Science.gov

Sample records for primer paso hacia

  1. 8. VIEW OF EL PASO AND SOUTHWESTERN RAILROAD BRIDGE, PIER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. VIEW OF EL PASO AND SOUTHWESTERN RAILROAD BRIDGE, PIER BETWEEN EAST APPROACH AND RAILROAD, LOOKING NORTH. - El Paso & Southwestern Railroad Rio Grande Bridge, Spanning Rio Grande at Southwestern Railroad, El Paso, El Paso County, TX

  2. 7. VIEW OF EL PASO AND SOUTHWESTERN RAILROAD BRIDGE, PIER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. VIEW OF EL PASO AND SOUTHWESTERN RAILROAD BRIDGE, PIER BETWEEN HIGHWAY AND RAILROAD, LOOKING NORTH. - El Paso & Southwestern Railroad Rio Grande Bridge, Spanning Rio Grande at Southwestern Railroad, El Paso, El Paso County, TX

  3. 4. GENERAL VIEW OF EL PASO AND SOUTHWESTERN RAILROAD BRIDGE, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. GENERAL VIEW OF EL PASO AND SOUTHWESTERN RAILROAD BRIDGE, RAILROAD SPAN, LOOKING NORTH. - El Paso & Southwestern Railroad Rio Grande Bridge, Spanning Rio Grande at Southwestern Railroad, El Paso, El Paso County, TX

  4. 27 CFR 9.84 - Paso Robles.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... THE TREASURY LIQUORS AMERICAN VITICULTURAL AREAS Approved American Viticultural Areas § 9.84 Paso Robles. (a) Name. The name of the viticultural area described in this section is “Paso Robles”. (b) Approved Map. The appropriate map for determining the boundary of the Paso Robles viticultural area is...

  5. 27 CFR 9.84 - Paso Robles.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... THE TREASURY LIQUORS AMERICAN VITICULTURAL AREAS Approved American Viticultural Areas § 9.84 Paso Robles. (a) Name. The name of the viticultural area described in this section is “Paso Robles”. (b) Approved Map. The appropriate map for determining the boundary of the Paso Robles viticultural area is...

  6. 27 CFR 9.84 - Paso Robles.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... THE TREASURY ALCOHOL AMERICAN VITICULTURAL AREAS Approved American Viticultural Areas § 9.84 Paso Robles. (a) Name. The name of the viticultural area described in this section is “Paso Robles”. (b) Approved Map. The appropriate map for determining the boundary of the Paso Robles viticultural area is...

  7. 27 CFR 9.84 - Paso Robles.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... THE TREASURY LIQUORS AMERICAN VITICULTURAL AREAS Approved American Viticultural Areas § 9.84 Paso Robles. (a) Name. The name of the viticultural area described in this section is “Paso Robles”. (b) Approved Map. The appropriate map for determining the boundary of the Paso Robles viticultural area is...

  8. 27 CFR 9.84 - Paso Robles.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... THE TREASURY ALCOHOL AMERICAN VITICULTURAL AREAS Approved American Viticultural Areas § 9.84 Paso Robles. (a) Name. The name of the viticultural area described in this section is “Paso Robles”. (b) Approved Map. The appropriate map for determining the boundary of the Paso Robles viticultural area is...

  9. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  10. RATMAC PRIMER

    SciTech Connect

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  11. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  12. 76 FR 48833 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-09

    ... Energy Regulatory Commission El Paso Natural Gas Company; Notice of Application Take notice that on July 20, 2011, El Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs, Colorado 80944...) of the Natural Gas Act, to abandon, in place, El Paso's El Paso-Douglas Line (Line No. 1004) in...

  13. 76 FR 76707 - Brian Hamilton; El Paso Natural Gas and El Paso Western Pipelines; Notice of Complaint

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-08

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Brian Hamilton; El Paso Natural Gas and El Paso Western Pipelines; Notice of... Improvement Act of 2002, and the Pipeline Hazardous Material Safety Administration, Brian...

  14. 76 FR 77994 - Brian Hamilton v. El Paso Natural Gas, El Paso Western Pipelines; Notice Announcing Docket Number...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-15

    ... Energy Regulatory Commission Brian Hamilton v. El Paso Natural Gas, El Paso Western Pipelines; Notice Announcing Docket Number Change On December 2, 2011, the Commission issued a notice in docket number RP12-220... docket number, RP12-220-000 and give the proceeding a new docket number. This notice changes the...

  15. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  16. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  17. Landsat's Decades-Long Look at El Paso, Texas

    NASA Video Gallery

    Landsat satellites have captured hundreds of images of the regionsurrounding El Paso, Texas since the program started in 1972. On May30, 2013, Landsat 8 began adding to the program’s extensive ...

  18. 76 FR 5120 - Television Broadcasting Services; El Paso, TX

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-28

    ... From the Federal Register Online via the Government Publishing Office ] FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 Television Broadcasting Services; El Paso, TX AGENCY: Federal Communications... 73 Television, Television broadcasting. For the reasons discussed in the preamble, the...

  19. 76 FR 61135 - Environmental Impact Statement: El Paso County, TX

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-03

    ...FHWA is issuing this notice to advise the public that the NOI to prepare an environmental impact statement (EIS) for proposed improvements to Loop 375 Border Highway West, in El Paso County, Texas, is being...

  20. Super Guppy Swallows T-38s; Heads for El Paso

    NASA Video Gallery

    Two NASA T-38 aircraft were swallowed whole by NASA's Super Guppy recently on Dryden Flight Research Center's back ramp. The Guppy then airlifted the two retired T-38s to El Paso, Texas, where they...

  1. Education Vouchers. A Primer.

    ERIC Educational Resources Information Center

    Richter, Philip C.; Hollender, Mary Jo

    This document is intended to serve both as a primer and as an annotated bibliography about educational vouchers. As a primer, it introduces the reader to the concept of vouchers and to the variety of issues--including political, economic, legal, and educational issues--associated with vouchers. As an annotated bibliography, it provides a summary…

  2. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  3. Social disparities in children's respiratory health in El Paso, Texas.

    PubMed

    Grineski, Sara E; Collins, Timothy W; Chavez-Payan, Paola; Jimenez, Anthony M; Clark-Reyna, Stephanie; Gaines, Marie; Kim, Young-an

    2014-03-01

    The objectives of this study were to assess prevalence of children's respiratory health conditions and to measure and describe social disparities in children's respiratory problems and access to health resources for asthma/wheezing management. Data were collected through a cross-sectional, observational mail survey of all primary caretakers of 4th and 5th grade children in El Paso Independent School District (El Paso, TX, USA). 6295 primary caretakers received surveys at their home address and 1904 surveys were completed and returned for a 30% response rate. El Paso children have high rates of asthma (17%) and allergies (51%). In terms of social disparities, children that are male, not poor, obese, Hispanic, born in El Paso, have a US-born caretaker, and have a caretaker who has lower levels Spanish proficiency have increased odds of respiratory problems. Among children with asthma and wheezing, disparities exist in access to care; those that are poor, with a Spanish-speaking caretaker, or with a foreign-born caretaker had increased odds of seeking care in urgent care center, emergency rooms and hospitals. Results have scholarly and practical implications for broader trends in terms of increasing prevalence of respiratory health problems across multiple scales (from El Paso to the US context to worldwide) and health disparities experienced within the rapidly growing US Hispanic population. PMID:24619157

  4. 76 FR 41235 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... 28, 2011, El Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs, Colorado 80944... Interstate Gas Company, P.O. Box 1087, Colorado Springs, CO 80944, telephone no. (719) 667-7514, facsimile...

  5. 77 FR 14776 - El Paso Natural Gas Company; Notice of Amendment to Presidential Permit

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-13

    ... notice that on February 20, 2012, El Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs... Nevada Avenue, P.O. Box 1087, Colorado Springs, Colorado 80944, or call at 719-667-7514, or email...

  6. 76 FR 18756 - El Paso Natural Gas Company; Notice of Request Under Blanket Authorization

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-05

    ... Take notice that on March 22, 2011, El Paso Natural Gas Company (El Paso), Post Office Box 1087... application should be directed to Susan C. Stires, Post Box Office 1087, Colorado Springs, CO 80944,...

  7. 75 FR 62515 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-12

    ... notice that on September 28, 2010, El Paso Natural Gas Company (EPNG), P.O. Box 1087, Colorado Springs..., Director, Regulatory Affairs, El Paso Natural Gas Company, P.O. Box 1087, Colorado Springs, Colorado...

  8. Designing Polymerase Chain Reaction Primers Using Primer3Plus.

    PubMed

    Hung, Jui-Hung; Weng, Zhiping

    2016-01-01

    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  9. 77 FR 20617 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-05

    ... export capacity of 366,000 Mcf/d, designed to transport natural gas to a new delivery interconnect with... Energy Regulatory Commission El Paso Natural Gas Company; Notice of Application Take notice that on March 23, 2012, El Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs, Colorado...

  10. 76 FR 28016 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-13

    ... Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs, CO 80944, filed with the Federal... Gas Company, P.O. Box 1087, Colorado Springs, CO 80944, at (719) 667-7514 (phone), (719) 667-7534 (fax... Paso Natural ] Gas Company, P.O. Box 1087, Colorado Springs, Colorado 80944, at (719) 520-4534...

  11. 75 FR 42727 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-22

    ... notice that on July 13, 2010, El Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs... Gas Company, P.O. Box 1087, Colorado Springs, Colorado 80944, or by calling (719) 667-7514 (telephone... and General Counsel, El Paso Natural Gas Company, P.O. Box 1087, Colorado Springs, Colorado 80944,...

  12. 76 FR 66708 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-27

    ... October 7, 2011, El Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs, Colorado 80904, filed in the above referenced docket an application pursuant to section 3 of the Natural Gas Act (NGA... Department, El Paso Natural Gas Company, P.O. Box 1087, Colorado Springs, Colorado 80904, by telephone...

  13. 76 FR 66711 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-27

    ... October 11, 2011, El Paso Natural Gas Company (El Paso), P.O. Box 1087, Colorado Springs, Colorado 80904... application under section 3 of the NGA in Docket No. CP12-7-000, requesting amendment and reissuance of its..., Director, Regulatory Affairs Department, El Paso Natural Gas Company, P.O. Box 1087, Colorado...

  14. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  15. PRELIMINARY RESEARCH FINDINGS OF THE EL PASO CHILDREN'S HEALTH STUDY

    EPA Science Inventory

    The El-Paso-Ciudad Juarez area is one of the largest metropolitan areas on the U.S.-Mexico border. Sources of air pollutants inlcude the more than 18 million vehicles, which annually cross between the two cities, heavily traveled roads and interstate freeways, and local indust...

  16. 76 FR 44280 - Television Broadcasting Services; El Paso, TX

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-25

    ... COMMISSION 47 CFR Part 73 Television Broadcasting Services; El Paso, TX AGENCY: Federal Communications... 12, 2009 digital transition deadline, after which the Video Division granted KVIA-TV Special... channel substitution will serve the public interest by significantly improving the public's digital...

  17. The Chicanos of El Paso: A Case of Changing Colonization.

    ERIC Educational Resources Information Center

    Martinez, Oscar J.

    Using historical statistics and key indicators, data were synthesized to identify longitudinal trends and patterns in the social, economic, and political status of El Paso's Chicanos. Data related to group achievement were analyzed. A framework adapted to local conditions based on the internal colonialism model was used for the periodization of El…

  18. 76 FR 19276 - Television Broadcasting Services; El Paso, TX

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-07

    ... From the Federal Register Online via the Government Publishing Office FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 Television Broadcasting Services; El Paso, TX AGENCY: Federal Communications... U.S.C. 801(a)(1)(A). List of Subjects in 47 CFR Part 73 Television. Federal...

  19. 76 FR 28946 - Television Broadcasting Services; El Paso, TX

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-19

    ... From the Federal Register Online via the Government Publishing Office FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 Television Broadcasting Services; El Paso, TX AGENCY: Federal Communications... CFR 1.415 and 1.420. List of Subjects in 47 CFR Part 73 Television Federal Communications...

  20. El Paso Formation - a Lower Ordovician platform carbonate deposit

    SciTech Connect

    Clemons, R.E.

    1987-05-01

    The eastward-transgressive Lower Ordovician El Paso Formation conformably overlies Bliss Sandstone in southern New Mexico. Locally, lower El Paso was deposited on low hills of plutonic and volcanic rocks. The region subsided gradually throughout Canadian time, receiving the El Paso carbonate rock blanket up to 460 m thick. Lithologic and chronologic correlative rocks were deposited over most of the southwestern US as the first Paleozoic carbonate platform sequence. The El Paso Formation contains four members, listed here in ascending order: Hitt Canyon, Jose, McKelligon, and Padre. Gradually decreasing sand content upward through the Hitt Canyon indicates deepening water and/or greater distance to shore. Girvanella(.) oncolites are locally abundant. Stromatolite mounds near the top of the Hitt Canyon, combined with an influx of sand, ooids, and rounded bioclasts in the Jose Member, recorded a shoaling phase. The overlying McKelligon Member contains little or no sand, and sponge-Calathium mounds are prominent at some locales. Stromatolite mounds are interbedded with sponge-Calathium mounds in a few sections. Lower Padre Member beds are typically silty to sandy and locally contain thinly-laminated zones. The Padre contains more restricted fauna that includes traces of ostracods. Pervasive bioturbation of El Paso beds and fauna consisting of echinoderms, sponges, gastropods, trilobites, Nuia, Calathium, cephalopods, and algae plus minor brachiopods and Pulchrilamina indicate predominating shallow-subtidal environments. Low-energy platform environments, in which a large volume of micritic muds accumulated, were disturbed thousands of times by storms producing abundant thin, poorly washed biosparite, intrasparite, and intrasparrudite lenses.

  1. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  2. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  3. Crystalline Silica Primer

    USGS Publications Warehouse

    ,

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  4. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  5. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  6. Modeling Visibility in the EL Paso del Norte Region

    NASA Astrophysics Data System (ADS)

    Fitzgerald, R. M.; Medina, R.; DuBois, D. W.; Novlan, D.

    2013-12-01

    Poor visibility is a subject of growing public concern throughout the U.S, and an active area of research. Its societal impacts in air quality, aviation transport and traffic are significant. Aerosols play a fundamental role in the attenuation of solar radiation, and also affect visibility. The scattering and extinction coefficients of aerosol particles in the Paso del Norte Region have been calculated using the T- matrix model in conjunction with a laser particle counter. Inter-comparison of the model's results of the scattering and absorption coefficients against the corresponding data from a Photoacustic Extinctiometer instrument (which measures in-situ absorption and scattering coefficients of aerosol particles) shows excellent agreement. In addition, the volume-weighted method is used to determine the composite index of refraction which is representative of the aerosols for the Paso del Norte Airshed to obtain information of the type of aerosol particles present in the Airshed. The Single Scattering Albedo has also been retrieved using our methodology to obtain further insight into the type of aerosols present on a given day. Finally, the Koschmieder equation has been used to calculate the visual range or visibility, and was correlated with the PM2.5 and PM10 particle concentration present in the Airshed. Our methodology will allow a better understanding of the size and type of aerosol particles that are most detrimental to the visibility for the Paso del Norte Region.

  7. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  8. Multiplexed Primer Prediction for PCR

    SciTech Connect

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  9. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  10. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  11. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  12. Multiplexed Primer Prediction for PCR

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequencesmore » used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.« less

  13. The composition of wet deposition in El Paso, Texas

    NASA Astrophysics Data System (ADS)

    Emmert, Sonny

    The composition of precipitation reflects the transport of particles from varying air mass source regions as well as input from local environmental and anthropogenic activities. Air research in El Paso, TX, U.S.A/Ciudad Juarez, Chihuahua, Mexico has been traditionally limited to studies of local inputs of air pollution; no transition has been made to studying the scavenging, washout, and transport of pollutants by precipitation. The goal of this research project was to identify transported pollutants in precipitation, and determine if there were any health and ecological implications. The research investigated biological, chemical, and geological constituents in precipitation samples collected between September 2004 and October 2005. A variety of analysis techniques were used to determine composition of the precipitation. These techniques included bacterial and fungal plate counts, inductively coupled plasma/mass spectrometry, ion chromatography, transmission electron microscopy, scanning electron microscopy, and electron microprobe analysis. Samples were collected from an urban site in El Paso, Texas at the campus of the University of Texas at El Paso. Wet only samples were the target of the sample collection. Particulate matter <10 microns was correlated with fungal growth while particulate matter < 2.5 microns was correlated with bacterial growth in analyzed samples. Microscopy methods revealed new techniques in particle characterization, evidence of anthropogenic influence, and a wide variety of particle compositions. The ionic chemistry results reflected elevated levels of ions as well as an overall alkalinity of rainwater samples. Elemental analysis of the inorganic fraction suggested elevated enrichment of Phosphorus in the study area and possible ratios for transport identification of southwestern dust storms.

  14. STR primer concordance study.

    PubMed

    Budowle, B; Masibay, A; Anderson, S J; Barna, C; Biega, L; Brenneke, S; Brown, B L; Cramer, J; DeGroot, G A; Douglas, D; Duceman, B; Eastman, A; Giles, R; Hamill, J; Haase, D J; Janssen, D W; Kupferschmid, T D; Lawton, T; Lemire, C; Llewellyn, B; Moretti, T; Neves, J; Palaski, C; Schueler, S; Sgueglia, J; Sprecher, C; Tomsey, C; Yet, D

    2001-12-15

    Over 1500 population database samples comprising African Americans, Caucasians, Hispanics, Native Americans, Chamorros and Filipinos were typed using the PowerPlex 16 and the Profiler Plus/COfiler kits. Except for the D8S1179 locus in Chamorros and Filipinos from Guam, there were eight examples in which a typing difference due to allele dropout was observed. At the D8S1179 locus in the population samples from Guam, there were 13 examples of allele dropout observed when using the Profiler Plus kit. The data support that the primers used in the PowerPlex 16, Profiler Plus, and COfiler kits are reliable for typing reference samples that are for use in CODIS. In addition, allele frequency databases have been established for the STR loci Penta D and Penta E. Both loci are highly polymorphic. PMID:11741760

  15. Ground-water resources of the El Paso area, Texas

    USGS Publications Warehouse

    Sayre, Albert Nelson; Livingston, Penn Poore

    1945-01-01

    El Paso, Tex., and Ciudad Juarez, Chihuahua, Mexico, and the industries in -that area draw their water supplies from wells, most of which are from 600 to 800 feet deep. In 1906, the estimated average pumpage there was about 1,000,000 gallons a day, and by 1935 it had increased to 15,400,000 gallons a day. The water-bearing beds, consisting of sand and gravel interbedded wire clay, tie in the deep structural trough known as the Hueco bolson, between the Organ and Franklin Mountains on the west, the Hueco, Finlay, and Malone Mountains on the east, the Tularosa Basin on the north, and the mountain ranges of Mexico on the south. From the gorge above El Paso to that beginning near Fort Quitman, about 90 miles southeast .of El Paso, the Rio Grande has eroded a flat-bottomed, steepwalled valley, 6 to 8 miles wide and 225 to 350 feet deep. No other large drainage channels have been developed on the bolson. The valley is known as the El Paso Valley, and the uneroded upland part of the bolson is called the Mesa. In the lowest parts of the El Paso Valley, the water-table is nearly at the surface. The quality of the underground water in the valley varies greatly both vertically and laterally. To a depth of about 400 to 500 feet it is in general too highly mineralized for municipal use, but between about. 500 and 900 feet good water may be obtained from several beds. In the beds between 500 and 900 feet the water level in wells is in places as. much as 20 feet lower than that in the shallow beds. Beneath the Mesa the water level .varies from about 200 feet beneath the surface, where the ground elevation is least, to about 400 feet. where it is highest. The water beneath the Mesa in general is of satisfactory quality and contains less than 500 parts per million of dissolved solids. Two cones of depression in the water table have been formed by the pumping near El Paso--one m the vicinity of the Mesa well field, the other around the Montana well field in the valley. The water

  16. Short-term water consumption dynamics in El Paso, Texas

    NASA Astrophysics Data System (ADS)

    Fullerton, Thomas M.; ElíAs, Arturo

    2004-08-01

    Time series analysis of water consumption patterns has been the subject of increasing attention in recent years. For many municipalities such efforts offer a means for developing potentially useful planning tools. Because data requirements are not extensive, model development is feasible for markets where information is limited. The work at hand examines the applicability of such a tool in El Paso, Texas, a growing metropolitan economy located in a semiarid region. Sample data are from January 1994 through December 2002. In addition to estimating a linear transfer function equation of water consumption in this city the model is subjected to a series of simulation benchmark tests.

  17. Effects of the Paso Robles Geothermal Reservoir on water quality and availability in the Paso Robles Groundwater Basin, California

    NASA Astrophysics Data System (ADS)

    Rytuba, J. J.; Langenheim, V. E.; Goldstein, D.

    2012-12-01

    Geochemical and isotopic data from water wells and hot springs in the Paso Robles Groundwater Basin (PRGB) indicate that two water sources affect water quality and availability: meteoric water stored in Pliocene sediments, and geothermal waters present in deeper Miocene sediments. Understanding mixing of these two water sources is important in managing groundwater in the PRGB. The PRGB is the southernmost of several Salinas Valley groundwater basins. Demands from both population growth and agriculture have made water quality and availability a continuing concern. To address continuing depletion of groundwater, a 25 km pipe was recently constructed to bring water from Lake Nacimiento to supplement municipal water supplies. The PRGB is bounded on the west by the Rinconada Fault, and on the east by the San Juan and Red Hills faults. The main aquifer in the PRGB is in the Pliocene Paso Robles Formation (PRF). Aeromagnetic anomalies delineate the boundaries of the basin and thickness of basin fill. Aeromagnetic highs are coincident with surface and near surface presence of the highly magnetic La Panza granite, while aeromagnetic lows occur where basin fill is deepest and the La Panza granite is at a depth of over 1 km. The low temperature (<40oC) geothermal system in the Paso Robles area is located on the west side of the PRGB. The geothermal reservoir is present in the base of the PRF and the upper part of the Miocene Monterey Formation. The geothermal waters are Ca-Mg-SO4 waters, with gas chemistry dominated by CH4, N2, CO2, and H2S. Sulfur, barite and FeS precipitates occur in hot spring pools. The hot springs and geothermal wells are localized along the Rinconada and subsidiary faults. Several new hot springs developed along the Rinconada fault, including one in the Paso Robles city center after the 2003 M6.5 San Simeon earthquake. The city center hot spring was covered over and hot spring effluent was piped 1 km to a leach field in the Salinas River floodplain

  18. Explanatory chapter: PCR primer design.

    PubMed

    Álvarez-Fernández, Rubén

    2013-01-01

    This chapter is intended as a guide on polymerase chain reaction (PCR) primer design (for information on PCR, see General PCR and Explanatory Chapter: Troubleshooting PCR). In the next section, general guidelines will be provided, followed by a discussion on primer design for specific applications. A list of recommended software tools is shown at the end.

  19. Summary of extensometric measurements in El Paso, Texas

    USGS Publications Warehouse

    Heywood, Charles E.

    2003-01-01

    Two counter-weighted-pipe borehole extensometers were installed on the left bank of the Rio Grande between El Paso, Texas, and Ciudad Juarez, Chihuahua, Mexico, in 1992. A shallow extensometer measures vertical compaction in the 6- to 100-meter aquifer-system depth interval. A deep extensometer measures vertical compaction in the 6- to 305-meter aquifer-system depth interval. Both extensometers are referenced to the same surface datum, which allows time-series differencing to determine vertical compaction in the depth interval between 100 and 305 meters. From April 2, 1993, through June 13, 2002, 1.6 centimeters of compaction occurred in the 6-to 305-m depth interval. Until February 1999, most aquifer-system compaction occurred in the deeper aquifer-system interval between 100 and 305 meters, from which ground water was extracted. After that time, compaction in the shallow interval from 6 to 100 meters was predominant and attained a maximum of 7.6 millimeters by June 13, 2002. Minor residual compaction is expected to continue; continued maintenance of the El Paso extensometers would document this process.

  20. Ozone studies in the Paso del Norte region

    NASA Astrophysics Data System (ADS)

    Becerra-Davila, Fernando

    The Paso del Norte region forms the largest contiguous bi-national conglomerate on the US-Mexico border. With a combined population of around 2 million inhabitants, the Paso del Norte region is isolated, more than 500 km away from the nearest urban area of comparable size, thus making it an ideal location for air quality studies of an isolated urban environment. The meteorological conditions leading to a high ozone episode in this region, such as the historical ozone episode of June 2006, are analyzed. It is well known that stagnation and minimal winds, high temperatures, and pressure ridges over the region are conducive to high ozone episodes. In addition, the planetary boundary height is studied to understand its impact on high ozone episodes. Several studies report that ground level ozone non-attainment regulations could be caused not only by local emissions, but also by atmospheric transport. In this work the atmospheric advection of pollutants into the region is analyzed using HYSPLIT backward trajectories. Furthermore, a novel backward trajectory clustering technique is implemented for the summer of 2006. The "ozone weekend effect" (OWE) is a phenomenon by which in some geographical regions ambient ozone concentrations tend to be higher on weekends than on weekdays, despite the lower emissions of ozone precursors during those days. The observed local OWE has never previously been studied in terms of the photolysis rates of four of the main ozone precursors. In this research a novel method that allows the calculation of actinic fluxes, photolysis frequencies and photolysis rates with a high degree of accuracy and reliability has been developed. This method utilizes a combination of the experimental data available for this region in conjunction with a radiative transfer model (TUV model). Three weekend-weekday cases during summers 2006, 2009 and 2010 are studied in this work. In this research, the photolysis impact on the local OWE is studied. The results

  1. ATMOSPHERIC VOLATILE ORGANIC COMPOUND MEASUREMENTS DURING THE 1996 PASO DEL NORTE OZONE STUDY

    EPA Science Inventory

    Ambient air VOC samples were collected at surface air quality monitoring sites, near sources of interest, and aloft on the US (El Paso) and Mexican (Ciudad Juarez) side of the border during a six-week period of the 1996 Paso del Norte Ozone Study. Samples were collected at five...

  2. Evaluation of Academic Policy Formulation and Implementation Transmountain Early College High School, El Paso, Texas

    ERIC Educational Resources Information Center

    Heidemann, Virginia Margaret

    2010-01-01

    Transmountain Early College High School (TMECHS) opened in August 2008, created by a partnership between the El Paso Community College (EPCC) and the El Paso Independent School District (EPISD), and supported in its conceptualization, start-up, and first few years operation by grant funding and guidance from the Texas High School Project (THSP)…

  3. 78 FR 58049 - Proposed Establishment of the Adelaida District, Creston District, El Pomar District, Paso Robles...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-20

    ..., at 74 FR 3425). Overview of the Paso Robles Viticultural Area The Paso Robles viticultural area... with Monterey County (see T.D. ATF-148, published in the Federal Register on October 4, 1983, at 48 FR....D. ATF-377, published in the Federal Register on June 13, 1996, at 61 FR 29952); and, as noted...

  4. 75 FR 70225 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-17

    ... Energy Regulatory Commission El Paso Natural Gas Company; Notice of Application November 9, 2010. Take notice that on October 29, 2010, El Paso Natural Gas Company (EPNG), P.O. Box 1087, Colorado Springs... Natural Gas Act (NGA) and Rule 207(a)(5) of the Commission's regulations, requesting the...

  5. 77 FR 3757 - El Paso Natural Gas Company; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-25

    ... Energy Regulatory Commission El Paso Natural Gas Company; Notice of Application Take notice that on January 5, 2012, El Paso Natural Gas Company (EPNG), Post Office Box 1087, Colorado Springs, Colorado 80944 filed an application in the above referenced docket pursuant to section 7(b) of the Natural...

  6. Titanium Mass-Balance Analysis of Paso Robles Soils: Elemental Gains and Losses as Affected by Acid Alteration Fluids

    NASA Astrophysics Data System (ADS)

    Sutter, B.; Ming, D. W.

    2010-03-01

    Titanium mass-balance analysis of Paso Robles soils indicated elemental gains as supplied by sulfuric acid alteration fluids. This suggests that open-system dissolution processes have operated in the Paso Robles soils.

  7. DELIVERING TIMELY AIR QUALITY, TRAFFIC, AND WEATHER INFORMATION TO YOUR COMMUNITY/THE PASO DEL NORTE ENVIRONMENTAL MONITORING PROJECT

    EPA Science Inventory

    EPA has developed a technology transfer handbook for the EMPACT Paso del Norte Project. The EMPACT Paso del Norte Environmental Monitoring Project is a mobile vehicle emissions project that involves the international community of El Paso, TX; Sundland Park, NM; and Juarez, Mexico...

  8. 77 FR 29629 - El Paso Natural Gas Company; Notice of Intent To Prepare an Environmental Assessment for the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-18

    ... transport natural gas to a new delivery interconnect with Tarahumara Pipeline at the United States/Mexico... Energy Regulatory Commission El Paso Natural Gas Company; Notice of Intent To Prepare an Environmental... construction and operation of facilities by El Paso Natural Gas Company (EPNG) in El Paso County, Texas....

  9. 40 CFR 81.82 - El Paso-Las Cruces-Alamogordo Interstate Air Quality Control Region.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false El Paso-Las Cruces-Alamogordo... Designation of Air Quality Control Regions § 81.82 El Paso-Las Cruces-Alamogordo Interstate Air Quality Control Region. The El Paso-Las Cruces-Alamogordo Interstate Air Quality Control Region (New...

  10. Hermetic G-16 percussion primer

    SciTech Connect

    Durand, N.A.; Weinmaster, R.R.; Massis, T.M.

    1988-01-01

    Studies were conducted to optimize a Hermetic percussion primer capable of surviving temperatures of 200/degree/C for up to 48 hours. These studies included work with typical brass percussion primers and the pyrotechnic composition designed G-16. The G-16 mixture is composed of antimony sulfide, calcium silicide, and potassium. The hermetically sealed assembly consists of a brass cup and anvil loaded with G-16 pyrotechnic mixture and assembly includes a steel disc which is laser welded over the sealing mechanisms cause negligible changes. This assembly can be used with other primers and is capable of enhanced output for specialized applications. 4 refs., 8 figs., 4 tabs.

  11. Selection of primers for polymerase chain reaction.

    PubMed

    Rychlik, W

    1995-04-01

    One of the most important factors affecting the quality of PCR is the choice of primers. In general, the longer the PCR product the more difficult it is to select efficient primers and set appropriate designing primers, and in general, the more DNA sequence information is available, the better the chance of finding an optimal primer pair. Efficient primers can be designed by avoiding the following flaws: primer-dimer formation, self-complementarity, too low Tm of the primers, and/or their incorrect internal stability profile. Tips on subcloning PCR products, calculating duplex stability (predicting dimer formation strength), and designing degenerate primers are given.

  12. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    PubMed Central

    You, Frank M; Huo, Naxin; Gu, Yong Qiang; Luo, Ming-cheng; Ma, Yaqin; Hane, Dave; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2008-01-01

    Background Microsatellite (simple sequence repeat – SSR) and single nucleotide polymorphism (SNP) markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR), as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated in several laboratories

  13. [Energy education exhibits for Insights El Paso Science Museum

    SciTech Connect

    Shubinski, R.

    1998-05-27

    The grant in question, DE-FG03-94ER75954, was awarded to Insights El Paso Science Museum to build key exhibits. These exhibits helped the Museum fulfill its mission to ``promote curiosity and stimulate interest by exploratory, entertaining, exciting, and participatory learning in a broad range of scientific disciplines to persons of all ages regionally and internationally.`` There are several current Board of Directors members who also were Board members during the grant period and who helped construct some of the exhibits. Through speaking with them and reviewing minutes of Board meetings during 1994, it has been determined that seven of the ten proposed exhibits were constructed, with an eighth exhibit constructed as an alternative. Photos of seven of the exhibits and preliminary sketches of some are attached. Following is a list of the constructed exhibits: Hot or Cold, Give and Take, Conduction, Convection, Sources of Energy, Wind Generator, Solar Tracker, and Perpetual Motion.

