gini coefficients were successfully applied to the 2-DGE mapping data for resolving evenness of bacterial populations, and showed that the plotted curve from high-resolution 2-DGE mapping became less linear and more an exponential function than that of the 1-DGE methods such as chain length analysis and denaturing gradient gel electrophoresis, suggesting that the 2-DGE mapping may achieve a more detailed evaluation of bacterial community. In conclusion, the 2-DGE mapping combined with the selective primer pairs enables bacterial community structure analysis in river sediment and thus it can also monitor sediment pollution based on the change of bacterial community structure.

STITCHER 2.0: primer design for overlapping PCR applications

PubMed Central

O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

2017-01-01

Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

STITCHER 2.0: primer design for overlapping PCR applications.

PubMed

O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

2017-03-30

Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

Genetic diversity analysis of tree peony germplasm using iPBS markers.

PubMed

Duan, Y B; Guo, D L; Guo, L L; Wei, D F; Hou, X G

2015-07-06

We examined the genetic diversity of 10 wild species (populations) and 55 varieties of tree peony using inter-primer binding site (iPBS) markers. From a total of 36 iPBS primers, 16 were selected based on polymorphic amplification. The number of bands amplified by each primer ranged from 9 to 19, with an average of 12.88 bands per primer. The length of bands ranged from 100 to 2000 bp, concentrated at 200 to 1800 bp. Sixteen primers amplified 206 bands in total, of which 173 bands were polymorphic with a polymorphism ratio of 83.98%. Each primer amplified 10.81 polymorphic bands on average. The data were then used to construct a phylogenetic tree using unweighted pair group method with arithmetic mean methods. Clustering analysis showed that the genetic relationships among the varieties were not only related to the genetic background or geographic origin, but also to the flowering phase, flower color, and flower type. Our data also indicated that iPBS markers were useful tools for classifying tree peony germplasms and for tree peony breeding, and the specific bands were helpful for molecular identification of tree peony varieties.

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

PCR-Based Method for the Detection of Toxic Mushrooms Causing Food-Poisoning Incidents.

PubMed

Nomura, Chie; Masayama, Atsushi; Yamaguchi, Mizuka; Sakuma, Daisuke; Kajimura, Keiji

2017-01-01

In this study, species-specific identification of five toxic mushrooms, Chlorophyllum molybdites, Gymnopilus junonius, Hypholoma fasciculare, Pleurocybella porrigens, and Tricholoma ustale, which have been involved in food-poisoning incidents in Japan, was investigated. Specific primer pairs targeting internal transcribed spacer (ITS) regions were designed for PCR detection. The specific amplicons were obtained from fresh, cooked, and simulated gastric fluid (SGF)-treated samples. No amplicons were detected from other mushrooms with similar morphology. Our method using one-step extraction of mushrooms allows rapid detection within 2.5 hr. It could be utilized for rapid identification or screening of toxic mushrooms.

PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products.

PubMed

Dorn-In, Samart; Hölzel, Christina S; Janke, Tobias; Schwaiger, Karin; Balsliemke, Joachim; Bauer, Johann

2013-03-01

Food processing of spoiled meat is prohibited by law, since it is a deception and does not comply with food safety aspects. In general, spoilage of meat is mostly caused by bacteria. However, a high contamination level of fungi could be also found in some meat or meat products with certain preserving conditions. In case that unhygienic meat is used to produce heat processed products, the microorganisms will be deactivated by heat, so that they cannot be detected by a standard cultivation method. Therefore, this study aimed to develop and apply a molecular biological method--polymerase chain reaction and single strand conformation polymorphism (PCR-SSCP)--to reconstruct the original fungal flora of heat processed meat. Twenty primer pairs were tested for their specificity for fungal DNA. Since none of them fully complied with all study criteria (such as high specificity and sensitivity for fungal DNA; suitability of the products for PCR-SSCP) in the matrix "meat", we designed a new reverse primer, ITS5.8R. The primer pair ITS1/ITS5.8R amplified DNA from all tested fungal species, but not DNA from meat-producing animals or from ingredients of plant origin (spices). For the final test, 32 DNA bands in acrylamide gel from 15 meat products and 1 soy sauce were sequenced-all originating from fungal species, which were, in other studies, reported to contaminate meat e.g. Alternaria alternata, Aureobasidium pullulans, Candida rugosa, C. tropicalis, C. zeylanoides, Eurotium amstelodami and Pichia membranifaciens, and/or spices such as Botrytis aclada, Guignardia mangiferae, Itersonilia perplexans, Lasiodiplodia theobromae, Lewia infectoria, Neofusicoccum parvum and Pleospora herbarum. This confirms the suitability of PCR-SSCP to specifically detect fungal DNA in heat processed meat products, and thus provides an overview of fungal species contaminating raw material such as meat and spices. Copyright © 2013 Elsevier B.V. All rights reserved.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

Genetic Fingerprinting Using Microsatellite Markers in a Multiplex PCR Reaction: A Compilation of Methodological Approaches from Primer Design to Detection Systems.

PubMed

Krüger, Jacqueline; Schleinitz, Dorit

2017-01-01

Microsatellites are polymorphic DNA loci comprising repeated sequence motifs of two to five base pairs which are dispersed throughout the genome. Genotyping of microsatellites is a widely accepted tool for diagnostic and research purposes such as forensic investigations and parentage testing, but also in clinics (e.g. monitoring of bone marrow transplantation), as well as for the agriculture and food industries. The co-amplification of several short tandem repeat (STR) systems in a multiplex reaction with simultaneous detection helps to obtain more information from a DNA sample where its availability may be limited. Here, we introduce and describe this commonly used genotyping technique, providing an overview on available resources on STRs, multiplex design, and analysis.

Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

PubMed

Vela, J; Vitorica, J; Ruano, D

2001-12-01

We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

NASA Astrophysics Data System (ADS)

Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

2013-11-01

This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

Development and Application of Transcriptome-Derived Microsatellites in Actinidia eriantha (Actinidiaceae)

PubMed Central

Guo, Rui; Landis, Jacob B.; Moore, Michael J.; Meng, Aiping; Jian, Shuguang; Yao, Xiaohong; Wang, Hengchang

2017-01-01

Actinidia eriantha Benth. is a diploid perennial woody vine native to China and is recognized as a valuable species for commercial kiwifruit improvement with high levels of ascorbic acid as well as having been used in traditional Chinese medicine. Due to the lack of genomic resources for the species, microsatellite markers for population genetics studies are scarce. In this study, RNASeq was conducted on fruit tissue of A. eriantha, yielding 5,678,129 reads with a total output of 3.41 Gb. De novo assembly yielded 69,783 non-redundant unigenes (41.3 Mb), of which 21,730 were annotated using protein databases. A total of 8,658 EST-SSR loci were identified in 7,495 unigene sequences, for which primer pairs were successfully designed for 3,842 loci (44.4%). Among these, 183 primer pairs were assayed for PCR amplification, yielding 69 with detectable polymorphism in A. eriantha. Additionally, 61 of the 69 polymorphic loci could be successfully amplified in at least one other Actinidia species. Of these, 14 polymorphic loci (mean NA = 6.07 ± 2.30) were randomly selected for assessing levels of genetic diversity and population structure within A. eriantha. Finally, a neighbor-joining tree and Bayesian clustering analysis showed distinct clustering into two groups (K = 2), agreeing with the geographical distributions of these populations. Overall, our results will facilitate further studies of genetic diversity within A. eriantha and will aid in discriminating outlier loci involved in local adaptation. PMID:28890721

A newly constructed primer pair for the PCR amplification, cloning and sequencing of the flagellin (flaA) gene from isolatesof urease-negative Campylobacter lari.

PubMed

Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo

2005-08-01

A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.

Species-specific PCR for the identification of Cooperia curticei (Nematoda: Trichostrongylidae) in sheep.

PubMed

Amarante, M R V; Bassetto, C C; Neves, J H; Amarante, A F T

2014-12-01

Agricultural ruminants usually harbour mixed infections of gastrointestinal nematodes. A specific diagnosis is important because distinct species can differ significantly in their fecundity and pathogenicity. Haemonchus spp. and Cooperia spp. are the most important gastrointestinal nematodes infecting ruminants in subtropical/tropical environments. In Brazil, C. punctata is more adapted to cattle than sheep. Additionally, C. spatulata appears to be more adapted to cattle, whereas C. curticei is more adapted to sheep. However, infection of sheep with C. punctata is common when cattle and sheep share the same pasture. Although morphological analyses have been widely used to identify nematodes, molecular methods can overcome technical limitations and help improve species-specific diagnoses. Genetic markers in the first and second internal transcribed spacers (ITS-1 and ITS-2, respectively) of nuclear ribosomal DNA (rDNA) have been used successfully to detect helminths. In the present study, the ITS-1 region was analysed and used to design a species-specific oligonucleotide primer pair to identify C. curticei. The polymerase chain reaction (PCR) product was sequenced and showed 97% similarity to C. oncophora partial ITS-1 clones and 99% similarity to the C. curticei sequence JF680982. The specificity of this primer pair was corroborated by the analysis of 17 species of helminths, including C. curticei, C. punctata and C. spatulata. Species-specific diagnosis, which has implications for rapid and reliable identification, can support studies on the biology, ecology and epidemiology of trichostrongylid nematodes in a particular geographical location.

Development of a Gene-Centered SSR Atlas as a Resource for Papaya (Carica papaya) Marker-Assisted Selection and Population Genetic Studies

PubMed Central

Vidal, Newton Medeiros; Grazziotin, Ana Laura; Ramos, Helaine Christine Cancela; Pereira, Messias Gonzaga; Venancio, Thiago Motta

2014-01-01

Carica papaya (papaya) is an economically important tropical fruit. Molecular marker-assisted selection is an inexpensive and reliable tool that has been widely used to improve fruit quality traits and resistance against diseases. In the present study we report the development and validation of an atlas of papaya simple sequence repeat (SSR) markers. We integrated gene predictions and functional annotations to provide a gene-centered perspective for marker-assisted selection studies. Our atlas comprises 160,318 SSRs, from which 21,231 were located in genic regions (i.e. inside exons, exon-intron junctions or introns). A total of 116,453 (72.6%) of all identified repeats were successfully mapped to one of the nine papaya linkage groups. Primer pairs were designed for markers from 9,594 genes (34.5% of the papaya gene complement). Using papaya-tomato orthology assessments, we assembled a list of 300 genes (comprising 785 SSRs) potentially involved in fruit ripening. We validated our atlas by screening 73 SSR markers (including 25 fruit ripening genes), achieving 100% amplification rate and uncovering 26% polymorphism rate between the parental genotypes (Sekati and JS12). The SSR atlas presented here is the first comprehensive gene-centered collection of annotated and genome positioned papaya SSRs. These features combined with thousands of high-quality primer pairs make the atlas an important resource for the papaya research community. PMID:25393538

RNA Structural Analysis by Evolving SHAPE Chemistry

PubMed Central

Spitale, Robert C.; Flynn, Ryan A.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

2017-01-01

RNA is central to the flow of biological information. From transcription to splicing, RNA localization, translation, and decay, RNA is intimately involved in regulating every step of the gene expression program, and is thus essential for health and understanding disease. RNA has the unique ability to base-pair with itself and other nucleic acids to form complex structures. Hence the information content in RNA is not simply its linear sequence of bases, but is also encoded in complex folding of RNA molecules. A general chemical functionality that all RNAs have is a 2’-hydroxyl group in the ribose ring, and the reactivity of the 2'-hydroxyl in RNA is gated by local nucleotide flexibility. In other words, the 2'-hydroxyl is reactive at single-stranded and conformationally flexible positions but is unreactive at nucleotides constrained by base pairing. Recent efforts have been focused on developing reagents that modify RNA as a function of RNA 2’ hydroxyl group flexibility. Such RNA structure probing techniques can be read out by primer extension in experiments termed RNA SHAPE (Selective 2’ Hydroxyl Acylation and Primer Extension). Herein we describe the efforts devoted to the design and utilization of SHAPE probes for characterizing RNA structure. We also describe current technological advances that are being used to utilize SHAPE chemistry with deep sequencing to probe many RNAs in parallel. The merger of chemistry with genomics is sure to open the door to genome-wide exploration of RNA structure and function. PMID:25132067

Serovar distribution of a DNA sequence involved in the antigenic relationship between Leptospira and equine cornea.

PubMed

Lucchesi, Paula M A; Parma, Alberto E; Arroyo, Guillermo H

2002-01-01

Horses infected with Leptospira present several clinical disorders, one of them being recurrent uveitis. A common endpoint of equine recurrent uveitis is blindness. Serovar pomona has often been incriminated, although others have also been reported. An antigenic relationship between this bacterium and equine cornea has been described in previous studies. A leptospiral DNA fragment that encodes cross-reacting epitopes was previously cloned and expressed in Escherichia coli. A region of that DNA fragment was subcloned and sequenced. Samples of leptospiral DNA from several sources were analysed by PCR with two primer pairs designed to amplify that region. Reference strains from serovars canicola, icterohaemorrhagiae, pomona, pyrogenes, wolffi, bataviae, sentot, hebdomadis and hardjo rendered products of the expected sizes with both pairs of primers. The specific DNA region was also amplified from isolates from Argentina belonging to serogroups Canicola and Pomona. Both L. biflexa serovar patoc and L. borgpetersenii serovar tarassovi rendered a negative result. The DNA sequence related to the antigen mimicry with equine cornea was not exclusively found in serovar pomona as it was also detected in several strains of Leptospira belonging to different serovars. The results obtained with L. biflexa serovar patoc strain Patoc I and L. borgpetersenii serovar tarassovi strain Perepelicin suggest that this sequence is not present in these strains, which belong to different genomospecies than those which gave positive results. This is an interesting finding since L. biflexa comprises nonpathogenic strains and serovar tarassovi has not been associated clinically with equine uveitis.