  14. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  15. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  16. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  17. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  18. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  19. Coal mining: A petex primer

    SciTech Connect

    Not Available

    1985-01-01

    This book is an introduction to the coal industry - from planning a mine to delivering coal to a power plant. The primer covers what coal is and how it is used, modern underground and surface mining practices, coal preparation and transport, and the relation between coal and the environment.

  20. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011

    2011-01-01

    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  1. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  2. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  3. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of...

  4. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  5. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  6. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan

    2002-01-01

    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  7. Ground-water resources of the Hueco Bolson, northeast of El Paso, Texas

    USGS Publications Warehouse

    Knowles, Doyle Blewer; Kennedy, Richard A.

    1958-01-01

    The Hueco Bolson is in the extreme western part of Texas and south- central New Mexico, covering parts of El Paso County, Tex., and Dona Ana and Otero Counties, N. Mex. Wells tapping the bolson deposits furnish the major part of the water supply for the city of El Paso, Ciudad Juarez, Fort Bliss, Biggs Air Force Base, and private industries. in the area. The progressively increasing demand for water made it obvious that a comprehensive investigation of the quantity and quality of water in storage in the entire Hueco Bolson would be essential for the proper planning of future water supplies. A test-drilling program was started in 1953, jointly sponsored by the city of El Paso, the United States Army, the United States Air Force, and the Texas Board of Water Engineers. The drilling was supervised by the United States Geological Survey.

  8. Branched modular primers in DNA sequencing

    SciTech Connect

    Mugasimangalam, R.C.; Shmulevitz, M. |; Ramanathan, V.

    1997-08-01

    The need to synthesize new sequencing primers, such as in primer walking, can be eliminated by assembling modular primers from oligonucleotide modules selected from presynthesized libraries. Our earlier modular primers consisted of 5-mers, 6-mers or 7-mers, annealing to the template contiguously with each other. Here we introduce a novel {open_quotes}branched{close_quotes} type of modular primer with a distinctly different specificity mechanism. The concept of a {open_quotes}branched{close_quotes} primer involves modules that are physically linked by annealing to each other as well as to the target, forming a branched structure of the 3-way junction type. While contiguous modular primers are made specific by the preference of the polymerase for longer primer, branched primers, in contrast, owe their specificity to cooperative annealing of their modules to the intended site on the template. This cooperativity of annealing to the template is provided by mutually complementary segments in the two modules that bind each other. Thus the primer-template complex is no longer limited to linear sequences, but acquires another, second dimension giving the modular primer new functionality.

  9. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.

    1996-12-31

    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  10. El Paso and White Sands area as seen from the Apollo 6 unmanned spacecraft

    NASA Technical Reports Server (NTRS)

    1968-01-01

    The El Paso and White Sands area are photographed from the Apollo 6 (Spacecraft 020/Saturn 502) unmanned space mission three hours and eight minutes after liftoff. North is toward top of picture. Near bottom center of picture is the El Paso-Ciudad Juarez, Mexico metropolitan area. At the top is the White Sands National Monument area. Note Rio Grande River on left side of picture. The snow-covered Sacremento Mountains are seen in the upper right corner. The altitude of the spacecraft when this photograph was taken was 115 nautical miles.

  11. Survey of methicillin-resistant Staphylococcus aureus strains from two hospitals in El Paso, Texas.

    PubMed

    O'Brien, Frances G; Lim, Tien Tze; Winnett, David C; Coombs, Geoffrey W; Pearson, Julie C; Delgado, Alejandro; Langevin, Mark J; Cantore, Stephanie A; Gonzalez, Leti; Gustafson, John E

    2005-06-01

    Seventy-one percent of 76 methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from two medical centers in El Paso, Texas, represent three similar pulsed-field gel electrophoresis types. Overall, six pulsed-field types were identified represented by multilocus sequence/staphylococcal chromosomal cassette DNA mec (SCCmec) types: ST5-MRSA-II; ST36-MRSA-II; ST8 (untypeable SCCmec); and a newly described clonal cluster 8 strain, ST507-MRSA-IV. This study demonstrates the presence of multiple-antibiotic-resistant epidemic MRSA clones in El Paso.

  12. GIS-MODELED INDICATORS OF MOBILE SOURCE EMISSIONS AND ADVERSE HEALTH EFFECTS AMONG CHILDREN IN EL PASO, TEXAS, USA

    EPA Science Inventory

    The El Paso Children's Health Study has been a major collaborative effort by NHEERL and NERL scientists to examine the role of mobile source emissions in the development of allergies and asthma among 4th and 5th grade children in El Paso, TX. The purpose of this study was to det...

  13. CONTINUOUS MEASUREMENT OF FINE AND ULTRAFINE PARTICULATE MATTER, CRITERIA POLLUTANTS AND METEOROLOGICAL CONDITIONS IN URBAN EL PASO, TEXAS

    EPA Science Inventory

    Continuous measurements of aerosol size distributions were made in El Paso, TX, for a period in winter 1999. Size distribution measurements were performed at two urban locations in El Paso using two pairs of the scanning mobility particle sizer and the aerodynamic particle si...

  14. 78 FR 22540 - El Paso Natural Gas Company, L.L.C.; Notice of Petition for Declaratory Order

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-16

    ... From the Federal Register Online via the Government Publishing Office ] DEPARTMENT OF ENERGY Federal Energy Regulatory Commission El Paso Natural Gas Company, L.L.C.; Notice of Petition for... Practice and Procedure, 18 CFR 385.207(a)(2)(2012), El Paso Natural Gas Company, L.L.C. (EPNG) submits...

  15. 78 FR 21934 - El Paso Natural Gas Company, L.L.C.; Notice of Request Under Blanket Authorization

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-12

    ... Authorization Take notice that on March 26, 2013, El Paso Natural Gas Company, L.L.C. (El Paso), P.O. Box 1087...., P.O. Box 1087, Colorado Springs, CO 80944, (719) 667-7517. Any person or the Commission's staff may... the Federal Energy Regulatory Commission, 888 First Street NE., Washington, DC 20426. Dated: April...

  16. GIS-MODELED INDICATORS OF MOBILE SOURCE EMISSIONS AND ADVERSE HEALTH EFFECTS AMONG CHILDREN IN EL PASO, TEXAS,USA*

    EPA Science Inventory

    The El Paso Children's Health Study has been a major collaborative effort by NHEERL and NERL scientists to examine the role of mobile source emissions in the development of allergies and asthma among 4th and 5th grade children in El Paso, TX. The purpose of this study was to dete...

  17. Sample Return Primer and Handbook

    NASA Technical Reports Server (NTRS)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  18. Effect of primers on bonding agent polymerization.

    PubMed

    Hotta, M; Kondoh, K; Kamemizu, H

    1998-10-01

    The aim of the present study was to evaluate the effect of primers on the polymerization of bonding agent. We measured the degree of conversion (radical production) and mechanical properties (surface hardness and direct tensile strength) of various adhesives/primers mixed at different ratios and the effect of varying the visible-light curing time. With and without primer treatment, the tensile bond strength of adhesive resin to micacious glass ceramic and human enamel was measured. After the tensile bond test, using the Image Capture System, the failure patterns of adhesive resin bonded to micacious glass-ceramic were analysed. The results show that the mixtures containing the higher amounts of primer yielded a lower degree of conversion and inferior mechanical properties when compared with the mixtures containing a lower proportion of primer, except in the experimental bonding system. The adhesive/primer mixtures inhibited free radical polymerization. The value for the Knoop hardness number and the direct tensile strength of the adhesive/primer mixtures were significantly decreased compared with those of the adhesive bonding agent alone with no primer added. The tensile bond strength of adhesive resin bonded to micacious glass-ceramic or human enamel without primer treatment was significantly greater than that of adhesive resin with primer treatment in certain cases. Most of the fractures of ceramic surfaces were cohesive (within resins) and/or interface (at the ceramic surface) failure.

  19. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    PubMed Central

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  20. El Paso Community College Women in Technology End of the Year Report, 1998-1999.

    ERIC Educational Resources Information Center

    Di Benedetto, Victoria

    The Women in Technology (WIT) program at Texas' El Paso Community College (EPCC) was established to recruit women into nontraditional occupations, offering technical education, services to help retain women, and community outreach efforts to help change attitudes. This report describes outcomes for the 1998-99 fiscal year, focusing on six WIT…

  1. Comparing Values in Education on the U.S.-Mexican Border, El Paso and Ciudad Juarez.

    ERIC Educational Resources Information Center

    Rippberger, Susan; Staudt, Kathleen

    A three-year study examined attitudes toward education and public schools through behaviors in elementary schools in two United States-Mexican border towns, El Paso (Texas) and Ciudad Juarez (Mexico). It looked at curricular civic rituals such as the flag salute, and more covert normative training found in classroom organization and management…

  2. 77 FR 27774 - Kinder Morgan, Inc. and El Paso Corporation; Analysis of Proposed Agreement Containing Consent...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-11

    ... Register of May 7, 2012, in FR Doc. 2012-10870, on page 26760, the third column, first paragraph, correct... From the Federal Register Online via the Government Publishing Office FEDERAL TRADE COMMISSION Kinder Morgan, Inc. and El Paso Corporation; Analysis of Proposed Agreement Containing Consent Orders...

  3. Service Integration in Colorado: Connecting Programs To Provide Better Services in Mesa and El Paso Counties.

    ERIC Educational Resources Information Center

    Ragan, Mark

    Efforts to integrate the delivery of human service programs (HSP) in Colorado's El Paso County and Mesa County were examined through site visits and meetings with 34 members of HSP staff in both counties. The site visits confirmed that staff and management of HSP in both counties have implemented a series of client-centered processes to provide…

  4. Mediated Debate, Historical Framing, and Public Art: The Juan de Onate Controversy in El Paso

    ERIC Educational Resources Information Center

    Perez, Frank G.; Ortega, Carlos F.

    2008-01-01

    In 1988, the El Paso, Texas, city council accepted a proposal to build twelve statues of historically important individuals as part of a downtown revitalization initiative. Juan de Onate was selected as the centerpiece statue of the XII Travelers Memorial of the Southwest. The decision to honor the Spanish colonizer triggered a local controversy…

  5. Urban Impact of Dissolved Metals in the Paso del Norte Segment of the Rio Grande

    ERIC Educational Resources Information Center

    Freiwan, Sumayeh Ahmad

    2013-01-01

    The Paso del Norte segment of the Rio Grande experiences two seasons per year; the (wet) irrigation season and the (dry) non-irrigation season. The goal of this study was to improve the understanding of occurrence and contribution of dissolved metals in this region during the non-irrigation season. The objectives of this study were to (1) evaluate…

  6. Nucleic acid amplification using modular branched primers

    SciTech Connect

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  7. Atmospheric volatile organic compound measurements during the 1996 Paso del Norte Ozone Study.

    PubMed

    Seila, R L; Main, H H; Arriaga, J L; Martínez, G; Ramadan, A B

    2001-08-10

    Ambient air VOC samples were collected at surface air quality monitoring sites, near sources of interest, and aloft on the US (El Paso) and Mexican (Ciudad Juárez) side of the border during a six-week period of the 1996 Paso del Norte Ozone Study. Samples were collected at five sites, three on the US side and two on the Mexican side, during nine intensive operation days when high ozone levels were forecast for the area. Six other sites were sampled to characterize up-wind, down-wind and other emission sources. Samples for determining source profiles were collected for rush hour traffic, propane-powered bus exhaust, automobile paint shop emissions, propane fuels, and industrial manufacturing in Cd. Juárez and a refinery in El Paso. Most samples were collected in electro-polished stainless steel canisters for determination of C2 to C(10+) hydrocarbons by GC-FID. Carbonyl samples were collected on DNPH impregnated cartridges at three surface sites during aircraft flights and analyzed by HPLC. This paper presents the spatial and temporal characteristics of VOC species concentrations and compositions to examine the differences and similarities of the various locations and time periods. Overall surface, total non-methane hydrocarbon values ranged from 0.1 to 3.4 ppmC with the highest concentrations being recorded in the morning and evening at five vehicle-dominated sites, three in Cd. Juárez and two in El Paso. Toluene in El Paso samples and propane, which is used as a cooking and transportation fuel in Cd. Juárez, were the most abundant hydrocarbons. The most abundant carbonyls were acetaldehyde, acetone and formaldehyde.

  8. Interaction and Relationship Between Groundwater and Surface Water at Keystone Heritage Park EL Paso Texas

    NASA Astrophysics Data System (ADS)

    Gonzalez, B.

    2012-12-01

    Belinda Gonzalez1, Joshua Villalobos1, Marissa Cameron 2 1Department of Geological Sciences, El Paso Community College, El Paso, TX 79925, USA 2Department of Geological Sciences, University of Texas at El Paso, El Paso, TX 79968, USA beli_72764@yahoo.com Historically the floodplain of the Rio Grande River was dotted with shifting wetlands and ponds.The increasing population throughout the United States and Mexico has made it necessary to put the Rio Grande floodplain under till for cultivation. Along with cultivation, the river was channelized and dammed to prevent flooding and to stabilize the Mexico/U.S. border.The loss of wetland ecosystems in the area changed migration patterns of water fowl and destroyed priceless aquatic habitats.The area of our study, Keystone Heritage Park, is the last remaining open wetlands in El Paso County. Before efforts of restoration to reestablish wetlands associated with the Rio Grande can begin, there must be an in-depth, and complete, understanding of the surface and subsurface hydrological system which created and sustains this last remaining wetland. Studies of the wetland's soil properties and their effect on groundwater flow have indicated regions on the periphery of the wetlands where soils are saturated with moisture.These subsurface regions of saturated soils are semi-linear in shape and lead toward the wetland indicating that they are possible loci for groundwater flow for the wetland.These subsurface soil layers are possibly composed of mountain front alluvium that is being feed with meteoric water entering faults that bound the nearby Franklin Mountains.The primary goals of this study are 1) initiate a systematic data acquisition from 9 piezometers and 2 water level loggers of temporal variations in the depth of the groundwater due to regional pumping or rain fall and 2) generate a depth and TDS (Total Dissolved Solids) profile of the wetland pond to locate regions where groundwater maybe entering the lake.

  9. Atmospheric volatile organic compound measurements during the 1996 Paso del Norte Ozone Study.

    PubMed

    Seila, R L; Main, H H; Arriaga, J L; Martínez, G; Ramadan, A B

    2001-08-10

    Ambient air VOC samples were collected at surface air quality monitoring sites, near sources of interest, and aloft on the US (El Paso) and Mexican (Ciudad Juárez) side of the border during a six-week period of the 1996 Paso del Norte Ozone Study. Samples were collected at five sites, three on the US side and two on the Mexican side, during nine intensive operation days when high ozone levels were forecast for the area. Six other sites were sampled to characterize up-wind, down-wind and other emission sources. Samples for determining source profiles were collected for rush hour traffic, propane-powered bus exhaust, automobile paint shop emissions, propane fuels, and industrial manufacturing in Cd. Juárez and a refinery in El Paso. Most samples were collected in electro-polished stainless steel canisters for determination of C2 to C(10+) hydrocarbons by GC-FID. Carbonyl samples were collected on DNPH impregnated cartridges at three surface sites during aircraft flights and analyzed by HPLC. This paper presents the spatial and temporal characteristics of VOC species concentrations and compositions to examine the differences and similarities of the various locations and time periods. Overall surface, total non-methane hydrocarbon values ranged from 0.1 to 3.4 ppmC with the highest concentrations being recorded in the morning and evening at five vehicle-dominated sites, three in Cd. Juárez and two in El Paso. Toluene in El Paso samples and propane, which is used as a cooking and transportation fuel in Cd. Juárez, were the most abundant hydrocarbons. The most abundant carbonyls were acetaldehyde, acetone and formaldehyde. PMID:11523535

  10. Hydrocarbon source apportionment for the 1996 Paso del Norte Ozone Study.

    PubMed

    Fujita, E M

    2001-08-10

    The 1996 Paso del Norte (PdN) ozone study was conducted to improve current understanding of the significant meteorological and air quality processes that lead to high concentrations of ozone in El Paso, Texas (USA) and Ciudad Juárez, Chihuahua (Mexico). Two-hour canister samples were collected five times daily at 05.00-07.00 h, 07.00-09.00 h, 09.00-11.00 h, 11.00-13.00 h, and 15.00-17.00 h MST during intensive study periods at one urban and one rural site on each side of the border. An automated gas chromatograph was operated at one site in central El Paso. Source profiles (the fractional chemical composition of emissions) from motor vehicles, gasoline, liquefied petroleum gas, and commercial natural gas were combined with source profiles from other studies for input to the Chemical Mass Balance (CMB) receptor model to apportion the measured non-methane hydrocarbons (NMHC) to sources. On-road vehicle emissions accounted for one-half to two-thirds of the NMHC in Ciudad Juárez and El Paso with the highest contributions occurring during the morning and afternoon commute periods. Emissions from diesel exhaust contributed approximately 2-3% of NMHC in Ciudad Juárez and less than 2% in El Paso. The average sum of liquid gasoline and gasoline vapor increased during the day in Ciudad Juárez from 2% at 06.00 h to approximately 12% at 16.00 h. Diurnal and day-of-the-week patterns in the liquid gasoline contributions are essentially identical to the corresponding patterns for motor vehicle exhaust, which suggest that a large fraction of the liquid gasoline contribution may be associated with tailpipe emissions rather than evaporative emissions from motor vehicles or industrial sources. Including the sum of the two sources put the upper limit for tailpipe contributions at 60-70% of NMHC. PMID:11516134

  11. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.

    1992-01-01

    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  12. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  13. Titanium Mass-balance Analysis of Paso Robles Soils: Elemental Gains and Losses as Affected by Acid Alteration Fluids

    NASA Technical Reports Server (NTRS)

    Sutter, Brad; Ming, Douglas W.

    2010-01-01

    The Columbia Hills soils have been exposed to aqueous alteration in alkaline [1] as well as acid conditions [2,3]. The Paso Robles class soils are bright soils that possess the highest S concentration of any soil measured on Mars [2]. Ferric-sulfate detection by Moessbauer analysis indicated that acid solutions were involved in forming these soils [4]. These soils are proposed to have formed by alteration of nearby rock by volcanic hydrothermal or fumarolic activity. The Paso Robles soils consist of the original Paso Robles-disturbed-Pasadena (PR-dist), Paso Robles- PasoLight (PR-PL), Arad-Samra, Arad-Hula, Tyrone- Berker Island1 and Tyrone-MountDarwin [2 ,3. ]Chemical characteristics indicate that the PR-dist and PR-PL soils could be derived from acid weathering of local Wishstone rocks while the Samra and Hula soils are likely derived from local Algonquin-Iroquet rock [3]. The Paso Robles soils were exposed to acidic sulfur bearing fluids; however, little else is known about the chemistry of the alteration fluid and its effects on the alteration of the proposed parent materials. The objectives of this work are to conduct titanium normalized mass-balance analysis to1) assess elemental gains and losses from the parent materials in the formation of the Paso Robles soils and 2) utilize this information to indicate the chemical nature of the alteration fluids.

  14. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  15. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  16. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  17. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  18. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  19. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  20. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on...

  1. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives... primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters) in... of water to protect the primer from impact. Slit packages of prill, water gel, or emulsions are...

  2. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Use § 56.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... impact. Slit packages of prill, water gel, or emulsions are not considered rigid cartridges and may...

  3. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-SURFACE METAL AND NONMETAL MINES Explosives Use § 56.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... impact. Slit packages of prill, water gel, or emulsions are not considered rigid cartridges and may...

  4. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SAFETY AND HEALTH SAFETY AND HEALTH STANDARDS-UNDERGROUND METAL AND NONMETAL MINES Explosives... primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters) in... of water to protect the primer from impact. Slit packages of prill, water gel, or emulsions are...

  5. [DNA amplification using PCR with abutting primers].

    PubMed

    Garafutdinov, R R; Galimova, A A; Sakhabutdinova, A R; Vakhitov, V A; Chemeris, A V

    2015-01-01

    DNA analysis of ñîmplex biological objects (wastewater, soil, archaeological and forensic samples, etc.) is currently of great interest. DNA of these objects is characterized by low suitability for research due to the violation of its integrity and chemical structure; thus, the detection of specific nucleic acid fragments can be achieved by PCR with contiguous primers. In this paper, we present the results that clarify the specific characteristics of PCR with abutting primers. The 3'-ends of these primers are annealed at adjacent nucleotides of complementary chains of DNA target. It has been shown that the proximity of primers enables the formation of specific reaction products with a higher sensitivity and less reaction time. Using artificially damaged DNA and DNA from the soil we demonstrated that the abutting primers provide assured detection of specific DNA fragments. The results of this work may be taken into account in PCR with degraded (fragmented) DNA.

  6. Electrostatic Discharge testing of propellants and primers

    SciTech Connect

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  7. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  8. MRI Biosensors: A Short Primer

    PubMed Central

    Louie, Angelique

    2013-01-01

    Interest in Magnetic Resonance Imaging (MRI) contrast agents for molecular imaging of biological function experienced a surge of excitement approximately 20 years ago with the development of the first activatable contrast agents that could act as biosensors and turn “on” in response to a specific biological activity. This brief tutorial, based on a short course lecture from the 2011 ISMRM meeting, provides an overview of underlying principles governing the design of biosensing contrast agents. We describe mechanisms by which a magnetic resonance imaging (MRI) contrast agent can be made into a sensor for both T1 and T2 types contrast agents. Examples of biological activities that can interact with a contrast agent are discussed using specific examples from the recent literature to illustrate the primary mechanisms of action that have been utilized to achieve activation. MRI sensors for pH, ion binding, enzyme cleavage, and oxidation-reduction are presented. This article is not meant to be an exhaustive review, but an illustrative primer to explain how activation can be achieved for an MRI contrast agent. Chemical exchange saturation transfer (CEST) is not covered as these agents were covered in a separate lecture. PMID:23996662

  9. Climate change primer for respirologists.

    PubMed

    Takaro, Tim K; Henderson, Sarah B

    2015-01-01

    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion.

  10. PACES Participation in Educational Outreach Programs at the University of Texas at El Paso

    NASA Technical Reports Server (NTRS)

    Dodge, Rebecca L.

    1997-01-01

    The University of Texas at El Paso (UTEP) is involved in several initiatives to improve science education within the El Paso area public schools. These include outreach efforts into the K- 12 classrooms; training programs for in-service teachers; and the introduction of a strong science core curricula within the College of Education. The Pan American Center for Earth and Environmental Studies (PACES), a NASA-funded University Research Center, will leverage off the goals of these existing initiatives to provide curriculum support materials at all levels. We will use currently available Mission to Planet Earth (MTPE) materials as well as new materials developed specifically for this region, in an effort to introduce the Earth System Science perspective into these programs. In addition, we are developing curriculum support materials and classes within the Geology and Computer Departments, to provide education in the area of remote sensing and GIS applications at the undergraduate and graduate levels.

  11. Geoseismic issues considered for design of the Samalayuca pipeline, El Paso County, Texas

    SciTech Connect

    Keaton, J.R.; Beckwith, G.H.; Medina, O.

    1995-12-31

    The Samalayuca, Pipeline is a proposed 20-inch-diameter natural gas pipeline extending approximately 21 miles from the Hueco Compressor Station on the El Paso Natural Gas main line to the International Boundary with Mexico near Clint, Texas, about 25 miles southeast of El Paso. The purpose of the project is to supply gas for power generation at a plant south of Cuidad Juarez, Chihuahua, Mexico. Geoseismic issues considered in the design of the Samalayuca Pipeline consisted of surface fault rupture, earthquake-induced landslides, and liquefaction-induced ground displacement.Faults represent two kinds of hazard to pipeline facilities: surface displacement and strong shaking. Earthquake-induced landslides and liquefaction require strong shaking to occur before these processes represent hazards to buried pipelines.

  12. Bacterial populations in the groundwater on the US-Mexico border in El Paso County, Texas.

    PubMed

    Mroz, R C; Pillai, S D

    1994-12-01

    In El Paso County, Texas, 73 domestic wells were sampled using a variety of selective media to determine the extent of bacterial contamination of the groundwater on the US side of the United States-Mexico border. Thirteen wells were contaminated by fecal coliforms, whereas other wells contained a variety of bacterial genera including some potential pathogens that normally would not be detected by standard methods of water testing.

  13. Composition and Formation of the "Paso Robles" Class Soils at Gusev Crater

    NASA Technical Reports Server (NTRS)

    Yen, A. S.; Morris, Richard V.; Gellert, R.; Clark, B. C.; Ming, Douglas W.; Klingelhoefer, G.; McCoy, T. J.; Schmidt, M. E.

    2007-01-01

    Light-toned, subsurface soil deposits have been excavated by the Mars Exploration Rover (MER) Spirit in six distinct locations along its traverse across the Columbia Hills of Gusev Crater. Samples at two of these sites have been analyzed in detail by the M ssbauer (MB) and Alpha Particle X-ray Spectrometers (APXS), providing information on iron mineralogy and elemental chemistry, respectively. These soils are referred to as "Paso Robles" class deposits.

  14. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  15. The Influence of Photolysis Rate Constants in Ozone Production for the Paso del Norte Region

    NASA Astrophysics Data System (ADS)

    Becerra, Fernando; Fitzgerald, Rosa

    2012-03-01

    In this research work we are focusing on understanding the relationship between photolysis rates and the photochemical ozone changes observed in the Paso del Norte region. The city of El Paso, Texas together with Ciudad Juarez, Mexico, forms the largest contiguous bi-national metropolitan area. This region suffers year-round ozone pollution events, and a better understanding is needed to mitigate them. Previous studies have found that ambient ozone concentrations tend to be higher on weekends rather than on weekdays, this phenomenon being referred to, as the ``weekend effect.'' If the ozone standard is exceeded more frequently on weekends, then this phenomenon must be considered in the design of ozone control strategies. In this work we investigate some of the most representative weekend ozone episodes at El Paso, TX, during the years 2009, 2010 and 2011 using the ozone photolysis rates. In this research the TUV radiative-transfer model is used to calculate the local photolysis rates and a UV MFRSR instrument is used to obtain experimental parameters. Seasonal variations and the weekday-weekend effect is studied. The results of this research will help to understand the underlying behavior of the photolysis rate constants when different atmospheric conditions are present.

  16. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  17. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  18. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-01-01

    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  19. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  20. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  1. ANL supplement to the UNICOS primer

    SciTech Connect

    Wiley, M.S.; Karlovsky, S.R.

    1991-06-01

    The ANL Supplement to the UNICOS Primer (ANL/TM 460) introduces the Cray X-MP interactive and batch services available at Argonne National Laboratory. It serves as a companion to the UNICOS Primer (Cray publication SG-2010 6.0). Whereas the UNICOS Primer discusses standard Unix issues of Cray computing, this manual discusses those issues specific to Cray computing at ANL. If this is your first experience on a Unix-based system, we assume that you have read at least Chapters 1 through 3 of the UNICOS Primer. The Glossary at the back of the UNICOS Primer will also be useful to you. If you are already familiar with a Unix system, it should suffice to keep the UNICOS Primer handy as you use this document. To learn about Unix programming in greater detail, we recommend A Practical Guide to the Unix System, by Mark G. Sobell. This manual and all other sources referred to in this document are available for purchase at the Document Distribution Counter in Building 221, Room A-134. We assume that you have already read the Guide to Computing at ANL (ANL/TM 336) to get an overview of all the computing facilities and services available at Argonne National Laboratory. You should also refer to Recommended Documentation for Computer Users at ANL (ANL/TM 379) for additional guidance in selecting available documentation that will best fill your particular computing needs.

  2. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.

    1995-02-01

    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  3. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    PubMed

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/. PMID:21622660

  4. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  5. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  6. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  7. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner

    2004-01-01

    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open with a…

  8. Winter season air pollution in El Paso-Ciudad Juarez. A review of air pollution studies in an international airshed

    SciTech Connect

    Einfeld, W.; Church, H.W.

    1995-03-01

    This report summarizes a number of research efforts completed over the past 20 years in the El Paso del Norte region to characterize pollution sources and air quality trends. The El Paso del Norte region encompasses the cities of El Paso, Texas and Ciudad Juarez, Chihuahua and is representative of many US-Mexico border communities that are facing important air quality issues as population growth and industrialization of Mexican border communities continue. Special attention is given to a group of studies carried out under special US Congressional funding and administered by the US Environmental Protection Agency. Many of these studies were fielded within the last several years to develop a better understanding of air pollution sources and trends in this typical border community. Summary findings from a wide range of studies dealing with such issues as the temporal and spatial distribution of pollutants and pollution potential from both stationary and mobile sources in both cities are presented. Particular emphasis is given to a recent study in El Paso-Ciudad Juarez that focussed on winter season PM{sub 10} pollution in El Paso-Ciudad Juarez. Preliminary estimates from this short-term study reveal that biomass combustion products and crustal material are significant components of winter season PM{sub 10} in this international border community.

  9. The 1996 Paso del Norte Ozone Study: analysis of meteorological and air quality data that influence local ozone concentrations.

    PubMed

    MacDonal, C P; Roberts, P T; Main, H H; Dye, T S; Coe, D L; Yarbrough, J

    2001-08-10

    The 1996 Paso del Norte Ozone Study and subsequent data analyses were implemented to develop an understanding of the chemical and physical processes which lead to high concentrations of ozone in the Paso del Norte study area which includes El Paso County, Texas, Sunland Park, New Mexico, and Ciudad Juárez, Mexico. Both the data and data analysis results are being used to support photochemical grid modeling. El Paso County and Sunland Park fail to meet the National Ambient Air Quality Standard (NAAQS) for ozone, and neighboring Ciudad Juárez fails to meet the Mexican ambient standard for ozone. This paper summarizes the measurement campaigns of the 1996 Paso del Norte Ozone Study and the findings and conclusions that arose from subsequent data analyses. Data analyses showed that high ozone concentrations resulted from a combination of conditions, including high surface temperatures, strong sunlight with few clouds, light surface winds and high concentrations of ozone precursors at ground level in the morning, and slow convective boundary layer (CBL) growth. Synoptic-scale meteorological conditions observed during high ozone episodes included an aloft high-pressure system and aloft warming. Aloft carryover of ozone and ozone precursors did not significantly contribute to high concentrations of ozone at the surface.

  10. Results from an investigation of the integration of wind energy into the El Paso Electric grid system

    SciTech Connect

    Moroz, E.M.; Parks, N.J.; Swift, A.H.; Traichal, P.A.

    1997-12-31

    This paper documents some preliminary results from an evaluation of the costs and benefits to be gained from the integration of wind generated electricity into the El Paso Electric grid system. The study focused on the utilization of the considerable known wind potential of the Guadalupe/Delaware Mountains region, but also looked at other energetic wind resources within 15 miles of El Paso Electric`s Grid. The original project`s goal was to identify the added value of wind in terms of jobs, line support, risk reduction etc., that wind energy could bring to El Paso Electric. Although these goals have not yet been achieved the potential for water savings and reductions in gaseous emissions have been documented. Thus this paper focuses mainly on the water consumption and criteria pollutant emissions that could be avoided by adding wind energy to El Paso Electric`s generation mix. Preliminary data from a renewables attitude survey indicates that, from the 338 respondents, there is overwhelming public support for utilizing such renewable sources of electricity. This case study, which should be of direct relevance to the arid southwestern states and beyond, was sponsored by the Environmental Protection Agency (EPA) and conducted in cooperation with El Paso Electric.

  11. Investigation of Soil Permeability and Hydrological Properties of Flood Plain Deposits of the Rio Grande in EL Paso TX

    NASA Astrophysics Data System (ADS)

    Schacht, D.; Jin, L.; Doser, D. I.

    2013-12-01

    The various soil types within the flood plains of Rio Grande in El Paso 's Lower Valley have long been utilized by local farmers. These soils are typically more conducive to farming than the more recent (Pliocene) sandy soils outside of the flood plain region. This project will explore the various properties of these soils types such as their grain size, depths, extent, and hydrological conductivity utilizing various geophysical and geochemical methods. The study site is located in El Paso 's Lower Valley and is situated in an actively farmed area. Soil maps from the Natural Resource Conservation Service (NRCS) and variations in vegetation growth will help delineate locations of soil types in the study area. The information that will be collected will produce baseline data to help track expected seasonal variations in the soil's moisture content and in the depth of the local water table. This project represents a collaboration between El Paso Community College's and the University of Texas at El Paso's Departments of Geological Sciences as a means for students majoring in Geological Sciences at El Paso Community College to gain hands on experience in researching geological issues through partnerships with their future institution and faculty.