EcoGene 3.0

PubMed Central

Zhou, Jindan; Rudd, Kenneth E.

2013-01-01

EcoGene (http://ecogene.org) is a database and website devoted to continuously improving the structural and functional annotation of Escherichia coli K-12, one of the most well understood model organisms, represented by the MG1655(Seq) genome sequence and annotations. Major improvements to EcoGene in the past decade include (i) graphic presentations of genome map features; (ii) ability to design Boolean queries and Venn diagrams from EcoArray, EcoTopics or user-provided GeneSets; (iii) the genome-wide clone and deletion primer design tool, PrimerPairs; (iv) sequence searches using a customized EcoBLAST; (v) a Cross Reference table of synonymous gene and protein identifiers; (vi) proteome-wide indexing with GO terms; (vii) EcoTools access to >2000 complete bacterial genomes in EcoGene-RefSeq; (viii) establishment of a MySql relational database; and (ix) use of web content management systems. The biomedical literature is surveyed daily to provide citation and gene function updates. As of September 2012, the review of 37 397 abstracts and articles led to creation of 98 425 PubMed-Gene links and 5415 PubMed-Topic links. Annotation updates to Genbank U00096 are transmitted from EcoGene to NCBI. Experimental verifications include confirmation of a CTG start codon, pseudogene restoration and quality assurance of the Keio strain collection. PMID:23197660

EcoGene 3.0.

PubMed

Zhou, Jindan; Rudd, Kenneth E

2013-01-01

EcoGene (http://ecogene.org) is a database and website devoted to continuously improving the structural and functional annotation of Escherichia coli K-12, one of the most well understood model organisms, represented by the MG1655(Seq) genome sequence and annotations. Major improvements to EcoGene in the past decade include (i) graphic presentations of genome map features; (ii) ability to design Boolean queries and Venn diagrams from EcoArray, EcoTopics or user-provided GeneSets; (iii) the genome-wide clone and deletion primer design tool, PrimerPairs; (iv) sequence searches using a customized EcoBLAST; (v) a Cross Reference table of synonymous gene and protein identifiers; (vi) proteome-wide indexing with GO terms; (vii) EcoTools access to >2000 complete bacterial genomes in EcoGene-RefSeq; (viii) establishment of a MySql relational database; and (ix) use of web content management systems. The biomedical literature is surveyed daily to provide citation and gene function updates. As of September 2012, the review of 37 397 abstracts and articles led to creation of 98 425 PubMed-Gene links and 5415 PubMed-Topic links. Annotation updates to Genbank U00096 are transmitted from EcoGene to NCBI. Experimental verifications include confirmation of a CTG start codon, pseudogene restoration and quality assurance of the Keio strain collection.

Rapid identification of the genus Dekkera/Brettanomyces, the Dekkera subgroup and all individual species.

PubMed

Hulin, M; Harrison, E; Stratford, M; Wheals, A E

2014-09-18

The genus Dekkera/Brettanomyces comprises five described species: Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. naardenensis and B. nanus. Some of them, especially D. bruxellensis, are important spoilage organisms, particularly in the wine and beverage industries. Because of their economic importance many different methods have been developed to identify members of the genus in general and D. bruxellensis in particular. These methods vary in their rapidity, complexity and cost but, partly because of confidentiality issues, it is unclear which methods are used, or how widely, in the relevant industries. Building on previous work with the genera Saccharomyces and Zygosaccharomyces, a suite of eight PCR primer pairs has been designed either on the D1-D2 region of the 26S rRNA gene or translation elongation factor TEF1-α. These primers can specifically identify the genus as a whole, only Dekkera species, each one of the five recognised species as well as a significant subgroup of D. bruxellensis represented by NCYC 3426. Multiplexing has also been tried and it has been shown to be possible with some combinations of genus or Dekkera-level and species-specific primers. Using direct colony PCR amplification followed by gel electrophoresis, a clear positive result can be obtained in less than 3h, thus providing a quick, reliable and inexpensive way to identify target species. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of Uvaria sp by barcoding coupled with high-resolution melting analysis (Bar-HRM).

PubMed

Osathanunkul, M; Madesis, P; Ounjai, S; Pumiputavon, K; Somboonchai, R; Lithanatudom, P; Chaowasku, T; Wipasa, J; Suwannapoom, C

2016-01-13

DNA barcoding, which was developed about a decade ago, relies on short, standardized regions of the genome to identify plant and animal species. This method can be used to not only identify known species but also to discover novel ones. Numerous sequences are stored in online databases worldwide. One of the ways to save cost and time (by omitting the sequencing step) in species identification is to use available barcode data to design optimized primers for further analysis, such as high-resolution melting analysis (HRM). This study aimed to determine the effectiveness of the hybrid method Bar-HRM (DNA barcoding combined with HRM) to identify species that share similar external morphological features, rather than conduct traditional taxonomic identification that require major parts (leaf, flower, fruit) of the specimens. The specimens used for testing were those, which could not be identified at the species level and could either be Uvaria longipes or Uvaria wrayias, indicated by morphological identification. Primer pairs derived from chloroplast regions (matK, psbA-trnH, rbcL, and trnL) were used in the Bar-HRM. The results obtained from psbA-trnH primers were good enough to help in identifying the specimen while the rest were not. Bar-HRM analysis was proven to be a fast and cost-effective method for plant species identification.

A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

PubMed

Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

2005-06-01

Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism generated by SPCC11 was essentially due to the variation in length of the mononucleotide repeats.

Design of a Percussion and Electric Primer Gun Firing Power Supply

DTIC Science & Technology

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.

PubMed

Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng

2005-08-01

Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.

Rapid and reliable diagnostic method to detect Zika virus by real-time fluorescence reverse transcription loop-mediated isothermal amplification.

PubMed

Guo, Xu-Guang; Zhou, Yong-Zhuo; Li, Qin; Wang, Wei; Wen, Jin-Zhou; Zheng, Lei; Wang, Qian

2018-04-18

To detect Zika virus more rapidly and accurately, we developed a novel method that utilized a real-time fluorescence reverse transcription loop-mediated isothermal amplification (LAMP) technique. The NS5 gene was amplified by a set of six specific primers that recognized six distinct sequences. The amplification process, including 60 min of thermostatic reaction with Bst DNA polymerase following real-time fluorescence reverse transcriptase using genomic Zika virus standard strain (MR766), was conducted through fluorescent signaling. Among the six pairs of primers that we designate here, NS5 was the most efficient with a high sensitivity of up to 3.3 ng/μl and reproducible specificity on eight pathogen samples that were used as negative controls. The real-time fluorescence reverse transcription LAMP detection process can be completed within 35 min. Our study demonstrated that real-time fluorescence reverse transcription LAMP could be highly beneficial and convenient clinical application to detect Zika virus due to its high specificity and stability.

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

PubMed Central

Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

2015-01-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

PubMed

Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

2016-11-22

Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

PubMed

Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

2015-07-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

USGS Publications Warehouse

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Molecular detection of Hepatozoon canis and Babesia canis vogeli in domestic dogs from Cuiabá, Brazil.

PubMed

Spolidorio, Mariana Granziera; Torres, Mariana de Medeiros; Campos, Wilma Neres da Silva; Melo, Andréia Lima Tomé; Igarashi, Michelle; Amude, Alexandre Mendes; Labruna, Marcelo Bahia; Aguiar, Daniel Moura

2011-01-01

The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co‑infection of Babesia spp. and Hepatozoon spp. was seen in 5 dogs. Sequenced samples revealed 100% identity with B. canis vogeli, and H. canis. This is the first molecular detection of H. canis in domestic dogs from Cuiabá. Additionally, it is described for the first time the presence of B. canis vogeli circulating among dogs in Cuiabá.

Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

PubMed

Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

2017-08-01

A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

Assessing the germplasm of Laminaria (phaeophyceae) with random amplified polymorphic DNA (RAPD) method

NASA Astrophysics Data System (ADS)

He, Yingjun; Zou, Yuping; Wang, Xiaodong; Zheng, Zhiguo; Zhang, Daming; Duan, Delin

2003-06-01

Eighteen gametophytes including L. japonica, L. ochotensis and L. longissima, were verified with random amplified polymorphic DNA (RAPD) technique. Eighteen ten-base primers were chosen from 100 primers selected for final amplification test. Among the total of 205 bands amplified, 181 (88.3%) were polymorphic. The genetic distance among different strains ranged from 0.072 to 0.391. The dendrogram constructed by unweighted pair-group method with arithmetic (UPGMA) method showed that the female and male gametophytes of the same cell lines could be grouped in pairs respectively. It indicated that RAPD analysis could be used not only to distinguish different strains of Laminaria, but also to distinguish male and female gametophyte within the same cell lines. There is ambiguous systematic relationship if judged merely by the present data. It seems that the use of RAPD marker is limited to elucidation of the phylogenetic relationship among the species of Laminaria.

Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

PubMed

Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

2015-10-26

Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

E-microsatellite markers for Centella asiatica (Gotu Kola) genome: validation and cross-transferability in Apiaceae family for plant omics research and development.

PubMed

Sahu, Jagajjit; Das Talukdar, Anupam; Devi, Kamalakshi; Choudhury, Manabendra Dutta; Barooah, Madhumita; Modi, Mahendra Kumar; Sen, Priyabrata

2015-01-01

Abstract Centella asiatica (Gotu Kola) is a plant that grows in tropical swampy regions of the world and has important medicinal and culinary use. It is often considered as part of Ayurvedic medicine, traditional African medicine, and traditional Chinese medicine. The unavailability of genomics resources is significantly impeding its genetic improvement. To date, no attempt has been made to develop Expressed Sequence Tags (ESTs) derived Simple Sequence Repeat (SSR) markers (eSSRs) from the Centella genome. Hence, the present study aimed to develop eSSRs and their further experimental validation and cross-transferability of these markers in different genera of the Apiaceae family to which Centella belongs. An in-house pipeline was developed for the entire analyses by combining bioinformatics tools and perl scripts. A total of 4443 C. asiatica EST sequences from dbEST were processed, which generated 2617 nonredundant high quality EST sequences consisting 441 contigs and 2176 singletons. Out of 1776.5 kb of examined sequences, 417 (15.9%) ESTs containing 686 SSRs were detected with a density of one SSR per 2.59 kb. The gene ontology study revealed 282 functional domains involved in various processes, components, and functions, out of which 64 ESTs were found to have both SSRs and functional domains. Out of 603 designed EST-SSR primers, 18 pairs of primers were selected for validation based on the optimum parameter value. Reproducible amplification was obtained for six primer pairs in C. asiatica that were further tested for cross-transferability in nine other important genera/species of the Apiaceae family. Cross-transferability of the EST-SSR markers among the species were examined and Centella javanica showed highest transferability (83.3%). The study revealed six highly polymorphic EST-SSR primers with an average PIC value of 0.95. In conclusion, these EST-SSR markers hold a big promise for the genomics analysis of Centella asiatica, to facilitate comparative map-based analyses across other related species within the Apiaceae family, and future marker-assisted breeding programs. To the best of our knowledge, this is the first report of development of EST-SSRs in Centella asiatica by in silico approaches, which offers a veritable potential in further use in plant omics research and development.

Simultaneous Genotyping of the rs4762 and rs699 Polymorphisms in Angiotensinogen Gene and Correlation with Iranian CAD Patients with Novel Hexa-primer ARMS-PCR

PubMed Central

KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud

2017-01-01

Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324

Newly developed primers for complete YCF1 amplification in Pinus (Pinaceae) chloroplasts with possible family-wide utility

Treesearch

Matthew Parks; Aaron Liston; Rich Cronn

2011-01-01

Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...

Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

USGS Publications Warehouse

Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

1999-01-01

We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

Development and characterization of 32 microsatellite loci in Genipa americana (Rubiaceae)1

PubMed Central

Manoel, Ricardo O.; Freitas, Miguel L. M.; Barreto, Mariana A.; Moraes, Mário L. T.; Souza, Anete P.; Sebbenn, Alexandre M.

2014-01-01

• Premise of the study: Microsatellite primers were developed for the tree species Genipa americana (Rubiaceae) for further population genetic studies. • Methods and Results: We identified 144 clones containing 65 repeat motifs from a genomic library enriched for (CT)8 and (GT)8 motifs. Primer pairs were developed for 32 microsatellite loci and validated in 40 individuals of two natural G. americana populations. Seventeen loci were polymorphic, revealing from three to seven alleles per locus. The observed and expected heterozygosities ranged from 0.24 to 1.00 and from 0.22 to 0.78, respectively. • Conclusions: The 17 primers identified as polymorphic loci are suitable to study the genetic diversity and structure, mating system, and gene flow in G. americana. PMID:25202610

Polymorphism of follicle stimulating hormone beta (FSHβ) subunit gene and its association with litter traits in giant panda.

PubMed

Huang, Xiaoyu; Li, Desheng; Wang, Jiwen; Huang, Yan; Han, Chunchun; Zhang, Guiquan; Huang, Zhi; Wu, Honglin; Wei, Ming; Wang, Guosong; Hu, Haiping; Deng, Tao; He, Tao; Zhou, Yingming; Song, Shixian; Luo, Bo; Zhang, Heming

2013-11-01

The different SSCP patterns of the follicle stimulating hormone beta (FSHβ) gene amplified by three pairs of primers were sequenced. Comparisons among the three nucleotide sequences of three genotypes indicated that three base substitutions (A213T, A91G, and A89C) were detected in FSHβ gene, which A213T substitution led to one amino acids mutation (Lys > Met), and the other two substitutions were synonymous mutations. The AA, AB and BB genotypes patterns obtained by FSHβ primer1 had evident relation with the litter traits, but the SSCP genotypes patterns obtained by FSHβ primer2 and primer3 had no evident relation with the litter traits in giant panda. The giant panda with AA and AB genotype had the largest litter size and multiparity rate compared with the BB genotypes (P < 0.05). We speculated that the giant pandas with the A allele have better litter traits than those with the B allele.

Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

PubMed Central

Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

2014-01-01

For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

Chloroplast and nuclear DNA studies in a few members of the Brassica oleracea L. group using PCR-RFLP and ISSR-PCR markers: a population genetic analysis.

PubMed

Panda, S; Martín, J P; Aguinagalde, I

2003-04-01

A population genetic analysis of chloroplast and nuclear DNA was performed covering nine wild populations of Brassica oleracea. Three members of the n = 9 group, all close to B. oleracea, Brassica alboglabra Bailey, Brassica bourgeaui (Webb) O. Kuntze and Brassica montana Pourret, were also studied to better understand their relationship with B. oleracea. Chloroplast DNA was analysed using the PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism) method. The ISSR-PCR (inter-simple sequence repeat - polymerase chain reaction) technique was adopted to study nuclear DNA. Twelve primer pairs of chloroplast DNA showed very good amplification. The amplified product of each primer pair, digested by three restriction enzymes, revealed no variation of cpDNA among the taxa studied. This indicates they may have the same chloroplast genotype. Seven selected ISSR primers have detected genetic variation, both within and among the populations/taxa surveyed. The information obtained on the intra- and inter-populational genetic diversity of wild populations of B. oleracea neatly defined the individual plants. It could provide important guidelines for backing management and conservation strategies in this species. The study confirms a close relationship between B. alboglabra, B. bourgeaui and B. montana, which is parallel to their morphological similitude.

Identification on commercialized products of AFLP markers able to discriminate slow- from fast-growing chicken strains.

PubMed

Fumière, Olivier; Dubois, Marc; Grégoire, Dimitrie; Théwis, André; Berben, Gilbert

2003-02-26

The European chicken meat market is characterized by numerous quality marks: "Label de Qualité Wallon" in Belgium, "Label Rouge" in France, denominations of geographical origin, organic agriculture, etc. Most of those certified productions have specifications requiring the use of slow-growing chicken strains. The amplified fragment length polymorphism (AFLP) technique has been used to search molecular markers able to discriminate slow-growing chicken strains from fast-growing ones and to authenticate certified products. Two pairs of restriction enzymes (EcoRI/MseI and EcoRI/TaqI) and 121 selective primer combinations were tested on individual DNA samples from chicken products essentially in carcass form that were ascribed as belonging to either slow- or fast-growing strains. Within the resulting fingerprints, two fragments were identified as type-strains specific markers. One primer combination gives a band (333 bp) that is specific for slow-growing chickens, and another primer pair generates a band (372 bp) that was found to be characteristic of fast-growing chickens. The two markers were isolated, cloned, and sequenced. The effectiveness and the specificity of the two interesting determinants were assessed on individuals of two well-known strains (ISA 657 and Cobb 500) and on commercialized products coming from various origins.

Nested PCR for ultrasensitive detection of the potato ring rot bacterium, Clavibacter michiganensis subsp. sepedonicus.

PubMed

Lee, I M; Bartoszyk, I M; Gundersen, D E; Mogen, B; Davis, R E

1997-07-01

Oligonucleotide primers derived from sequences of the 16S rRNA gene (CMR16F1, CMR16R1, CMR16F2, and CMR16R2) and insertion element IS1121 of Clavibacter michiganensis subsp. sepedonicus (CMSIF1, CMSIR1, CMSIF2, and CMISR2) were used in nested PCR to detect the potato ring rot bacterium C. michiganensis subsp. sepedonicus. Nested PCR with primer pair CMSIF1-CMSIR1 followed by primer pair CMSIF2-CMSIR2 specifically detected C. michiganensis subsp. sepedonicus, while nested PCR with CMR16F1-CMR16R1 followed by CMR16F2-CMR16R2 detected C. michiganensis subsp. sepedonicus and the other C. michiganensis subspecies. In the latter case, C. michiganensis subsp. sepedonicus can be differentiated from the other subspecies by restriction fragment length polymorphism (RFLP) analyses of the nested PCR products (16S rDNA sequences). The nested PCR assays developed in this work allow ultrasensitive detection of very low titers of C. michiganensis subsp. sepedonicus which may be present in symptomiess potato plants or tubers and which cannot be readily detected by direct PCR (single PCR amplification). RFLP analysis of PCR products provides for an unambiguous confirmation of the identify of C. michiganensis subsp. sepedonicus.

Molecular diagnostic for boll weevil (Coleoptera: Curculionidae) based on amplification of three species-specific microsatellites.

PubMed

Kim, Kyung Seok; Szendrei, Zsofia; Rodriguez-Saona, Cesar; Mulder, Phillip G; Sappington, Thomas W

2009-04-01

The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton, Gossypium hirsutum L., in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally the traps collect nontarget weevils that can be misidentified by scouts. For example, the congeneric pepper weevil, Anthonomus eugenii Cano, and other superficially similar weevils are attracted to components of the boll weevil lure or trap color. Although morphologically distinguishable by trained personnel, the potential for misidentification is compounded when captured weevils are dismembered or partially consumed by ants or ground beetles that sometimes feed on them in the traps. Because misidentification can have expensive consequences, a molecular diagnostic tool would be of great value to eradication managers. We demonstrate that a cocktail of three primer pairs in a single polymerase chain reaction (PCR) amplify species-specific microsatellites that unambiguously distinguish the boll weevil from three other weevil species tested, including pepper weevil; cranberry weevil, Anthonomus eugenii musculus Say; and pecan weevil, Curculio caryae Horn. However, it does not distinguish the boll weevil from the subspecific "thurberia" weevil. A universal internal transcribed spacer primer pair included in the cocktail cross-amplifies DNA from all species, serving as a positive control. Furthermore, the diagnostic primers amplified the target microsatellites from various boll weevil adult body parts, indicating that the PCR technology using the primer cocktail is sensitive enough to positively identify a boll weevil even when the body is partly degraded.

The yeast retrotransposon Ty5 uses the anticodon stem-loop of the initiator methionine tRNA as a primer for reverse transcription.

PubMed Central

Ke, N; Gao, X; Keeney, J B; Boeke, J D; Voytas, D F

1999-01-01

Retrotransposons and retroviruses replicate by reverse transcription of an mRNA intermediate. Most retroelements initiate reverse transcription from a host-encoded tRNA primer. DNA synthesis typically extends from the 3'-OH of the acceptor stem, which is complementary to sequences on the retroelement mRNA (the primer binding site, PBS). However, for some retrotransposons, including the yeast Ty5 elements, sequences in the anticodon stem-loop of the initiator methionine tRNA (IMT) are complementary to the PBS. We took advantage of the genetic tractability of the yeast system to investigate the mechanism of Ty5 priming. We found that transposition frequencies decreased at least 800-fold for mutations in the Ty5 PBS that disrupt complementarity with the IMT. Similarly, transposition was reduced at least 200-fold for IMT mutations in the anticodon stem-loop. Base pairing between the Ty5 PBS and IMT is essential for transposition, as compensatory changes that restored base pairing between the two mutant RNAs restored transposition significantly. An analysis of 12 imt mutants with base changes outside of the region of complementarity failed to identify other tRNA residues important for transposition. In addition, assays carried out with heterologous IMTs from Schizosaccharomyces pombe and Arabidopsis thaliana indicated that residues outside of the anticodon stem-loop have at most a fivefold effect on transposition. Our genetic system should make it possible to further define the components required for priming and to understand the mechanism by which Ty5's novel primer is generated. PMID:10411136

Analysis of expressed sequence tags from Prunus mume flower and fruit and development of simple sequence repeat markers

PubMed Central

2010-01-01

Background Expressed Sequence Tag (EST) has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST) sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047), among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs) in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65%) and low in the peach (46%), and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species. PMID:20626882

Transcriptome Analysis of Houttuynia cordata Thunb. by Illumina Paired-End RNA Sequencing and SSR Marker Discovery

PubMed Central

Wei, Lin; Li, Shenghua; Liu, Shenggui; He, Anna; Wang, Dan; Wang, Jie; Tang, Yulian; Wu, Xianjin

2014-01-01

Background Houttuynia cordata Thunb. is an important traditional medical herb in China and other Asian countries, with high medicinal and economic value. However, a lack of available genomic information has become a limitation for research on this species. Thus, we carried out high-throughput transcriptomic sequencing of H. cordata to generate an enormous transcriptome sequence dataset for gene discovery and molecular marker development. Principal Findings Illumina paired-end sequencing technology produced over 56 million sequencing reads from H. cordata mRNA. Subsequent de novo assembly yielded 63,954 unigenes, 39,982 (62.52%) and 26,122 (40.84%) of which had significant similarity to proteins in the NCBI nonredundant protein and Swiss-Prot databases (E-value <10−5), respectively. Of these annotated unigenes, 30,131 and 15,363 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. In addition, 24,434 (38.21%) unigenes were mapped onto 128 pathways using the KEGG pathway database and 17,964 (44.93%) unigenes showed homology to Vitis vinifera (Vitaceae) genes in BLASTx analysis. Furthermore, 4,800 cDNA SSRs were identified as potential molecular markers. Fifty primer pairs were randomly selected to detect polymorphism among 30 samples of H. cordata; 43 (86%) produced fragments of expected size, suggesting that the unigenes were suitable for specific primer design and of high quality, and the SSR marker could be widely used in marker-assisted selection and molecular breeding of H. cordata in the future. Conclusions This is the first application of Illumina paired-end sequencing technology to investigate the whole transcriptome of H. cordata and to assemble RNA-seq reads without a reference genome. These data should help researchers investigating the evolution and biological processes of this species. The SSR markers developed can be used for construction of high-resolution genetic linkage maps and for gene-based association analyses in H. cordata. This work will enable future functional genomic research and research into the distinctive active constituents of this genus. PMID:24392108

Isolation, amplification and characterization of foodborne pathogen disease bacteria gene for rapid kit test development

NASA Astrophysics Data System (ADS)

Nurjayadi, M.; Santoso, I.; Kartika, I. R.; Kurniadewi, F.; Saamia, V.; Sofihan, W.; Nurkhasanah, D.

2017-07-01

There is a lot of public concern over food safety. Food-safety cases recently, including many food poisoning cases in both the developed and developing countries, considered to be the national security threats which involved police investigation. Quick and accurate detection methods are needed to handle the food poisoning cases with a big number of sufferers at the same time. Therefore, the research is aimed to develop a specific, sensitive, and rapid result molecular detection tool for foodborne pathogen bacteria. We, thus, propose genomic level approach with Polymerase Chain Reaction. The research has successfully produced a specific primer to perform amplification to fim-C S. typhi, E. coli, and pef Salmonella typhimurium genes. The electrophoresis result shows that amplification products are 95 base pairs, 121 base pairs, and 139 base pairs; and all three genes are in accordance with the size of the in silico to third genes bacteria. In conclusion, the research has been successfully designed a specific detection tool to three foodborne pathogen bacteria genes. Further stages test and the uses of Real-time PCR in the detection are still in the trial process for better detection method.

Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

PubMed

Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

2015-10-01

Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.

Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

PubMed

Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

2017-04-01

Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

Robust Detection of Rare Species Using Environmental DNA: The Importance of Primer Specificity

PubMed Central

Wilcox, Taylor M.; McKelvey, Kevin S.; Young, Michael K.; Jane, Stephen F.; Lowe, Winsor H.; Whiteley, Andrew R.; Schwartz, Michael K.

2013-01-01

Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method’s sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design. PMID:23555689

Serovar distribution of a DNA sequence involved in the antigenic relationship between Leptospira and equine cornea

PubMed Central

Lucchesi, Paula MA; Parma, Alberto E; Arroyo, Guillermo H

2002-01-01

Background Horses infected with Leptospira present several clinical disorders, one of them being recurrent uveitis. A common endpoint of equine recurrent uveitis is blindness. Serovar pomona has often been incriminated, although others have also been reported. An antigenic relationship between this bacterium and equine cornea has been described in previous studies. A leptospiral DNA fragment that encodes cross-reacting epitopes was previously cloned and expressed in Escherichia coli. Results A region of that DNA fragment was subcloned and sequenced. Samples of leptospiral DNA from several sources were analysed by PCR with two primer pairs designed to amplify that region. Reference strains from serovars canicola, icterohaemorrhagiae, pomona, pyrogenes, wolffi, bataviae, sentot, hebdomadis and hardjo rendered products of the expected sizes with both pairs of primers. The specific DNA region was also amplified from isolates from Argentina belonging to serogroups Canicola and Pomona. Both L. biflexa serovar patoc and L. borgpetersenii serovar tarassovi rendered a negative result. Conclusions The DNA sequence related to the antigen mimicry with equine cornea was not exclusively found in serovar pomona as it was also detected in several strains of Leptospira belonging to different serovars. The results obtained with L. biflexa serovar patoc strain Patoc I and L. borgpetersenii serovar tarassovi strain Perepelicin suggest that this sequence is not present in these strains, which belong to different genomospecies than those which gave positive results. This is an interesting finding since L. biflexa comprises nonpathogenic strains and serovar tarassovi has not been associated clinically with equine uveitis. PMID:11869455

Robust detection of rare species using environmental DNA: the importance of primer specificity.

PubMed

Wilcox, Taylor M; McKelvey, Kevin S; Young, Michael K; Jane, Stephen F; Lowe, Winsor H; Whiteley, Andrew R; Schwartz, Michael K

2013-01-01

Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design.