  12. Primerize: automated primer assembly for transcribing non-coding RNA domains

    PubMed Central

    Tian, Siqi; Yesselman, Joseph D.; Cordero, Pablo; Das, Rhiju

    2015-01-01

    Customized RNA synthesis is in demand for biological and biotechnological research. While chemical synthesis and gel or chromatographic purification of RNA is costly and difficult for sequences longer than tens of nucleotides, a pipeline of primer assembly of DNA templates, in vitro transcription by T7 RNA polymerase and kit-based purification provides a cost-effective and fast alternative for preparing RNA molecules. Nevertheless, designing template primers that optimize cost and avoid mispriming during polymerase chain reaction currently requires expert inspection, downloading specialized software or both. Online servers are currently not available or maintained for the task. We report here a server named Primerize that makes available an efficient algorithm for primer design developed and experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides. Free access: http://primerize.stanford.edu. PMID:25999345

  13. Associations between urban air pollution and pediatric asthma control in El Paso, Texas.

    PubMed

    Zora, Jennifer E; Sarnat, Stefanie Ebelt; Raysoni, Amit U; Johnson, Brent A; Li, Wen-Whai; Greenwald, Roby; Holguin, Fernando; Stock, Thomas H; Sarnat, Jeremy A

    2013-03-15

    Exposure to traffic-related pollutants poses a serious health threat to residents of major urban centers around the world. In El Paso, Texas, this problem is exacerbated by the region's arid weather, frequent temperature inversions, heavy border traffic, and an aged, poorly maintained vehicle fleet. The impact of exposure to traffic pollution, particularly on children with asthma, is poorly understood. Tracking the environmental health burden related to traffic pollution in El Paso is difficult, especially within school microenvironments, because of the lack of sensitive environmental health indicator data. The Asthma Control Questionnaire (ACQ) is a survey tool for the measurement of overall asthma control, yet has not previously been considered as an outcome in air pollution health effect research. We conducted a repeated measure panel study to examine weekly associations between ACQ scores and traffic- and non-traffic air pollutants among asthmatic schoolchildren in El Paso. In the main one- and two-pollutant epidemiologic models, we found non-significant, albeit suggestive, positive associations between ACQ scores and respirable particulate matter (PM10), coarse particulate matter (PM10-2.5), fine particulate matter (PM2.5), black carbon (BC), nitrogen dioxide (NO2), benzene, toluene, and ozone (O3). Notably, associations were stronger and significant for some subgroups, in particular among subjects taking daily inhaled corticosteroids. This pattern may indicate heightened immune system response in more severe asthmatics, those with worse asthma "control" and higher ACQ scores at baseline. If the ACQ is appropriately used in the context of air pollution studies, it could reflect clinically measurable and biologically relevant changes in lung function and asthma symptoms that result from poor air quality and may increase our understanding of how air pollution influences asthma exacerbation.

  14. Obstetric emergencies at the United States–Mexico border crossings in El Paso, Texas

    PubMed Central

    McDonald, Jill A.; Rishel, Karen; Escobedo, Miguel A.; Arellano, Danielle E.; Cunningham, Timothy J.

    2015-01-01

    Objective To describe the frequency, characteristics, and patient outcomes for women who accessed Emergency Medical Services (EMS) for obstetric emergencies at the ports of entry (POE) between El Paso, Texas, United States of America, and Ciudad Juárez, Chihuahua, Mexico. Methods A descriptive study of women 12–49 years of age for whom an EMS ambulance was called to an El Paso POE location from December 2008–April 2011 was conducted. Women were identified through surveillance of EMS records. EMS and emergency department (ED) records were abstracted for all women through December 2009 and for women with an obstetric emergency through April 2011. For obstetric patients admitted to the hospital, additional prenatal and birth characteristics were collected. Frequencies and proportions were estimated for each variable; differences between residents of the United States and Mexico were tested. Results During December 2008–December 2009, 47.6% (68/143) of women receiving EMS assistance at an El Paso POE had an obstetric emergency, nearly 20 times the proportion for Texas overall. During December 2008–April 2011, 60.1% (66/109) of obstetric patients with ED records were admitted to hospital and 52 gave birth before discharge. Preterm birth (23.1%; No. = 12), low birth weight (9.6%; No. = 5), birth in transit (7.7%; No. = 4), and postpartum hemorrhage (5.8%; No. = 3) were common; fewer than one-half the women (46.2%; No. = 24) had evidence of prenatal care. Conclusions The high proportion of obstetric EMS transports and high prevalence of complications in this population suggest a need for binational risk reduction efforts. PMID:25915011

  15. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  16. Climate Change, Health, and Communication: A Primer.

    PubMed

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  17. PrimerIdent: A web based tool for conserved primer design

    PubMed Central

    Pessoa, Alberto M; Pereira, Susana; Teixeira, Jorge

    2010-01-01

    Conserved primers across multiple species and simultaneously specific for a certain isozyme can be rare and difficult to find. PrimerIdent was developed aiming to automate this primer design and selection process in a given nucleotide sequence alignment, providing an intuitive, easy to interpret graphical result, which offers a list of all possible primers that meet the user criteria, with a colour-code identity to each sequence in the alignment. The software here presented is a simple and intuitive web based tool that is suitable for distinguishing very similar nucleotide sequences, such as isozymes­coding sequences, to enable the conserved primer design across multiple species, necessary for approaches that rely on knowing if a primer is suitable for a certain set of pre-aligned sequences, to design a specific primer to a certain sequence variation, or a combination thereof. This extremely useful software can, therefore, be used as a tool for the specific amplification of individual members of multigenic families across related species and also to evaluate the differential expression of isogenes for a given species. Availability http://primerident.up.pt PMID:21346862

  18. Resource investigation of low- and moderate-temperature geothermal areas in Paso Robles, California

    SciTech Connect

    Campion, L.F.; Chapman, R.H.; Chase, G.W.; Youngs, L.G.

    1983-01-01

    Ninety-eight geothermal wells and springs were identified and plotted, and a geologic map and cross sections were compiled. Detailed geophysical, geochemical, and geological surveys were conducted. The geological and geophysical work delineated the basement highs and trough-like depressions that can exercise control on the occurrence of the thermal waters. The Rinconada fault was also evident. Cross sections drawn from oil well logs show the sediments conforming against these basement highs and filling the depressions. It is along the locations where the sediments meet the basement highs that three natural warm springs in the area occur. Deep circulation of meteoric waters along faults seems to be a reasonable source for the warm water. The Santa Margarita, Pancho Rico, and Paso Robles Formations would be the first permeable zones that abut the faults through which water would enter. Temperatures and interpretation of well logs indicate the warmest aquifer at the base of the Paso Robles Formation. Warm water may be entering higher up in the section, but mixing with water from cooler zones seems to be evident. Geothermometry indicates reservoir temperatures could be as high as 91/sup 0/C (196/sup 0/F).

  19. Meteorological Simulations of Ozone Episode Case Days during the 1996 Paso del Norte Ozone Study

    SciTech Connect

    Brown, M.J.; Costigan, K.; Muller, C.; Wang, G.

    1999-02-01

    Meteorological simulations centered around the border cities of El Paso and Ciudad Juarez have been performed during an ozone episode that occurred on Aug. 13,1996 during the 1996 Paso del Norte Ozone Study field campaign. Simulations were petiormed using the HOTMAC mesoscale meteorological model using a 1,2,4, and 8 km horizontal grid size nested mesh system. Investigation of the vertical structure and evolution of the atmospheric boundary layer for the Aug. 11-13 time period is emphasized in this paper. Comparison of model-produced wind speed profiles to rawirisonde and radar profiler measurements shows reasonable agreement. A persistent upper-level jet was captured in the model simulations through data assimilation. In the evening hours, the model was not able to produce the strong wind direction shear seen in the radar wind profiles. Based on virtual potential temperature profile comparisons, the model appears to correctly simulate the daytime growth of the convective mixed layer. However, the model underestimates the cooling of the surface layer at night. We found that the upper-level jet significantly impacted the turbulence structure of the boundary layer, leading to relatively high turbulent kinetic energy (tke) values aloft at night. The model indicates that these high tke values aloft enhance the mid-morning growth of the boundary layer. No upper-level turbulence measurements were available to verify this finding, however. Radar profiler-derived mixing heights do indicate relatively rapid morning growth of the mixed layer.

  20. Ambient Concentrations of Metabolic Disrupting Chemicals and Children’s Academic Achievement in El Paso, Texas

    PubMed Central

    Clark-Reyna, Stephanie E.; Grineski, Sara E.; Collins, Timothy W.

    2016-01-01

    Concerns about children’s weight have steadily risen alongside the manufacture and use of myriad chemicals in the US. One class of chemicals, known as metabolic disruptors, interfere with human endocrine and metabolic functioning and are of specific concern to children’s health and development. This article examines the effect of residential concentrations of metabolic disrupting chemicals on children’s school performance for the first time. Census tract-level ambient concentrations for known metabolic disruptors come from the US Environmental Protection Agency’s National Air Toxics Assessment. Other measures were drawn from a survey of primary caretakers of 4th and 5th grade children in El Paso Independent School District (El Paso, TX, USA). A mediation model is employed to examine two hypothetical pathways through which the ambient level of metabolic disruptors at a child’s home might affect grade point average. Results indicate that concentrations of metabolic disruptors are statistically significantly associated with lower grade point averages directly and indirectly through body mass index. Findings from this study have practical implications for environmental justice research and chemical policy reform in the US. PMID:27598179

  1. Increasing Minority Participation and Matriculation in the Geosciences at El Paso Community College

    NASA Astrophysics Data System (ADS)

    Villalobos, J. I.

    2011-12-01

    Community colleges currently serve 44% of all undergraduate students and 45% of all of all first time freshmen in the US. Hispanics now constitute 15% of the general population and 19% of the college population in the US. This increase has led to more institutions emerging as HSI (Hispanic Serving Institution) by the federal government. These facts illustrate the potential community colleges hold to encourage STEM (Science Technology Engineering and Math) majors to minorities as well as non-minorities. But the reality is the number of STEM degrees awarded at community colleges has not followed the same trends in enrollment. El Paso Community College (EPCC) currently enrolls 27,000 students with 85% of the student body being Hispanic. More than 130 programs of study are offered including an Associate of Science degree in Geological Sciences. Over the past three years we have implemented several initiatives in our effort to increase the number of Geological Science (GS) majors at EPCC. These efforts are aimed to decrease attrition rates of science majors by; streamlining the GS degree plan along with the process of course registration, introduce field-based research projects to students to allow hands on research, develop a work relationships with students and university faculty, increase the number of geology courses offered at EPCC including a field-based capstone course (GEOL 2407- Geological Field Methods), and strengthening the educational-bridge between the geological science departments of EPCC and University of Texas at El Paso.

  2. Hydrothermal processes at Gusev Crater: An evaluation of Paso Robles class soils

    USGS Publications Warehouse

    Yen, A. S.; Morris, R.V.; Clark, B. C.; Gellert, Ralf; Knudson, A.T.; Squyres, S.; Mittlefehldt, D. W.; Ming, D. W.; Arvidson, R.; McCoy, T.; Schmidt, M.; Hurowitz, J.; Li, R.; Johnson, J. R.

    2008-01-01

    The Mars Exploration Rover Spirit analyzed multiple occurrences of sulfur-rich, light-toned soils along its traverse within Gusev Crater. These hydrated deposits are not readily apparent in images of undisturbed soil but are present at shallow depths and were exposed by the actions of the rover wheels. Referred to as 'Paso Robles' class soils, they are dominated by ferric iron sulfates, silica, and Mg-sulfates. Ca-sulfates, Ca-phosphates, and other minor phases are also indicated in certain specific samples. The chemical compositions are highly variable over both centimeter-scale distances and between the widely separated exposures, but they clearly reflect the elemental signatures of nearby rocks. The quantity of typical basaltic soil mixed into the light-toned materials prior to excavation by the rover wheels is minimal, suggesting negligible reworking of the deposits after their initial formation. The mineralogy, geochemistry, variability, association with local compositions, and geologic setting of the deposits suggest that Paso Robles class soils likely formed as hydrothermal and famarolic condensates derived from magma degassing and/ or oxidative alteration of crustal iron sulfide deposits. Their occurrence as unconsolidated, near-surface soils permits, though does not require, an age that is significantly younger than that of the surrounding rocks. Copyright 2008 by the American Geophysical Union.

  3. Preliminary isostatic residual gravity anomaly map of Paso Robles 30 x 60 minute quadrangle, California

    USGS Publications Warehouse

    McPhee, D.K.; Langenheim, V.E.; Watt, J.T.

    2011-01-01

    This isostatic residual gravity map is part of an effort to map the three-dimensional distribution of rocks in the central California Coast Ranges and will serve as a basis for modeling the shape of basins and for determining the location and geometry of faults within the Paso Robles quadrangle. Local spatial variations in the Earth\\'s gravity field, after accounting for variations caused by elevation, terrain, and deep crustal structure reflect the distribution of densities in the mid- to upper crust. Densities often can be related to rock type, and abrupt spatial changes in density commonly mark lithological or structural boundaries. High-density rocks exposed within the central Coast Ranges include Mesozoic granitic rocks (exposed northwest of Paso Robles), Jurassic to Cretaceous marine strata of the Great Valley Sequence (exposed primarily northeast of the San Andreas fault), and Mesozoic sedimentary and volcanic rocks of the Franciscan Complex [exposed in the Santa Lucia Range and northeast of the San Andreas fault (SAF) near Parkfield, California]. Alluvial sediments and Tertiary sedimentary rocks are characterized by low densities; however, with increasing depth of burial and age, the densities of these rocks may become indistinguishable from those of older basement rocks.

  4. The displaced eugeoclinal rocks in the El Paso Mountains and northern Mojave Desert: A Triassic sliver

    SciTech Connect

    Miller, J.S.; Glazner, A.F. . Dept. of Geology); Walker, J.D.; Martin, M.W. . Dept. of Geology)

    1993-04-01

    Many workers have drawn attention to the displaced eugeoclinal rocks in the northern Mojave Desert and El Paso Mountains and their importance in models for the development of an active continental margin in the western Cordillera. Existing models can generally for either strike-slip juxtaposition or thrust emplacement. New field data, U-Pb zircon geochronology, and isotopic data for metasedimentary rocks and plutons in the northern Mojave Desert and El Paso Mountains shed light on the timing and mechanism of emplacement of the eugeoclinal allocthon. The observations and data above indicate that Early Triassic plutons in the northern Mojave Desert came through oceanic lithosphere but later Jurassic plutons intercepted continental lithosphere. The authors suggest a model where eugeoclinal rocks were deposited on oceanic crust which was initially brought southward along a strike-slip fault and later thrust eastward over the cratonal assemblage. Permian thrusting is incompatible with their data and observations. Intrusion of lower Triassic strata by Early Triassic plutons in the Lane Mountain area permits some Early Triassic thrusting but the oceanic affinity of the plutons implies that thrusting did not involve continental lithosphere.

  5. Meteorological simulations of boundary-layer structure during the 1996 Paso del Norte Ozone Study.

    PubMed

    Brown, M J; Muller, C; Wang, G; Costigan, K

    2001-08-10

    Meteorological simulations centered around the border cities of El Paso and Ciudad Juárez have been performed during an ozone episode that occurred on August 13, 1996 during the 1996 Paso del Norte Ozone Study field campaign. Simulations were performed using the HOTMAC boundary-layer meteorological model using a 1, 2, 4 and 8-km horizontal grid size nested mesh system. Investigation of the vertical structure and evolution of the atmospheric boundary layer for the August 12-14 time period is emphasized in this paper due to its suspected importance in precipitating the ozone episode [Sci Total Environ (2001)]. This period was characterized by a slowly-evolving high pressure system over the region, a persistent upper-level jet at 2500-3500 m above ground level (agl), deep daytime mixed layer heights of 3500 m depth and unusually deep nighttime stable layers extending up to 2500 m above the ground. The fact that the boundary-layer growth stalled on the morning of August 13 relative to that on August 12 has been suggested as a possible reason for the ozone episode on the 13th. In addition, relatively weak surface-level winds were measured on August 13. Using both model results and experimental data we hypothesize explanations for the slower mixed-layer growth on the morning of the 13th and the stronger surface-level winds found on the 12th and 14th.

  6. Ambient Concentrations of Metabolic Disrupting Chemicals and Children's Academic Achievement in El Paso, Texas.

    PubMed

    Clark-Reyna, Stephanie E; Grineski, Sara E; Collins, Timothy W

    2016-01-01

    Concerns about children's weight have steadily risen alongside the manufacture and use of myriad chemicals in the US. One class of chemicals, known as metabolic disruptors, interfere with human endocrine and metabolic functioning and are of specific concern to children's health and development. This article examines the effect of residential concentrations of metabolic disrupting chemicals on children's school performance for the first time. Census tract-level ambient concentrations for known metabolic disruptors come from the US Environmental Protection Agency's National Air Toxics Assessment. Other measures were drawn from a survey of primary caretakers of 4th and 5th grade children in El Paso Independent School District (El Paso, TX, USA). A mediation model is employed to examine two hypothetical pathways through which the ambient level of metabolic disruptors at a child's home might affect grade point average. Results indicate that concentrations of metabolic disruptors are statistically significantly associated with lower grade point averages directly and indirectly through body mass index. Findings from this study have practical implications for environmental justice research and chemical policy reform in the US. PMID:27598179

  7. Depositional environments and diagenesis of El Paso Group, Southern Hueco Mountains, Hudspeth County, Texas

    SciTech Connect

    Aluka, I.J.

    1988-01-01

    The El Paso Group, a predominantly carbonate sequence, overlies the time-transgressive Cambrian-Ordovician Bliss Sandstone, and underlies the Upper Ordovician Montoya Group. The sequence contains three units (in ascending order): lower limestone, middle cherty limestone, and upper dolomite. The units were deposited in a shelf lagoon with open and restricted circulation, subtidal and intertidal environments. Deposition in these environments is indicated by the presence of land-derived clastics (silt- and sand-size quartz), abundant pellets, micrite, a variety of textures (mudstones to grainstones), algal structures, cross-bedding, and inter-fingering of clastics with limestones due to sedimentary offlap and onlap resulting in clastic progradation west and east from the Diablo platform (the clastic source). The upper unit was, in part, deposited in a supratidal environment, as shown by the presence of abundant dolomite. In addition, the rocks of the El Paso Group were affected by various diagenetic processes, including dolomitization (supratidal dolomitization and dolomitization through meteoric mixing) and silicification, as exemplified by chert nodules and lenses and the presence of silica in intragranular voids and as intrapelmatozoan infillings. Silica partially replaced gastropods, cephalopods, and pelmatozoan ossicles. Recrystallization (aggrading neomorphism) converted carbonate muds into microspar and sparry calcite. Stylolitization (microstylolites and sutured stylolites) affected the rocks as indicated by the presence of iron oxides along the stylolites. The rocks were also affected by pyritization as shown silicified bioclasts.

  8. Summary of hydrologic information in the El Paso, Texas, area, with emphasis on ground-water studies, 1903-80

    USGS Publications Warehouse

    White, D.E.

    1983-01-01

    Flow in the Rio Grande is diverted for crop irrigation in the United States and the Republic of Mexico, and for limited municipal supply in El Paso. The flow is regulated by releases from reservoirs in New Mexico and varies widely in both quantity and quality (dissolved-solids concentrations). During 1943-80, the flow at El Paso ranged from 57,481 acre-feet (71 cubic hectometers) in 1956 to 631,800 acre-feet (779 cubic hectometers) in 1943 and averaged about 317,000 acre-feet per year (391 cubic hectometers).

  9. Size-Time-Composition Resolved Study of Aerosols Across El Paso, Texas in Fall 2008

    NASA Astrophysics Data System (ADS)

    Cahill, T. A.; Gill, T. E.; Pingitore, N. E.; Olvera, H. A.; Clague, J. W.; Barnes, D. E.; Perry, K. D.; Li, W.; Amaya, M. A.

    2009-12-01

    Systematic variations in the absolute amounts, size and composition of airborne particulate matter (PM) across the El Paso, Texas metropolitan area may differentially impact the respiratory status (e.g., asthma) and overall health of the local population. To understand these variations, we collected size-time resolved samples of PM with DRUM samplers during a one-month period in late autumn 2008 at three sites along a NW-SE (roughly upwind-downwind) transect across El Paso’s airshed. The DRUM sampler is a rotating-drum impactor separating and collecting aerosols on Mylar strips mounted on the drums, in 8 size stages from 10 μm to <0.1 μm. DRUM strips are analyzed with 3-hr time resolution by β-gauge for mass and by synchrotron X-ray fluorescence for elemental composition. We collected samples at Santa Teresa, New Mexico (a minimally developed area NW of El Paso, at the edge of a sparsely-inhabited expanse of the Chihuahuan Desert), at the edge of the University of Texas- El Paso (UTEP) campus (in the urban core of El Paso), and at Socorro, Texas (a suburban area in the valley of the Rio Grande, SE of the urban core). Results illustrate sharp excursions in mass and element concentrations in aerosol-laden periods lasting from several hours to several days, associated with stagnant air, inversions, smoke events, dust/high wind/frontal passage, and/or daily traffic patterns, punctuated by several periods of reduced aerosol levels after Pacific frontal passages. Mass and absorption data show an increasing influence of carbonaceous (absorbing) aerosols with decreasing particle size <~1 μm, and increasing influence of mineral (scattering) aerosols with increasing particle size >~1 μm. Calcium/silicon ratios were high (>1), especially in coarser stages and during high wind events, reflecting wind erosion of the Chihuahuan Desert’s calcareous soils. Concentrations of chlorine, silicon, calcium, coarse potassium, and lead increased during high wind events, while

  10. Internet Primer: Workshop Design and Objectives.

    ERIC Educational Resources Information Center

    Laverty, Corinne Y. C.

    1996-01-01

    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  11. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  12. Theme: A Primer for Agricultural Education.

    ERIC Educational Resources Information Center

    Vaughn, Paul, Ed.; And Others

    1998-01-01

    Includes "A Primer for Agricultural Education" (Vaughn); "What Are the Goals and Purposes of Ag Ed?" (Case, Whitaker); "Basics of Supervised Experience" (Lee); "The FFA [Future Farmers of America]: Why Do We Have It?" (Case, Whitaker); "The Council: Providing Visionary Leadership" (Daniel, Vaughn); "Ag Communications" (Lockaby, Vernon); and…

  13. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye

    2008-01-01

    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  14. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  15. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  16. Issues Primer. EEE708 Negotiated Study Program.

    ERIC Educational Resources Information Center

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  17. GIS-modeled indicators of traffic-related air pollutants and adverse pulmonary health among children in El Paso, Texas, USA.

    EPA Science Inventory

    The El Paso Children?s Health Study examined 5,654 children enrolled in the El Paso, Texas public school district by questionnaire in 2001. Exposure measurements were first collected in the late fall of 1999. Then school-level and residence-level exposures to traffic-related air ...

  18. Variability in childhood allergy and asthma across ethnicity, language, and residency duration in El Paso, Texas: a cross-sectional study

    PubMed Central

    2009-01-01

    Background We evaluated the impact of migration to the USA-Mexico border city of El Paso, Texas (USA), parental language preference, and Hispanic ethnicity on childhood asthma to differentiate between its social and environmental determinants. Methods Allergy and asthma prevalence was surveyed among 9797 fourth and fifth grade children enrolled in the El Paso Independent School District. Parents completed a respiratory health questionnaire, in either English or Spanish, and a sub-sample of children received spirometry testing at their school. Here we report asthma and allergy outcomes across ethnicity and El Paso residency duration. Results Asthma and allergy prevalence increased with longer duration of El Paso residency independent of ethnicity and preferred language. Compared with immigrants who arrived in El Paso after entering first grade (18%), lifelong El Paso residents (68%) had more prevalent allergy (OR, 1.72; 95% CI, 1.32 - 2.24), prevalent asthma (OR, 1.75; 95% CI, 1.24 - 2.46), and current asthma (OR, 2.01; 95% CI, 1.37 - 2.95). Spirometric measurements (FEV1/FVC and FEF25-75) also declined with increasing duration of El Paso residency (0.16% and 0.35% annual reduction, respectively). Conclusion These findings suggest that a community-wide environmental exposure in El Paso, delayed pulmonary development, or increased health of immigrants may be associated with allergy and asthma development in children raised there. PMID:19995440

  19. A Study of Y.W.C.A. Services Performed for Pregnant and Parenting High School Students of El Paso from 1982 to 1985.

    ERIC Educational Resources Information Center

    Jackson, Ronald B.

    Questionnaires and interviews were used to study the effectiveness of programs provided for pregnant and parenting students by the Young Women's Christian Association (YWCA) of El Paso, Texas. The study focused on the School-Age Parent Center (SPC), established in 1974 by the El Paso Independent School District, and the YWCA programs and services…

  20. Early College High Schools Established from 2006 through 2008 in El Paso County, Texas: Discovering Factors Contributing to Hispanic Student Success

    ERIC Educational Resources Information Center

    Munoz, Maluka Dorotea

    2011-01-01

    The purpose of this study was to (a) identify factors contributing to the success of Hispanic students in four Early College High Schools (ECHSs) in El Paso County, (b) identify components of the ECHSs that can be realistically considered for implementation by administrators of larger public high schools in El Paso County, and (c) determine…

  1. Evaluation of new primers for CSF1PO.

    PubMed

    Yoshida, K; Sekiguchi, K; Kasai, K; Sato, H; Seta, S; Sensabaugh, G F

    1997-01-01

    We describe new primers for the detection of the STR polymorphism at the CSF1PO locus. These primers have been designed to produce shorter amplicons (150-182 bp) than the primers in standard use (295-327 bp). The reliability of the new primers for CSF1PO typing has been demonstrated by testing on known samples and by sequence analysis. These primers are superior to the original primers with regard to electrophoretic resolution and utility for typing of severely degraded DNA.

  2. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  3. Protegiendo a su familia de los terremotos-Los siete pasos a la seguridad para prepararse en caso de un terremoto (en espa?ol y en ingles)

    USGS Publications Warehouse

    Desarrollado por American Red Cross, Asian Pacific Fund

    2007-01-01

    Les escribimos esta carta para comunicarle un mensaje sumamente importante sobre las preparaciones de emergencia. Historicamente, hemos sufrido terremotos aqui en el Area de la Bahia de San Francisco que han causado graves privaciones para los residentes de la comunidad y da?os increibles a nuestras ciudades. Es probable que suframos un terremoto de gran magnitud en los proximos 30 a?os. Muchos de nosotros venimos de otros paises donde hemos pasado por terremotos y por eso creemos entenderlos. Sin embargo, la manera que nos preparamos para terremotos en nuestros paises de origen puede ser distinta a la que empleamos aca en los Estados Unidos. Muy pocas personas mueren a causa de los derrumbes de los edificios en el Area de la Bahia porque la mayoria de los edificios son construidos para resistir el sacudimiento de la tierra. Pero es muy probable que su familia no tenga atencion medica, alimentos o que esten separados del uno al otro por dias o semanas. Finalmente depende de usted mantener a su familia a salvo hasta que llegue asistencia, por eso les pedimos que nos unamos para aprender a cuidar a su familia antes, durante, y despues de un terremoto. El primer paso es leer este libro. Cada uno de su familia, ni?os y adultos, pueden aprender como prepararse para un terremoto. Haga participar e incluya sus ni?os; pueden ayudarle a prepararse. Aproveche las clases ofrecidas en su comunidad sobre las preparaciones de terremotos por la Cruz Roja Estadounidense (American Red Cross). Estos cursos de preparacion son gratis y disponibles en espa?ol para todos en la comunidad sin tomar en cuenta la historia de la familia, estado legal, genero o edad. Les recomendamos que tome ventaja de estas clases gratuitas. Para mas informacion consulte la ultima pagina de este libro. Recuerde que un terremoto puede ocurrir sin aviso y la unica manera de reducir el da?o de terremotos es estar preparados. !Preparese!

  4. Residential Exposure to Nighttime Retained Heat in the El Paso, Texas, USA Desert Metroplex

    NASA Astrophysics Data System (ADS)

    Amaya, M. A.; Mohammed, M.; Pingitore, N. E.; Aldouri, R. K.; Benedict, B. A.

    2013-12-01

    The urban heat island is a well recognized and extensively studied phenomenon that has accelerating importance resulting from two trends associated with world-wide population growth: increasing urbanization and global warming. Urbanization, particularly when unplanned and haphazard, changes such thermal parameters as albedo, surface roughness, and heat capacities of surface materials. Rapid urbanization in the contiguous El Paso, Texas, USA - Ciudad Juarez, Chihuahua, Mexico bi-national metroplex has produced an urban heat island that is warmer than the surrounding Chihuahuan desert (temperature: 35-40 C summer; high elevation: 600-1675 m; rainfall: less than 250 mm annual). Despite the extensive literature on the urban heat island, little is known about urban nighttime land surface temperatures. We employed infrared satellite imaging to establish the variation of nighttime neighborhood surface temperatures across the city of El Paso, as well as all of El Paso County. The underlying purpose of our continuing investigation is to evaluate the geography of morbidity risk: are different neighborhoods at different risk of high nighttime temperatures. Those risks can include heat stress, and irritability and sleep deprivation, with possible resultant violence. Heat exposure at night is significant because residents are at home and 90% of El Pasoans do not have 'refrigerated' air conditioning, but instead have evaporative coolers, which are less expensive to own and operate, but are less effective since they raise the humidity of the partially cooled air. Our geographically weighted regression model showed that both day and nighttime land surface temperatures correlated with the normalized difference vegetation index, population density, and albedo. The association with the index and albedo was stronger during the daytime and with population density during the nighttime. Vegetation (negative) and population density (positive) were the dominant temperature drivers, with

  5. Geospatial Distribution of Heavy Metals in an Urban Soil, El Paso, Texas, USA

    NASA Astrophysics Data System (ADS)

    Amaya, M. A.; Elkekli, A. R.; Clague, J. W.; Grimida, S. E.; Pingitore, N. E., Jr.

    2014-12-01

    Some 500 city blocks were selected randomly via population-based stratification. Equal volumes of soil collected from the public space (where present) in front of each house on a block yielded a composite sample. Composites provide neighborhood level "smoothing" relative to sampling many individual houses, and greatly decrease laboratory effort/cost. In the laboratory 10 g of soil were comminuted in a ceramic ball mill, mixed with cellulose/ paraffin binder, and pressed (20 tons) into a pellet. A Panalytical Epsilon5 EDS-XRF, using 8 sequential secondary target conditions and 12 NIST and USGS multi-element rock standards provided analyses. The concentration of Pb ranged from 11 to 420 ppm; Cr, 4.3 - 52 ppm; Cu, 6.5 - 390 ppm; Zn, 17 - 480 ppm; Cd, 0.4 - 12 ppm; and Sb, 2.9 - 20 ppm. High levels of all metals characterize the urban core area of El Paso, which dates to the late 19th Century. This area hosts both commercial and old residential structures, as well as major highways and a large railroad yard. There currently is, and was in the past, considerable light industry in the area. Two highly traveled highway and one railroad border crossing over the Rio Grande into contiguous Cd. Juarez (population close to 2 million) add to current and past contamination. A century-old Pb-Cu-Zn smelter, recently demolished, forms the western boundary of the urban core. Heavy metal pollution from the smelter is recognized near the former site. Its effect on the rest of the urban core is uncertain due to the current and former presence of other heavy metal sources. Aggressive post-World War II growth and expansion of El Paso into the surrounding desert, as is common in the US Southwest, placed newer housing onto more pristine land surfaces. This is reflected in generally low-to-background levels of heavy metals in these newer areas of the city. Thus there is a strong contamination and heavy metals exposure risk gradient between older and newer neighborhoods within a single city

  6. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.