A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

PubMed

Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

2012-06-01

The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

Rapid and inexpensive analysis of genetic variability in Arapaima gigas by PCR multiplex panel of eight microsatellites.

PubMed

Hamoy, I G; Santos, E J M; Santos, S E B

2008-01-22

The aim of the present study was the development of a multiplex genotyping panel of eight microsatellite markers of Arapaima gigas, previously described. Specific primer pairs were developed, each one of them marked with either FAM-6, HEX or NED. The amplification conditions using the new primers were standardized for a single reaction. The results obtained demonstrate high heterozygosity (average of 0.69) in a Lower Amazon population. The multiplex system described can thus be considered a fast, efficient and inexpensive method for the investigation of genetic variability in Arapaima populations.

High occurrence of Bathyarchaeota (MCG) in the deep-sea sediments of South China Sea quantified using newly designed PCR primers.

PubMed

Yu, Tiantian; Liang, Qianyong; Niu, Mingyang; Wang, Fengping

2017-08-01

The archaeal phylum Bathyarchaeota, which is composed of a large number of diverse lineages, is widespread and abundant in marine sediments. Environmental factors that control the distribution, abundance and evolution of this largely diversified archaeal phylum are currently unclear. In this study, a new pair of specific primers that target the major marine subgroups of bathyarchaeotal 16S rRNA genes was designed and evaluated to investigate the distribution and abundance of Bathyarchaeota in marine sediments. The abundance of Bathyarchaeota along two sediment cores from the deep-sea sediments of South China Sea (SCS, each from the Dongsha and Shenhu area) was determined. A strong correlation was found between the bathyarchaeotal abundance and the content of total organic carbon (TOC), suggesting an important role of Bathyarchaeota in organic matter remineralisation in the sediments of SCS. Furthermore, diversity analysis revealed that subgroups Bathy-2, Bathy-8 and Bathy-10 were dominant bathyarchaeotal members of the deep-sea sediments in the SCS. Bathy-8 was found predominantly within the reducing and deeper sediment layers, while Bathy-10 occurred preferentially in the oxidizing and shallower sediment layers. Our study lays a foundation for the further understanding of the ecological functions and niche differentiation of the important but not well-understood sedimentary archaeal group. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

swga: a primer design toolkit for selective whole genome amplification.

PubMed

Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

2017-07-15

Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

[Identification and detection of trag: a new infection-related gene expressed in vivo from isolates of Streptococcus suis].

PubMed

Zhu, Haodan; Gu, Hongwei; Lu, Chengping

2008-12-01

The trag (transfer gene G) was one of the novel infection-related factors identified by in vivo-induced antigen technology (IVIAT) from Streptococcus suis type 2 expression libraries with swine convalesecent sera in our former research. We detected the distribution of trag in different Streptococcus suis isolates and identify the differential expression of the new infection-related factor between in vivo and in vitro condition. According to the sequence of trag of North American strain 89/1591, a pair of primers were designed to detect the distribution of trag in total 43 SS isolates. Another pair of primers were designed to amplify the ORF of trag of 5 SS representive strains (ZY05719, HA9801, 98012, SH040805, SH040917). Partial gene of trag was cloned and inserted into expression vector pET28a(+), and induced by IPTG to express recombinant TRAG. The recombinant protein was probed with swine convalescent sera and immune sera respectively. The trag was detected in the most of SS2 isolates (30/32), in SS9 isolates (4/6), and 1 isolate of SS7, while it was not found in SS2 European strain ATCC43765, avirulent strain SS2 T15, 1 isolates of SS1, 1 isolates of SS1/2 and 2 isolates of group C streptococcal strains from pigs. Comparisons between the sequences of TRAG of 5 isolates with that of SS isolates, showed a high homology (>97%) with North American strain 89/1589 and China strains 98HAH33, 05ZYH33. The immunoreactivity was only presented with convalescent sera. The trag was detected from virulent SS isolates but not from avirulent strain, which suggested that this gene may be related to the pathogenicity of SS. The special reactivity was only present with convalescent sera, and it indicated that TRAG might play a role during SS2 invasive course.

Analysis of the Transcriptome of Erigeron breviscapus Uncovers Putative Scutellarin and Chlorogenic Acids Biosynthetic Genes and Genetic Markers

PubMed Central

Zhang, Jia-Jin; Shu, Li-Ping; Zhang, Wei; Long, Guang-Qiang; Liu, Tao; Meng, Zheng-Gui; Chen, Jun-Wen; Yang, Sheng-Chao

2014-01-01

Background Erigeron breviscapus (Vant.) Hand-Mazz. is a famous medicinal plant. Scutellarin and chlorogenic acids are the primary active components in this herb. However, the mechanisms of biosynthesis and regulation for scutellarin and chlorogenic acids in E. breviscapus are considerably unknown. In addition, genomic information of this herb is also unavailable. Principal Findings Using Illumina sequencing on GAIIx platform, a total of 64,605,972 raw sequencing reads were generated and assembled into 73,092 non-redundant unigenes. Among them, 44,855 unigenes (61.37%) were annotated in the public databases Nr, Swiss-Prot, KEGG, and COG. The transcripts encoding the known enzymes involved in flavonoids and in chlorogenic acids biosynthesis were discovered in the Illumina dataset. Three candidate cytochrome P450 genes were discovered which might encode flavone 6-hydroase converting apigenin to scutellarein. Furthermore, 4 unigenes encoding the homologues of maize P1 (R2R3-MYB transcription factors) were defined, which might regulate the biosynthesis of scutellarin. Additionally, a total of 11,077 simple sequence repeat (SSR) were identified from 9,255 unigenes. Of SSRs, tri-nucleotide motifs were the most abundant motif. Thirty-six primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism. The result revealed that 34 (94.40%) primer pairs were successfully amplified and 19 (52.78%) primer pairs exhibited polymorphisms. Conclusion Using next generation sequencing (NGS) technology, this study firstly provides abundant genomic data for E. breviscapus. The candidate genes involved in the biosynthesis and transcriptional regulation of scutellarin and chlorogenic acids were obtained in this study. Additionally, a plenty of genetic makers were generated by identification of SSRs, which is a powerful tool for molecular breeding and genetics applications in this herb. PMID:24956277

Analysis of the transcriptome of Erigeron breviscapus uncovers putative scutellarin and chlorogenic acids biosynthetic genes and genetic markers.

PubMed

Jiang, Ni-Hao; Zhang, Guang-Hui; Zhang, Jia-Jin; Shu, Li-Ping; Zhang, Wei; Long, Guang-Qiang; Liu, Tao; Meng, Zheng-Gui; Chen, Jun-Wen; Yang, Sheng-Chao

2014-01-01

Erigeron breviscapus (Vant.) Hand-Mazz. is a famous medicinal plant. Scutellarin and chlorogenic acids are the primary active components in this herb. However, the mechanisms of biosynthesis and regulation for scutellarin and chlorogenic acids in E. breviscapus are considerably unknown. In addition, genomic information of this herb is also unavailable. Using Illumina sequencing on GAIIx platform, a total of 64,605,972 raw sequencing reads were generated and assembled into 73,092 non-redundant unigenes. Among them, 44,855 unigenes (61.37%) were annotated in the public databases Nr, Swiss-Prot, KEGG, and COG. The transcripts encoding the known enzymes involved in flavonoids and in chlorogenic acids biosynthesis were discovered in the Illumina dataset. Three candidate cytochrome P450 genes were discovered which might encode flavone 6-hydroase converting apigenin to scutellarein. Furthermore, 4 unigenes encoding the homologues of maize P1 (R2R3-MYB transcription factors) were defined, which might regulate the biosynthesis of scutellarin. Additionally, a total of 11,077 simple sequence repeat (SSR) were identified from 9,255 unigenes. Of SSRs, tri-nucleotide motifs were the most abundant motif. Thirty-six primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism. The result revealed that 34 (94.40%) primer pairs were successfully amplified and 19 (52.78%) primer pairs exhibited polymorphisms. Using next generation sequencing (NGS) technology, this study firstly provides abundant genomic data for E. breviscapus. The candidate genes involved in the biosynthesis and transcriptional regulation of scutellarin and chlorogenic acids were obtained in this study. Additionally, a plenty of genetic makers were generated by identification of SSRs, which is a powerful tool for molecular breeding and genetics applications in this herb.

Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material

PubMed Central

Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.

2000-01-01

A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384

Massive dominance of Epsilonproteobacteria in formation waters from a Canadian oil sands reservoir containing severely biodegraded oil

PubMed Central

Hubert, Casey R J; Oldenburg, Thomas B P; Fustic, Milovan; Gray, Neil D; Larter, Stephen R; Penn, Kevin; Rowan, Arlene K; Seshadri, Rekha; Sherry, Angela; Swainsbury, Richard; Voordouw, Gerrit; Voordouw, Johanna K; Head, Ian M

2012-01-01

Summary The subsurface microbiology of an Athabasca oil sands reservoir in western Canada containing severely biodegraded oil was investigated by combining 16S rRNA gene- and polar lipid-based analyses of reservoir formation water with geochemical analyses of the crude oil and formation water. Biomass was filtered from formation water, DNA was extracted using two different methods, and 16S rRNA gene fragments were amplified with several different primer pairs prior to cloning and sequencing or community fingerprinting by denaturing gradient gel electrophoresis (DGGE). Similar results were obtained irrespective of the DNA extraction method or primers used. Archaeal libraries were dominated by Methanomicrobiales (410 of 414 total sequences formed a dominant phylotype affiliated with a Methanoregula sp.), consistent with the proposed dominant role of CO2-reducing methanogens in crude oil biodegradation. In two bacterial 16S rRNA clone libraries generated with different primer pairs, > 99% and 100% of the sequences were affiliated with Epsilonproteobacteria (n = 382 and 72 total clones respectively). This massive dominance of Epsilonproteobacteria sequences was again obtained in a third library (99% of sequences; n = 96 clones) using a third universal bacterial primer pair (inosine-341f and 1492r). Sequencing of bands from DGGE profiles and intact polar lipid analyses were in accordance with the bacterial clone library results. Epsilonproteobacterial OTUs were affiliated with Sulfuricurvum, Arcobacter and Sulfurospirillum spp. detected in other oil field habitats. The dominant organism revealed by the bacterial libraries (87% of all sequences) is a close relative of Sulfuricurvum kujiense – an organism capable of oxidizing reduced sulfur compounds in crude oil. Geochemical analysis of organic extracts from bitumen at different reservoir depths down to the oil water transition zone of these oil sands indicated active biodegradation of dibenzothiophenes, and stable sulfur isotope ratios for elemental sulfur and sulfate in formation waters were indicative of anaerobic oxidation of sulfur compounds. Microbial desulfurization of crude oil may be an important metabolism for Epsilonproteobacteria indigenous to oil reservoirs with elevated sulfur content and may explain their prevalence in formation waters from highly biodegraded petroleum systems. PMID:21824242

Microsatellite Markers for Raspberries and Blackberries

USDA-ARS?s Scientific Manuscript database

Twelve microsatellites were isolated from SSR-enriched genomic libraries of Rubus idaeus L.‘Meeker’ red raspberry (diploid) and R. loganobaccus L. H. Bailey ‘Marion’ blackberry-raspberry hybrid (hexaploid). These primer pairs, with the addition of one developed from a GenBank R. idaeus sequence, w...

An evaluation of a new approach to the regeneration of Helichrysum italicum (Roth) G. Don, and the molecular characterization of the variation among sets of differently derived regenerants.

PubMed

Perrini, Rosaria; Alba, Vittorio; Ruta, Claudia; Morone-Fortunato, Irene; Blanco, Antonio; Montemurro, Cinzia

2009-01-01

A protocol for the induction of regeneration from leaves of Helichrysum italicum was established. Calli were found to form on the basal medium only when it was supplemented with thidiazuron (TDZ) alone or in combination with naphthalene acetic acid (NAA), with a percentage ranking of at least 80%. The hormone-free medium showed the highest percentage of shoot regeneration (62%) even though no callus formed. AFLP markers were employed to verify tissue culture-induced variation in the regenerated plantlets obtained by direct shoot regeneration or the indirect shoot regeneration process (callus formation). Seven out of the eleven AFLP primer pairs yielded polymorphic patterns. The average number of fragments per primer pair was 64.1. Singletons were represented by 12 (2.7%) fragments. Student's T-test was performed both on the average number of shared fragments and on the nucleotide diversity, and no significant statistical difference was observed between the two regeneration treatments.

GST-PRIME: an algorithm for genome-wide primer design.

PubMed

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

DTIC Science & Technology

2007-05-08

deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.

PubMed

Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R

2001-04-01

A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.

Analysis of genetic diversity and population structure of oil palm (Elaeis guineensis) from China and Malaysia based on species-specific simple sequence repeat markers.

PubMed

Zhou, L X; Xiao, Y; Xia, W; Yang, Y D

2015-12-08

Genetic diversity and patterns of population structure of the 94 oil palm lines were investigated using species-specific simple sequence repeat (SSR) markers. We designed primers for 63 SSR loci based on their flanking sequences and conducted amplification in 94 oil palm DNA samples. The amplification result showed that a relatively high level of genetic diversity was observed between oil palm individuals according a set of 21 polymorphic microsatellite loci. The observed heterozygosity (Ho) was 0.3683 and 0.4035, with an average of 0.3859. The Ho value was a reliable determinant of the discriminatory power of the SSR primer combinations. The principal component analysis and unweighted pair-group method with arithmetic averaging cluster analysis showed the 94 oil palm lines were grouped into one cluster. These results demonstrated that the oil palm in Hainan Province of China and the germplasm introduced from Malaysia may be from the same source. The SSR protocol was effective and reliable for assessing the genetic diversity of oil palm. Knowledge of the genetic diversity and population structure will be crucial for establishing appropriate management stocks for this species.