    1971-01-01

    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  7. INTRA-URBAN GRADIENTS OF FINE PARTICULATE MATTER (PM2.5) IN THE EL PASO CHILDREN'S HEALTH STUDY

    EPA Science Inventory

    El Paso, Texas, a metropolitan area with over 500,000 residents, is located directly across the US/Mexico border from Ciudad Juarez with over 1 million residents. An estimated 18 million vehicles annually cross the international border between these two large cities. The border...

  8. SPRINGTIME SPATIAL CONCENTRATION GRADIENTS OF NITROGEN DIOXIDE AND VOLATILE ORGANIC SPECIES IN THE EL PASO CHILDREN'S HEALTH STUDY

    EPA Science Inventory

    Each year, over 18 million vehicles cross the international border between El Paso, TX (USA) and Ciudad Juarez (Mexico). The border traffic congestion, as well as the more typical intra-urban and interstate traffic, provide an opportunity to investigate the health effects of PM ...

  9. Attic dust analysis approach for evaluation of heavy metal deposition in the El Paso Del Norte Region

    Technology Transfer Automated Retrieval System (TEKTRAN)

    During the 90 years from 1887 to 1977, a large smelter in the El Paso Del Norte region of North America smelted many ores including copper, lead, and zinc. In order to identify the patterns of heavy metal dispersion from the smelter, we sampled attic dust and dust from undisturbed surfaces in 15 bu...

  10. 75 FR 42737 - Texas Gas Service Company, a Division of ONEOK, Inc. v. El Paso Natural Gas Company; Notice of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-22

    ... Energy Regulatory Commission Texas Gas Service Company, a Division of ONEOK, Inc. v. El Paso Natural Gas Company; Notice of Complaint July 9, 2010. Take notice that on July 7, 2010, pursuant to section 5 of the Natural Gas Act, 15 U.S.C. 717d (2006) and Rule 206 of the Federal Energy Regulatory Commission's Rules...

  11. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  12. Karst development in the Tobosa basin (Ordovician-Devonian) strata in the El Paso border region of west Texas

    SciTech Connect

    Lemone, D.V. . Dept. of Geological Sciences)

    1993-02-01

    Karst development within the Tobosa basin strata in the El Paso border region is best displayed during two time intervals: Middle Ordovician (27 Ma) developed on the Lower Ordovician El Paso Group and Middle Silurian to Middle Devonian (40 Ma) karst developed on the Lower-Middle Fusselman Formation. These major exposure intervals are recognized in regional outcrops as well as in the subsurface of the Permian Basin where they form major reservoirs. Minor local karsting is noted also within and upon the Upper Ordovician (Montoya Group) and within the shoaling upward members of overlying the Fusselman Formation. Middle Ordovician karsting with major cavern development extends down into McKellingon Canyon Formation approximately 1,000 feet below the top of the Lower Ordovician El Paso Group. The McKellingon is overlain by the cavern roof-forming early diagenetic dolomites, lower Scenic Drive Formation which in turn is overlain by the locally karsted upper Scenic Drive and Florida Mountains formations. Collapse of the overlying Montoya Group into El Paso Group rocks is observed. The Fusselman Formation rests disconformably on the Montoya Group. It is a massive, vuggy, fine- to coarsely-crystalline, whitish dolomite. Extensive karsting has developed on the top of the Fusselman. The middle Devonian Canutillo Formation with a basal flooding deposit overlies this karst surface. Minor karsting following fracture systems extends from the major karst of the El Paso Group up into the major karst in the Fusselman. The karst seems to be following and developing along the same linear fracture systems. If so, it is not unreasonable to interpret these fracture systems as being inherited from the earlier Precambrian structures underlying them.

  13. Lead Contamination of Urban Soil in the El Paso (Texas)--Juarez (Mexico) Border Metroplex

    NASA Astrophysics Data System (ADS)

    Pingitore, N. E.; Amaya, M. A.; Clague, J.

    2005-12-01

    We present an unusually detailed map of the distribution of lead in El Paso--Juarez soils, one that is based on x-ray fluorescence analysis of 1000 composite soil samples collected in the region. Mixing equal volumes of samples taken from the public space in front of individual houses or structures around a single municipal block created a single composite sample to characterize each of the 500 blocks studied in each city. Maps based on such composites highlight the distribution of lead at the neighborhood level, and de-emphasize any anomalous elevated level associated with an individual house or structure. In both cities, levels of lead are highest in their contiguous downtown commercial districts, which date to the 19th Century and are linked by the traditional border river crossing area at the Rio Grande. Rail yards, transport hubs, light industry complexes, and the oldest residential areas lie adjacent to, and inter-tongue with, this commercial district on both sides of the border. A century-old smelter, placed on standby six years ago, abuts the western limit of the old urban core in El Paso. The continuity of this elevated-lead zone, the proximity of the smelter, the many potential lead sources associated with traditional commercial activities, and the age of its structures, make it difficult to differentiate lead sources. Lead values decrease systematically away from this urban core zone, with the lowest levels generally encountered in peripheral, lightly populated developments and communities. The binational distribution of Pb in soil is consistent with Pb measurements reported on particulate matter taken from nine air monitoring stations (covering both cities) during the 1990s. Soil data thus can complement air studies by providing an essentially infinite geographic network of sampling sites that, with varying accuracy, record and integrate air conditions over years and decades. Research supported by NIEHS Grant 1RO1-ES11367.

  14. Unusual Recharge Processes near Arroyos of the Rio Grande Aquifer, El Paso/Juarez Area

    NASA Astrophysics Data System (ADS)

    Merino, M.; Hibbs, B. J.; Hogan, J.; Eastoe, C. J.; Druhan, J.

    2005-12-01

    The twin-cities of El Paso and Juarez share the water resources of the Hueco Bolson aquifer and overlying Rio Grande aquifer. Both aquifers span the international border between Mexico and the United States. Salinity in the Rio Grande aquifer varies widely, some parts of the shallow aquifer containing less than 1,000 mg/L total dissolved solids (TDS), other parts of the aquifer exceeding 5,000 mg/L TDS. One sizable part of the "Lower Valley" area, approximately 45 km below El Paso contains very dilute water near the outer edge of the floodplain. Historically it had been thought that the dilute waters in this location were derived from recharge from arroyos that drained proximal parts of the Hueco Bolson. Instead, our hydrogen and oxygen isotope data and carbon-14 data indicate that these dilute waters were derived from pre-dam infiltration of the Rio Grande. Relatively light and slightly evaporated pre-dam waters (-11.5 del O18) at the arroyos are also relatively young (60 to 90 percent modern carbon), tagging them as runoff waters from pre-dam snowmelt in Colorado. These isotopically light waters are found up to 110 meters beneath land surface. Prior to Rio Grande rectification and channelization of the mid-1930's, the Rio Grande flowed near the outer edge of the floodplain where these pre-dam, dilute waters are found at depth. Review of predevelopment drill stem tests indicated a permeable zone about 150 to 230 meters deep that had a lower hydraulic head than the overlying Rio Grande aquifer. The permeable zone acted as a predevelopment sink for flow that induced recharge from the Rio Grande and Rio Grande aquifer. Thus, we can account for local predevelopment recharge of the Rio Grande aquifer from infiltration of dilute water from the Rio Grande prior to the historic era of channel rectification, and not from recharge from flanking arroyos as had been postulated by previous researchers.

  15. Irregular recurrence of paleoearthquakes along the central Garlock fault near El Paso Peaks, California

    USGS Publications Warehouse

    Dawson, T.E.; McGill, S.F.; Rockwell, T.K.

    2003-01-01

    New investigations at the El Paso Peaks paleoseismic site have refined and extended the record of paleoearthquakes for the central Garlock fault. Event evidence, in the form of buried fissures, scarps, folds, and upward terminations, has allowed us to identify six well-resolved earthquakes, designated as events W, U, R, Q, K, and F, within the last ???7000 years. The exposures that we excavated did not reveal additional evidence for three poorly resolved events reported by McGill and Rockwell [1998]. Evidence for event Y, identified in the previous study, was reexamined and found not to be a paleoearthquake. Radiocarbon dates of detrital charcoal, combined with a method of interpolating the event ages with revised sedimentation rates, provide our preferred constraints on the timing of faulting events. The most recent surface-rupturing earthquake, event W, occurred between A.D. 1450 and 1640. The penultimate event U occurred between A.D. 675 and 950. Event R, which was unrecognized in the previous study, occurred between A.D. 250 and 475. Event Q occurred relatively shortly before event R, between A.D. 25 and 275. Event K occurred between 3340 and 2930 B.C. The oldest identified paleoearthquake, event F, occurred between 5300 and 4670 B.C. The event ages indicate that earthquake recurrence is highly irregular at the El Paso Peaks site, with individual preferred intervals ranging from as little as 215 years to as many as 3300 years. The irregular recurrence of surface-rupturing earthquakes along the central Garlock fault may be related to temporal and spatial clustering of earthquakes proposed for faults in the Eastern California Shear Zone.

  16. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  17. Universal COI primers for DNA barcoding amphibians.

    PubMed

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. PMID:22145866

  18. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  19. Optimization of turn-back primers in isothermal amplification.

    PubMed

    Kimura, Yasumasa; de Hoon, Michiel J L; Aoki, Shintaro; Ishizu, Yuri; Kawai, Yuki; Kogo, Yasushi; Daub, Carsten O; Lezhava, Alexander; Arner, Erik; Hayashizaki, Yoshihide

    2011-05-01

    The application of isothermal amplification technologies is rapidly expanding and currently covers different areas such as infectious disease, genetic disorder and drug dosage adjustment. Meanwhile, many of such technologies have complex reaction processes and often require a fine-tuned primer set where existing primer design tools are not sufficient. We have developed a primer selection system for one important primer, the turn-back primer (TP), which is commonly used in loop-mediated amplification (LAMP) and smart amplification process (SmartAmp). We chose 78 parameters related to the primer and target sequence, and explored their relationship to amplification speed using experimental data for 1344 primer combinations. We employed the least absolute shrinkage and selection operator (LASSO) method for parameter selection and estimation of their numerical coefficients. We subsequently evaluated our prediction model using additional independent experiments and compared to the LAMP primer design tool, Primer Explorer version4 (PE4). The evaluation showed that our approach yields a superior primer design in isothermal amplification and is robust against variations in the experimental setup. Our LASSO regression analysis revealed that availability of the 3'- and 5'-end of the primer are particularly important factors for efficient isothermal amplification. Our computer script is freely available at: http://gerg.gsc.riken.jp/TP_optimization/.

  20. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.

    1998-01-01

    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  1. Hubble Space Telescope Primer for Cycle 21

    NASA Astrophysics Data System (ADS)

    Gonzaga, S.; et al.

    2012-12-01

    The Hubble Space Telescope Primer for Cycle 21 is a companion document to the HST Call for Proposals1. It provides an overview of the Hubble Space Telescope (HST), with basic information about telescope operations, instrument capabilities, and technical aspects of the proposal preparation process. A thorough understanding of the material in this document is essential for the preparation of a competitive proposal. This document is available as an online HTML document and a PDF file. The HTML version, optimized for online browsing, contains many links to additional information. The PDF version is optimized for printing, but online PDF readers have search capabilities for quick retrieval of specific information.

  2. Protein sulfation analysis--A primer.

    PubMed

    Monigatti, Flavio; Hekking, Brian; Steen, Hanno

    2006-12-01

    The aim of this review is to present an overview of protein sulfation in the context of 'modificomics', i.e. post-translational modification-specific proteome research. In addition to a short introduction to the biology of protein sulfation (part 1), we will provide detailed discussion regarding (i) methods and tools for prediction of protein tyrosine sulfation sites (part 2), (ii) biochemical techniques used for protein sulfation analysis (part 3.1), and (iii) mass spectrometric strategies and methods applied to protein sulfation analysis (part 3.2). We will highlight strengths and limitations of different strategies and approaches (including references), providing a primer for newcomers to protein sulfation analysis.

  3. Aerosol characterizaton in El Paso-Juarez airshed using optical methods

    NASA Astrophysics Data System (ADS)

    Esparza, Angel Eduardo

    2011-12-01

    The assessment and characterization of atmospheric aerosols and their optical properties are of great significance for several applications such as air pollution studies, atmospheric visibility, remote sensing of the atmosphere, and impacts on climate change. Decades ago, the interest in atmospheric aerosols was primarily for visibility impairment problems; however, recently interest has intensified with efforts to quantify the optical properties of aerosols, especially because of the uncertainties surrounding the role of aerosols in climate change. The main objective of the optical characterization of aerosols is to understand their properties. These properties are determined by the aerosols' chemical composition, size, shape and concentration. The general purpose of this research was to contribute to a better characterization of the aerosols present in the Paso del Norte Basin. This study permits an alternative approach in the understanding of air pollution for this zone by analyzing the predominant components and their contributions to the local environment. This dissertation work had three primary objectives, in which all three are intertwined by the general purpose of the aerosol characterization in the Paso del Norte region. The first objective was to retrieve the columnar aerosol size distribution for two different cases (clean and polluted scenarios) at each season (spring, summer, fall and winter) of the year 2009. In this project, instruments placed in buildings within the University of Texas at El Paso (UTEP) as well as a monitoring site (CAMS 12) from the Texas Commission on Environmental Quality (TCEQ) provided the measurements that delimited the aerosol size distribution calculated by our model, the Environmental Physics Inverse Reconstruction (EPIRM) model. The purpose of this objective was to provide an alternate method of quantifying and size-allocating aerosols in situ, by using the optical properties of the aerosols and inversely reconstruct and

  4. Providing Bridges from 2YC to 4YC in the El Paso Region

    NASA Astrophysics Data System (ADS)

    Doser, D. I.; Villalobos, J. I.

    2012-12-01

    For the past ~3 years the University of Texas at El Paso (UTEP) has been working closely with El Paso Community College (EPCC) to help ease the transfer of geoscience and environmental science students between our institutions. We have initiated a number of activities to accomplish this including: articulation of degree programs to build a 2+2 transfer plan, review of introductory course content, cross-institution research projects with EPCC students and co-sponsored student research symposiums. One of the most successful activities has been our cross-institutional research projects that involve either individual students working with a UTEP undergraduate/UTEP faculty member team or EPCC classes that join UTEP classes for some aspect of field work or project. The EPCC students gain confidence in their ability to succeed by working with UTEP students and finding out that they are as capable of engaging in and completing research as their 4YC peers. They also have an opportunity to meet UTEP professors first as mentors and professional colleagues rather than in a classroom setting. The research symposium serves as an excellent venue for showcasing their research to the EPCC and UTEP community, as well as interacting with local and out of town professionals who serve as judges for the research presentations. Feedback provided by the judges assists students in refining their presentations for out of town professional meetings. The first students participating in the research program are graduating from UTEP in the summer and fall of 2012. Many EPCC students involved in research have obtained summer internships in industry, the public sector or at other academic institutions, some even prior to attending UTEP. Several have received competitive scholarships. The greatest challenges to the research program include finding UTEP faculty who are willing to work with EPCC students and financial support for the students during their research activities. The greatest challenges

  5. Infrasound from the El Paso super-bolide of October 9, 1997

    SciTech Connect

    ReVelle, D.O.; Whitaker, R.W.; Armstrong, W.T.

    1998-12-31

    During the noon hour on October 9, 1997 an extremely bright fireball ({approx}-21.5 in stellar magnitude putting it into the class of a super-bolide) was observed over western Texas with visual sightings from as far away as Arizona to northern Mexico and even in northern New Mexico over 300 miles away. This event produced tremendously loud sonic boom reports in the El Paso area. It was also detected locally by 4 seismometers which are part of a network of 5 seismic stations operated by the University of Texas at El Paso (UTEP). Subsequent investigations of the data from the six infrasound arrays used by LANL (Los Alamos National Laboratory) and operated for the DOE (Department of Energy) as a part of the CTB (Comprehensive Test Ban) Research and Development program for the IMS (International Monitoring System) showed the presence of an infrasonic signal from the proper direction at the correct time for this super-bolide from two of the six arrays. Both the seismic and infrasound recordings indicated that an explosion occurred in the atmosphere at source heights from 28--30 km, having its epicenter slightly to the northeast of Horizon City, Texas. The signal characteristics, analyzed from {approx}0.1 to 5.0 Hz, include a total duration of {approx}4 min (at Los Alamos, LA) to >{approx}5 min at Lajitas, Texas, TXAR, another CTB IMS array operated by E. Herrin at Southern Methodist University (SMU) for a source directed from LA toward {approx}171--180 deg and from TXAR of {approx}321-4 deg respectively from true north. The observed signal trace velocities (for the part of the recording with the highest cross-correlation) at LA ranged from 300--360 m/sec with a signal velocity of 0.30 {+-} 0.03 km/sec, implying a Stratospheric (S Type) ducted path. The dominant signal frequency at LA was from 0.20 to 0.80 Hz, with a peak near 0.3 Hz. These highly correlated signals at LA had a very large, peak to peak, maximum amplitude of 21.0 microbars (2.1 Pa). The analysis, using

  6. Global Health in Family Medicine Summer Primer

    PubMed Central

    Rouleau, Katherine; Janakiram, Praseedha; Nicolle, Eileen; Godoy-Ruiz, Paula; Pakes, Barry N.

    2015-01-01

    Abstract Problem addressed Despite the rapid emergence of global health training across North American universities, there remains a gap in educational programs focusing on the unique role of family medicine and primary care in global health. Objective of program The objective of the Global Health in Family Medicine Summer Primer, developed in 2013 by the Department of Family and Community Medicine at the University of Toronto in Ontario, is to strengthen global health competencies among family medicine residents and faculty. Program description The course covers the meaning of global health; global health ethics; the place of family medicine, primary care, and primary health care in the global health context; epidemiology; infectious diseases; the social determinants of health; and care of vulnerable populations locally and globally. The course is delivered in an intensive 5-day format with didactic lectures, group discussions, interactive workshops, and lived-experience panels. Conclusion The Global Health in Family Medicine Summer Primer has proven to be a successful educational initiative and provides valuable lessons learned for other academic science centres in developing global health training programs for family medicine residents and faculty. PMID:26380854

  7. Alanylated lipoteichoic acid primer in Bacillus subtilis

    PubMed Central

    Luo, Yu

    2016-01-01

    Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG) moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid. PMID:27134729

  8. Confirmation and investigation of higher science curiosity in Juarez Middle School students compared to their peers in El Paso, Texas

    NASA Astrophysics Data System (ADS)

    Carmona Miranda, Karla

    In the last 20 years attitudes towards science and science classes in K-12 education have been an important topic of investigation due to the decreasing number of students choosing Science, Technology, Engineering and Math (STEM) related careers, and the increasing need for STEM prepared workers to cover the job demands of the future. The purpose of this study is to confirm a previously measured difference in scientific curiosity between middle school students in El Paso and in Ciudad Juarez, and to collect additional data that might tell us what the possible factors or reasons for this difference are. Our sample consists of 156 middle school students from Juarez public schools, and 448 middle school students from El Paso public middle schools. The Children's Science Curiosity Scale of Harty & Beall (1984) will be used to measure the curiosity level. Additionally, the students will be asked to respond to "Why do you like or dislike science?" Our results show that those obtained by Ortiz (2006) in a similar study persist but with a reduction of standard deviations. The percentage of students that state that they do not like science in Ciudad Juarez and El Paso are 9% and 14%, respectively. The most common reason to like science among students in Ciudad Juarez was related to the topics covered in class, and among students in El Paso was related to the experiments and hands-on activities done in class. After analyzing contingency tables with chi-squared tests and calculating the respective contingency coefficients, it is safe to say that even though relationships between the reasons to like or dislike science and country exist, these relationships are not strong. Other results, limitations, and future research also are discussed.

  9. The 1996 and 1997 Paso del Norte ozone studies: An overview of the field studies and data analyses

    SciTech Connect

    MacDonald, C.P.; Roberts, P.T.; Main, H.H.; Dye, T.S.; Coe, D.L.; Yarbrough, J.

    1999-07-01

    This paper summarizes the measurement campaigns of the 1996 and 1997 Paso del Norte Ozone Studies, the resultant data sets, and the findings and conclusions that arose from subsequent data analyses. The purpose of these data analyses was to develop an understanding of the significant chemical and physical processes that lead to high concentrations of ozone in the Paso del Norte study region which includes El Paso, TX; Sunland Park, NM; and Juarez, Mexico. High ozone concentrations resulted from a combination of conditions, including slow convective boundary layer (CBL) growth, reduced CBL depth, light surface winds, and high concentrations of ozone precursor at ground level in the morning. Synoptic-scale meteorological conditions observed during high ozone episodes included an upstream aloft high-pressure system, and aloft warming. Aloft carryover of ozone and ozone precursors did not significantly contribute to the surface ozone concentration. Furthermore, hydrocarbon and NO{sub x} data, although spatially limited, showed that the system is more often NO{sub x}-limited rather than VOC-limited.

  10. Minority Universities Systems Engineering (MUSE) Program at the University of Texas at El Paso

    NASA Technical Reports Server (NTRS)

    Robbins, Mary Clare; Usevitch, Bryan; Starks, Scott A.

    1997-01-01

    In 1995, The University of Texas at El Paso (UTEP) responded to the suggestion of NASA Jet Propulsion Laboratory (NASA JPL) to form a consortium comprised of California State University at Los Angeles (CSULA), North Carolina Agricultural and Technical University (NCAT), and UTEP from which developed the Minority Universities Systems Engineering (MUSE) Program. The mission of this consortium is to develop a unique position for minority universities in providing the nation's future system architects and engineers as well as enhance JPL's system design capability. The goals of this collaboration include the development of a system engineering curriculum which includes hands-on project engineering and design experiences. UTEP is in a unique position to take full advantage of this program since UTEP has been named a Model Institution for Excellence (MIE) by the National Science Foundation. The purpose of MIE is to produce leaders in Science, Math, and Engineering. Furthermore, UTEP has also been selected as the site for two new centers including the Pan American Center for Earth and Environmental Sciences (PACES) directed by Dr. Scott Starks and the FAST Center for Structural Integrity of Aerospace Systems directed by Dr. Roberto Osegueda. The UTEP MUSE Program operates under the auspices of the PACES Center.

  11. The geologic structure of part of the southern Franklin Mountains, El Paso County, Texas

    SciTech Connect

    Smith, W.R.; Julian, F.E. . Dept. of Geosciences)

    1993-02-01

    The Franklin Mountains are a west tilted fault block mountain range which extends northwards from the city of El Paso, Texas. Geologic mapping in the southern portion of the Franklin Mountains has revealed many previously unrecognized structural complexities. Three large high-angle faults define the boundaries of map. Twenty lithologic units are present in the field area, including the southernmost Precambrian meta-sedimentary rocks in the Franklin Mountains (Lanoria Quartzite and Thunderbird group conglomerates). The area is dominated by Precambrian igneous rocks and lower Paleozoic carbonates, but Cenozoic ( ) intrusions are also recognized. Thin sections and rock slabs were used to describe and identify many of the lithologic units. The Franklin Mountains are often referred to as a simple fault block mountain range related to the Rio Grande Rift. Three critical regions within the study area show that these mountains contain structural complexities. In critical area one, Precambrian granites and rhyolites are structurally juxtaposed, and several faults bisecting the area affect the Precambrian/Paleozoic fault contact. Critical area two contains multiple NNW-trending faults, three sills and a possible landslide. This area also shows depositional features related to an island of Precambrian rock exposed during deposition of the lower Paleozoic rocks. Critical area three contains numerous small faults which generally trend NNE. They appear to be splays off of one of the major faults bounding the area. Cenozoic kaolinite sills and mafic intrusion have filled many of the fault zones.

  12. The DOE infrastructure support program at the University of Texas at El Paso. Final report

    SciTech Connect

    1998-11-01

    The University of Texas at El Paso (UTEP) is located on 300 acres, only a few hundred years from the US/Mexico border. The DOE Infrastructure Support Program was initiated at UTEP in 1987. The purpose of the program was to assist the University in building the infrastructure required for its emerging role as a regional center for energy-related research. Equally important was the need to strength the University`s ability to complete for sponsored energy-related programs at the state and national levels and to provide opportunities for faculty, staff and students to participate in energy-related research and outreach activities. The program had four major objectives, as follows: (1) implement energy research, outreach and demonstration projects already funded, and prepare new proposals to fund university research interests; (2) establish an Energy Center as a separate operational entity to provide continuing infrastructure support for energy-related programs; (3) strengthen university/private sector energy research linkages; and (4) involve minority graduate and undergraduate students in energy research and outreach activities. Each of the above objectives has been exceeded substantially, and, as a consequence, the University has become a regional leader in energy and environmental research and outreach efforts.

  13. Sensitivity Modeling Study for an Ozone Occurrence during the 1996 Paso Del Norte Ozone Campaign

    PubMed Central

    Lu, Duanjun; Reddy, Remata S.; Fitzgerald, Rosa; Stockwell, William R.; Williams, Quinton L.; Tchounwou, Paul B.

    2008-01-01

    Surface ozone pollution has been a persistent environmental problem in the US and Europe as well as the developing countries. A key prerequisite to find effective alternatives to meeting an ozone air quality standard is to understand the importance of local anthropogenic emissions, the significance of biogenic emissions, and the contribution of long-range transport. In this study, an air quality modeling system that includes chemistry and transport, CMAQ, an emission processing model, SMOKE, and a mesoscale numerical meteorological model, WRF, has been applied to investigate an ozone event occurring during the period of the 1996 Paso del Norte Ozone Campaign. The results show that the modeling system exhibits the capability to simulate this high ozone occurrence by providing a comparable temporal variation of surface ozone concentration at one station and to capture the spatial evolution of the event. Several sensitivity tests were also conducted to identify the contributions to high surface ozone concentration from eight VOC subspecies, biogenic VOCs, anthropogenic VOCs and long-range transportation of ozone and its precursors. It is found that the reductions of ETH, ISOP, PAR, OLE and FORM help to mitigate the surface ozone concentration, and like anthropogenic VOCs, biogenic VOC plays a nonnegligible role in ozone formation. But for this case, long-range transport of ozone and its precursors appears to produce an insignificant contribution. PMID:19190351

  14. Great Lakes rivermouths: a primer for managers

    USGS Publications Warehouse

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  15. Homolog-specific PCR primer design for profiling splice variants

    PubMed Central

    Srivastava, Gyan Prakash; Hanumappa, Mamatha; Kushwaha, Garima; Nguyen, Henry T.; Xu, Dong

    2011-01-01

    To study functional diversity of proteins encoded from a single gene, it is important to distinguish the expression levels among the alternatively spliced variants. A variant-specific primer pair is required to amplify each alternatively spliced variant individually. For this purpose, we developed a new feature, homolog-specific primer design (HSPD), in our high-throughput primer and probe design software tool, PRIMEGENS-v2. The algorithm uses a de novo approach to design primers without any prior information of splice variants or close homologs for an input query sequence. It not only designs primer pairs but also finds potential isoforms and homologs of the input sequence. Efficiency of this algorithm was tested for several gene families in soybean. A total of 187 primer pairs were tested under five different abiotic stress conditions with three replications at three time points. Results indicate a high success rate of primer design. Some primer pairs designed were able to amplify all splice variants of a gene. Furthermore, by utilizing combinations within the same multiplex pool, we were able to uniquely amplify a specific variant or duplicate gene. Our method can also be used to design PCR primers to specifically amplify homologs in the same gene family. PRIMEGENS-v2 is available at: http://primegens.org. PMID:21415011

  16. Attic Dust Analysis Approach for Evaluation of Heavy Metal Deposition on the El Paso Del Norte Region

    NASA Astrophysics Data System (ADS)

    Shekhter, E. G.; van Pelt, S.; Pannell, K.; Gill, T. E.; Barnes, M. A.

    2010-12-01

    The El Paso del Norte region in the United States is a region of complex topography that is the home to more than 2 million people who share the same air. A large non-ferrous smelter (primary lead-copper smelter),owned by the American Smelting and Refining Company (ASARCO), was functioning in the Rio Grande River valley on the west side of the Franklin Mountains that divide the city of El Paso and across the river from Juarez, Mexico’s largest city on the United States border. During the more than 100 years of operation, beginning in 1887, the ASARCO smelter emissions considerably deteriorated the already complex environmental condition on the US-Mexican border. In order to identify the sources and patterns of heavy metal dispersion, we used an attic dust analyses approach which has not been previously been applied in this area. Undisturbed attic dust can provide an integrated history of atmospheric loading of particulates emanating from geological, biological and anthropogenic sources and can help to reconstruct the air pollution history on a local scale. We sampled attic dust and dust from undisturbed surfaces in 15 buildings of varying ages from three neighborhoods in the cities of El Paso and Juarez. The dust samples and samples of unpolluted buried soil horizons in the area were extracted with aqua regia and analyzed by ICP-AES and ICP-MS. Enrichment ratios (ER) were calculated by dividing the concentration of a trace metal in the attic dust by the mean concentration of the same element in the buried soil horizons. Mean ER for Pb were 263.3, 95.4, and 70.2 for dust collected in a neighborhood near the smelter, downtown Juarez, and an El Paso neighborhood on the other side of the Franklin Mountains from the smelter. Greater ER for As, Cd, Zn, Sb, and Cu followed the same trends, by neighborhood, noted for Pb. In addition, dust collected from attics surfaces (pipes, ducts, storage containers) post-dating smelter disclosure had lower ER for the trace metals

  17. HST archive primer, version 4.1

    NASA Technical Reports Server (NTRS)

    Fruchter, A. (Editor); Baum, S. (Editor)

    1994-01-01

    This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.

  18. Primer on tritium safe handling practices

    SciTech Connect

    Not Available

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  19. Formaldehyde as hypothetical primer of biohomochirality

    SciTech Connect

    Goldanskii, V.I.

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  20. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    PubMed

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  1. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    NASA Astrophysics Data System (ADS)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  2. Dispersion Modeling of Inert Particulate Matter in the El Paso, TX- Cd. Juarez, MX Region

    NASA Astrophysics Data System (ADS)

    Pearson, R.; Fitzgerald, R.

    2005-05-01

    The El Paso, TX-Cd. Juarez, MX region is subject to the emission of inert particulate matter (PM) into the atmosphere, from a variety of sources. The impact of these emissions has been studied extensively in for regulatory compliance in the area of health effects, air quality and visibility. Little work has been done to study the fate and transport of the particulate matter within the region. The Environmental Physics Group at The University of Texas at El Paso has recently applied the SARMAP Air Quality Model (SAQM) to model the dispersion of inert particulate matter in the region. The meteorological data for the SAQM was created with the Penn State/NCAR meteorological modeling system, version 5 (MM5). The SAQM was used to simulate three common occurrences for large particulate emission and concentration. The first was times of heavy traffic volume at the international bridges which cause large numbers of cars to sit, with engines running, for extended periods of time. The second was moderate to high wind events that cause large amounts of coarse particulate matter to become entrained in the atmosphere and transported into and around the region. The third is a temperature inversion which traps the particulate matter at the surface during morning rush hour. The initial conditions for particulate matter, for the two cases involving mobile emissions, were derived from the 1999 version 3 national emissions inventory (NEI) mobile, on-road data from the EPA. Output from the MM5 was used to as the meteorological driver for the SAQM. The MM5 was initialized with data from the NCAR reanalysis project. Meteorological data collected in the region bye the Texas Commission on Environmental Quality (TCEQ) and the EPA was used for Four Dimensional Data Assimilation. The MM5 was nudged with gridded, surface and observational data. Statistical analysis was done on the MM5 for the variables, wind speed, wind direction, temperature and mixing ratio. The statistics performed included

  3. Solute Sources and Budget for the Rio Grande above El Paso, Texas

    NASA Astrophysics Data System (ADS)

    Hogan, J. F.; Phillips, F. M.; Hendrickx, J. M.

    2001-12-01

    Issues of water quality, especially salinity, limit the use of water resources from the Rio Grande. Identification and quantification of salinity sources is critical for improved river management. In the headwater region salts are typically derived from atmospheric deposition and chemical weathering reactions. Salinity increases during transit may result from both natural (saline groundwater, hydrothermal springs and dissolution of evaporite deposits) and anthropogenic (agricultural return flow and wastewater from sewage treatment plants) sources. These increases are magnified by evapotranspiration (this includes evaporation from open water, transpiration from irrigated agriculture and transpiration from natural riparian areas). With multiple salinity sources and evapotranspiration acting simultaneously, understanding the solute balance for the Rio Grande at a level needed for improved river management is difficult. We have conducted synoptic sampling of the Rio Grande from the headwaters in Colorado to south of El Paso, Texas. Sampling was conducted in January and August of 2000 and 2001. The total dissolved solids content (TDS) of the Rio Grande increases from < 50 mg/L in headwater regions of Colorado to > 2000 mg/L south of El Paso, Texas. The Cl/Br (wt/wt) ratio for river water increases from ~50 in the headwaters (typical for atmospheric deposition) to ~700 in the lower basin. This increase in Cl/Br ratio demonstrates the importance of additional salinity sources. Three end-members are recognized using Cl/Br mixing plots for winter samples: atmospheric deposition, a hydrothermal end-member localized around Truth of Consequences, NM, and a third end-member that may represent groundwater. Samples collected during the summer months are shifted off the winter mixing lines indicating concentration through ET. Increases in salinity were not a simple function of distance downriver, but rather occurred in a series of steps. Some of these steps are correlated with

  4. Influence of deposit architecture on intrastratal deformation, slope deposits of the Tres Pasos Formation, Chile

    NASA Astrophysics Data System (ADS)

    Auchter, Neal C.; Romans, Brian W.; Hubbard, Stephen M.

    2016-07-01

    Slope sediments on passive and active margins deform and fail across a broad range of scales ranging from loading and sediment remobilization near the sediment-water interface to submarine landslides and mass movements that incorporate significant volumes of slope deposits. Deformational styles are characterized by updip extension and downdip compressional features that occur above a detachment surface. Conditions for failure and deformation include the presence of weak layer(s) that serve as a detachment surface, competency contrasts that allow for detachment and downslope movement, deformation above a detachment surface, and a triggering mechanism(s) that initiates failure. Slope failure processes and products are well documented at scales resolvable by seismic-reflection surveys and in instances of extensive downslope failure, but the processes and products associated with intermediate-scale slope deformation are poorly understood. Intrastratal deformation is defined as stratigraphically isolated zones of deformation bounded above and below by concordant and undeformed strata. In this study, outcrop examples of intrastratal deformation from the Upper Cretaceous Tres Pasos Formation are used to elucidate the influence of depositional architecture on slope deformation. The facies distribution associated with compensational stacking of lobe deposits is shown to have a first-order control on the location and style of deformation. Detachment planes that form in mudstone deposits associated with lobe fringe and interlobe deposits are spatially limited and deformation is restricted to interbedded sandstone and mudstone associated with off-axial lobe positions. Downslope translation was arrested by stratigraphic buttresses associated with more sandstone-prone axial deposits. Emplacement of a regionally extensive mass transport deposit is interpreted as the triggering mechanism for contemporaneous intrastratal deformation of > 60 m of underlying stratigraphy. A vertical

  5. Modeling particle number concentrations along Interstate 10 in El Paso, Texas

    NASA Astrophysics Data System (ADS)

    Olvera, Hector A.; Jimenez, Omar; Provencio-Vasquez, Elias

    2014-12-01

    Annual average daily particle number concentrations around a highway were estimated with an atmospheric dispersion model and a land use regression model. The dispersion model was used to estimate particle concentrations along Interstate 10 at 98 locations within El Paso, Texas. This model employed annual averaged wind speed and annual average daily traffic counts as inputs. A land use regression model with vehicle kilometers traveled as the predictor variable was used to estimate local background concentrations away from the highway to adjust the near-highway concentration estimates. Estimated particle number concentrations ranged between 9.8 × 103 particles/cc and 1.3 × 105 particles/cc, and averaged 2.5 × 104 particles/cc (SE 421.0). Estimates were compared against values measured at seven sites located along I10 throughout the region. The average fractional error was 6% and ranged between -1% and -13% across sites. The largest bias of -13% was observed at a semi-rural site where traffic was lowest. The average bias amongst urban sites was 5%. The accuracy of the estimates depended primarily on the emission factor and the adjustment to local background conditions. An emission factor of 1.63 × 1014 particles/veh-km was based on a value proposed in the literature and adjusted with local measurements. The integration of the two modeling techniques ensured that the particle number concentrations estimates captured the impact of traffic along both the highway and arterial roadways. The performance and economical aspects of the two modeling techniques used in this study shows that producing particle concentration surfaces along major roadways would be feasible in urban regions where traffic and meteorological data are readily available.

  6. Modeling particle number concentrations along Interstate 10 in El Paso, Texas

    PubMed Central

    Olvera, Hector A.; Jimenez, Omar; Provencio-Vasquez, Elias

    2014-01-01

    Annual average daily particle number concentrations around a highway were estimated with an atmospheric dispersion model and a land use regression model. The dispersion model was used to estimate particle concentrations along Interstate 10 at 98 locations within El Paso, Texas. This model employed annual averaged wind speed and annual average daily traffic counts as inputs. A land use regression model with vehicle kilometers traveled as the predictor variable was used to estimate local background concentrations away from the highway to adjust the near-highway concentration estimates. Estimated particle number concentrations ranged between 9.8 × 103 particles/cc and 1.3 × 105 particles/cc, and averaged 2.5 × 104 particles/cc (SE 421.0). Estimates were compared against values measured at seven sites located along I10 throughout the region. The average fractional error was 6% and ranged between -1% and -13% across sites. The largest bias of -13% was observed at a semi-rural site where traffic was lowest. The average bias amongst urban sites was 5%. The accuracy of the estimates depended primarily on the emission factor and the adjustment to local background conditions. An emission factor of 1.63 × 1014 particles/veh-km was based on a value proposed in the literature and adjusted with local measurements. The integration of the two modeling techniques ensured that the particle number concentrations estimates captured the impact of traffic along both the highway and arterial roadways. The performance and economical aspects of the two modeling techniques used in this study shows that producing particle concentration surfaces along major roadways would be feasible in urban regions where traffic and meteorological data are readily available. PMID:25313294

  7. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  8. DNA sequencing technology, walking with modular primers. Final report

    SciTech Connect

    Ulanovsky, L.

    1996-12-31

    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  9. Moisture insensitive primer: A myth or truth

    PubMed Central

    Shukla, Chandresh; Maurya, Rajkumar; Jain, Upendra; Gupta, Ankur; Garg, Jayshree

    2014-01-01

    Objectives: To compare the mean shear bond strength (SBS) of moisture insensitive primer (MIP) used for orthodontic bonding in the presence and absence of saliva. Materials and Methods: A total of 60 human noncarious maxillary premolars with sound buccal surfaces, recently extracted were collected in two groups of each 30. Maxillary premolar brackets were bonded to the teeth using light cure (Transbond XT, 3M Unitek, Monrovia, CA, USA) and MIP (Transbond MIP 3M Unitek, Monrovia, CA, USA,) in the presence and absence of saliva. Operators’ saliva was used during the bonding under moist condition. After debonding, all the specimens were examined under a stereomicroscope (×40 magnification) for adhesive remnant using adhesive remnant index (ARI). The SBS tests were done using Instron universal testing machine at cross-head speed of 1 mm/min, force passing parallel to the buccal surface using custom rod and registered in Newtons later converted into Megapascals. Results: Light cure and MIP (Transbond MIP and Transbond XT, 3M Unitek, Monrovia, CA, USA) in the absence of saliva showed higher mean SBS than the presence of saliva. Group I (light cure and MIP) in the absence of saliva showed mean SBS of 9.65 ± 0.90 Mpa. Group II (light cure and MIP) with the presence of saliva showed mean SBS of 9.03 ± 1.14 Mpa. The difference between both the groups was statistically significant, as confirmed by paired t-test (P < 0.05). In-Group I, ARI scores showed that more than half of the adhesive was left over the tooth surface, and Group II showed that there was no or insignificant amount of adhesive left over the tooth surface. Chi-square test revealed significant difference in debonding characteristics among the test groups of ARI (P < 0.05). Failure occurred mainly in resin– bracket base and resin – adhesive interfaces (χ² = 10.04, df = 3, P = 0.031). Conclusion: Moisture insensitive primer is effective in the presence/absence of moisture and has shown SBS value of more

  10. Primer on electricity futures and other derivatives

    SciTech Connect

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  11. Evidence for long-term impact of Pasos Adelante: using a community-wide survey to evaluate chronic disease risk modification in prior program participants.

    PubMed

    Carvajal, Scott C; Miesfeld, Noelle; Chang, Jean; Reinschmidt, Kerstin M; de Zapien, Jill Guernsey; Fernandez, Maria L; Rosales, Cecilia; Staten, Lisa K

    2013-10-01

    Effective community-level chronic disease prevention is critical to population health within developed and developing nations. Pasos Adelante is a preventive intervention that aims to reduce chronic disease risk with evidence of effectiveness in US-Mexico residing, Mexican origin, participants. This intervention and related ones also implemented with community health workers have been shown to improve clinical, behavioral and quality of life indicators; though most evidence is from shorter-term evaluations and/or lack comparison groups. The current study examines the impact of this program using secondary data collected in the community 3-6 years after all participants completed the program. A proportional household survey (N = 708) was used that included 48 respondents who indicated they had participated in Pasos. Using propensity score matching to account for differences in program participants versus other community residents (the program targeted those with diabetes and associated risk factors), 148 natural controls were identified for 37 matched Pasos participants. Testing a range of behavioral and clinical indicators of chronic disease risk, logistic regression models accounting for selection bias showed two significant findings; Pasos participants were more physically active and drank less whole milk. These findings add to the evidence of the effectiveness of Pasos Adalente and related interventions in reducing chronic disease risk in Mexican-origin populations, and illustrate the use of innovative techniques for using secondary, community-level data to complement prior evaluation research.

  12. Identifying and locating tectonic tremor beneath the San Andreas Fault near Parkfield, CA, with the PASO array

    NASA Astrophysics Data System (ADS)

    Peterson, D. E.; Thurber, C. H.; Montgomery-Brown, E. D.; Brown, J. R.; Shelly, D. R.

    2011-12-01

    Tectonic tremor is a weak but persistent shaking of the Earth that was first discovered in subduction zones and later found beneath the San Andreas Fault (SAF). Tremor events represent spasmodic slip on the deep extension of the SAF, occurring at a depth of about 20-25 kilometers. Tremor occurs deeper than the nearby regular earthquakes, which can be found at maximum depths of 12-15 kilometers. Tremor is characterized by bursts of low frequency and/or very low frequency earthquakes (LFE/VLF) with dominant energy in the 1-10 Hz range. Tremor tells us about fault slip at depth in both space and time by illuminating the fault down to about the base of the crust. In the pursuit of deriving information about deep fault behavior and crustal structure, we are analyzing continuous data from the previously untapped Parkfield Area Seismic Observatory (PASO) temporary array, operated in 2000-2002 and 2004-2006. We started the identification process by correlating templates of known events from a nearby station array based on an existing catalog of tremor events. Using the dense PASO array and various correlation methods, including autocorrelation (Brown et. al. 2008), a scanning algorithm (Rowe, 2005), and cross correlation of template events (Shelly et al., 2007), we will refine the locations of these known events and seek to identify undiscovered clusters of LFEs and tremor. After generating an updated catalog initially for the month of September 2002, we will use S-wave arrivals from the 59 stations comprising the PASO array to provide strong constraints on the locations of identified events.

  13. Public health surveillance using emergency medical service logs - U.S.--Mexico land border, El Paso, Texas, 2009.

    PubMed

    2010-06-01

    In 2008, approximately 358 million travelers entered the United States, of whom 206 million arrived via land ports of entry (POEs) on the U.S.--Mexico border. Effective response to infectious diseases of public health importance among travelers requires timely identification and reporting to state and federal health authorities. Currently, notifications are made primarily by U.S. Customs and Border Protection (CBP) officers to CDC quarantine stations. However, CBP personnel have competing priorities and limited public health training.To evaluate the utility of monitoring emergency medical service (EMS) dispatch and response logs for ill travelers with symptoms or signs suggestive of infectious diseases, CDC screened medical records of patients transported by EMS during 2009 from the four POEs in El Paso, Texas. The screening was conducted using commercial software that monitors EMS logs and sends alerts in real time based on preestablished criteria (i.e., records containing keywords suggesting infectious diseases). Records that met the criteria were forwarded to El Paso Quarantine Station personnel and reviewed within 24 hours. If a reportable infectious disease was suspected, the final diagnosis was requested from the receiving hospital.This report summarizes the results of the evaluation, which found that, of 50,779 EMS responses in the city of El Paso, 455 (0.9%) records met alert criteria, 86 (0.2%) needed diagnostic confirmation, and nine (<0.1%) were for reportable infectious diseases. Monitoring EMS logs can enhance detection of travelers with serious infections at POEs but requires additional screening and follow-up by CDC.

  14. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  15. On the mechanism of the modular primer effect.

    PubMed Central

    Beskin, A D; Zevin-Sonkin, D; Sobolev, I A; Ulanovsky, L E

    1995-01-01

    Modular primers are strings of three contiguously annealed unligated oligonucleotides (modules) as short as 5- or 6-mers, selected from a presynthesized library. It was previously found that such strings can prime DNA sequencing reactions specifically, thus eliminating the need for the primer synthesis step in DNA sequencing by primer walking. It has remained largely a mystery why modular primers prime uniquely, while a single module, used alone in the same conditions, often shows alternative priming of comparable strength. In a puzzling way, the single module, even in a large excess over the template, no longer primes at the alternative sites, when modules with which it can form a contiguous string are also present. Here we describe experiments indicating that this phenomenon cannot be explained by cooperative annealing of the modules to the template. Instead, the mechanism seems to involve competition between different primers for the available polymerase. In this competition, the polymerase is preferentially engaged by longer primers, whether modular or conventional, at the expense of shorter primers, even though the latter can otherwise prime with similar or occasionally higher efficiency. Images PMID:7659510

  16. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  17. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether theremore » are also TaqMan/Luminex probe matches within predicted amplicons.« less

  18. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  19. Utilizing geophysical methods for asessment and characterization of canal seepage in El Paso's lower valley irrigation delivery systems

    NASA Astrophysics Data System (ADS)

    Cegon, Amanda Brooke

    El Paso County Water Improvement District No. 1 (EPCWID No.1) delivers the Rio Grande water for agricultural production and urban uses through numerous networked irrigation canals. Of the nearly 86 billion gallons of water released annually for irrigation uses in Texas, billions are lost due to evaporation and seepage in unlined canals with 56 million gallons of the billions are lost in Franklin Canal annually due to improper lining and sediment variation of the canals. To characterize seepage patterns and identify areas of high seepage, Electrical Resistivity, Ground Truthing via soil sample analysis were used along three, half-mile long sectioned canals during irrigation and non-irrigation seasons. The data lines acquired were processed in EARTHIMAGER 2D to create 2D vertical resistivity inversion profiles to locate potential areas of high seepage/high resistivity. The research results will help El Paso County Water Improvement District No. 1 to develop management strategies to conserve water and improve the delivery efficiency systems which leads to economic growth in the Rio Grande Basin.

  20. The effect of urban canopy parameterizations on mesoscale meteorological model simulations in the Paso del Norte area

    SciTech Connect

    Brown, M.J.; Williams, M.D.

    1997-04-01

    Since mesoscale numerical models do not have the spatial resolution to directly simulate the fluid dynamics and thermodynamics in and around urban structures, urban canopy parameterizations are sometimes used to approximate the drag, heating, and enhanced turbulent kinetic energy (tke) produced by the sub-grid scale urban elements. In this paper, we investigate the effect of the urban canopy parameterizations used in the HOTMAC mesoscale meteorological model by turning the parameterizations on and off. The model simulations were performed in the Paso del Norte region, which includes the cities of El Paso and Ciudad Juarez, the Franklin and Sierra Juarez mountains, and the Rio Grande. The metropolitan area is surrounded by relatively barren scrubland and is intersected by strips of vegetation along the Rio Grande. Results indicate that the urban canopy parameterizations do affect the mesoscale flow field, reducing the magnitude of wind speed and changing the magnitude of the sensible heat flux and tke in the metropolitan area. A nighttime heat island and a daytime cool island exist when urban canopy parameters are turned on, but associated recirculation flows are not readily apparent. Model-computed solar, net, and longwave radiation values look reasonable, agreeing for the most part with published measurements.

  1. BTSC VAPOR INSTRUSION PRIMER "VAPOR INTRUSION CONSIDERATION FOR REDEVELOPMENT"

    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  2. New primers for DNA barcoding of digeneans and cestodes (Platyhelminthes).

    PubMed

    Van Steenkiste, Niels; Locke, Sean A; Castelin, Magalie; Marcogliese, David J; Abbott, Cathryn L

    2015-07-01

    Digeneans and cestodes are species-rich taxa and can seriously impact human health, fisheries, aqua- and agriculture, and wildlife conservation and management. DNA barcoding using the COI Folmer region could be applied for species detection and identification, but both 'universal' and taxon-specific COI primers fail to amplify in many flatworm taxa. We found that high levels of nucleotide variation at priming sites made it unrealistic to design primers targeting all flatworms. We developed new degenerate primers that enabled acquisition of the COI barcode region from 100% of specimens tested (n = 46), representing 23 families of digeneans and 6 orders of cestodes. This high success rate represents an improvement over existing methods. Primers and methods provided here are critical pieces towards redressing the current paucity of COI barcodes for these taxa in public databases.

  3. El Paso Electric Company Diablo Substation to the US-Mexico border 115kV transmission line project. Final Environmental Assessment

    SciTech Connect

    Not Available

    1992-04-01

    This Environmental Assessment documents the analysis of alternative corridors for development and operation of a proposed 115 kilovolt transmission line using private lands and transporting power to the US-Mexico international border. The project will require (1) an amendment to El Paso Electric Company`s existing export authorization to transfer power across this border, and (2) a Presidential Permit for construction of the transmission line. The project would be located in Dona Ana county in southern New Mexico, approximately five miles west of El Paso, Texas. The alternative corridors, specific locations within those corridors, and structure types are identified and analyzed in the environmental studies.

  4. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457

  5. Universal primers that amplify RNA from all three flavivirus subgroups

    PubMed Central

    Maher-Sturgess, Sheryl L; Forrester, Naomi L; Wayper, Paul J; Gould, Ernest A; Hall, Roy A; Barnard, Ross T; Gibbs, Mark J

    2008-01-01

    Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5) coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers. PMID:18218114

  6. Hydrogeological characterization of a bank filtration experiment site at the Rio Grande, El Paso, Texas, USA

    NASA Astrophysics Data System (ADS)

    Langford, R.; Schulze-Makuch, D.; Pillai, S.; Abdel-Fattah, A.; Widmer, K.

    2003-04-01

    An experiment site was constructed along an artificial channel of the Rio Grande in El Paso, Texas. The experiment was funded by the EPA and is designed to measure the effectiveness of bank filtration in an arid environment. Regionally, the experiment is important because of the hundreds of thousands of people drinking water from shallow wells drilled in close proximity to septic systems. A pumping well was drilled 17 meters from the stream bank and screened from 3.5 to 8 m depth. A cruciform array of observation wells with several multilevel completions allows detection of downstream and vertical movement of water as well as flow from the stream to the well. All of the wells were continuously cored during drilling. Analysis of the cores reveals that the site consists of two stacked channels filled with sand deposited from the meandering Rio Grande. A grid of ground-penetrating radar lines provided three-dimensional coverage between wells and showed bedding to 6.5 m depth. Constant head hydraulic conductivities show that the aquifer consists of two more permeable units separated by the less permeable upper fill of the lower channel complex, with vertical hydraulic conductivities of (1x10-6 to 2x10-6 m/s?). The intervals above and below this interval have the highest vertical conductivities (up to 3.5x10-5 m/s). A multiple pumping and tracer test was conducted using the cruciform array of the field site that consisted of a pumping well, 16 observation wells, and a stream sampling point. The average hydraulic conductivity of the geological media at the field site was about 2 x 10-3 m/s based on pumping test analysis. However, the type curve responses revealed significant heterogeneity of hydraulic conductivity throughout the field site. For the tracer test, bromide and microspheres were used as tracers. Microspheres were used to mimic the behavior of Giardia and Cryptosporidium. The tracers (bromide and microspheres of different sizes and colors) were injected in one

  7. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    SciTech Connect

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M; Busch, Robert D.; Emerson, Scott

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  8. Simulated ground-water flow in the Hueco Bolson, an alluvial-basin aquifer system near El Paso, Texas

    USGS Publications Warehouse

    Heywood, Charles E.; Yager, Richard M.

    2003-01-01

    The neighboring cities of El Paso, Texas, and Ciudad Juarez, Chihuahua, Mexico, have historically relied on ground-water withdrawals from the Hueco Bolson, an alluvial-aquifer system, to supply water to their growing populations. By 1996, ground-water drawdown exceeded 60 meters in some areas under Ciudad Juarez and El Paso. A simulation of steady-state and transient ground-water flow in the Hueco Bolson in westernmost Texas, south-central New Mexico, and northern Chihuahua, Mexico, was developed using MODFLOW-96. The model is needed by El Paso Water Utilities to evaluate strategies for obtaining the most beneficial use of the Hueco Bolson aquifer system. The transient simulation represents a period of 100 years beginning in 1903 and ending in 2002. The period 1903 through 1968 was represented with 66 annual stress periods, and the period 1969 through 2002 was represented with 408 monthly stress periods. The ground-water flow model was calibrated using MODFLOWP and UCODE. Parameter values representing aquifer properties and boundary conditions were adjusted through nonlinear regression in a transient-state simulation with 96 annual time steps to produce a model that approximated (1) 4,352 water levels measured in 292 wells from 1912 to 1995, (2) three seepage-loss rates from a reach of the Rio Grande during periods from 1979 to 1981, (3) three seepage-loss rates from a reach of the Franklin Canal during periods from 1990 to 1992, and (4) 24 seepage rates into irrigation drains from 1961 to 1983. Once a calibrated model was obtained with MODFLOWP and UCODE, the optimal parameter set was used to create an equivalent MODFLOW-96 simulation with monthly temporal discretization to improve computations of seepage from the Rio Grande and to define the flow field for a chloride-transport simulation. Model boundary conditions were modified at appropriate times during the simulation to represent changes in well pumpage, drainage of agricultural fields, and channel

  9. PREJUICIO Y DISTANCIA SOCIAL HACIA PERSONAS HOMOSEXUALES POR PARTE DE JÓVENES UNIVERSITARIOS

    PubMed Central

    Fernández Rodríguez, María del C.; Squiabro, José Calderón

    2014-01-01

    Se realizó un estudio descriptivo transversal con el propósito de explorar actitudes de rechazo y distancia social hacia las personas gays y lesbianas (GL) en 565 universitarios. Se utilizó una escala para medir Prejuicio y otra escala para medir Distancia Social. Los participantes reflejaron niveles moderados de prejuicio y distancia social (DS) hacia las personas gays y lesbianas. Los varones (M=104.5, DT= 27.47) mostraron significativamente más prejuicio que las mujeres (M=98.8, DT= 23.41). Los hombres (M=22.7, DT= 7.00) mostraron significativamente mayor DS que las mujeres (M=21.1, DT= 5.41). Las personas que asisten con regularidad a la iglesia mostraron más prejuicio y DS que los que no asisten. Se analiza importancia de incluir el tema de la diversidad sexual a través del currículo para desmontar prejuicios hacia la comunidad homosexual. PMID:25606066

  10. Nutrition Knowledge Predicts Eating Behavior of All Food Groups "except" Fruits and Vegetables among Adults in the Paso del Norte Region: Que Sabrosa Vida

    ERIC Educational Resources Information Center

    Sharma, Shreela V.; Gernand, Alison D.; Day, R. Sue

    2008-01-01

    Objective: To examine the association between nutrition knowledge and eating behavior in a predominantly Mexican American population on the Texas-Mexico border. Design: Cross-sectional using data from the baseline survey of the Que Sabrosa Vida community nutrition initiative. Setting: El Paso and surrounding counties in Texas. Participants: Data…

  11. ADVERSE IMPACT OF HOME DAMPNESS AND LENGTH OF RESIDENCE ON ATOPY AND LUNG FUNCTION AMONG CHILDREN IN EL PASO, TEXAS, USA

    EPA Science Inventory

    The El Paso Children's Health Study examined ambient exposures to motor vehicle emissions and their effect on the prevalence of allergy and asthma among children living in a major United States-Mexico border city. In the spring of 2001, the parents of all fourth and fifth grad...

  12. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  13. Primer design for PCR reactions in forensic biology.

    PubMed

    Elkins, Kelly M

    2015-01-01

    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  14. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  15. Rapid and simple method of qPCR primer design.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2015-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool for analysis and quantification of gene expression. It is advantageous compared to traditional gel-based method of PCR, as gene expression can be visualized "real-time" using a computer. In qPCR, a reporter dye system is used which intercalates with DNA's region of interest and detects DNA amplification. Some of the popular reporter systems used in qPCR are the following: Molecular Beacon(®), SYBR Green(®), and Taqman(®). However, success of qPCR depends on the optimal primers used. Some of the considerations for primer design are the following: GC content, primer self-dimer, or secondary structure formation. Freely available software could be used for ideal qPCR primer design. Here we have shown how to use some freely available web-based software programs (such as Primerquest(®), Unafold(®), and Beacon designer(®)) to design qPCR primers.

  16. Seepage investigation on the Rio Grande from below Caballo Reservoir, New Mexico, to El Paso, Texas, 2012

    USGS Publications Warehouse

    Gunn, Mark A.; Roark, D. Michael

    2014-01-01

    A seepage investigation was conducted by the U.S. Geological Survey, in cooperation with the New Mexico Interstate Stream Commission, along an approximately 106-mile reach of the Rio Grande from below Caballo Reservoir, New Mexico, to El Paso, Texas, during June 26–28, 2012, to determine gain or loss of streamflow due to seepage to or from the river channel. Discharge measurements were made during the irrigation season at high flow including 5 sites along the Rio Grande, 5 diversions, and 63 inflows. The net gain or loss of flow in the river channel was computed for four reaches within the 106-mile reach of the Rio Grande. The normalized percentage difference was computed for each reach to determine the difference between discharge measured at upstream and downstream sites, and the normalized percentage uncertainty was computed to determine if a computed gain or loss exceeded cumulative uncertainty associated with measurement of discharge.

  17. Organic petrology of Paleocene Marcelina Formation coals, Paso Diablo mine, western Venezuela: Tectonic controls on coal type

    USGS Publications Warehouse

    Hackley, P.C.; Martinez, M.

    2007-01-01

    About 7??Mt of high volatile bituminous coal are produced annually from the four coal zones of the Upper Paleocene Marcelina Formation at the Paso Diablo open-pit mine of western Venezuela. As part of an ongoing coal quality study, we have characterized twenty-two coal channel samples from the mine using organic petrology techniques. Samples also were analyzed for proximate-ultimate parameters, forms of sulfur, free swelling index, ash fusion temperatures, and calorific value. Six of the samples represent incremental benches across the 12-13??m thick No. 4 bed, the stratigraphically lowest mined coal, which is also mined at the 10??km distant Mina Norte open-pit. Organic content of the No. 4 bed indicates an upward increase of woody vegetation and/or greater preservation of organic material throughout the life of the original mire(s). An upward increase in telovitrinite and corresponding decrease in detrovitrinite and inertinite illustrate this trend. In contrast, stratigraphically higher coal groups generally exhibit a 'dulling upward' trend. The generally high inertinite content, and low ash yield and sulfur content, suggest that the Paso Diablo coals were deposited in rain-fed raised mires, protected from clastic input and subjected to frequent oxidation and/or moisture stress. However, the two thinnest coal beds (both 0.7??m thick) are each characterized by lower inertinite and higher telovitrinite content relative to the rest of Paso Diablo coal beds, indicative of less well-established raised mire environments prior to drowning. Foreland basin Paleocene coals of western Venezuela, including the Paso Diablo deposit and time-correlative coal deposits of the Ta??chira and Me??rida Andes, are characterized by high inertinite and consistently lower ash and sulfur relative to Eocene and younger coals of the area. We interpret these age-delimited coal quality characteristics to be due to water availability as a function of the tectonic control of subsidence rate. It

  18. Aryl hydrocarbon receptor-mediated activity of particulate organic matter from the Paso del Norte airshed along the U.S.-Mexico border.

    PubMed Central

    Arrieta, Daniel E; Ontiveros, Cynthia C; Li, Wen-Whai; Garcia, Jose H; Denison, Michael S; McDonald, Jacob D; Burchiel, Scott W; Washburn, Barbara Shayne

    2003-01-01

    In this study, we determined the biologic activity of dichloromethane-extracted particulate matter < 10 micro m in aerodynamic diameter (PM10) obtained from filters at three sites in the Paso del Norte airshed, which includes El Paso, Texas, USA; Juarez, Chihuahua, Mexico, and Sunland Park, New Mexico, USA. The extracts were rich in polycyclic aromatic hydrocarbons (PAHs) and had significant biologic activity, measured using two in vitro assay systems: ethoxyresorufin-(O-deethylase (EROD) induction and the aryl hydrocarbon-receptor luciferase reporter system. In most cases, both EROD (5.25 pmol/min/mg protein) and luciferase activities (994 relative light units/mg) were highest in extracts from the Advance site located in an industrial neighborhood in Juarez. These values represented 58% and 55%, respectively, of induction associated with 1 micro M ss-naphthoflavone exposures. In contrast, little activity was observed at the Northeast Clinic site in El Paso, the reference site. In most cases, luciferase and EROD activity from extracts collected from the Tillman Health Center site, situated in downtown El Paso, fell between those observed at the other two sites. Overall, a statistically significant correlation existed between PM10 and EROD and luciferase activities. Chemical analysis of extracts collected from the Advance site demonstrated that concentrations of most PAHs were higher than those reported in most other metropolitan areas in the United States. Calculations made with these data suggest a cancer risk of 5-12 cases per 100,000 people. This risk estimate, as well as comparisons with the work of other investigators, raises concern regarding the potential for adverse health effects to the residents of this airshed. Further work is needed to understand the sources, exposure, and effects of PM10 and particulate organic material in the Paso del Norte airshed. PMID:12896850

  19. Implementation of InTeGrate Modules into Introductory Courses in the El Paso Higher Education Community

    NASA Astrophysics Data System (ADS)

    Doser, D. I.; Villalobos, J. I.; Henry, I. E.

    2014-12-01

    InTeGrate (Interdisciplinary Teaching about Earth for a Sustainable Future) has developed teaching modules that focus on Earth sustainability and Earth-centered societal issues. We have begun to implement modules on climate change, earth materials and freshwater into introductory geology and environmental science courses taught at the University of Texas at El Paso (UTEP), El Paso Community College (EPCC) and local early college high schools (ECHS) for classes of 20 to 220 students. Our eventual goal is to insure students taking introductory classes at any institution will be exposed to comparable content and be similarly prepared for advanced courses. Our initial results suggest that the modules' use of case studies and analysis of authentic data sets are very appealing to our student body (over 70% Hispanic). Since many students do not speak English at home, they were challenged by vocabulary presented in some modules. Modules containing glossaries and extensive background material (such as concept maps and annotated figures) proved very helpful to these students. The use of pre-activity quizzes insured that the students had mastered basic concepts needed for in-class activities. Modifications required to teach these modules in larger classes included condensing materials and reducing the amount of color figures to save paper and printer costs, streamlining dissemination/collection of in-class group assignments, and adapting assignments such as jigsaws and gallery walks to the confines of a large lecture hall with fixed seating. Student reflections indicated students were able to make connections to societal issues and retain these ideas through the end of the courses.

  20. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  1. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    SciTech Connect

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  2. New cyt b gene universal primer set for forensic analysis.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  3. A High Temperature Hermetic Primer and a Variable Spring Tester

    SciTech Connect

    Begeal, D.R.

    1994-05-01

    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  4. New cyt b gene universal primer set for forensic analysis.