Multiplex PCR for diagnosis of Theileria uilenbergi, Theileria luwenshuni, and Theileria ovis in small ruminants.

PubMed

Zhang, Xiao; Liu, Zhijie; Yang, Jifei; Chen, Ze; Guan, Guiquan; Ren, Qiaoyun; Liu, Aihong; Luo, Jianxun; Yin, Hong; Li, Youquan

2014-02-01

Infections with Theileria sp. may cause significant economic losses to the sheep industry. Species identification based on microscopic examination is difficult, and more suitable methods are required for the rapid detection and identification of Theileria sp, in clinical specimens. In this study, a multiplex polymerase chain reaction (mPCR) assay was developed to simultaneously identify three individual Theileria species in small ruminants. Three pairs of specific, sensitive primers were designed on the basis of the 5.8S ribosomal RNA gene (Theileria luwenshuni and Theileria ovis) and the 18S ribosomal RNA gene (Theileria uilenbergi) to generate target products of 303, 884, and 530 bp, respectively. Standard DNA for each of the three species was extracted from blood recovered from infected sheep, and a preliminary study was conducted on 56 sheep to verify the reliability of the system. Optimal PCR conditions, including primer concentration, annealing time, and the number of amplification cycles, were established. The assay sensitivity under these conditions was 10(-3) % parasitemia, and its specificity was 100 %. The results of the study suggest that mPCR represents a simple, efficient test method as a practical alternative for the rapid detection and identification of Theileria species in small ruminants.

Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

PubMed

Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

2009-01-01

A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

Transferability of microsatellite markers of Capsicum annuum L. to C. frutescens L. and C. chinense Jacq.

PubMed

Carvalho, S I C; Ragassi, C F; Oliveira, I B; Amaral, Z P S; Reifschneider, F J B; Faleiro, F G; Buso, G S C

2015-07-17

In order to support further genetic, diversity, and phylogeny studies of Capsicum species, the transferability of a Capsicum annuum L. simple sequence repeat (SSR) microsatellite set was analyzed for C. frutescens L. ("malagueta" and "tabasco" peppers) and C. chinense Jacq. (smell peppers, among other types). A total of 185 SSR primers were evaluated in 12 accessions from 115 C. frutescens L. and 480 C. chinense Jacq, representing different types within each species. Transferability to C. frutescens L. and C. chinense Jacq. occurred for 116 primers (62.7%). Nineteen (16.37%) were polymorphic in C. frutescens L. and 36 (31.03%) in C. chinense Jacq., 17 of which were coincident and could be used to analyze samples obtained for the 2 species. Among these primers, CA49 showed a different amplitude range of alleles between the 2 species (130-132 base pairs for C. frutescens L. and 120-128 base pairs for C. chinense Jacq.), and could differentiate the species. A total of 55 alleles were identified among the 19 polymorphic SSR loci among accessions of C. frutescens L., with the number of alleles per locus ranging from 2 to 5, a mean of 2.89, and the polymorphic information content ranging from 0.30 to 0.65. The number of alleles identified in C. chinense Jacq. was 119, ranging from 2 to 5 alleles per locus, an average of 3.30, and polymorphic information content from 0.19 to 0.68. The C. annuum L. SSR primers were most often transfer-able and polymorphic for C. frutescens L. and C. chinense Jacq., and we present a set of SSR for each species.

Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

PubMed

Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

2012-01-01

An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.

Isolation and characterization of novel microsatellite markers and their application for diversity assessment in cultivated groundnut (Arachis hypogaea)

PubMed Central

Cuc, Luu M; Mace, Emma S; Crouch, Jonathan H; Quang, Vu D; Long, Tran D; Varshney, Rajeev K

2008-01-01

Background Cultivated peanut or groundnut (Arachis hypogaea L.) is the fourth most important oilseed crop in the world, grown mainly in tropical, subtropical and warm temperate climates. Due to its origin through a single and recent polyploidization event, followed by successive selection during breeding efforts, cultivated groundnut has a limited genetic background. In such species, microsatellite or simple sequence repeat (SSR) markers are very informative and useful for breeding applications. The low level of polymorphism in cultivated germplasm, however, warrants a need of larger number of polymorphic microsatellite markers for cultivated groundnut. Results A microsatellite-enriched library was constructed from the genotype TMV2. Sequencing of 720 putative SSR-positive clones from a total of 3,072 provided 490 SSRs. 71.2% of these SSRs were perfect type, 13.1% were imperfect and 15.7% were compound. Among these SSRs, the GT/CA repeat motifs were the most common (37.6%) followed by GA/CT repeat motifs (25.9%). The primer pairs could be designed for a total of 170 SSRs and were optimized initially on two genotypes. 104 (61.2%) primer pairs yielded scorable amplicon and 46 (44.2%) primers showed polymorphism among 32 cultivated groundnut genotypes. The polymorphic SSR markers detected 2 to 5 alleles with an average of 2.44 per locus. The polymorphic information content (PIC) value for these markers varied from 0.12 to 0.75 with an average of 0.46. Based on 112 alleles obtained by 46 markers, a phenogram was constructed to understand the relationships among the 32 genotypes. Majority of the genotypes representing subspecies hypogaea were grouped together in one cluster, while the genotypes belonging to subspecies fastigiata were grouped mainly under two clusters. Conclusion Newly developed set of 104 markers extends the repertoire of SSR markers for cultivated groundnut. These markers showed a good level of PIC value in cultivated germplasm and therefore would be very useful for germplasm analysis, linkage mapping, diversity studies and phylogenetic relationships in cultivated groundnut as well as related Arachis species. PMID:18482440

DRDB: An Online Date Palm Genomic Resource Database.

PubMed

He, Zilong; Zhang, Chengwei; Liu, Wanfei; Lin, Qiang; Wei, Ting; Aljohi, Hasan A; Chen, Wei-Hua; Hu, Songnian

2017-01-01

Background: Date palm ( Phoenix dactylifera L.) is a cultivated woody plant with agricultural and economic importance in many countries around the world. With the advantages of next generation sequencing technologies, genome sequences for many date palm cultivars have been released recently. Short sequence repeat (SSR) and single nucleotide polymorphism (SNP) can be identified from these genomic data, and have been proven to be very useful biomarkers in plant genome analysis and breeding. Results: Here, we first improved the date palm genome assembly using 130X of HiSeq data generated in our lab. Then 246,445 SSRs (214,901 SSRs and 31,544 compound SSRs) were annotated in this genome assembly; among the SSRs, mononucleotide SSRs (58.92%) were the most abundant, followed by di- (29.92%), tri- (8.14%), tetra- (2.47%), penta- (0.36%), and hexa-nucleotide SSRs (0.19%). The high-quality PCR primer pairs were designed for most (174,497; 70.81% out of total) SSRs. We also annotated 6,375,806 SNPs with raw read depth≥3 in 90% cultivars. To further reduce false positive SNPs, we only kept 5,572,650 (87.40% out of total) SNPs with at least 20% cultivars support for downstream analyses. The high-quality PCR primer pairs were also obtained for 4,177,778 (65.53%) SNPs. We reconstructed the phylogenetic relationships among the 62 cultivars using these variants and found that they can be divided into three clusters, namely North Africa, Egypt - Sudan, and Middle East - South Asian, with Egypt - Sudan being the admixture of North Africa and Middle East - South Asian cultivars; we further confirmed these clusters using principal component analysis. Moreover, 34,346 SSRs and 4,177,778 SNPs with PCR primers were assigned to shared cultivars for cultivar classification and diversity analysis. All these SSRs, SNPs and their classification are available in our database, and can be used for cultivar identification, comparison, and molecular breeding. Conclusion: DRDB is a comprehensive genomic resource database of date palm. It can serve as a bioinformatics platform for date palm genomics, genetics, and molecular breeding. DRDB is freely available at http://drdb.big.ac.cn/home.

DRDB: An Online Date Palm Genomic Resource Database

PubMed Central

He, Zilong; Zhang, Chengwei; Liu, Wanfei; Lin, Qiang; Wei, Ting; Aljohi, Hasan A.; Chen, Wei-Hua; Hu, Songnian

2017-01-01

Background: Date palm (Phoenix dactylifera L.) is a cultivated woody plant with agricultural and economic importance in many countries around the world. With the advantages of next generation sequencing technologies, genome sequences for many date palm cultivars have been released recently. Short sequence repeat (SSR) and single nucleotide polymorphism (SNP) can be identified from these genomic data, and have been proven to be very useful biomarkers in plant genome analysis and breeding. Results: Here, we first improved the date palm genome assembly using 130X of HiSeq data generated in our lab. Then 246,445 SSRs (214,901 SSRs and 31,544 compound SSRs) were annotated in this genome assembly; among the SSRs, mononucleotide SSRs (58.92%) were the most abundant, followed by di- (29.92%), tri- (8.14%), tetra- (2.47%), penta- (0.36%), and hexa-nucleotide SSRs (0.19%). The high-quality PCR primer pairs were designed for most (174,497; 70.81% out of total) SSRs. We also annotated 6,375,806 SNPs with raw read depth≥3 in 90% cultivars. To further reduce false positive SNPs, we only kept 5,572,650 (87.40% out of total) SNPs with at least 20% cultivars support for downstream analyses. The high-quality PCR primer pairs were also obtained for 4,177,778 (65.53%) SNPs. We reconstructed the phylogenetic relationships among the 62 cultivars using these variants and found that they can be divided into three clusters, namely North Africa, Egypt – Sudan, and Middle East – South Asian, with Egypt – Sudan being the admixture of North Africa and Middle East – South Asian cultivars; we further confirmed these clusters using principal component analysis. Moreover, 34,346 SSRs and 4,177,778 SNPs with PCR primers were assigned to shared cultivars for cultivar classification and diversity analysis. All these SSRs, SNPs and their classification are available in our database, and can be used for cultivar identification, comparison, and molecular breeding. Conclusion: DRDB is a comprehensive genomic resource database of date palm. It can serve as a bioinformatics platform for date palm genomics, genetics, and molecular breeding. DRDB is freely available at http://drdb.big.ac.cn/home. PMID:29209336

Development of microsatellite markers of vandaceous orchids for species and variety identification.

PubMed

Peyachoknagul, S; Nettuwakul, C; Phuekvilai, P; Wannapinpong, S; Srikulnath, K

2014-07-24

Vandaceous orchids are a group of orchid genera in the subfamily Vandoideae. Among this group, Mokara, Phalaenopsis, and Vanda are the most popular and commercially important orchids in Thailand. Novel microsatellite markers were developed from Mokara, the intergeneric hybrid from 3 genera Vanda, Ascocentrum, and Arachnis by using enriched method. Six primers from this study plus one primer previously developed from Vanda genome, a total of 7 markers, were selected to characterize 4 orchid genera (Mokara, Vanda, Rhynchostylis, and Ascocenda). The observed and expected heterozygosities varied in the 4 genera from 0.0000-1.0000 and 0.0000-0.8765, respectively. The transferability of these primers was also investigated in 76 vandaceous orchids from 12 genera. Three primer pairs, MOK26, MOK29, and MOK62, could successfully amplify the DNA of all samples, while MOK103 could be used with most of the samples. The total number of alleles from 76 samples ranged from 3 to 19 alleles per locus, with an average of 8.5714. Therefore, these markers could be used for variety/ species identification, certification and protection, genetic diversity, and evolutionary studies.

Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

PubMed

Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

2017-04-05

Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Development of SSR markers from Citrus clementina (Rutaceae) BAC end sequences and interspecific transferability in Citrus.

PubMed

Ollitrault, Frédérique; Terol, Javier; Pina, Jose Antonio; Navarro, Luis; Talon, Manuel; Ollitrault, Patrick

2010-11-01

Microsatellite primers were developed from bacterial artificial chromosome (BAC) end sequences of Citrus clementina and their transferability and polymorphism tested in the genus Citrus for future anchorage of physical and genetic maps and comparative interspecific genetic mapping. • Using PAGE and DNA silver staining, 79 primer pairs were selected for their transferability and polymorphism among 526 microsatellites mined in BES. A preliminary diversity study in Citrus was conducted with 18 of them, in C. reticulata, C. maxima, C. medica, C. sinensis, C. aurantium, C. paradisi, C. lemon, C. aurantifolia, and some papedas (wild citrus), using a capillary electrophoresis fragment analyzer. Intra- and interspecific polymorphism was observed, and heterozygous markers were identified for the different genotypes to be used for genetic mapping. • These results indicate the utility of the developed primers for comparative mapping studies and the integration of physical and genetic maps.

Development of EST-SSR markers for Elaeocarpus photiniifolia (Elaeocarpaceae), an endemic taxon of the Bonin Islands.

PubMed

Sugai, Kyoko; Setsuko, Suzuki; Uchiyama, Kentaro; Murakami, Noriaki; Kato, Hidetoshi; Yoshimaru, Hiroshi

2012-02-01

Expressed sequence tag (EST)-derived microsatellite markers were developed for Elaeocarpus photiniifolia, an endemic taxon of the Bonin Islands. Initially, a complementary DNA (cDNA) library was constructed by de novo pyrosequencing of total RNA extracted from a seedling. A total of 267 primer pairs were designed from the library. Of the 48 tested loci, 25 loci were polymorphic among 41 individuals representing the entire geographical range of the species, with the number of alleles per locus and expected heterozygosity ranging from two to 14 and 0.09 to 0.86, respectively. Most loci were transferable to a related species, E. sylvestris. The developed markers will be useful for evaluating the genetic structure of E. photiniifolia.

Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

DTIC Science & Technology

2015-08-01

preload bolt and breech, and between the breech and chamber, were found to be too loose. When heavy grease or Teflon tape was used to tighten the...increase the difficulty of removing and tightening the breech. The preload bolt does not have to be removed between firing and in future designs could use... tightened it could loosen the primer plate, so left-handed threads were machined on the primer plate. The ballistic simulator fixture was occasionally

A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

PubMed

Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2017-02-01

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.

An efficient method to find potentially universal population genetic markers, applied to metazoans

PubMed Central

2010-01-01

Background Despite the impressive growth of sequence databases, the limited availability of nuclear markers that are sufficiently polymorphic for population genetics and phylogeography and applicable across various phyla restricts many potential studies, particularly in non-model organisms. Numerous introns have invariant positions among kingdoms, providing a potential source for such markers. Unfortunately, most of the few known EPIC (Exon Primed Intron Crossing) loci are restricted to vertebrates or belong to multigenic families. Results In order to develop markers with broad applicability, we designed a bioinformatic approach aimed at avoiding multigenic families while identifying intron positions conserved across metazoan phyla. We developed a program facilitating the identification of EPIC loci which allowed slight variation in intron position. From the Homolens databases we selected 29 gene families which contained 52 promising introns for which we designed 93 primer pairs. PCR tests were performed on several ascidians, echinoderms, bivalves and cnidarians. On average, 24 different introns per genus were amplified in bilaterians. Remarkably, five of the introns successfully amplified in all of the metazoan genera tested (a dozen genera, including cnidarians). The influence of several factors on amplification success was investigated. Success rate was not related to the phylogenetic relatedness of a taxon to the groups that most influenced primer design, showing that these EPIC markers are extremely conserved in animals. Conclusions Our new method now makes it possible to (i) rapidly isolate a set of EPIC markers for any phylum, even outside the animal kingdom, and thus, (ii) compare genetic diversity at potentially homologous polymorphic loci between divergent taxa. PMID:20836842

Multiplex primer prediction software for divergent targets

PubMed Central

Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

2009-01-01

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

PubMed

Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

2015-03-20

USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

PubMed

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

PubMed Central

2018-01-01

Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

PubMed Central

Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

2003-01-01

A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

Isolation and characterization of microsatellite markers for carolina hemlock (Tsuga caroliniana)

Treesearch

S.A. Josserand; K.M. Potter; C.S. Echt; C.D. Nelson

2008-01-01

We describe the isolation and characterization of 31 polymorphic di- and trinucleotide microsatellite marker loci for Carolina hemlock (Tsuga caroliniana Englem.). In addition, primer pairs for 16 loci amplified scoreable alleles in six other Euga species. In eastern North America, both Carolina hemlock and eastern hemlock (Tsuga canadensis...

Allelic divergence and cultivar-specific SSR alleles revealed by capillary electrophoresis using fluorescence-labeled SSR markers in sugarcane

USDA-ARS?s Scientific Manuscript database

Though sugarcane cultivars (Saccharum spp. hybrids) are complex aneu-polyploid hybrids, genetic evaluation and tracking of clone- or cultivar-specific alleles become possible due to capillary electrophoregrams (CE) using fluorescence-labeled SSR primer pairs. Twenty-four sugarcane cultivars, 12 each...

Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification

PubMed Central

Guo, Xu-Guang; Zhou, Shan

2014-01-01

Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

PubMed

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

Development of a novel molecular detection method for clustered regularly interspaced short palindromic repeats (CRISPRs) in Taylorella organisms.

PubMed

Hara, Yasushi; Nakajima, Takuya; Akamatsu, Marie; Yahiro, Motoki; Kagawa, Shizuko; Petry, Sandrine; Matsuda, Motoo; Moore, John E

2015-07-01

Contagious equine metritis is a bacterial infectious disease of horses caused by Taylorella equigenitalis, a Gram-negative eubacterium. The disease has been described in several continents, including Europe, North America and Asia. A novel molecular method was developed to detect clustered regularly interspaced short palindromic repeats (CRISPRs), which were separated by non-repetitive unique spacer regions (NRUSRs) of similar length, in the Taylorella equigenitalis EQ59 strain using a primer pair, f-/r-TeCRISPR-ladder, by PCR amplification. In total, 31 Taylorella isolates (17 T. equigenitalis and 14 Taylorella asinigenitalis) were examined. The T. equigenitalis isolates came from thoroughbred and cold-blooded horses from nine countries during 1980-1996, whilst the T. asinigenitalis isolates all originated from donkey jacks in France and the USA during 1997-2006. PAGE fractionated all of the 13 CRISPRs separated by 12 NRUSRs in T. equigenitalis EQ59. Permutation examples of CRISPRs, which were separated by NRUSRs for small-sized ladders, consisting of two doublet bands were shown. Putative CRISPRs separated by NRUSRs were amplified with 14/17 (82.4 %) geographically disparate T. equigenitalis isolates using the newly designed primer pair. Approximately 82.4 % of the T. equigenitalis isolates had CRISPRs separated by NRUSRs. The CRISPR locus was also found in the French T. asinigenitalis strain MCE3. Putative CRISPRs separated by NRUSRs were detected similarly in 4/14 (28.6 %) T. asinigenitalis isolates. Overall, a more detailed understanding of the molecular biology of CRISPRs within Taylorella organisms may help elucidate the pathogenic virulence and transmission mechanisms associated with this important equine pathogen.

Frequent Detection and Genetic Diversity of Human Bocavirus in Urban Sewage Samples.

PubMed

Iaconelli, M; Divizia, M; Della Libera, S; Di Bonito, P; La Rosa, Giuseppina

2016-12-01

The prevalence and genetic diversity of human bocaviruses (HBoVs) in sewage water samples are largely unknown. In this study, 134 raw sewage samples from 25 wastewater treatment plants (WTPs) in Italy were analyzed by nested PCR and sequencing using species-specific primer pairs and broad-range primer pairs targeting the capsid proteins VP1/VP2. A large number of samples (106, 79.1 %) were positive for HBoV. Out of these, 49 were classified as HBoV species 2, and 27 as species 3. For the remaining 30 samples, sequencing results showed mixed electropherograms. By cloning PCR amplicons and sequencing, we confirmed the copresence of species 2 and 3 in 29 samples and species 2 and 4 in only one sample. A real-time PCR assay was also performed, using a newly designed TaqMan assay, for quantification of HBoVs in sewage water samples. Viral load quantification ranged from 5.51E+03 to 1.84E+05 GC/L (mean value 4.70E+04 GC/L) for bocavirus 2 and from 1.89E+03 to 1.02E+05 GC/L (mean value 2.27E+04 GC/L) for bocavirus 3. The wide distribution of HBoV in sewages suggests that this virus is common in the population, and the most prevalent are the species 2 and 3. HBoV-4 was also found, representing the first detection of this species in Italy. Although there is no indication of waterborne transmission for HBoV, the significant presence in sewage waters suggests that HBoV may spread to other water environments, and therefore, a potential role of water in the HBoV transmission should not be neglected.

Development and Identification of SSR Markers Associated with Starch Properties and β-Carotene Content in the Storage Root of Sweet Potato (Ipomoea batatas L.)

PubMed Central

Zhang, Kai; Wu, Zhengdan; Tang, Daobin; Lv, Changwen; Luo, Kai; Zhao, Yong; Liu, Xun; Huang, Yuanxin; Wang, Jichun

2016-01-01

Sweet potato (Ipomoea batatas L.) is a nutritious food crop and, based on the high starch content of its storage root, a potential bioethanol feedstock. Enhancing the nutritional value and starch quantity of storage roots are important goals of sweet potato breeding programs aimed at developing improved varieties for direct consumption, processing, and industrial uses. However, developing improved lines of sweet potato is challenging due to the genetic complexity of this plant and the lack of genome information. Short sequence repeat (SSR) markers are powerful molecular tools for tracking important loci in crops and for molecular-based breeding strategies; however, few SSR markers and marker-trait associations have hitherto been identified in sweet potato. In this study, we identified 1824 SSRs by using a de novo assembly of publicly available ESTs and mRNAs in sweet potato, and designed 1476 primer pairs based on SSR-containing sequences. We mapped 214 pairs of primers in a natural population comprised of 239 germplasms, and identified 1278 alleles with an average of 5.972 alleles per locus and a major allele frequency of 0.7702. Population structure analysis revealed two subpopulations in this panel of germplasms, and phenotypic characterization demonstrated that this panel is suitable for association mapping of starch-related traits. We identified 32, 16, and 17 SSR markers associated with starch content, β-carotene content, and starch composition in the storage root, respectively, using association analysis and further evaluation of a subset of sweet potato genotypes with various characteristics. The SSR markers identified here can be used to select varieties with desired traits and to investigate the genetic mechanism underlying starch and carotenoid formation in the starchy roots of sweet potato. PMID:26973669

A phytoplasma closely related to the pigeon pea witches'-broom phytoplasma (16Sr IX) is associated with citrus huanglongbing symptoms in the state of São Paulo, Brazil.

PubMed

Teixeira, D C; Wulff, N A; Martins, E C; Kitajima, E W; Bassanezi, R; Ayres, A J; Eveillard, S; Saillard, C; Bové, J M

2008-09-01

In February 2007, sweet orange trees with characteristic symptoms of huanglongbing (HLB) were encountered in a region of São Paulo state (SPs) hitherto free of HLB. These trees tested negative for the three liberibacter species associated with HLB. A polymerase chain reaction (PCR) product from symptomatic fruit columella DNA amplifications with universal primers fD1/rP1 was cloned and sequenced. The corresponding agent was found to have highest 16S rDNA sequence identity (99%) with the pigeon pea witches'-broom phytoplasma of group 16Sr IX. Sequences of PCR products obtained with phytoplasma 16S rDNA primer pairs fU5/rU3, fU5/P7 confirm these results. With two primers D7f2/D7r2 designed based on the 16S rDNA sequence of the cloned DNA fragment, positive amplifications were obtained from more than one hundred samples including symptomatic fruits and blotchy mottle leaves. Samples positive for phytoplasmas were negative for liberibacters, except for four samples, which were positive for both the phytoplasma and 'Candidatus Liberibacter asiaticus'. The phytoplasma was detected by electron microscopy in the sieve tubes of midribs from symptomatic leaves. These results show that a phytoplasma of group IX is associated with citrus HLB symptoms in northern, central, and southern SPs. This phytoplasma has very probably been transmitted to citrus from an external source of inoculum, but the putative insect vector is not yet known.

A multiplex PCR for detection of six viruses in ducks.

PubMed

Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

2017-10-01

In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

Selection, trans-species polymorphism, and locus identification of major histocompatibility complex class IIβ alleles of New World ranid frogs

USGS Publications Warehouse

Kiemnec-Tyburczy, Karen M.; Richmond, Jonathan Q.; Savage, Anna E.; Zamudio, Kelly R.

2010-01-01

Genes encoded by the major histocompatibility complex (MHC) play key roles in the vertebrate immune system. However, our understanding of the evolutionary processes and underlying genetic mechanisms shaping these genes is limited in many taxa, including amphibians, a group currently impacted by emerging infectious diseases. To further elucidate the evolution of the MHC in frogs (anurans) and develop tools for population genetics, we surveyed allelic diversity of the MHC class II ??1 domain in both genomic and complementary DNA of seven New World species in the genus Rana (Lithobates). To assign locus affiliation to our alleles, we used a "gene walking" technique to obtain intron 2 sequences that flanked MHC class II?? exon 2. Two distinct intron sequences were recovered, suggesting the presence of at least two class II?? loci in Rana. We designed a primer pair that successfully amplified an orthologous locus from all seven Rana species. In total, we recovered 13 alleles and documented trans-species polymorphism for four of the alleles. We also found quantitative evidence of selection acting on amino acid residues that are putatively involved in peptide binding and structural stability of the ??1 domain of anurans. Our results indicated that primer mismatch can result in polymerase chain reaction (PCR) bias, which influences the number of alleles that are recovered. Using a single locus may minimize PCR bias caused by primer mismatch, and the gene walking technique was an effective approach for generating single-copy orthologous markers necessary for future studies of MHC allelic variation in natural amphibian populations. ?? 2010 Springer-Verlag.

Typing of Intimin Genes in Human and Animal Enterohemorrhagic and Enteropathogenic Escherichia coli: Characterization of a New Intimin Variant

PubMed Central

Oswald, E.; Schmidt, H.; Morabito, S.; Karch, H.; Marchès, O.; Caprioli, A.