    PubMed

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  5. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  6. Changes in Rous Sarcoma Virus RNA Secondary Structure near the Primer Binding Site upon tRNATrp Primer Annealing

    PubMed Central

    Morris, Shannon; Leis, Jonathan

    1999-01-01

    Predicted secondary-structure elements encompassing the primer binding site in the 5′ untranslated region of Rous sarcoma virus (RSV) RNA play an integral role in multiple viral replications steps including reverse transcription, DNA integration, and RNA packaging (A. Aiyar, D. Cobrinik, Z. Ge, H. J. Kung, and J. Leis, J. Virol. 66:2464–2472, 1992; D. Cobrinik, A. Aiyar, Z. Ge, M. Katzman, H. Huang, and J. Leis, J. Virol. 65:3864–3872, 1991; J. T. Miller, Z. Ge, S. Morris, K. Das, and J. Leis, J. Virol. 71:7648–7656, 1997). These elements include the U5-Leader stem, U5-IR stem-loop, and U5-TΨC interaction region. Limited digestion of the 5′ untranslated region of wild-type and mutant RSV RNAs with structure- and/or sequence-specific RNases detects the presence of the U5-Leader stem and the U5-IR stem-loop. When a tRNATrp primer is annealed to wild-type RNAs in vitro, limited nuclease mapping indicates that the U5-IR stem becomes partially unwound. This is not observed when mutant RNAs with altered U5-IR stem-loop structures are substituted for wild-type RNAs. The U5-Leader stem also becomes destabilized when the tRNA primer is annealed to either wild-type or mutant RNA fragments. Nuclease mapping studies of tRNATrp, as well as the viral RNA, indicate that the U5-TΨC helix does form in vitro upon primer annealing. Collectively, these data suggest that the various structural elements near the RSV primer binding site undergo significant changes during the process of primer annealing. PMID:10400722

  7. A Primer on Fresh Water: The Environmental Citizenship Series.

    ERIC Educational Resources Information Center

    Environment Canada, Ottawa (Ontario).

    Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

  8. Depth profiles and free volume in aircraft primer films

    NASA Astrophysics Data System (ADS)

    Van Horn, J. D.; Chen, H.; Jean, Y. C.; Zhang, W.; Jaworowski, M. R.

    2015-06-01

    Positron annihilation lifetime spectroscopy (PALS) and associated techniques provide non-destructive methods to study the free volume inside polymeric materials, and to study material characteristics over a depth profile. Cast free films of organic- or aqueous-based, non-chromated aerospace primers, when cured for about one week, had very different water vapour transport (through-plane) behaviour. In addition, both types of primer films showed strong anisotropic behaviour in in-plane versus through-plane water vapour transport rates. We report the differences between the organic- and aqueous-based aircraft primer films samples and their surface depth profiles. In bulk PALS measurements, an aged, organic-based film exhibited typical lifetimes and intensities for a particulate-containing polymer film on both faces. In contrast, aqueous-based films exhibited face oriented-dependent differences. In all aqueous- based samples, the I3 value of the back of the sample was smaller. The primer film samples were also evaluated with mono-energetic positron beam techniques to generate depth profile information. The heterogeneity in the samples was verified by Doppler broadening of energy spectroscopy (DBES). A model for the differences in the faces of the films, and their layered structure is discussed.

  9. Children on Medication: A Primer for School Personnel.

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.

    Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…

  10. Exploding the Myths about DETC Accreditation: A Primer for Students

    ERIC Educational Resources Information Center

    Distance Education and Training Council, 2011

    2011-01-01

    Prospective distance education students are faced with a bewildering number of choices in selecting an institution that is best suited to achieving their educational goals. They also face a confusing forest of institutions' promotional claims of being the best or most respected school. This primer is intended to help the prospective student of an…

  11. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    ERIC Educational Resources Information Center

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  12. Zip Pak for Pre-Primer Reading Level (Teacher's Manual).

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children with reading deficiencies. Its goals are to: (1) increase and widen the child's ability to be selective in choosing his information and selecting information pertinent to a purpose; and (2) improve the child's ability to make decisions,…

  13. Zip Pak for Pre-Primer Reading Level.

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children who have reading deficiencies. The area of failure with these children has not been with the visual discrimination involved in decoding, but with the interpretation of the material to be decoded. Therefore, the 5 lessons in this student…

  14. Philosophical Foundations: A Primer for Adult Continuing Education.

    ERIC Educational Resources Information Center

    Rampp, Lary C., Ed.; Guffey, J. Stephen, Ed.

    This document, which is intended as a primer for adult continuing education, contains 11 chapters examining the philosophical foundations of adult and continuing education. The chapter titles and authors are as follows: "Progressivism and Adult Continuing Education" (Michael Day); "Progressivism: An Anthology" (Andrea Reeve); "Progressivism;…

  15. 5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. LOOKING NORTH TOWARD BARRICADES AROUND BUILDING NO. 230, PRIMER AND DETONATOR LOADING BUILDING. BARRICADES DIRECT FORCE OF BLAST UPWARD IN THE EVENT OF AN EXPLOSION. - Picatinny Arsenal, 200 Area, Shell Component Loading, State Route 15 near I-80, Dover, Morris County, NJ

  16. Computer Terminals and Terminology Made Easy! A Primer.

    ERIC Educational Resources Information Center

    Penny, Judith H.

    Designed to make computer users comfortable with both computers and user/reference manual instructions before they have hands-on training, this primer is an introduction to computer concepts, devices, and terms. Common questions related to learning about data processing are addressed, and the following topics are covered: captured data; reports;…

  17. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary

    2011-01-01

    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  18. Sequence-specific DNA primer effects on telomerase polymerization activity.

    PubMed Central

    Lee, M S; Blackburn, E H

    1993-01-01

    The ribonucleoprotein enzyme telomerase synthesizes one strand of telomeric DNA by copying a template sequence within the RNA moiety of the enzyme. Kinetic studies of this polymerization reaction were used to analyze the mechanism and properties of the telomerase from Tetrahymena thermophila. This enzyme synthesizes TTGGGG repeats, the telomeric DNA sequence of this species, by elongating a DNA primer whose 3' end base pairs with the template-forming domain of the RNA. The enzyme was found to act nonprocessively with short (10- to 12-nucleotide) primers but to become processive as TTGGGG repeats were added. Variation of the 5' sequences of short primers with a common 3' end identified sequence-specific effects which are distinct from those involving base pairing of the 3' end of the primer with the RNA template and which can markedly induce enzyme activity by increasing the catalytic rate of the telomerase polymerization reaction. These results identify an additional mechanistic basis for telomere and DNA end recognition by telomerase in vivo. Images PMID:8413255

  19. Improved primer for bonding polyurethane adhesives to metals

    NASA Technical Reports Server (NTRS)

    Constanza, L. J.

    1969-01-01

    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  20. Deeper Learning: A Primer for State Legislators. ECS Education Trends

    ERIC Educational Resources Information Center

    Aragon, Stephanie

    2015-01-01

    A growing number of schools across the country are working hard to provide a "deeper" learning experience for their students, and state legislators are being asked to create policies that support wide-scale implementation of 21st century learning practices. This primer is created for state policymakers seeking to modify instruction and…

  1. Barcoded primers used in multiplex amplicon pyrosequencing bias amplification.

    PubMed

    Berry, David; Ben Mahfoudh, Karim; Wagner, Michael; Loy, Alexander

    2011-11-01

    "Barcode-tagged" PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries. PMID:21890669

  2. Blood Donation and Transfusion: A Primer for Health Educators.

    ERIC Educational Resources Information Center

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  3. Method to amplify variable sequences without imposing primer sequences

    DOEpatents

    Bradbury, Andrew M.; Zeytun, Ahmet

    2006-11-14

    The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

  4. Palynofacial analysis in alkaline soils and paleoenvironmental implications: The Paso Otero 5 archaeological site (Necochea district, Buenos Aires province, Argentina)

    NASA Astrophysics Data System (ADS)

    Grill, S.; Borromei, A.; Martínez, G.; Gutierrez, M. A.; Cornou, M. E.; Olivera, D.

    2007-06-01

    The combination of palynofacial and sedimentological analyses constitutes a valuable method for paleoenvironmental and paleoclimatic reconstructions, especially when fossil pollen information is scarce or absent. This methodology elucidates a late Pleistocene/Holocene sequence at the Paso Otero 5 archaeological site in the middle basin of the Quequén Grande River, Necochea district, Buenos Aires province, Argentina. Although the main factor responsible for the destruction of pollen grains is pH, biochemical and chemical oxidation and mechanical damage contribute to the deterioration as well. The site sequence indicates that extremely arid climatic conditions without vegetation cover prevailed during the late Pleistocene (˜12,000 14C yr BP), after which the climate changed to semiarid conditions associated with a disturbed environment due to strong eolian activity (Palynofacies 1 and 2; pre-10,400 14C yr BP). During the Pleistocene/Holocene transition (Palynofacies 3 and 4; ˜10,400-9400 14C yr BP), loamy facies associated with paleosoils reflected stable conditions and temporary ponds (spring deposits). Similar conditions occurred near the end of early Holocene (Palynofacies 5-9; ˜9400-6600 14C yr BP), whereas sandy and silty facies are associated with the flood margins of streams or rivers in the middle and late Holocene (Palynofacies 10-14; 6600-2500 14C yr BP). The top of the sequence (Palynofacies 15 and 16) consists of alluvium sediments and reflects locally humid conditions and modern vegetation with anthropic influence. One of the earliest Pampean sites with evidence of humans (10,450-10,200 14C yr BP), Paso Otero 5, provides a variety of megafauna bone specimens associated with ``fish-tail" projectile points, a lithic artifact diagnostic of early human occupations in South America. The site contains a complete stratigraphic record from the late Pleistocene to the present. The evidence presented herein supports the hypothesis that human colonization, at

  5. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies

    PubMed Central

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-01-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira–Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface. PMID:19465390

  6. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.

    PubMed

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-07-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  7. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  8. Soil-borne polycyclic aromatic hydrocarbons in El Paso, Texas: Analysis of a potential problem in the United States/Mexico border region

    PubMed Central

    De La Torre-Roche, Roberto J.; Lee, Wen-Yee; Campos-Díaz, Sandra I.

    2009-01-01

    Ultrasonic extraction followed by Stir Bar Sorptive Extraction (SBSE) and thermal desorption inline coupled with Gas Chromatography and Mass Spectrometry (TD/GC/MS)was used to perform a comprehensive determination of soil-borne polycyclic aromatic hydrocarbons (PAHs) in El Paso, Texas. The method provided good sensitivity and faster processing time for the analysis. The total PAHs in El Paso soil ranged from 0.1 to 2225.5 µg kg−1. Although the majority of PAH concentrations did not exceed the soil screening levels regulated by the United States Environmental Protection Agency, the existence of PAHs in this ecosystem is ubiquitous. Naphthalene were found in 100% of the soil samples; while the heavy PAHs (five- and six-ring) were not often detected and mostly remained in closer proximity to industrial areas and major traffic points. The results ruled out the possibility of petroleum refining as the significant source of local soil-borne PAH contamination, but they suggested that the PAHs found in El Paso soil were closely linked to human activities and possible other industrial processes. PMID:18768257

  9. A Smoke-Free Paso del Norte: Impact Over 10 Years on Smoking Prevalence Using the Behavioral Risk Factor Surveillance System

    PubMed Central

    Taylor, Thom; Hernandez, Nora; Kelly, Michael; Law, Jon; Colwell, Brian

    2012-01-01

    Objectives. We assessed the impact of a tobacco control initiative over 10 years on cessation and prevention. Methods. We examined 2000–2009 Behavioral Risk Factor Surveillance System cases of a metropolitan statistical area (MSA) with systematic tobacco control efforts throughout the decade (El Paso, TX) and 2 comparison MSAs similar in size and population with less coordinated tobacco control efforts (Austin-Round Rock, TX and San Antonio, TX). Results. Yearly, El Paso exhibited a 6% increase in the prevalence of former smokers, a 6% decrease in prevalence of daily smokers, and a 7% decrease in the prevalence of established smoking (≥ 100 cigarettes per lifetime and currently smoking); we did not observe similar trends in the comparison MSAs. There was no change in the prevalence of nondaily smokers in any of the MSAs. Conclusions. The coordinated tobacco control activities in El Paso are related to cessation among daily smokers and prevention of established smoking at the population level but have not stimulated cessation among nondaily smokers. Comprehensive tobacco control should focus more on not only daily smokers but also nondaily smokers. PMID:22494000

  10. Insurance Status Is a Greater Barrier Than Income or Acculturation to Chronic Disease Screening in the Mexican Origin Population in El Paso, Texas.

    PubMed

    Salinas, Jennifer J; de Heer, Hendrik D; Lapeyrouse, Lisa M; Heyman, Josiah M; Balcázar, Hector Guillermo

    2015-01-01

    The purpose of this study was to determine the association between income, insurance status, acculturation, and preventive screening for diabetes, high blood pressure, and cholesterol in Mexican American adults living in El Paso, Texas. This is a secondary data analysis using data from El Paso, Texas, that was collected between November 2007 and May 2009. Bivariate and stepwise regression analysis was used to determine the relationships between income, insurance, and acculturation factors on preventive screenings. Findings indicate that insurance status was associated with blood pressure check, blood sugar check, cholesterol screening, and any preventive screening. The association for income $40,000 + was explained by insurance. The only significant acculturation variable was language use for cholesterol. Disparities in preventive health screening in Mexican Americans were associated with primary insurance coverage in El Paso, Texas. With the border region being among the most medically underserved and underinsured areas in the United States, the results from this study suggest policy efforts are essential to ensure equal access to resources to maintain good health. Intervention efforts may include increasing awareness of enrollment information for insurance programs through the Affordable Care Act.

  11. Organic geochemical investigation and coal-bed methane characteristics of the Guasare coals (Paso Diablo mine, western Venezuela)

    USGS Publications Warehouse

    Quintero, K.; Martinez, M.; Hackley, P.; Marquez, G.; Garban, G.; Esteves, I.; Escobar, M.

    2011-01-01

    The aim of this work was to carry out a geochemical study of channel samples collected from six coal beds in the Marcelina Formation (Zulia State, western Venezuela) and to determine experimentally the gas content of the coals from the Paso Diablo mine. Organic geochemical analyses by gas chromatography-mass spectrometry and isotopic analyses on-line in coalbed gas samples were performed. The results suggest that the Guasare coals were deposited in a continental environment under highly dysoxic and low salinity conditions. The non-detection of 18??(H)-oleanane does not preclude that the organic facies that gave rise to the coals were dominated by angiosperms. In addition, the presence of the sesquiterpenoid cadalene may indicate the subordinate contribution of gymnosperms (conifers) in the Paleocene Guasare mire. The average coalbed gas content obtained was 0.6 cm3/g. ??13C and D values indicate that thermogenic gas is prevalent in the studied coals. Copyright ?? Taylor & Francis Group, LLC.

  12. Applications of particle-tracking techniques to bank infiltration: a case study from El Paso, Texas, USA

    NASA Astrophysics Data System (ADS)

    Abdel-Fattah, Ahmad; Langford, Richard; Schulze-Makuch, Dirk

    2008-08-01

    This paper presents results of a small scale study that utilized particle-tracking techniques to evaluate transport of river water through an alluvial aquifer in a bank infiltration testing site in El Paso, Texas, USA. The particle-tracking survey was used to better define filtration parameters. Several simulations were generated to allow visualization of the effects of well placement and pumping rate on flow paths, travel time, the size of the pumping influence zone, and proportion of river-derived water and groundwater mixing in the pumping well. Simulations indicate that migration of river water into the aquifer is generally slow. Most water does not arrive at the well by the end of an 18-day pumping period at 0.54 m3/min pumping rate for a well located 18 m from the river. Forty-four percent of the water pumped from the well was river water. The models provided important information needed to design appropriate sampling schedules for bank filtration practices and ensured meeting adequate soil-retention times. The pumping rate has more effect on river water travel time than the location of the pumping well from the river. The examples presented in this paper indicate that operating the pumping well at a doubled distance from the river increased the time required for the water to travel to the well, but did not greatly change the capture zone.

  13. An Aquifer Storage and Recovery system with reclaimed wastewater to preserve native groundwater resources in El Paso, Texas.

    PubMed

    Sheng, Zhuping

    2005-06-01

    The traditional concept of Aquifer Storage and Recovery (ASR) has been emphasized and extensively applied for water resources conservation in arid and semi-arid regions using groundwater systems as introduced in Pyne's book titled Groundwater Recharge and Wells. This paper extends the ASR concept to an integrated level in which either treated or untreated surface water or reclaimed wastewater is stored in a suitable aquifer through a system of spreading basins, infiltration galleries and recharge wells; and part or all of the stored water is recovered through production wells, dual function recharge wells, or by streams receiving increased discharge from the surrounding recharged aquifer as needed. In this paper, the author uses the El Paso Water Utilities (EPWU) ASR system for injection of reclaimed wastewater into the Hueco Bolson aquifer as an example to address challenges and resolutions faced during the design and operation of an ASR system under a new ASR system definition. This new ASR system concept consists of four subsystems: source water, storage space-aquifer, recharge facilities and recovery facilities. Even though facing challenges, this system has successfully recharged approximately 74.7 million cubic meters (19.7 billion gallons) of reclaimed wastewater into the Hueco Bolson aquifer through 10 recharge wells in the last 18 years. This ASR system has served dual purposes: reuse of reclaimed wastewater to preserve native groundwater, and restoration of groundwater by artificial recharge of reclaimed wastewater into the Hueco Bolson aquifer.

  14. Dento-alveolar lesions and palaeodietary inferences from the Paso Alsina 1 site (eastern Pampean-Patagonian transition, Argentina).

    PubMed

    Flensborg, G

    2011-10-01

    Several archaeological researches in northeastern Patagonia and southeastern Pampas have evaluated various indicators of the diets of hunter-gatherers who inhabited these regions during the Late Holocene, including the role of plant foods. Dental analysis is an important way to introduce new information about subsistence. In this sense, the objective of this work is to document and interpret dento-alveolar lesions in an osteological sample recovered from the Paso Alsina 1 archaeological site (eastern Pampean-Patagonian transition, Argentina). This paper will explore the oral health status of individuals and discuss palaeodietary information of hunter-gatherers that inhabited the lower valley of the Colorado River during the final Late Holocene (ca. 500 years BP). The site is defined as a formal area bundle composed of 10 secondary multiple burials containing 56 individuals of both sexes and various ages (e.g., perinatal, infant, and adult). In this study, 781 teeth and 1036 alveoli from 47 maxillae and 38 mandibles were analysed from 51 adult individuals. The results indicate a moderate rate of dental wear, and dental calculus, and low percentages of caries, abscesses, and antemortem tooth loss. The information obtained suggests a diet based on a combination of proteins, fat and carbohydrates. Results are then compared with those from other lines of analysis for the study area and for the neighboring regions (northeastern Patagonia and southeastern Pampas). PMID:21924417

  15. Comparison of two carbonate mound sequences in the Lower Ordovician El Paso Formation, west Texas and southern New Mexico

    SciTech Connect

    Clemons, R.E.

    1985-01-01

    The El Paso Formations consists of four members, in ascending order: Hitt Canyon, Jose McKelligon and Padre. Mounds in the McKelligon Member exposed in the southern Franklin Mountains were described by Toomey (1970). Most of these mounds are small but one large one is 5.8 m thick and about 13.7 m long in outcrop. The mound rock is chiefly bioclastic wackestone with minor packstone and boundstone. The varied fauna contains echinoderms, sponges and spicules, gastropods, trilobites, digitate algae, Nuia, Girvanella, Pulchrilamina, Calathium, and minor brachiopods and cephalopods. Intraclastic, bioclastic grainstone fills channels cut in the mounds. Similar, but smaller and less spectacular mounds occur in the McKelligon Member in the Florida, Big Hatchet, and Caballo Mountains, Lone Mountain, Cooke's Range, and elsewhere in southwestern New Mexico. A second type of mound is common in the upper part of the Hitt Canyon Member in the Cooke's Range, Red Hills, Caballo and Big Hatchet Mountains. These mounds also are typically small but one in the Red Hills is 13.7 m thick and about 30 m long in outcrop. The mound complex is about 75-80% SH-C and LLH-C stromatolite boundstone and bioclastic wackestone. The remaining 20-25% is bioclastic packstone and grainstone between the SH-C stromatolites and filling channels cut in the mound complex. The limited fauna contains small fragments of echinoderms, gastropods, trilobites, spicules, and Nuia.

  16. Utilizing Continuous Resistivity Profiling for Assessment and Characterization of Canal Seepage in El Paso's Lower Valley Irrigation Network System

    NASA Astrophysics Data System (ADS)

    Brown, W. A.; Sheng, Z.

    2009-12-01

    Annually, billions of gallons of water are lost through seepage along sections of the irrigation network. To conserve water, El Paso County Water Improvement District has been assessing seepage losses and investigating measures for reducing such losses. Resistivity techniques were used to identify areas of high seepage and provide information on locations along canals that need to be structurally modified in an effort to curb water lost through seepage. Several half mile sections were selected along canals with varying seepage rates to conduct electric resistivity surveys in order generate soil profiles during the non-irrigation and irrigation seasons. Two different multiple channel resistivity meters (The“OhmMapper and the Super Sting R8”) were used, which both allow a vertical resistivity profile to be collected using a single current transmission. The results presented are preliminary and we believe that upon completion findings will serve multiple purposes. Firstly, a better understanding of seepage patterns, seepage rate and its spatial variation can be obtained. Secondly, our findings could be used to produce geological profiles associated with seepage areas which will enable the irrigation district to develop guidelines for improving delivery efficiency, especially during drought. And thirdly, our results will be transferable to other areas of the state and will have a positive impact on the environment and the overall quality of life.

  17. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  18. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  19. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  20. [Screening of peafowl microsatellite primers and analysis of genetic diversity].

    PubMed

    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang

    2006-10-01

    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing.

  1. Stability of the high-temperature G-16 primer composition

    SciTech Connect

    Durand, N.A.; Weinmaster, R.R.; Massis, T.A.; Fleming, W.

    1988-01-01

    The stability of the G-16 pyrotechnic primer mixture of antimony sulfide, calcium silicide, and potassium chlorate was studied at temperatures up to 200/sup 0/C in sealed and open environments. Data have shown that this mixture is stable in open environments at 200/sup 0/C for up to 48 hours. However, in sealed, limited volume environments, the mixture completely decomposes within 24 hours at 200/sup 0/C. In sealed environments, the mixture shows stability with copper present. Both functional testing and chemical analysis were used to evaluate the primer composition after temperature exposure. The degree of degradation of the mixture was determined from the concentration of final reaction products (sulfate and chloride ions), using ion chromatography. When copper was present, the intermediate reaction products were scavenged by the copper, and the degradation was reduced. The role of copper in the reaction was verified with differential scanning calorimetry and surface analysis. 3 refs., 9 figs., 2 tabs.

  2. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  3. [Screening of peafowl microsatellite primers and analysis of genetic diversity].

    PubMed

    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang

    2006-10-01

    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing. PMID:17035182

  4. Primer and interviews: Molecular mechanisms of morphological evolution

    PubMed Central

    Kiefer, Julie C

    2010-01-01

    The beauty of the developing embryo, and the awe that it inspires, lure many scientists into the field of developmental biology. What compels cells to divide, migrate, and morph into a being with a complex body plan? Evolutionary developmental biologists hold similar fascinations, with dynamics that take place on a grander timescale. How do phenotypic traits diverge over evolutionary time? This primer illustrates how a deep understanding of the basic principles that underlie developmental biology have changed how scientists think about the evolution of body form. The primer culminates in a conversation with David Stern, PhD, and Michael Shapiro, PhD, who discuss current topics in morphological evolution, why the field should be of interest to classic developmental biologists, and what lies ahead. Developmental Dynamics 239:3497–3505, 2010. © 2010 Wiley-Liss, Inc. PMID:21069831

  5. Small Commercial Building Re-tuning: A Primer

    SciTech Connect

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  6. Primer on Molecular Genetics; DOE Human Genome Program

    DOE R&D Accomplishments Database

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  7. Primer on molecular genetics. DOE Human Genome Program

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  8. Primer initiation and extension by T7 DNA primase

    PubMed Central

    Qimron, Udi; Lee, Seung-Joo; Hamdan, Samir M; Richardson, Charles C

    2006-01-01

    T7 DNA primase is composed of a catalytic RNA polymerase domain (RPD) and a zinc-binding domain (ZBD) connected by an unstructured linker. The two domains are required to initiate the synthesis of the diribonucleotide pppAC and its extension into a functional primer pppACCC (de novo synthesis), as well as for the extension of exogenous AC diribonucleotides into an ACCC primer (extension synthesis). To explore the mechanism underlying the RPD and ZBD interactions, we have changed the length of the linker between them. Wild-type T7 DNA primase is 10-fold superior in de novo synthesis compared to T7 DNA primase having a shorter linker. However, the primase having the shorter linker exhibits a two-fold enhancement in its extension synthesis. T7 DNA primase does not catalyze extension synthesis by a ZBD of one subunit acting on a RPD of an adjacent subunit (trans mode), whereas de novo synthesis is feasible in this mode. We propose a mechanism for primer initiation and extension based on these findings. PMID:16642036

  9. Primer initiation and extension by T7 DNA primase.

    PubMed

    Qimron, Udi; Lee, Seung-Joo; Hamdan, Samir M; Richardson, Charles C

    2006-05-17

    T7 DNA primase is composed of a catalytic RNA polymerase domain (RPD) and a zinc-binding domain (ZBD) connected by an unstructured linker. The two domains are required to initiate the synthesis of the diribonucleotide pppAC and its extension into a functional primer pppACCC (de novo synthesis), as well as for the extension of exogenous AC diribonucleotides into an ACCC primer (extension synthesis). To explore the mechanism underlying the RPD and ZBD interactions, we have changed the length of the linker between them. Wild-type T7 DNA primase is 10-fold superior in de novo synthesis compared to T7 DNA primase having a shorter linker. However, the primase having the shorter linker exhibits a two-fold enhancement in its extension synthesis. T7 DNA primase does not catalyze extension synthesis by a ZBD of one subunit acting on a RPD of an adjacent subunit (trans mode), whereas de novo synthesis is feasible in this mode. We propose a mechanism for primer initiation and extension based on these findings.

  10. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  11. Sensory reception of the primer pheromone ethyl oleate

    NASA Astrophysics Data System (ADS)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  12. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    PubMed

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  13. Integrated Analysis of the Hydrology of a Mitigated Wetland in El Paso,Texas Utilizing Water Quality and Electrical Conductivity

    NASA Astrophysics Data System (ADS)

    Gonzalez, R.; Lucero, M.; Villalobos, J. I.; Doser, D. I.; Sheng, Z.; Wetland, Conductivity, Salinity, Water Quality

    2010-12-01

    Keystone Heritage Park (KHP) is a 52-acre nature preserve containing a natural wetland within city limits of El Paso, Texas. The source of water for the wetland has been an issue of interest as efforts to restore this wetland back to it native habit are currently underway. KHP is situated within the Mesilla Bolson - a Tertiary fault-block basin- and is adjacent to the Franklin mountains - a Laramide related fault block mountain range. The wetlands of Keystone are located in the shallow water bearing zones within the Mesilla Bolson which include the overlying Rio Grande Alluvium. It is thought the primary sources of groundwater and surface water for the KHP wetlands are by means of mountain-front recharge and through groundwater traveling south coming from the Rio Grande. The goal of this project was to identify possible locations of freshwater springs originating from these sources flowing into the wetlands. The project and data covered a period where the wetlands are at their driest (Dec.-May) due to winter weather and when they are at their fullest due to monsoonal rains (July- Aug.). By utilizing a Horiba portable pH/EC/TDS Meter quality of surface and groundwater was gathered throughout the wetlands at 14 sites. Preliminary results suggest several springs recharging the wetlands during both dry and wet periods. Further investigation of this result led to the use of an EM-31 data logger for conductivity data to better understand the relationships between groundwater, surface water, soil properties, and the mobilization of minerals entering the wetlands.

  14. Integrated Analysis of the Hydrology of a Mitigated Wetland Utilizing Water Quality and Electrical Conductivity in El Paso Texas

    NASA Astrophysics Data System (ADS)

    Gonzalez, R.; Lucero, M.; Villalobos, J. I.; Doser, D. I.; Sheng, Z.

    2011-12-01

    Keystone Heritage Park (KHP) is a 52-acre nature preserve containing a natural wetland within city limits of El Paso, Texas. The source of water for the wetland has been an issue of interest as efforts to restore this wetland back to it native habit are currently underway. KHP is situated within the Mesilla Bolson - a Tertiary fault-block basin- and is adjacent to the Franklin mountains - a Laramide related fault block mountain range. The wetlands of Keystone are located in the shallow water bearing zones within the Mesilla Bolson which includes the overlying Rio Grande Alluvium. It is thought the primary sources of groundwater and surface water for the KHP wetlands are by means of mountain-front recharge and through groundwater traveling south coming from the Rio Grande. The goal of this project was to identify possible locations of freshwater springs originating from these sources flowing into the wetlands. The project and data covered a period where the wetlands are at their driest (Dec.-May) due to winter weather and when they are at their fullest due to monsoonal rains (July- Aug.). By utilizing a Horiba portable pH/EC/TDS Meter quality of surface and groundwater was gathered throughout the wetlands at 14 sites. Preliminary results suggest several springs recharging the wetlands during both dry and wet periods. Further investigation of this result led to the use of an EM-31 data logger for conductivity data to better understand the relationships between groundwater, surface water, soil properties, and the mobilization of minerals entering the wetlands.

  15. GIS-modeled indicators of traffic-related air pollutants and adverse pulmonary health among children in El Paso, Texas.

    PubMed

    Svendsen, Erik R; Gonzales, Melissa; Mukerjee, Shaibal; Smith, Luther; Ross, Mary; Walsh, Debra; Rhoney, Scott; Andrews, Gina; Ozkaynak, Halûk; Neas, Lucas M

    2012-10-01

    Investigators examined 5,654 children enrolled in the El Paso, Texas, public school district by questionnaire in 2001. Exposure measurements were first collected in the late fall of 1999. School-level and residence-level exposures to traffic-related air pollutants were estimated using a land use regression model. For 1,529 children with spirometry, overall geographic information system (GIS)-modeled residential levels of traffic-related ambient air pollution (calibrated to a 10-ppb increment in nitrogen dioxide levels) were associated with a 2.4% decrement in forced vital capacity (95% confidence interval (CI): -4.0, -0.7) after adjustment for demographic, anthropomorphic, and socioeconomic factors and spirometer/technician effects. After adjustment for these potential covariates, overall GIS-modeled residential levels of traffic-related ambient air pollution (calibrated to a 10-ppb increment in nitrogen dioxide levels) were associated with pulmonary function levels below 85% of those predicted for both forced vital capacity (odds ratio (OR) = 3.10, 95% CI: 1.65, 5.78) and forced expiratory volume in 1 second (OR = 2.35, 95% CI: 1.38, 4.01). For children attending schools at elevations above 1,170 m, a 10-ppb increment in modeled nitrogen dioxide levels was associated with current asthma (OR = 1.56, 95% CI: 1.08, 2.50) after adjustment for demographic, socioeconomic, and parental factors and random school effects. These results are consistent with previous studies in Europe and California that found adverse health outcomes in children associated with modeled traffic-related air pollutants.

  16. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    PubMed Central

    2009-01-01

    Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in

  17. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    NASA Technical Reports Server (NTRS)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  18. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    NASA Astrophysics Data System (ADS)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  19. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  20. A NASTRAN primer for the analysis of rotating flexible blades

    NASA Technical Reports Server (NTRS)

    Lawrence, Charles; Aiello, Robert A.; Ernst, Michael A.; Mcgee, Oliver G.

    1987-01-01

    This primer provides documentation for using MSC NASTRAN in analyzing rotating flexible blades. The analysis of these blades includes geometrically nonlinear (large displacement) analysis under centrifugal loading, and frequency and mode shape (normal modes) determination. The geometrically nonlinear analysis using NASTRAN Solution sequence 64 is discussed along with the determination of frequencies and mode shapes using Solution Sequence 63. A sample problem with the complete NASTRAN input data is included. Items unique to rotating blade analyses, such as setting angle and centrifugal softening effects are emphasized.

  1. Whole genome amplification using single-primer PCR.

    PubMed

    Lao, Kaiqin; Xu, Nan Lan; Straus, Neil A

    2008-03-01

    Comprehensive genomic molecular analyses require relatively large DNA amounts that are often not available from forensic, clinical and other crucial biological samples. Numerous methods to amplify the whole genome have been proposed for cancer, forensic and taxonomic research. Unfortunately, when using truly random primers for the initial priming step, all of these procedures suffer from high background problems for sub-nanogram quantities of input DNA. Here we report an approach to eliminate this problem for PCR-based methods even at levels of DNA approaching that of a single cell.

  2. Exciton Primer-mediated SNP detection in SmartAmp2 reactions.

    PubMed

    Lezhava, Alexander; Ishidao, Takefumi; Ishizu, Yuri; Naito, Kana; Hanami, Takeshi; Katayama, Atsuko; Kogo, Yasushi; Soma, Takahiro; Ikeda, Shuji; Murakami, Kayoko; Nogawa, Chihiro; Itoh, Masayoshi; Mitani, Yasumasa; Harbers, Matthias; Okamoto, Akimitsu; Hayashizaki, Yoshihide

    2010-02-01

    Most commonly used intercalating fluorescent dyes in DNA detection are lacking any sequence specificity, whereas so-called Exciton Primers can overcome this limitation by functioning as "sequence-specific dyes." After hybridization to complementary sequences, the fluorescence of Exciton Primers provides sequence-specific signals for real-time monitoring of amplification reactions. Applied to the SmartAmp2 mutation detection process, Exciton Primers show high signal strength with low background leading to a superior specificity and sensitivity compared to SYBR Green I. Signal strength can be further enhanced using multiple dyes within one Exciton Primer or use of multiple Exciton Primers in the same amplification reaction. Here we demonstrate the use of Exciton Primers for genotyping a single nucleotide polymorphism (SNP) in the VKORC1 locus (-1639G>A) relevant for Warfarin dosing as an example for Exciton Primers mediated genotyping by SmartAmp2. The genotyping assay can use only one labeled Exciton Primer for endpoint detection, or simultaneously by real-time monitoring detect wild-type and mutant alleles in a one-tube reaction using two Exciton Primers having different dyes. Working directly from blood samples, Exciton Primer mediated genotyping by SmartAmp2 offers superior solutions for rapid point-of-care testing.

  3. Fluid‐driven seismicity response of the Rinconada fault near Paso Robles, California, to the 2003 M 6.5 San Simeon earthquake

    USGS Publications Warehouse

    Hardebeck, Jeanne L.

    2012-01-01

    The 2003 M 6.5 San Simeon, California, earthquake caused significant damage in the city of Paso Robles and a persistent cluster of aftershocks close to Paso Robles near the Rinconada fault. Given the importance of secondary aftershock triggering in sequences of large events, a concern is whether this cluster of events could trigger another damaging earthquake near Paso Robles. An epidemic‐type aftershock sequence (ETAS) model is fit to the Rinconada seismicity, and multiple realizations indicate a 0.36% probability of at least one M≥6.0 earthquake during the next 30 years. However, this probability estimate is only as good as the projection into the future of the ETAS model. There is evidence that the seismicity may be influenced by fluid pressure changes, which cannot be forecasted using ETAS. The strongest evidence for fluids is the delay between the San Simeon mainshock and a high rate of seismicity in mid to late 2004. This delay can be explained as having been caused by a pore pressure decrease due to an undrained response to the coseismic dilatation, followed by increased pore pressure during the return to equilibrium. Seismicity migration along the fault also suggests fluid involvement, although the migration is too slow to be consistent with pore pressure diffusion. All other evidence, including focal mechanisms and b‐value, is consistent with tectonic earthquakes. This suggests a model where the role of fluid pressure changes is limited to the first seven months, while the fluid pressure equilibrates. The ETAS modeling adequately fits the events after July 2004 when the pore pressure stabilizes. The ETAS models imply that while the probability of a damaging earthquake on the Rinconada fault has approximately doubled due to the San Simeon earthquake, the absolute probability remains low.

  4. Development of a unique polyurethane primer/topcoat

    NASA Technical Reports Server (NTRS)

    Novak, Howard L.; Klotz, James M.

    1994-01-01

    USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.

  5. FullSSR: Microsatellite Finder and Primer Designer

    PubMed Central

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  6. Primer for evaluating ecological risk at petroleum release sites.

    PubMed

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response. PMID:10189585

  7. FullSSR: Microsatellite Finder and Primer Designer.

    PubMed

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  8. Primer for evaluating ecological risk at petroleum release sites.

    PubMed

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  9. FullSSR: Microsatellite Finder and Primer Designer.

    PubMed

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  10. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA.

    PubMed

    Asemaninejad, Asma; Weerasuriya, Nimalka; Gloor, Gregory B; Lindo, Zoë; Thorn, R Greg

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95-98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72-80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  11. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

    2016-01-01

    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and

  12. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë

    2016-01-01

    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  13. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    PubMed Central

    Lund, Anders H.; Duch, Mogens; Pedersen, Finn Skou

    2000-01-01

    Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNAPro molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian retroviruses have revealed evidence of molecular adaptation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites. While most of the selected primer binding sites are complementary to the 3′-end of tRNAPro, we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNAArg(CCU), tRNAPhe(GAA) and a hitherto unknown human tRNASer(CGA). PMID:10637332

  14. Universal multiplexable matK primers for DNA barcoding of angiosperms1

    PubMed Central

    Heckenhauer, Jacqueline; Barfuss, Michael H. J.; Samuel, Rosabelle

    2016-01-01

    Premise of the study: PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. Methods and Results: We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. Conclusions: These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification. PMID:27347449

  15. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  16. PCR primers for the amplification of four insect mitochondrial gene fragments.

    PubMed

    Kambhampati, S; Smith, P T

    1995-11-01

    Insect mitochondrial genome (mtDNA) analysis is a powerful tool for the study of population genetics and phylogenetics. In the past few years primer sequences for the PCR amplification of various insect mtDNA genes have been published. The objectives of this study were (1) present new primer sequences for six insect mitochondrial genes and (2) test primers designed in our laboratory and some previously published primers on a wide range of insects to determine if amplification of the target fragment could be obtained. The primers for the amplification of the two ribosomal RNA gene (16S and 12S rRNA) fragments are universal for insects and related groups; the primers for NADH5 and NADH4 dehydrogenase gene fragments and cytochrome c oxidase I gene fragment are applicable broadly.

  17. Inosine at Different Primer Positions to Study Structure and Diversity of Prokaryotic Populations.

    PubMed

    Ben-Dov, Eitan; Kushmaro, Ariel

    2015-01-01

    Culture-independent methods, employed to study the diversity and complexity of microbial communities that are based on amplification of rRNA genes with universal primers, include gradient gel electrophoresis (denaturing or temperature), single-strand-conformation polymorphism, restriction fragment length polymorphism, qPCR and high-throughput DNA sequencing. Substituting one or more base(s) within or at the 3'-termi of the universal primers by inosine can overcome some of their shortcomings improving amplification capacity. Universal primer sets do not usually amplify sequences with nucleotide mismatch to the templates, particularly in the last three bases, whereas inosine-modified primers anneal and amplify a variety of rRNA gene sequences. Inosine-containing primers are therefore might be useful to detect more species in diverse prokaryotic populations. The article summarizes the pros and cons of using inosine especially at the 3' termini of universal primers in nucleic acid amplification for the study of microbial diversity.

  18. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  19. A method for predicting service life of zinc rich primers on carbon steel

    NASA Technical Reports Server (NTRS)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  20. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    PubMed Central

    Spandidos, Athanasia; Wang, Xiaowei; Wang, Huajun; Dragnev, Stefan; Thurber, Tara; Seed, Brian

    2008-01-01

    Background Quantitative polymerase chain reaction (QPCR) is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays. PMID:19108745

  1. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  2. The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  3. Express Primer Tool for high-throughput gene cloning and expression

    2002-12-01

    A tool to assist in the design of primers for DNA amplification. The Express Primer web-based tool generates primer sequences specifically for the generation of expression clones for both lab scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for simultaneous amplification of multiple target genes.more » The Express Primer Tool enables the user to specify various experimental parameters (e.g. optimal Tm, Tm range, maximum Tm difference) for single or multiple candidate sequence(s) in FASTA format input as a flat text (ASCII) file. The application generates condidate primers, selects optimal primer pairs, and writes the forward and reverse primers pairs to an Excel file that is suitable for electronic submission to a synthesis facility. The program parameters emphasize high-throughput but allow for target atrition at various stages of the project.« less

  4. ecoPrimers: inference of new DNA barcode markers from whole genome sequence analysis

    PubMed Central

    Riaz, Tiayyba; Shehzad, Wasim; Viari, Alain; Pompanon, François; Taberlet, Pierre; Coissac, Eric

    2011-01-01

    Using non-conventional markers, DNA metabarcoding allows biodiversity assessment from complex substrates. In this article, we present ecoPrimers, a software for identifying new barcode markers and their associated PCR primers. ecoPrimers scans whole genomes to find such markers without a priori knowledge. ecoPrimers optimizes two quality indices measuring taxonomical range and discrimination to select the most efficient markers from a set of reference sequences, according to specific experimental constraints such as marker length or specifically targeted taxa. The key step of the algorithm is the identification of conserved regions among reference sequences for anchoring primers. We propose an efficient algorithm based on data mining, that allows the analysis of huge sets of sequences. We evaluate the efficiency of ecoPrimers by running it on three different sequence sets: mitochondrial, chloroplast and bacterial genomes. Identified barcode markers correspond either to barcode regions already in use for plants or animals, or to new potential barcodes. Results from empirical experiments carried out on a promising new barcode for analyzing vertebrate diversity fully agree with expectations based on bioinformatics analysis. These tests demonstrate the efficiency of ecoPrimers for inferring new barcodes fitting with diverse experimental contexts. ecoPrimers is available as an open source project at: http://www.grenoble.prabi.fr/trac/ecoPrimers. PMID:21930509

  5. Recent developments in primer design for DNA polymorphism and mRNA profiling in higher plants

    PubMed Central

    Yang, Xiaohan; Scheffler, Brian E; Weston, Leslie A

    2006-01-01

    Primer design is a critical step in the application of PCR-based technologies in gene expression and genetic diversity analysis. As more plant genomes have been sequenced in recent years, the emphasis of primer design strategy has shifted to genome-wide and high-throughput direction. This paper summarizes recent advances in primer design for profiling of DNA polymorphism and mRNA in higher plants, as well as new primer systems developed for animals that can be adapted for plants. PMID:16509990

  6. Anti-biofilm dentin primer with quaternary ammonium and silver nanoparticles.

    PubMed

    Cheng, L; Zhang, K; Melo, M A S; Weir, M D; Zhou, X; Xu, H H K

    2012-06-01

    Antibacterial bonding agents could combat recurrent caries at the tooth-composite margins. The objectives of this study were to develop novel antibacterial dentin primers containing quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg), and to investigate the effects on dentin bond strength and dental plaque microcosm biofilms for the first time. Scotchbond Multi-Purpose ("SBMP") bonding agent was used. QADM and NAg were incorporated into SBMP primer, yielding 4 primers: SBMP primer (control), control + 10% QADM (mass), control + 0.05% NAg, and control + 10% QADM + 0.05% NAg. Human saliva was collected to grow microcosm biofilms. The NAg particle size (mean ± SD; n = 100) was 2.7 ± 0.6 nm. Dentin shear bond strengths (n = 10) with human third molars were approximately 30 MPa for all groups (p > 0.1). QADM-NAg-containing primer increased the bacteria inhibition zone by 9-fold, compared with control primer (p < 0.05). QADM-NAg-containing primer reduced lactic acid production and colony-forming units of total micro-organisms, total streptococci, and mutans streptococci by an order of magnitude. In conclusion, novel QADM-NAg-containing primers were strongly antibacterial without compromising dentin bond strength, and hence are promising to inhibit biofilms and secondary caries. The processing method of incorporating QADM and NAg together into the same primer produced the strongest antibacterial effect, which could have a wide applicability to other bonding systems. PMID:22492276

  7. Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.

    PubMed

    Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya

    2012-01-01

    This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.

  8. PCR hot start using primers with the structure of molecular beacons (hairpin-like structure).

    PubMed

    Kaboev, O K; Luchkina, L A; Tret'iakov, A N; Bahrmand, A R

    2000-11-01

    A new technique of PCR hot start using oligonucleotide primers with a stem-loop structure is developed here. The molecular beacon oligonucleotide structure without any chromophore addition to the ends was used. The 3'-end sequence of the primers was complementary to the target and five or six nucleotides complementary to the 3'-end were added to the 5'-end. During preparation of the reaction mixture and initial heating, the oligonucleotide has a stem-loop structure and cannot serve as an effective primer for DNA polymerase. After heating to the annealing temperature it acquires a linear structure and primer extension can begin.

  9. Illegal sales of cigarettes to minors--Ciudad Juárez, Mexico; El Paso, Texas; and Las Cruces, New Mexico, 1999.

    PubMed

    1999-05-21

    In 1996, the United States-Mexico Binational Commission (US-MBC) Health Working Group identified prevention of tobacco use, particularly among adolescents, as a priority and subsequently recommended joint efforts toward reducing illegal sales of cigarettes to minors. A 1997 survey of 561 commercial cigarette outlets in Mexico City found that 79% of retailers sold cigarettes to minors. To assess the illegal sale of cigarettes to minors in other regions of Mexico and on both sides of the U.S.-Mexico border, during January-February 1999 the General Directorate of Epidemiology in Mexico, the Chihuahua State Department of Health Services (CDH), the Ciudad Juarez Department of Health (CJDH), the Texas Department of Health (TDH), and the New Mexico Department of Health (NMDH) surveyed cigarette outlets in Ciudad Juarez, Mexico; El Paso, Texas; and Las Cruces, New Mexico. This report summarizes the results of these surveys, which indicate that almost all retailers in the surveyed outlets in Ciudad Juarez sold cigarettes to minors and that sales rates to minors were substantially lower in El Paso and Las Cruces.

  10. Seroprevalence of select bloodborne pathogens and associated risk behaviors among injection drug users in the Paso del Norte region of the United States – Mexico border

    PubMed Central

    Baumbach, Joan P; Foster, Lily N; Mueller, Mark; Cruz, Michelle Firestone; Arbona, Sonia; Melville, Sharon; Ramos, Rebeca; Strathdee, Steffanie A

    2008-01-01

    Background The region situated where the borders of Mexico, Texas and New Mexico meet is known as 'Paso del Norte'. The Paso del Norte Collaborative was formed to study the seroprevalence of select pathogens and associated risk behaviors among injection drug users (IDUs) in the region. Methods Respondent-driven sampling (RDS) was used: 459 IDU participants included 204 from Mexico; 155 from Texas; and 100 from New Mexico. Each of the three sites used a standardized questionnaire that was verbally administered and testing was performed for select bloodborne infections. Results Participants were mostly male (87.4%) and Hispanic/Latino (84.7%) whose median age was 38. In Mexico, Texas and New Mexico, respectively: hepatitis B virus (HBV) was seen in 88.3%, 48.6% and 59.6% of participants; hepatitis C virus (HCV) in 98.7%, 76.4% and 80.0%; human immunodeficiency virus (HIV) in 2.1%, 10.0% and 1.0%; and syphilis in 4.0%, 9.9% and 3.0%. Heroin was the drug injected most often. More IDUs in New Mexico were aware of and used needle exchange programs compared with Texas and Mexico. Conclusion There was mixed success using RDS: it was more successfully applied after establishing good working relationships with IDU populations. Study findings included similarities and distinctions between the three sites that will be used to inform prevention interventions. PMID:19014605

  11. Assessment of arsenic and heavy metal concentrations in water and sediments of the Rio Grande at El Paso-Juarez metroplex region.

    PubMed

    Rios-Arana, J V; Walsh, E J; Gardea-Torresdey, J L

    2004-01-01

    The Rio Grande located along the US-Mexico border is affected by anthropogenic activities along its geographical course. Runoff and wind deposition of smelting residues may contribute to the pollution of the Rio Grande in the El Paso-Ciudad Juarez area. Few studies have addressed the presence or impacts of heavy metals or arsenic in this ecosystem. This study reports a survey of heavy metals (Cr, Cu, Cd, Ni, Pb, and Zn) and arsenic (As) in water and sediments of the Rio Grande collected from seven sites in the El Paso-Juarez region. Since water quality influences metal content in water, physical (temperature, flow and conductivity), and chemical (pH, dissolved oxygen, nitrates, alkalinity, and water hardness) parameters were measured at each site. Arsenic and heavy metal levels were determined using Inductively Couple Plasma (ICP) emission spectroscopy following EPA procedures. Zinc and lead were found as both total and dissolved metals in most of the samples, with concentrations of total recoverable metals reaching up to 105 and 70 microg/l, respectively. Most metals were found in sediment samples collected from four of seven sites. The highest Cu concentration (35 mg/l) was found at the American Dam site. Concentrations of metals found through this survey will be used as a reference for future studies in monitoring arsenic, heavy metals, and their impacts in the Rio Grande.

  12. Urban development under extreme hydrologic and weather conditions for El Paso-Juarez: Recommendations resulting from hydrologic modeling, GIS, and remote sensing analyses

    NASA Astrophysics Data System (ADS)

    Barud-Zubillaga, Alberto

    During the 2006 El Paso-Juarez flood there were many concerns regarding the capability of the existing stormwater system to handle 50- and 100-year flood events in El Paso, Texas and Juarez, Mexico area. Moreover in 2008, a considerable wet year from the normal 223 mm of annual precipitation for El Paso demonstrated that the area could very well received large amounts of precipitation at localized areas in short periods of time, representing a great flood threat to residents living in areas prone to flood. Some climate change projections for the area are exactly what had occurred over the last two decades; an increased number of torrential rainstorms over smaller concentrated pieces of land separated by longer years of drought between rainstorms. This study consisted in three projects focused on three critical regions within the El Paso-Juarez area that were greatly affected by the 2006 Flood. The goal was to identify if natural arroyos or the existent built stormwater system, could properly managed the projected precipitation patterns. The three projects described in this dissertation touch on the following points: (a) the importance of a reliable precipitation model that could accurately describes precipitation patterns in the region under extreme drought and wet climates conditions; (b) differences in land use/land cover characteristics as factors promoting or disrupting the possibility for flooding, and (c) limitations and capabilities of existent stormwater systems and natural arroyos as means to control flooding. Conclusions and recommendations are shown below, which apply not only to each particular project, but also to all study areas and similar areas in the El Paso-Juarez region. Urbanization can improve or worsen a pre-existing natural stormwater system if built under its required capacity. Such capacity should be calculated considering extreme weather conditions, based on a denser network of precipitation stations to capture the various microclimates

  13. Antibiotic resistance: a primer and call to action.

    PubMed

    Smith, Rachel A; M'ikanatha, Nkuchia M; Read, Andrew F

    2015-01-01

    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention, 2013; World Health Organization, 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral, and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices.

  14. Primer Part 1-The building blocks of epilepsy genetics.

    PubMed

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. PMID:27226047

  15. Primer Part 1-The building blocks of epilepsy genetics.

    PubMed

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies.

  16. [The pharmacology of humour -- a primer to quantum humourdynamics].

    PubMed

    Györfi, András

    2014-08-10

    A good word put in for someone during a medical consultation can alleviate the stress generated by the contact with the clinic. The superlative of "good word" in these situations could be a humorous phrase of the physician during the consultation, which can cause a cognitive shift in the patient's perception of her/his situation. This change of perspective will diminish the anxiety generated by the disease, can rebuild optimism and establish a good doctor-patient relationship, based on hope and collaboration. This paper analyzes the elements of humour and the neurological mechanisms involved in the emergence of mirth. The dosage of this genuine alternative medication is discussed based on a primer to quantum humor dynamics, observing the similarity between the behaviour of quantum mechanic's elementary particles with the quanta of humour called hilarion. Finally, laughter's psychological and physiological benefits are discussed, obtained through changes in circulation, respiration, muscular tonus and endorphin release.

  17. Magnetic resonance imaging methods in developmental science: a primer.

    PubMed

    Hunt, Ruskin H; Thomas, Kathleen M

    2008-01-01

    Structural and functional magnetic resonance imaging (MRI) are increasingly common research methods among investigators interested in typically and atypically developing populations. However, the effective use of these tools requires an understanding of the basis of the magnetic resonance signal, as well as some of the additional experimental complications that arise when collecting MRI data from developmental populations. This primer provides a foundation for investigators who wish to utilize MRI methods in their research and whose primary interest involves typically and atypically developing populations. The basic concepts of MRI physics are introduced, as well as the typical MRI scanner components and their role in MRI data acquisition. In addition, a variety of scan types (structural, functional, diffusion tensor) are discussed, along with a number of important experimental design factors that can impact the quality and utility of the data collected. Special consideration is given to working with pediatric and special populations.

  18. ParaDiS-FEM dislocation dynamics simulation code primer

    SciTech Connect

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A

    2011-09-27

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  19. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    SciTech Connect

    Hernandez, L.S.; Garcia, G. |; Lopez, C.

    1998-12-31

    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  20. MCNP{sup TM} criticality primer and training experiences

    SciTech Connect

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-09-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k{sub eff}). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k{sub eff} calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP.

  1. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

    PubMed Central

    Marcon, Helena Sanches; Coscrato, Virgínia Elias; Selivon, Denise; Perondini, André Luiz Paranhos; Marino, Celso Luis

    2011-01-01

    Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity. PMID:24031693

  2. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    EPA Science Inventory

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  3. Community Structure Analysis of Methanogens Associated with Rumen Protozoa Reveals Bias in Universal Archaeal Primers

    PubMed Central

    McAllister, Tim A.

    2012-01-01

    The diversity of protozoan-associated methanogens in cattle was investigated using five universal archaeal small-subunit (SSU) rRNA gene primer sets. Methanobrevibacter spp. and rumen cluster C (distantly related to Thermoplasma spp.) were predominant. Significant differences in species composition among libraries indicate that some primers used previously to characterize rumen methanogens exhibit biased amplification. PMID:22447586

  4. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.

    PubMed

    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo

    2010-03-01

    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  5. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  6. Microarrays for high-throughput genotyping of MICA alleles using allele-specific primer extension.

    PubMed

    Baek, I C; Jang, J-P; Choi, H-B; Choi, E-J; Ko, W-Y; Kim, T-G

    2013-10-01

    The role of major histocompatibility complex (MHC) class I chain-related gene A (MICA), a ligand of NKG2D, has been defined in human diseases by its allele associations with various autoimmune diseases, hematopoietic stem cell transplantation (HSCT) and cancer. This study describes a practical system to develop MICA genotyping by allele-specific primer extension (ASPE) on microarrays. From the results of 20 control primers, strict and reliable cut-off values of more than 30,000 mean fluorescence intensity (MFI) as positive and less than 3000 MFI as negative, were applied to select high-quality specific extension primers. Among 55 allele-specific primers, 44 primers could be initially selected as optimal primer. Through adjusting the length, six primers were improved. The other failed five primers were corrected by refractory modification. MICA genotypes by ASPE on microarrays showed the same results as those by nucleotide sequencing. On the basis of these results, ASPE on microarrays may provide high-throughput genotyping for MICA alleles for population studies, disease-gene associations and HSCT.

  7. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    ERIC Educational Resources Information Center

    Pine, Daniel S.

    2006-01-01

    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  8. A new PCR method: one primer amplification of PCR-CTPP products.

    PubMed

    Yin, Guang; Mitsuda, Yoko; Ezaki, Takayuki; Hamajima, Nobuyuki

    2012-10-01

    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) is a convenient method for genotyping single nucleotide polymorphisms, saving time, and costs. It uses four primers for PCR; F1 and R1 for one allele, and F2 and R2 for the other allele, by which three different sizes of DNA are amplified; between F1 and R1, between F2 and R2, and between F1 and R2. To date, we have applied PCR-CTPP successfully for genotyping more than 60 polymorphisms. However, it is not rare that PCR does not produce balanced amplification of allele specific bands. Accordingly, the method was modified by attaching a common sequence at the 5' end of two-pair primers and adding another primer with the common sequence in PCR, in total five different primers in a tube for PCR. The modification allowed one primer amplification for the products of initial PCR with confronting two-pair primers, named as one primer amplification of PCR-CTPP products (OPA-CTPP). This article demonstrates an example for an A/G polymorphism of paraoxonase 1 (PON1) Gln192Arg (rs662). PCR-CTPP failed clear genotyping for the polymorphism, while OPA-CTPP successfully produced PCR products corresponding to the allele. The present example indicated that the OPA-CTPP would be useful in the case that PCR-CTPP failed to produce balanced PCR products specific to each allele.

  9. GSP: A web-based platform for designing genome-specific primers in polyploids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  10. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Rhim, Lauren Morando; Kowal, Julie

    2008-01-01

    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  11. MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity.

    PubMed

    Qu, Wubin; Zhou, Yang; Zhang, Yanchun; Lu, Yiming; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2012-07-01

    Evaluating the specificity of polymerase chain reaction (PCR) primers is an essential step in PCR primer design. The MFEprimer-2.0 server allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. MFEprimer-2.0 uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported on the results page. Based on these characteristics and the user-friendly output, users can readily draw conclusions about the specificity of PCR primers. Analyses for degenerate primers and multiple PCR primers are also supported in MFEprimer-2.0. In addition, the databases supported by MFEprimer-2.0 are comprehensive, and custom databases can also be supported on request. The MFEprimer-2.0 server does not require a login and is freely available at http://biocompute.bmi.ac.cn/CZlab/MFEprimer-2.0. More over, the MFEprimer-2.0 command-line version and local server version are open source and can be downloaded at https://github.com/quwubin/MFEprimer/wiki/Manual/.

  12. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    PubMed

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information.

  13. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    PubMed Central

    Gaby, John Christian; Buckley, Daniel H.

    2012-01-01

    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitrogen fixers, but that there are also 23 nifH primers that target less than 50% of nifH sequences. The nifH primers we evaluated vary in their phylogenetic bias and their ability to recover sequences from commonly sampled environments. In addition, many of these primers will amplify genes that do not mediate nitrogen fixation, and thus it would be advisable for researchers to screen their sequencing results for the presence of non-target genes before analysis. Universal primers that performed well in silico were tested empirically with soil samples and with genomic DNA from a phylogenetically diverse set of nitrogen-fixing strains. This analysis will be of great utility to those engaged in molecular analysis of nifH genes from isolates and environmental samples. PMID:22848735

  14. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    PubMed

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  15. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  16. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    SciTech Connect

    Busch, R.D.

    2003-01-17

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  17. A Transparent Window into Biology: A Primer on Caenorhabditis elegans.

    PubMed

    Corsi, Ann K; Wightman, Bruce; Chalfie, Martin

    2015-06-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host-parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues.

  18. Review of Attachment, play, and authenticity: A Winnicott primer.

    PubMed

    Penn, Linda S

    2009-12-01

    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  19. The corrosion mechanisms for primer coated 2219-T87 aluminum

    NASA Technical Reports Server (NTRS)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  20. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    PubMed Central

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin

    2015-01-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  1. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Technical Reports Server (NTRS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, B.

    2012-01-01

    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high quality data for many areas of investigation. Unconditioned simple aperture time-series photometry are however affected by systematic structure. Examples of these systematics are differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler's primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 10(exp 5) stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have occurred to remove or reduce systematic artifacts. This paper provides a conceptual primer for users of the Kepler data archive to understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  2. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Astrophysics Data System (ADS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, Steve B.

    2012-09-01

    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high-quality data for many areas of investigation. Unconditioned simple aperture time-series photometry is, however, affected by systematic structure. Examples of these systematics include differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler's primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 105 stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have helped to remove or reduce systematic artifacts. This paper provides a conceptual primer to help users of the Kepler data archive understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  3. Quantification of splice variants using molecular beacon or scorpion primers.

    PubMed

    Taveau, Mathieu; Stockholm, Daniel; Spencer, Melissa; Richard, Isabelle

    2002-06-15

    Uncovering the relationship between the generation of alternative transcripts and cellular processes is of crucial importance in the exploration of a gene's biology. The description and quantification of the spatiotemporal splicing pattern can be one method to select the most interesting transcripts for future studies. Fluorescence-based real-time quantitative RT-PCR has recently revolutionized the possibilities for transcriptional quantification studies. In this report, Molecular Beacon and Scorpion probes have been tested as new possibilities for determining the expression level of alternative transcripts. We validated these systems by analyzing alternative splicing of exons 6, 15, and 16 of the calpain 3 gene with tissues containing large variation in the ratio of the different transcripts. We determined conditions that demonstrated that boundary probes are useful tools and good alternatives to boundary primers, when developing a system to quantify specific transcripts. We suggest that the choice of a quantification system should depend in part on the structure and base composition of the gene and may have to be determined experimentally.

  4. Digital model for simulated effects of ground-water pumping in the Hueco Bolson, El Paso Area, Texas, New Mexico, and Mexico

    USGS Publications Warehouse

    Meyer, W.R.

    1976-01-01

    The model study showed that a proposed plan of development for 1973-91, in which pumping would be increased by 29 percent in the Texas part of the bolson and by 34 percent in Ciudad Juarez, would cause additional waterlevel declines of as much as 45 feet (13.7 m) in the vicinity of El Paso and 70 feet (21.3 m) in Ciudad Juarez. The study also showed that nearly 60 percent of the water would come from storage in the water-table part of the bolson aquifer (model layer 2) and 28 percent from leakage from the alluvium (model layer 1). By the end of the period, 9.84 million acrefeet (12,133 hm3) of fresh water would be in storage in the Texas part of the bolson, as compared to 10.6 million acre-feet (13,070 hm3) in storage in 1973.

  5. Selected hydrologic data for the Mesilla ground-water basin, 1987 through 1992 water years, Dona Ana County, New Mexico, and El Paso County, Texas

    USGS Publications Warehouse

    Nickerson, Edward L.

    1995-01-01

    The Mesilla ground-water basin monitoring program was established in 1987 to document hydrologic conditions and establish a long-term, continuous data base to permit future quantitative evaluation of the ground-water flow system and stream/aquifer relations. Data collection is divided into three program elements. These are the (1) Mesilla ground- water basin observation-well program; (2) Mesilla Valley hydrologic sections; and (3) Rio Grande seepage investigations. This report is a compilation of hydrologic data collected for the Mesilla ground- water basin monitoring program during the 1987 through 1992 water years. Hydrologic data presented in the report include well records and water levels for 181 wells; mean daily river stage and ground- water levels at 37 sites; seepage investigations of the Rio Grande from Radium Springs, New Mexico, to El Paso, Texas; and chemical analyses of 29 water samples collected from the Rio Grande.

  6. Application of a stream-aquifer model to Monument Creek for development of a method to estimate transit losses for reusable water, El Paso County, Colorado

    USGS Publications Warehouse

    Kuhn, Gerhard; Arnold, L. Rick

    2006-01-01

    The U.S. Geological Survey, in cooperation with Colorado Springs Utilities, the Colorado Water Conservation Board, and the El Paso County Water Authority, began a study in 2004 to (1) apply a stream-aquifer model to Monument Creek, (2) use the results of the modeling to develop a transit-loss accounting program for Monument Creek, (3) revise the existing transit-loss accounting program for Fountain Creek to incorporate new water-management strategies and allow for incorporation of future changes in water-management strategies, and (4) integrate the two accounting programs into a single program with a Web-based user interface. The purpose of this report is to present the results of applying a stream-aquifer model to the Monument Creek study reach. More...

  7. Summary of water-quality data, October 1987 through September 1997, for Fountain and Monument Creeks, El Paso and Pueblo Counties, Colorado

    USGS Publications Warehouse

    Bossong, Clifford R.

    2001-01-01

    Fountain and Monument Creeks, which drain parts of El Paso and Pueblo Counties in Colorado, have been sampled systematically by the U.S. Geological Survey for many years to obtain records of water-quality properties and constituents; the data are stored in the National Water Inventory System. Statistical summaries of these data indicate that they have spatial and temporal trends. Comparison of water-quality data to in-stream regulatory standards, some of which were calculated in this report, indicate that some exceedances are widespread in the system and that some occur locally. Nonparametric tests to quantitatively detect monotonic trends in water-quality data indicate that many water-quality properties and constituents do not have significant monotonic trends; detected trends were mostly downward.

  8. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.; Mowrey, C.; Reis, E.