2000-01-01

Enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC) produce the characteristic “attaching and effacing” (A/E) lesion of the brush border. Intimin, an outer membrane protein encoded by eae, is responsible for the tight association of both pathogens with the host cell. Several eae have been cloned from different EPEC and EHEC strains isolated from humans and animals. These sequences are conserved in the N-terminal region but highly variable in the last C-terminal 280 amino acids (aa), where the cell binding activity is localized. Based on these considerations, we developed a panel of specific primers to investigate the eae heterogeneity of the variable 3′ region by using PCR amplification. We then investigated the distribution of the known intimin types in a large collection of EPEC and EHEC strains isolated from humans and different animal species. The existence of a yet-unknown family of intimin was suspected because several EHEC strains, isolated from human and cattle, did not react with any of the specific primer pairs, although these strains were eae positive when primers amplifying the conserved 5′ end were used. We then cloned and sequenced the eae present in one of these strains (EHEC of serotype O103:H2) and subsequently designed a PCR primer that recognizes in a specific manner the variable 3′ region of this new intimin type. This intimin, referred to as “ɛ,” was present in human and bovine EHEC strains of serogroups O8, O11, O45, O103, O121, and O165. Intimin ɛ is the largest intimin cloned to date (948 aa) and shares the greatest overall sequence identity with intimin β, although analysis of the last C-terminal 280 aa suggests a greater similarity with intimins α and γ. PMID:10603369

Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

PubMed

Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2016-09-01

Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

Detection of Naegleria Species in Environmental Samples from Peninsular Malaysia

PubMed Central

Ithoi, Init; Ahmad, Arine Fadzlun; Nissapatorn, Veeranoot; Lau, Yee Ling; Mahmud, Rohela; Mak, Joon Wah

2011-01-01

Background In Malaysia, researchers and medical practitioners are unfamiliar with Naegleria infections. Thus little is known about the existence of pathogenic Naegleria fowleri, and the resultant primary amoebic meningoencephalitis (PAM) is seldom included in the differential diagnosis of central nervous system infections. This study was conducted to detect the presence of Naegleria species in various environmental samples. Methods/Findings A total of 41 Naegleria-like isolates were isolated from water and dust samples. All these isolates were subjected to PCR using two primer sets designed from the ITS1-ITS2 regions. The N. fowleri species-specific primer set failed to produce the expected amplicon. The Naegleria genus-specific primers produced amplicons of 408 bp (35), 450 bp (2), 457 bp (2) or 381 bp (2) from all 41 isolates isolated from aquatic (33) and dust (8) samples. Analysis of the sequences from 10 representative isolates revealed that amplicons with fragments 408, 450 and 457 bp showed homology with non-pathogenic Naegleria species, and 381 bp showed homology with Vahlkampfia species. These results concurred with the morphological observation that all 39 isolates which exhibited flagella were Naegleria, while 2 isolates (AC7, JN034055 and AC8, JN034056) that did not exhibit flagella were Vahlkampfia species. Conclusion To date, pathogenic species of N. fowleri have not been isolated from Malaysia. All 39 isolates that produced amplicons (408, 450 and 457 bp) from the genus-specific primers were identified as being similar to nonpathogenic Naegleria. Amplicon 408 bp from 5 representative isolates showed 100% and 99.7% identity to Naegleria philippinensis isolate RJTM (AM167890) and is thus believed to be the most common species in our environment. Amplicons 450 bp and 457 bp were respectively believed to be from 2 new species of Naegleria, since representative isolates showed lower homology and had a longer base pair length when compared to the reference species in the Genbank, Naegleria schusteri (AJ566626) and Naegleria laresi (AJ566630), respectively. PMID:21915311

TipMT: Identification of PCR-based taxon-specific markers.

PubMed

Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

2017-02-11

Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

Comparison of Species Richness Estimates Obtained Using Nearly Complete Fragments and Simulated Pyrosequencing-Generated Fragments in 16S rRNA Gene-Based Environmental Surveys▿ †

PubMed Central

Youssef, Noha; Sheik, Cody S.; Krumholz, Lee R.; Najar, Fares Z.; Roe, Bruce A.; Elshahed, Mostafa S.

2009-01-01

Pyrosequencing-based 16S rRNA gene surveys are increasingly utilized to study highly diverse bacterial communities, with special emphasis on utilizing the large number of sequences obtained (tens to hundreds of thousands) for species richness estimation. However, it is not yet clear how the number of operational taxonomic units (OTUs) and, hence, species richness estimates determined using shorter fragments at different taxonomic cutoffs correlates with the number of OTUs assigned using longer, nearly complete 16S rRNA gene fragments. We constructed a 16S rRNA clone library from an undisturbed tallgrass prairie soil (1,132 clones) and used it to compare species richness estimates obtained using eight pyrosequencing candidate fragments (99 to 361 bp in length) and the nearly full-length fragment. Fragments encompassing the V1 and V2 (V1+V2) region and the V6 region (generated using primer pairs 8F-338R and 967F-1046R) overestimated species richness; fragments encompassing the V3, V7, and V7+V8 hypervariable regions (generated using primer pairs 338F-530R, 1046F-1220R, and 1046F-1392R) underestimated species richness; and fragments encompassing the V4, V5+V6, and V6+V7 regions (generated using primer pairs 530F-805R, 805F-1046R, and 967F-1220R) provided estimates comparable to those obtained with the nearly full-length fragment. These patterns were observed regardless of the alignment method utilized or the parameter used to gauge comparative levels of species richness (number of OTUs observed, slope of scatter plots of pairwise distance values for short and nearly complete fragments, and nonparametric and parametric species richness estimates). Similar results were obtained when analyzing three other datasets derived from soil, adult Zebrafish gut, and basaltic formations in the East Pacific Rise. Regression analysis indicated that these observed discrepancies in species richness estimates within various regions could readily be explained by the proportions of hypervariable, variable, and conserved base pairs within an examined fragment. PMID:19561178

Data in support of qPCR primer design and verification in a Pink1 -/- rat model of Parkinson disease.

PubMed

Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R

2016-09-01

Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

PubMed Central

2012-01-01

Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

PubMed

Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed

2012-08-10

Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Alignment-Free Design of Highly Discriminatory Diagnostic Primer Sets for Escherichia coli O104:H4 Outbreak Strains

PubMed Central

Bielaszewska, Martina; Karch, Helge; Toth, Ian K.

2012-01-01

Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820

Targeting the Mevalonate Pathway to Reduce Mortality from Ovarian Cancer

DTIC Science & Technology

2017-12-01

at cis-regulatory elements such as enhancers to facilitate gene transcription. CRISPR /Cas9- mediated ablation of a putative Meis1 enhancer carrying...Tables S4 and S5. 10 Cancer Cell 30, 1–16, July 11, 2016the CRISPR /Cas9-based genomic editing technology. Cas9 and a pair of single guide RNAs (sgRNA... CRISPR /Cas9-mediated deletio sgMeis1, a pair of sgRNAs that target the DMR boundaries. (N) Sequencing of the genomic PCR products from F2/R2 primers shows

Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

PubMed

Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2013-01-01

Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

PubMed

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-09-29

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

A multiplex primer design algorithm for target amplification of continuous genomic regions.

PubMed

Ozturk, Ahmet Rasit; Can, Tolga

2017-06-19

Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

Reading Assessment: A Primer for Teachers and Tutors.

ERIC Educational Resources Information Center

Caldwell, JoAnne Schudt

This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

Murrinh Nganki (Our Language), 1.

ERIC Educational Resources Information Center

Street, Chester; And Others

This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

GSP: a web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

WGSSAT: A High-Throughput Computational Pipeline for Mining and Annotation of SSR Markers From Whole Genomes.

PubMed

Pandey, Manmohan; Kumar, Ravindra; Srivastava, Prachi; Agarwal, Suyash; Srivastava, Shreya; Nagpure, Naresh S; Jena, Joy K; Kushwaha, Basdeo

2018-03-16

Mining and characterization of Simple Sequence Repeat (SSR) markers from whole genomes provide valuable information about biological significance of SSR distribution and also facilitate development of markers for genetic analysis. Whole genome sequencing (WGS)-SSR Annotation Tool (WGSSAT) is a graphical user interface pipeline developed using Java Netbeans and Perl scripts which facilitates in simplifying the process of SSR mining and characterization. WGSSAT takes input in FASTA format and automates the prediction of genes, noncoding RNA (ncRNA), core genes, repeats and SSRs from whole genomes followed by mapping of the predicted SSRs onto a genome (classified according to genes, ncRNA, repeats, exonic, intronic, and core gene region) along with primer identification and mining of cross-species markers. The program also generates a detailed statistical report along with visualization of mapped SSRs, genes, core genes, and RNAs. The features of WGSSAT were demonstrated using Takifugu rubripes data. This yielded a total of 139 057 SSR, out of which 113 703 SSR primer pairs were uniquely amplified in silico onto a T. rubripes (fugu) genome. Out of 113 703 mined SSRs, 81 463 were from coding region (including 4286 exonic and 77 177 intronic), 7 from RNA, 267 from core genes of fugu, whereas 105 641 SSR and 601 SSR primer pairs were uniquely mapped onto the medaka genome. WGSSAT is tested under Ubuntu Linux. The source code, documentation, user manual, example dataset and scripts are available online at https://sourceforge.net/projects/wgssat-nbfgr.

A new rapid methodological strategy to assess BRCA mutational status.

PubMed

Vuttariello, Emilia; Borra, Marco; Calise, Celeste; Mauriello, Elvira; Greggi, Stefano; Vecchione, Aldo; Biffali, Elio; Chiappetta, Gennaro

2013-07-01

Hereditary cancers account for approximately 10 % of breast and ovarian cancers. Mutations of the BRCA1 and BRCA2 genes, encoding two proteins involved in DNA repair, underlie most cases of such hereditary cancers. Women with BRCA mutations develop breast cancer in 50-80 % of cases and ovarian cancer in 10-40 % of cases. Assessing BRCA mutational status is needed to direct the clinical management of women with predisposition to these hereditary cancers. However, BRCA screening constitutes a bottleneck in terms of costs and time to deliver results. We developed a PCR-based assay using 73 primer pairs covering the entire coding regions of BRCA1 and BRCA2. PCR primers, containing at the 5' end the universal M13 primer sequences, were pre-spotted in 96-well plates. Following PCR, direct sequencing was performed using M13 primers, allowing to standardize the conditions. PCR amplification and sequencing were successful for each amplicon. We tested and validated the assay on 10 known gDNAs from patients with Hereditary breast and ovarian cancer (HBOC). Our strategy is a promising time and cost-effective method to detect BRCA mutations in the clinical setting, which is essential to formulate a personalized therapy for patients with HBOC.

Method for the detection of Salmonella enterica serovar Enteritidis

DOEpatents

Agron, Peter G.; Andersen, Gary L.; Walker, Richard L.

2008-10-28

Described herein is the identification of a novel Salmonella enterica serovar Enteritidis locus that serves as a marker for DNA-based identification of this bacterium. In addition, three primer pairs derived from this locus that may be used in a nucleotide detection method to detect the presence of the bacterium are also disclosed herein.

Development of a multiplex PCR assay for the detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei, Burkholderia thailandensis, and Burkholderia cepacia complex.

PubMed

Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry

2017-10-01

Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.

Permanent genetic resources added to Molecular Ecology Resources Database 1 August 2011-30 September 2011.

PubMed

A'Hara, S W; Amouroux, P; Argo, Emily E; Avand-Faghih, A; Barat, Ashoktaru; Barbieri, Luiz; Bert, Theresa M; Blatrix, R; Blin, Aurélie; Bouktila, D; Broome, A; Burban, C; Capdevielle-Dulac, C; Casse, N; Chandra, Suresh; Cho, Kyung Jin; Cottrell, J E; Crawford, Charles R; Davis, Michelle C; Delatte, H; Desneux, Nicolas; Djieto-Lordon, C; Dubois, M P; El-Mergawy, R A A M; Gallardo-Escárate, C; Garcia, M; Gardiner, Mary M; Guillemaud, Thomas; Haye, P A; Hellemans, B; Hinrichsen, P; Jeon, Ji Hyun; Kerdelhué, C; Kharrat, I; Kim, Ki Hwan; Kim, Yong Yul; Kwan, Ye-Seul; Labbe, Ellen M; LaHood, Eric; Lee, Kyung Mi; Lee, Wan-Ok; Lee, Yat-Hung; Legoff, Isabelle; Li, H; Lin, Chung-Ping; Liu, S S; Liu, Y G; Long, D; Maes, G E; Magnoux, E; Mahanta, Prabin Chandra; Makni, H; Makni, M; Malausa, Thibaut; Matura, Rakesh; McKey, D; McMillen-Jackson, Anne L; Méndez, M A; Mezghani-Khemakhem, M; Michel, Andy P; Paul, Moran; Muriel-Cunha, Janice; Nibouche, S; Normand, F; Palkovacs, Eric P; Pande, Veena; Parmentier, K; Peccoud, J; Piatscheck, F; Puchulutegui, Cecilia; Ramos, R; Ravest, G; Richner, Heinz; Robbens, J; Rochat, D; Rousselet, J; Saladin, Verena; Sauve, M; Schlei, Ora; Schultz, Thomas F; Scobie, A R; Segovia, N I; Seyoum, Seifu; Silvain, J-F; Tabone, Elisabeth; Van Houdt, J K J; Vandamme, S G; Volckaert, F A M; Wenburg, John; Willis, Theodore V; Won, Yong-Jin; Ye, N H; Zhang, W; Zhang, Y X

2012-01-01

This article documents the addition of 299 microsatellite marker loci and nine pairs of single-nucleotide polymorphism (SNP) EPIC primers to the Molecular Ecology Resources (MER) Database. Loci were developed for the following species: Alosa pseudoharengus, Alosa aestivalis, Aphis spiraecola, Argopecten purpuratus, Coreoleuciscus splendidus, Garra gotyla, Hippodamia convergens, Linnaea borealis, Menippe mercenaria, Menippe adina, Parus major, Pinus densiflora, Portunus trituberculatus, Procontarinia mangiferae, Rhynchophorus ferrugineus, Schizothorax richardsonii, Scophthalmus rhombus, Tetraponera aethiops, Thaumetopoea pityocampa, Tuta absoluta and Ugni molinae. These loci were cross-tested on the following species: Barilius bendelisis, Chiromantes haematocheir, Eriocheir sinensis, Eucalyptus camaldulensis, Eucalyptus cladocalix, Eucalyptus globulus, Garra litaninsis vishwanath, Garra para lissorhynchus, Guindilla trinervis, Hemigrapsus sanguineus, Luma chequen. Guayaba, Myrceugenia colchagüensis, Myrceugenia correifolia, Myrceugenia exsucca, Parasesarma plicatum, Parus major, Portunus pelagicus, Psidium guayaba, Schizothorax richardsonii, Scophthalmus maximus, Tetraponera latifrons, Thaumetopoea bonjeani, Thaumetopoea ispartensis, Thaumetopoea libanotica, Thaumetopoea pinivora, Thaumetopoea pityocampa ena clade, Thaumetopoea solitaria, Thaumetopoea wilkinsoni and Tor putitora. This article also documents the addition of nine EPIC primer pairs for Euphaea decorata, Euphaea formosa, Euphaea ornata and Euphaea yayeyamana. © 2011 Blackwell Publishing Ltd.

PlantFuncSSR: Integrating First and Next Generation Transcriptomics for Mining of SSR-Functional Domains Markers

PubMed Central

Sablok, Gaurav; Pérez-Pulido, Antonio J.; Do, Thac; Seong, Tan Y.; Casimiro-Soriguer, Carlos S.; La Porta, Nicola; Ralph, Peter J.; Squartini, Andrea; Muñoz-Merida, Antonio; Harikrishna, Jennifer A.

2016-01-01

Analysis of repetitive DNA sequence content and divergence among the repetitive functional classes is a well-accepted approach for estimation of inter- and intra-generic differences in plant genomes. Among these elements, microsatellites, or Simple Sequence Repeats (SSRs), have been widely demonstrated as powerful genetic markers for species and varieties discrimination. We present PlantFuncSSRs platform having more than 364 plant species with more than 2 million functional SSRs. They are provided with detailed annotations for easy functional browsing of SSRs and with information on primer pairs and associated functional domains. PlantFuncSSRs can be leveraged to identify functional-based genic variability among the species of interest, which might be of particular interest in developing functional markers in plants. This comprehensive on-line portal unifies mining of SSRs from first and next generation sequencing datasets, corresponding primer pairs and associated in-depth functional annotation such as gene ontology annotation, gene interactions and its identification from reference protein databases. PlantFuncSSRs is freely accessible at: http://www.bioinfocabd.upo.es/plantssr. PMID:27446111

Simultaneous Differentiation and Typing of Entamoeba histolytica and Entamoeba dispar

PubMed Central

Zaki, Mehreen; Meelu, Parool; Sun, Wei; Clark, C. Graham

2002-01-01

Sequences corresponding to some of the polymorphic loci previously reported from Entamoeba histolytica have been detected in Entamoeba dispar. Comparison of nucleotide sequences of two loci between E. dispar strain SAW760 and E. histolytica strain HM-1:IMSS revealed significant differences in both repeat and flanking regions. The tandem repeat units varied not only in sequence but also in number and arrangement between the two species at both the loci. Using the sequences obtained, primer pairs aimed at amplifying species-specific products were designed and tested on a variety of E. histolytica and E. dispar samples. Amplification results were in complete agreement with the original species classification in all cases, and the PCR products displayed discernible size and pattern variations among the isolates. PMID:11923344

Genetic diversity in intraspecific hybrid populations of Eucommia ulmoides Oliver evaluated from ISSR and SRAP molecular marker analysis.

PubMed

Yu, J; Wang, Y; Ru, M; Peng, L; Liang, Z S

2015-07-03

Eucommia ulmoides Oliver, the only extant species of Eucommiaceae, is a second-category state-protected endangered plant in China. Evaluation of genetic diversity among some intraspecific hybrid populations of E. ulmoides Oliver is vital for breeding programs and further conservation of this rare species. We studied the genetic diversity of 130 accessions from 13 E. ulmoides intraspecific hybrid populations using inter-simple sequence related (ISSR) and sequence-related amplified polymorphism (SRAP) markers. Of the 100 ISSR primers and 100 SRAP primer combinations screened, eight ISSRs and eight SRAPs were used to evaluate the level of polymorphism and discriminating capacity. A total number of 65 bands were amplified using eight ISSR primers, in which 50 bands (76.9%) were polymorphic, with an average of 8.1 polymorphic fragments per primer. Alternatively, another 244 bands were observed using eight SRAP primer combinations, and 163 (66.8%) of them were polymorphic, with an average of 30.5 polymorphic fragments per primer. The unweighted pair-group method (UPGMA) analysis showed that these 13 populations could be classified into three groups by the ISSR marker and two groups by the SRAP marker. Principal coordinate analysis using SRAP was completely identical to the UPGMA-based clustering, although this was partly confirmed by the results of UPGMA cluster analysis using the ISSR marker. This study provides insights into the genetic background of E. ulmoides intraspecific hybrids. The progenies of the variations "Huazhong-3", "big fruit", "Yanci", and "smooth bark" present high genetic diversity and offer great potential for E. ulmoides breeding and conservation.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

rpoB Gene Sequence-Based Identification of Aerobic Gram-Positive Cocci of the Genera Streptococcus, Enterococcus, Gemella, Abiotrophia, and Granulicatella

PubMed Central

Drancourt, Michel; Roux, Véronique; Fournier, Pierre-Edouard; Raoult, Didier

2004-01-01

We developed a new molecular tool based on rpoB gene (encoding the beta subunit of RNA polymerase) sequencing to identify streptococci. We first sequenced the complete rpoB gene for Streptococcus anginosus, S. equinus, and Abiotrophia defectiva. Sequences were aligned with these of S. pyogenes, S. agalactiae, and S. pneumoniae available in GenBank. Using an in-house analysis program (SVARAP), we identified a 740-bp variable region surrounded by conserved, 20-bp zones and, by using these conserved zones as PCR primer targets, we amplified and sequenced this variable region in an additional 30 Streptococcus, Enterococcus, Gemella, Granulicatella, and Abiotrophia species. This region exhibited 71.2 to 99.3% interspecies homology. We therefore applied our identification system by PCR amplification and sequencing to a collection of 102 streptococci and 60 bacterial isolates belonging to other genera. Amplicons were obtained in streptococci and Bacillus cereus, and sequencing allowed us to make a correct identification of streptococci. Molecular signatures were determined for the discrimination of closely related species within the S. pneumoniae-S. oralis-S. mitis group and the S. agalactiae-S. difficile group. These signatures allowed us to design a S. pneumoniae-specific PCR and sequencing primer pair. PMID:14766807

The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

ERIC Educational Resources Information Center

Schubert, Sandra; Zelinsky, Benjamin

Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

Limited-life cartridge primers

DOEpatents

Makowiecki, Daniel M.; Rosen, Robert S.

1998-01-01

A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

Limited-life cartridge primers

DOEpatents

Makowiecki, Daniel M.; Rosen, Robert S.

2005-04-19

A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

Fungal community profiles in agricultural soils of a long-term field trial under different tillage, fertilization and crop rotation conditions analyzed by high-throughput ITS-amplicon sequencing

PubMed Central

Geistlinger, Joerg; Wibberg, Daniel; Deubel, Annette; Zwanzig, Jessica; Babin, Doreen; Schlüter, Andreas; Schellenberg, Ingo

2018-01-01

Fungal communities in agricultural soils are assumed to be affected by soil and crop management. Our intention was to investigate the impact of different tillage and fertilization practices on fungal communities in a long-term crop rotation field trial established in 1992 in Central Germany. Two winter wheat fields in replicated strip-tillage design, comprising conventional vs. conservation tillage, intensive vs. extensive fertilization and different pre-crops (maize vs. rapeseed) were analyzed by a metabarcoding approach applying Illumina paired-end sequencing of amplicons generated by two recently developed primer pairs targeting the two fungal Internal Transcribed Spacer regions (ITS1, ITS2). Analysis of 5.1 million high-quality sequence reads uncovered a diverse fungal community in the two fields, composed of 296 fungal genera including 3,398 Operational Taxonomic Units (OTUs) at the 97% sequence similarity threshold. Both primer pairs detected the same fungal phyla (Basidio-, Asco-, Zygo-, Glomero- and Chytridiomycota), but in different relative abundances. OTU richness was higher in the ITS1 dataset, while ITS2 data were more diverse and of higher evenness. Effects of farming practice on fungal community structures were revealed. Almost two-thirds of the fungal genera were represented in all different soil treatments, whereas the remaining genera clearly responded to farming practice. Principal Component Analysis revealed four distinct clusters according to tillage practice and pre-crop. Analysis of Variance (ANOVA) substantiated the results and proved significant influences of tillage and pre-crop, while fertilization had the smallest and non-significant effect. In-depth analysis of putative phytopathogenic and plant beneficial fungal groups indicated distinct responses; for example Fusarium was significantly enriched in the intensively fertilized conservation tillage variants with the pre-crop maize, while Phoma displayed significant association with conventional tillage and pre-crop rapeseed. Many putative plant beneficial fungi also reacted differentially to farming practice with the most distinct responders identified among the Glomeromycota (arbuscular mycorrhizal fungi, AMF). PMID:29621291

High throughput pyrosequencing technology for molecular differential detection of Babesia vogeli, Hepatozoon canis, Ehrlichia canis and Anaplasma platys in canine blood samples.

PubMed

Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Kongklieng, Amornmas; Tantrawatpan, Chairat; Boonmars, Thidarut; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai

2014-06-01

Canine babesiosis, hepatozoonosis, ehrlichiosis, and anaplasmosis are tick-borne diseases caused by different hemopathogens. These diseases are causes of morbidity and mortality in dogs. The classic method for parasite detection and differentiation is based on microscopic observation of blood smears. The limitations of the microscopic method are that its performance requires a specially qualified person with professional competence, and it is ineffective in differentiating closely related species. This study applied PCR amplification with high throughput pyrosequencing for molecular differential detection of the following 4 hemoparasites common to tropical areas in dog blood samples: Babesia vogeli, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys. PCR was initially used to amplify specific target regions of the ribosomal RNA genes of each parasite using 2 primer pairs that included 18S rRNA for protozoa (B. vogeli and H. canis) and 16S rRNA for rickettsia (E. canis and A. platys). Babesia vogeli and H. canis were discriminated using 9 nucleotide positions out of 30 base pairs, whereas E. canis and A. platys were differentiated using 15 nucleotide positions out of 34 base pairs that were determined from regions adjacent to 3' ends of the sequencing primers. This method provides a challenging alternative for a rapid diagnosis and surveillance of these tick-borne diseases in canines. Copyright © 2014 Elsevier GmbH. All rights reserved.

Properties of targeted preamplification in DNA and cDNA quantification.

PubMed

Andersson, Daniel; Akrap, Nina; Svec, David; Godfrey, Tony E; Kubista, Mikael; Landberg, Göran; Ståhlberg, Anders

2015-01-01

Quantification of small molecule numbers often requires preamplification to generate enough copies for accurate downstream enumerations. Here, we studied experimental parameters in targeted preamplification and their effects on downstream quantitative real-time PCR (qPCR). To evaluate different strategies, we monitored the preamplification reaction in real-time using SYBR Green detection chemistry followed by melting curve analysis. Furthermore, individual targets were evaluated by qPCR. The preamplification reaction performed best when a large number of primer pairs was included in the primer pool. In addition, preamplification efficiency, reproducibility and specificity were found to depend on the number of template molecules present, primer concentration, annealing time and annealing temperature. The amount of nonspecific PCR products could also be reduced about 1000-fold using bovine serum albumin, glycerol and formamide in the preamplification. On the basis of our findings, we provide recommendations how to perform robust and highly accurate targeted preamplification in combination with qPCR or next-generation sequencing.

Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

USDA-ARS?s Scientific Manuscript database

Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

PubMed

Bertolini, Francesca; Ghionda, Marco Ciro; D'Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

Genetic study of kelp ``901'' strain

NASA Astrophysics Data System (ADS)

Xia, Peng; Wang, Xiuliang; Li, Xiaojie; Zhao, Yushan; Yao, Lin; Duan, Delin

2005-06-01

Based on DNA extraction and optimization of random amplified reaction (RAPD) to the gametophytes and sporophytes of Kelp “901” strain, genetic study on variation was conducted to its parents and offsprings of F6, F7, F8, and F9 generation. RAPD results have shown that among 30 selected primers for gametophytes, 297 loci ranging from 200 to 3 000 bp were obtained in the average of 9.9 loci for each primer. This indicated a high polymorphic rate with RAPD detection. UPGMA (unweighted pair-group method arithmetic average) analysis showed that each male and female gametophyte of a generation could be clustered into one pair separately. The genetic distances of the Kelp 901 generation were 0.3212 0.4767, and the maximum was between F7 and F8 (0.4767). Identity analysis showed that F6 generation was more close to the female parent (0.6593), and F7 generation was more close to the male parent (0.578 8). To the sporophytes study in 24 selected primers for RAPD amplification, 191 loci ranging from 230 2800 bp were obtained, in the average to each primer of 8.0 loci. The heterozygosity to six populations were male parent (0.2239), female parent (0.1072), F6 (0.2164), F7(0.2286), F8(0.2296) and F9(0.3172). The nearest genetic distance was 0.083 5(F8, F9). Total heterozygosity (HT) of F6, F7, F8 and F9 generations was 0.3186, the average heterozygosity (HS) for F6, F7, F8 and F9 generations was 0.2480, and deduced coefficient of population differentiation (Gst) was 22.2%. Six sequence characterized amplified regions (SCAR) were preliminary screened through RAPD analysis. It needed to be verified in detail as they are significant for molecular marker assistance in breeding and selecting Laminaria.

A Next Generation Semiconductor Based Sequencing Approach for the Identification of Meat Species in DNA Mixtures

PubMed Central

Bertolini, Francesca; Ghionda, Marco Ciro; D’Alessandro, Enrico; Geraci, Claudia; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine) for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon) as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43%) in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97) and lower for avian species (0.70). PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures. PMID:25923709

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

PubMed

Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

2007-10-01

Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.