    1985-01-01

    Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

  9. Guidelines for the tetra-primer ARMS-PCR technique development.

    PubMed

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  10. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens.

    PubMed

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-10-01

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  11. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE PAGES

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; Peña, José; Hysom, David A.; Borucki, Monica K.

    2014-01-01

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus.more » Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  12. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    PubMed Central

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-01-01

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  13. Insight into the Human DNA Primase Interaction with Template-Primer.

    PubMed

    Baranovskiy, Andrey G; Zhang, Yinbo; Suwa, Yoshiaki; Gu, Jianyou; Babayeva, Nigar D; Pavlov, Youri I; Tahirov, Tahir H

    2016-02-26

    DNA replication in almost all organisms depends on the activity of DNA primase, a DNA-dependent RNA polymerase that synthesizes short RNA primers of defined size for DNA polymerases. Eukaryotic and archaeal primases are heterodimers consisting of small catalytic and large accessory subunits, both of which are necessary for the activity. The mode of interaction of primase subunits with substrates during the various steps of primer synthesis that results in the counting of primer length is not clear. Here we show that the C-terminal domain of the large subunit (p58C) plays a major role in template-primer binding and also defines the elements of the DNA template and the RNA primer that interact with p58C. The specific mode of interaction with a template-primer involving the terminal 5'-triphosphate of RNA and the 3'-overhang of DNA results in a stable complex between p58C and the DNA/RNA duplex. Our results explain how p58C participates in RNA synthesis and primer length counting and also indicate that the binding site for initiating NTP is located on p58C. These findings provide notable insight into the mechanism of primase function and are applicable for DNA primases from other species.

  14. Comprehensive Primer Design for Analysis of Population Genetics in Non-Sequenced Organisms

    PubMed Central

    Tezuka, Ayumi; Matsushima, Noe; Nemoto, Yoriko; Akashi, Hiroshi D.; Kawata, Masakado; Makino, Takashi

    2012-01-01

    Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris), anole lizard (Anolis sagrei), guppy (Poecilia reticulata), and fruit fly (Drosophila melanogaster), for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation. PMID:22393396

  15. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies

    PubMed Central

    O’Donnell, James L.; Kelly, Ryan P.; Lowell, Natalie C.; Port, Jesse A.

    2016-01-01

    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary. PMID:26950069

  16. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups. PMID:18631176

  17. Shop primer as part of the corrosion protective coating for submerged steel structures

    SciTech Connect

    Bjordal, M.; Steinsmo, U.

    1998-12-31

    In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough if the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.

  18. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    PubMed

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  19. Optimization of primer design for the detection of variable genomic lesions in cancer.

    PubMed

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  20. Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    PubMed Central

    Coloma, Javier; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.

    2016-01-01

    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually engages with a DNA:DNA helix during primer synthesis. We present here the first crystal structure of human Polα polymerase subunit in complex with a DNA:DNA helix. Unexpectedly, we find that portion of the DNA:DNA helix in contact with the polymerase is not in a B-form but in a hybrid A-B form. Almost all of the contacts observed previously with an RNA primer are preserved with a DNA primer – with the same set of polymerase residues tracking the sugar-phosphate backbone of the DNA or RNA primer. Thus, rather than loss of specific contacts, the free energy cost of distorting DNA from B- to hybrid A-B form may augur the termination of primer synthesis in eukaryotes. PMID:27032819

  1. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens.

    PubMed

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-09-30

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  2. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    PubMed Central

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; Peña, José; Hysom, David A.; Borucki, Monica K.

    2014-01-01

    Background. Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results. A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions. This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family. PMID:25157264

  3. Biased Diversity Metrics Revealed by Bacterial 16S Pyrotags Derived from Different Primer Sets

    PubMed Central

    Cai, Lin; Ye, Lin; Tong, Amy Hin Yan; Lok, Si; Zhang, Tong

    2013-01-01

    In recent years, PCR-based pyrosequencing of 16S rRNA genes has continuously increased our understanding of complex microbial communities in various environments of the Earth. However, there is always concern on the potential biases of diversity determination using different 16S rRNA gene primer sets and covered regions. Here, we first report how bacterial 16S rRNA gene pyrotags derived from a series of different primer sets resulted in the biased diversity metrics. In total, 14 types of pyrotags were obtained from two-end pyrosequencing of 7 amplicon pools generated by 7 primer sets paired by 1 of 4 forward primers (V1F, V3F, V5F, and V7F) and 1 of 4 reverse primers (V2R, V4R, V6R, and V9R), respectively. The results revealed that: i) the activated sludge exhibited a large bacterial diversity that represented a broad range of bacterial populations and served as a good sample in this methodology research; ii) diversity metrics highly depended on the selected primer sets and covered regions; iii) paired pyrotags obtained from two-end pyrosequencing of each short amplicon displayed different diversity metrics; iv) relative abundance analysis indicated the sequencing depth affected the determination of rare bacteria but not abundant bacteria; v) the primer set of V1F and V2R significantly underestimated the diversity of activated sludge; and vi) the primer set of V3F and V4R was highly recommended for future studies due to its advantages over other primer sets. All of these findings highlight the significance of this methodology research and offer a valuable reference for peer researchers working on microbial diversity determination. PMID:23341963

  4. An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.

    1997-01-01

    To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

  5. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  6. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  7. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method. PMID:25429503

  8. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    SciTech Connect

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  9. Universal primers for amplification of the complete mitochondrial control region in marine fish species.

    PubMed

    Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

    2012-01-01

    Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

  10. Binary electrokinetic separation of target DNA from background DNA primers.

    SciTech Connect

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  11. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    NASA Astrophysics Data System (ADS)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  12. A primer on trace metal-sediment chemistry

    USGS Publications Warehouse

    Horowitz, Arthur J.

    1985-01-01

    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  13. Abridged adapter primers increase the target scope of Hi-Plex.

    PubMed

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J

    2015-01-01

    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  14. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  15. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  16. A Telecommunications Primer for College Presidents. Part I. The Technologies Defined. Educational Technology Profile 25.

    ERIC Educational Resources Information Center

    Smith, Ralph Lee

    1978-01-01

    Intended for use by presidents, planners, and administrators to acquaint them with developments in electronic communications, this primer describes cable television, common carrier, videotape recorders and videodiscs, satellites, microwave, circuit integration, digital transmission, data packet switching, and fiber optics. (LBH)

  17. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  18. Rapid DNA extraction methods and new primers for randomly amplified polymorphic DNA analysis of Giardia duodenalis.

    PubMed

    Deng, M Q; Cliver, D O

    1999-08-01

    A randomly amplified polymorphic DNA (RAPD) procedure using simple genomic DNA preparation methods and newly designed primers was optimized for analyzing Giardia duodenalis strains. Genomic DNA was extracted from in vitro cultivated trophozoites by five freezing-thawing cycles or by sonic treatment. Compared to a conventional method involving proteinase K digestion and phenol extraction, both freezing-thawing and sonication were equally efficient, yet with the advantage of being much less time- and labor-intensive. Five of the 10 tested RAPD primers produced reproducible polymorphisms among five human origin G. duodenalis strains, and grouping of these strains based on RAPD profiles was in agreement among these primers. The consistent classification of two standard laboratory reference strains, Portland-1 and WB, in the same group confirmed previous results using other fingerprinting methods, indicating that the reported simple DNA extraction methods and the selected primers are useful in RAPD for molecular characterization of G. duodenalis strains.

  19. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  20. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  1. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž

    2014-01-01

    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  2. Geohydrologic site characterization of the municipal solid waste landfill facility, US Army Air Defense Artillery Center and Fort Bliss, El Paso County, Texas

    USGS Publications Warehouse

    Abeyta, Cynthia G.

    1996-01-01

    Geohydrologic conditions of the Municipal Solid Waste Landfill Facility (MSWLF) on the U.S. Army Air Defense Artillery Center and Fort Bliss, El Paso County, Texas, were evaluated by the U.S. Geological Survey in cooperation with the U.S. Army. The 106.03-acre MSWLF has been in operation since January 1974. The landfill contains household refuse, Post solid wastes, bulky items, grass and tree trimmings from family housing, refuse from litter cans, construction debris, classified waste (dry), dead animals, asbestos, and empty oil cans. The MSWLF, located about 1,200 feet east of the nearest occupied structure, is estimated to receive an average of approximately 56 tons of municipal solid waste per day and, at a fill rate of 1-4 acres per year, is expected to reach its capacity by the year 2004. The MSWLF is located in the Hueco Bolson, 4 miles east of the Franklin Mountains. Elevations at the MSWLF range from 3,907 to 3,937 feet above sea level. The climate at the MSWLF and vicinity is arid continental, characterized by an abundance of sunny days, high summer temperatures, relatively cool winters typical of arid areas, scanty rainfall, and very low humidity throughout the year. Average annual temperature near the MSWLF and vicinity is 63.3 degrees Fahrenheit and annual precipitation is 7.8 inches. Potential evaporation in the El Paso area was estimated to be 65 inches per year. Soils at and adjacent to the MSWLF are nearly level to gently sloping, have a fine sandy loam subsoil, and are moderately deep over caliche. The MSWLF is underlain by Hueco Bolson deposits of Tertiary age and typically are composed of unconsolidated to slightly consolidated interbedded sands, clay, silt, gravel, and caliche. Individual beds are not well defined and range in thickness from a fraction of an inch to about 100 feet. The primary source of ground water in the MSWLF area is in the deposits of the Hueco Bolson. A relatively thick vadose zone of approximately 300 feet overlies the

  3. Challenges with using primer IDs to improve accuracy of next generation sequencing.

    PubMed

    Brodin, Johanna; Hedskog, Charlotte; Heddini, Alexander; Benard, Emmanuel; Neher, Richard A; Mild, Mattias; Albert, Jan

    2015-01-01

    Next generation sequencing technologies, like ultra-deep pyrosequencing (UDPS), allows detailed investigation of complex populations, like RNA viruses, but its utility is limited by errors introduced during sample preparation and sequencing. By tagging each individual cDNA molecule with barcodes, referred to as Primer IDs, before PCR and sequencing these errors could theoretically be removed. Here we evaluated the Primer ID methodology on 257,846 UDPS reads generated from a HIV-1 SG3Δenv plasmid clone and plasma samples from three HIV-infected patients. The Primer ID consisted of 11 randomized nucleotides, 4,194,304 combinations, in the primer for cDNA synthesis that introduced a unique sequence tag into each cDNA molecule. Consensus template sequences were constructed for reads with Primer IDs that were observed three or more times. Despite high numbers of input template molecules, the number of consensus template sequences was low. With 10,000 input molecules for the clone as few as 97 consensus template sequences were obtained due to highly skewed frequency of resampling. Furthermore, the number of sequenced templates was overestimated due to PCR errors in the Primer IDs. Finally, some consensus template sequences were erroneous due to hotspots for UDPS errors. The Primer ID methodology has the potential to provide highly accurate deep sequencing. However, it is important to be aware that there are remaining challenges with the methodology. In particular it is important to find ways to obtain a more even frequency of resampling of template molecules as well as to identify and remove artefactual consensus template sequences that have been generated by PCR errors in the Primer IDs.

  4. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    PubMed Central

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam

    2015-01-01

    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconia with sandblasting, etching, and porcelain primer (GP); and glazed zirconia with sandblasting, etching, zirconia primer, and porcelain primer (GZP). A stainless steel metal bracket was bonded to each target surface with resin cement, and all specimens underwent thermal cycling. The shear bond strength of the specimens was measured by a universal testing machine. A scanning electron microscope, three-dimensional optical surface-profiler, and stereoscopic microscope were used to image the zirconia surfaces. The data were analyzed with one-way analyses of variance and the Fisher exact test. Results Group GZ showed significantly lower shear bond strength than did the other groups. No statistically significant differences were found among groups NZ, GP, and GZP. All specimens in group GZ showed adhesive failure between the zirconia and resin cement. In groups NZ and GP, bonding failed at the interface between the resin cement and bracket base or showed complex adhesive and cohesive failure. Conclusions Porcelain primer is the more appropriate choice for bonding a metal bracket to the surface of a full-contour glazed zirconia crown with resin cement. PMID:26629476

  5. Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation

    NASA Technical Reports Server (NTRS)

    Hockridge, R. R.; Thibault, H. G.

    1972-01-01

    The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.

  6. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners

    PubMed Central

    Feemster, Agnes Ann

    2015-01-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail’s ability to meet language standards, enhance the writer’s image, and successfully transmit information. PMID:26715801

  7. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    PubMed

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  8. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    PubMed Central

    Lee, Ji-Yeon; Kim, Jin-Seok

    2015-01-01

    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm2. The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). Results The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Conclusions Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses. PMID:26258062

  9. A Primer on Population Health Management and Its Perioperative Application.

    PubMed

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  10. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  11. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    PubMed

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  12. UniPrime2: a web service providing easier Universal Primer design

    PubMed Central

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C.

    2009-01-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence. PMID:19401435

  13. Morphological categorization of acid-base resistant zones with self-etching primer adhesive systems.

    PubMed

    Inoue, Go; Nikaido, Toru; Sadr, Alireza; Tagami, Junji

    2012-01-01

    This study investigated the influence of the composition of self-etching primer adhesive systems on the morphology of acid-base resistant zones (ABRZs). One-step self-etching primer systems (Clearfil Tri-S Bond, G-Bond, and One-Up Bond F Plus) and two-step self-etching primer systems (Clearfil SE Bond, Clearfil Protect Bond, UniFil Bond, and Mac Bond II) were used in this study. Each adhesive was applied on prepared dentin disk surfaces, and a resin composite was placed between two dentin disks. All resin-bonded specimens were subjected to acid-base challenge. Observation under a scanning electron microscope (SEM) revealed the creation of an ABRZ adjacent to the hybrid layer for all the self-etch primer adhesive systems, even when non-fluoride releasing adhesives were used. The presence of fluoride in two-step self-etching adhesive significantly increased the thickness of ABRZ created. Results suggested that an ABRZ was created with the use of self-etching primer adhesive systems, but its morphology differed between one-and two-step self-etching primer adhesive systems and was influenced by fluoride release activity.

  14. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  15. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    PubMed Central

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra

    2015-01-01

    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (P<.05). However, in Ti alloy, there was no significant difference between Alloy Primer and MAC-Bond II. Tarnished Co-Cr and Au-Ag-Pd alloy surfaces presented significantly decreased shear bond strength. CONCLUSION Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  16. Hydrogeology and ground-water quality of the Chromic Acid Pit site, US Army Air Defense Artillery Center and Fort Bliss, El Paso, Texas

    USGS Publications Warehouse

    Abeyta, Cynthia G.; Thomas, C.L.

    1996-01-01

    The Chromic Acid Pit site is an inactive waste disposal site that is regulated by the Resource Conservation and Recovery Act of 1976. The 2.2-cubic-yard cement-lined pit was operated from 1980 to 1983 by a contractor to the U.S. Army Air Defense Artillery Center and Fort Bliss. The pit, located on the Fort Bliss military reservation, in El Paso, Texas, was used for disposal and evaporation of chromic acid waste generated from chrome plating operations. The site was certified closed in 1989 and the Texas Natural Resources Conservation Commission issued Permit Number HW-50296 (U.S. Environmental Protection Agency Permit Number TX4213720101), which approved and implemented post-closure care for the Chromic Acid Pit site. In accordance with an approved post-closure plan, the U.S. Geological Survey is cooperating with the U.S. Army in evaluating hydrogeologic conditions and ground- water quality at the site. One upgradient and two downgradient ground-water monitoring wells were installed adjacent to the chromic acid pit by a private contractor. Quarterly ground-water sampling of these wells by the U.S. Geological Survey began in December 1993. The Chromic Acid Pit site is situated in the Hueco Bolson intermontane valley. The Hueco Bolson is a primary source of ground water in the El Paso area. City of El Paso and U.S. Army water-supply wells are located on all sides of the study area and are completed 600 to more than 1,200 feet below land surface. The ground-water level in the area of the Chromic Acid Pit site has declined about 25 feet from 1982 to 1993. Depth to water at the Chromic Acid Pit site in September 1994 was about 284 feet below land surface; ground-water flow is to the southeast. Ground-water samples collected from monitoring wells at the Chromic Acid Pit site contained dissolved-solids concentrations of 442 to 564 milligrams per liter. Nitrate as nitrogen concentrations ranged from 2.1 to 2.7 milligrams per liter; nitrite plus nitrate as nitrogen

  17. Hydrogeology and simulation of flow between the alluvial and bedrock aquifers in the upper Black Squirrel Creek basin, El Paso County, Colorado

    USGS Publications Warehouse

    Watts, K.R.

    1995-01-01

    Anticipated increases in pumping from the bedrock aquifers in El Paso County potentially could affect the direction and rate of flow between the alluvial and bedrock aquifers and lower water levels in the overlying alluvial aquifer. The alluvial aquifer underlies about 90 square miles in the upper Black Squirrel Creek Basin of eastern El Paso County. The alluvial aquifer consists of unconsolidated alluvial deposits that unconformably overlie siltstones, sandstones, and conglomerate (bedrock aquifers) and claystone, shale, and coal (bedrock confining units) of the Denver Basin. The bedrock aquifers (Dawson, Denver, Arapahoe, and Laramie-Fox Hills aquifers) are separated by confining units (upper and lower Denver and the Laramie confining units) and overlie a relatively thick and impermeable Pierre confining unit. The Pierre confining unit is assumed to be a no-flow boundary at the base of the alluvial/ bedrock aquifer system. During 1949-90, substantial water-level declines, as large as 50 feet, in the alluvial aquifer resulted from withdrawals from the alluvial aquifer for irrigation and municipal supplies. Average recharge to the alluvial aquifer from infiltration of precipitation and surface water was an estimated 11.97 cubic feet per second and from the underlying bedrock aquifers was an estimated 0.87 cubic foot per second. Water-level data from eight bedrock observation wells and eight nearby alluvial wells indicate that, locally, the alluvial and bedrock aquifers probably are hydraulically connected and that the alluvial aquifer in the upper Black Squirrel Creek Basin receives recharge from the Denver and Arapahoe aquifers but-locally recharges the Laramie-Fox Hills aquifer. Subsurface-temperature profiles were evaluated as a means of estimating specific discharge across the bedrock surface (the base of the alluvial aquifer). However, assumptions of the analytical method were not met by field conditions and, thus, analyses of subsurface-temperature profiles

  18. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    PubMed Central

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  19. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified Arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6.

    PubMed

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  20. Spatial and Temporal Variations in Streamflow and Dissolved Solids in the Rio Grande from Del Norte, Colorado, to El Paso, Texas, 1993-95

    NASA Astrophysics Data System (ADS)

    Moore, S. J.; Anderholm, S. K.

    2002-12-01

    Data collected as part of the Rio Grande Valley National Water Quality Assessment Program were used to evaluate spatial and temporal variations in streamflow and the concentration of dissolved solids at selected sites on the Rio Grande from Del Norte, Colorado, to El Paso, Texas, for the period of April 1993 to September 1995. Dissolved solids loads, which were estimated by a multivariate linear regression model (ESTIMATOR2000), are also presented and discussed. Spatial and temporal variations in streamflow, dissolved solids concentrations, and dissolved solids loads were used to evaluate how surface-water and ground-water inflows to and outflows from the Rio Grande affect dissolved solids along the river. Streamflow decreases from Del Norte, Colorado, to the mouth of the Conejos River because of diversions for irrigation. Streamflow increases from the mouth of the Conejos River to Otowi Bridge because of surface-water inflows (from the Conejos River, the Chama River, and other tributaries) and ground-water inflow in northern New Mexico. Streamflow decreases downstream from Otowi Bridge because outflows (due to agricultural use, leakage to ground water, and evapo-transpiration) are greater than inflows. Dissolved solids concentrations generally increase in the downstream direction; however, dissolved solids concentrations decrease between the mouth of the Conejos River and Otowi Bridge due to surface-water inflows from the Conejos and the Chama Rivers and ground-water inflows in northern New Mexico. In several reaches of the Rio Grande, decreasing streamflow and increasing dissolved solids loads indicate the presence of inflows with large dissolved solids concentrations (relative to those of the Rio Grande immediately upstream from that inflow); this occurs (1) between Del Norte, Colorado, and the mouth of Trinchera Creek, near Lasauses, Colorado (2) between Otowi Bridge and San Marcial, New Mexico, and (3) between Leasburg, New Mexico, and El Paso, Texas

  1. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    PubMed

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P < 0.05); no difference was observed between the composites (P > 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength. PMID:22414522

  2. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    PubMed

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P < 0.05); no difference was observed between the composites (P > 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength.

  3. Model input and output files for the simulation of time of arrival of landfill leachate at the water table, Municipal Solid Waste Landfill Facility, U.S. Army Air Defense Artillery Center and Fort Bliss, El Paso County, Texas

    USGS Publications Warehouse

    Abeyta, Cynthia G.; Frenzel, Peter F.

    1999-01-01

    This report contains listings of model input and output files for the simulation of the time of arrival of landfill leachate at the water table from the Municipal Solid Waste Landfill Facility (MSWLF), about 10 miles northeast of downtown El Paso, Texas. This simulation was done by the U.S. Geological Survey in cooperation with the U.S. Department of the Army, U.S. Army Air Defense Artillery Center and Fort Bliss, El Paso, Texas. The U.S. Environmental Protection Agency-developed Hydrologic Evaluation of Landfill Performance (HELP) and Multimedia Exposure Assessment (MULTIMED) computer models were used to simulate the production of leachate by a landfill and transport of landfill leachate to the water table. Model input data files used with and output files generated by the HELP and MULTIMED models are provided in ASCII format on a 3.5-inch 1.44-megabyte IBM-PC compatible floppy disk.

  4. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  5. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    PubMed Central

    Penton, C. Ryan; Johnson, Timothy A.; Quensen, John F.; Iwai, Shoko; Cole, James R.; Tiedje, James M.

    2013-01-01

    Targeting sequencing to genes involved in key environmental processes, i.e., ecofunctional genes, provides an opportunity to sample nature's gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised) method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature's related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification. PMID:24062736

  6. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments.

  7. Circulating primers enhance platelet function and induce resistance to antiplatelet therapy

    PubMed Central

    Blair, T A; Moore, S F; Hers, I

    2015-01-01

    Background Aspirin and P2Y12 antagonists are antiplatelet compounds that are used clinically in patients with thrombosis. However, some patients are ‘resistant’ to antiplatelet therapy, which increases their risk of developing acute coronary syndromes. These patients often present with an underlying condition that is associated with altered levels of circulating platelet primers and platelet hyperactivity. Platelet primers cannot stimulate platelet activation, but, in combination with physiologic stimuli, significantly enhance platelet function. Objectives To explore the role of platelet primers in resistance to antiplatelet therapy, and to evaluate whether phosphoinositide 3-kinase (PI3K) contributes to this process. Methods and Results We used platelet aggregation, thromboxane A2 production and ex vivo thrombus formation as functional readouts of platelet activity. Platelets were treated with the potent P2Y12 inhibitor AR-C66096, aspirin, or a combination of both, in the presence or absence of the platelet primers insulin-like growth factor-1 (IGF-1) and thrombopoietin (TPO), or the Gz-coupled receptor ligand epinephrine. We found that platelet primers largely overcame the inhibitory effects of antiplatelet compounds on platelet functional responses. IGF-1-mediated and TPO-mediated, but not epinephrine-mediated, enhancements in the presence of antiplatelet drugs were blocked by the PI3K inhibitors wortmannin and LY294002. Conclusions These results demonstrate that platelet primers can contribute to antiplatelet resistance. Furthermore, our data demonstrate that there are PI3K-dependent and PI3K-independent mechanisms driving primer-mediated resistance to antiplatelet therapy. PMID:26039631

  8. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    PubMed Central

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  9. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics. PMID:25229098

  10. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  11. A profile of US-Mexico border mobility among a stratified random sample of Hispanics living in the El Paso-Juarez area.

    PubMed

    Lapeyrouse, L M; Morera, O; Heyman, J M C; Amaya, M A; Pingitore, N E; Balcazar, H

    2012-04-01

    Examination of border-specific characteristics such as trans-border mobility and transborder health service illuminates the heterogeneity of border Hispanics and may provide greater insight toward understanding differential health behaviors and status among these populations. In this study, we create a descriptive profile of the concept of trans-border mobility by exploring the relationship between mobility status and a series of demographic, economic and socio-cultural characteristics among mobile and non-mobile Hispanics living in the El Paso-Juarez border region. Using a two-stage stratified random sampling design, bilingual interviewers collected survey data from border residents (n = 1,002). Findings show that significant economic, cultural, and behavioral differences exist between mobile and non-mobile respondents. While non-mobile respondents were found to have higher social economic status than their mobile counterparts, mobility across the border was found to offer less acculturated and poorer Hispanics access to alternative sources of health care and other services.

  12. Estimated probabilities and volumes of postwildfire debris flows—A prewildfire evaluation for the Pikes Peak area, El Paso and Teller Counties, Colorado

    USGS Publications Warehouse

    Elliott, John G.; Ruddy, Barbara C.; Verdin, Kristine L.; Schaffrath, Keelin R.

    2012-01-01

    Debris flows are fast-moving, high-density slurries of water, sediment, and debris that can have enormous destructive power. Although debris flows, triggered by intense rainfall or rapid snowmelt on steep hillsides covered with erodible material, are a common geomorphic process in some unburned areas, a wildfire can transform conditions in a watershed with no recent history of debris flows into conditions that pose a substantial hazard to residents, communities, infrastructure, aquatic habitats, and water supply. The location, extent, and severity of wildfire and the subsequent rainfall intensity and duration cannot be known in advance; however, hypothetical scenarios based on empirical debris-flow models are useful planning tools for conceptualizing potential postwildfire debris flows. A prewildfire study to determine the potential for postwildfire debris flows in the Pikes Peak area in El Paso and Teller Counties, Colorado, was initiated in 2010 by the U.S. Geological Survey, in cooperation with the City of Colorado Springs, Colorado Springs Utilities. The study was conducted to provide a relative measure of which subwatersheds might constitute the most serious potential debris-flow hazards in the event of a large-scale wildfire and subsequent rainfall.

  13. Seepage investigations of the Rio Grande from below Leasburg Dam, Leasburg, New Mexico, to above American Dam, El Paso, Texas, 2006-13

    USGS Publications Warehouse

    Crilley, D.M.; Matherne, A.M.; Thomas, Nicole; Falk, S.E.

    2013-01-01

    Seepage investigations were conducted annually by the U.S. Geological Survey from 1988 to 1998 and from 2004 to 2013 along a 64-mile reach of the Rio Grande from below Leasburg Dam, Leasburg, New Mexico, to above American Dam, El Paso, Texas, as part of the Mesilla Basin monitoring program. Results of studies conducted from 2006 to 2013 are presented in this report. Seepage investigations were conducted over a period of 1–2 days in February of each year, during low-flow conditions in the non-irrigation season. During the seepage investigations, discharge was measured at as many as 24 sites along the Rio Grande and as many as 20 inflow sites within the study reach. Net seepage gain or loss was computed for each subreach by subtracting the discharge measured at the upstream location from the discharge measured at the closest downstream location along the river and then subtracting any inflow to the river within the subreach. An estimated gain or loss was determined to be significant when it exceeded the cumulative measurement uncertainty associated with the net seepage computation. Study reaches during 2006 to 2013 ranged from 20.2 to 64 miles in length, and seepage losses ranged from 8.2 ± 3.1 to 47.9 ± 8.2 cubic feet per second.

  14. Aquifer tests in the flood-plain alluvium and Santa Fe group at the Rio Grande near Canutillo, El Paso County, Texas

    USGS Publications Warehouse

    Nickerson, Edward L.

    1989-01-01

    An aquifer system consisting of the Rio Grande flood-plain alluvium and Santa Fe Group underlying the southern Mesilla Valley in Dona Ana County, New Mexico and El Paso County, Texas has become an important source of water for both municipal and agricultural uses. Determination of aquifer properties is essential in order to evaluate groundwater potential for increasing water demand and potential streamflow depletion of the Rio Grande due to groundwater development. The aquifer system at the Canutillo well field hydrologic section was divided into a shallow, intermediate, and deep zone based on geohydrologic characteristics. Aquifer properties of specific zones at the test site were determined from a series of multiple-well aquifer tests conducted from December 3, 1985 through January 20, 1986. The Rio Grande is hydraulically connected to the shallow flood-plain alluvium. Water generally occurs within the shallow zone under unconfined conditions, within the intermediate zone under semiconfined conditions, and within the deep zone under confined conditions. (USGS)

  15. Evaluating Primers for Profiling Anaerobic Ammonia Oxidizing Bacteria within Freshwater Environments

    PubMed Central

    Sonthiphand, Puntipar; Neufeld, Josh D.

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  16. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    PubMed

    Sonthiphand, Puntipar; Neufeld, Josh D

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  17. Ceramic primer heat-treatment effect on resin cement/Y-TZP bond strength.

    PubMed

    Silva, L H; Costa, A K F; Queiroz, J R C; Bottino, M A; Valandro, L F

    2012-01-01

    The purpose of this study was to evaluate the effect of different heat-treatment strategies for a ceramic primer on the shear bond strength of a 10-methacryloyloxydecyl-dihydrogen-phosphate (MDP)-based resin cement to a yttrium-stabilized tetragonal zirconia polycrystal (Y-TZP) ceramic. Specimens measuring 4.5 × 3.5 × 4.5 mm(3) were produced from Y-TZP presintered cubes and embedded in polymethyl methacrylate (PMMA). Following finishing, the specimens were cleaned using an ultrasound device and distilled water and randomly divided into 10 experimental groups (n=14) according to the heat treatment of the ceramic primer and aging condition. The strategies used for the experimental groups were: GC (control), without primer; G20, primer application at ambient temperature (20°C); G45, primer application + heat treatment at 45°C; G79, primer application + heat treatment at 79°C; and G100, primer application + heat treatment at 100°C. The specimens from the aging groups were submitted to thermal cycling (6000 cycles, 5°C/55°C, 30 seconds per bath) after 24 hours. A cylinder of MDP-based resin cement (2.4 mm in diameter) was constructed on the ceramic surface of the specimens of each experimental group and stored for 24 hours at 37°C. The specimens were submitted to a shear bond strength test (n=14). Thermal gravimetric analysis was performed on the ceramic primer. The data obtained were statistically analyzed by two-way analysis of variance and the Tukey test (α=0.05). The experimental group G79 without aging (7.23 ± 2.87 MPa) presented a significantly higher mean than the other experimental groups without aging (GC: 2.81 ± 1.5 MPa; G20: 3.38 ± 2.21 MPa; G100: 3.96 ± 1.57 MPa), showing no difference from G45 only (G45: 6 ± 3.63 MPa). All specimens of the aging groups debonded during thermocycling and were considered to present zero bond strength for the statistical analyses. In conclusion, heat treatment of the metal/zirconia primer improved bond strength

  18. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    PubMed Central

    2013-01-01

    Background Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called “universal” primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Results Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first–time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. Conclusions These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory. PMID:24020880

  19. Comparison of primer sets for T-cell clonality testing in canine intestinal lymphoma.

    PubMed

    Takanosu, Masamine; Kagawa, Yumiko

    2015-09-01

    Clonality testing based on polymerase chain reaction is an important tool for diagnosis of lymphoproliferative diseases. Many primers have been designed and used for canine clonality testing. Canine intestinal lymphoma is usually diagnosed pathologically by examination of excised intestinal or endoscopic biopsy tissues, and clonality testing is sometimes used to support the pathological diagnosis if this examination is inconclusive. In the present study, the sensitivity of each previously published primer set for clonality testing was examined by using formalin-fixed, paraffin-embedded sections from 39 cases pathologically diagnosed as canine intestinal lymphoma (large-cell type). All 39 cases were immunohistochemically positive for cluster of differentiation (CD)3. Thirty-two out of the 39 cases showed clonality in the T-cell receptor gamma (TRG) with at least 1 of the tested primers. The primer set with the highest sensitivity detected all 32 cases with TRG clonality, with a sensitivity of 82.1%. These results provide useful evidence for the selection of primer sets for clonality testing of canine intestinal lymphoma.

  20. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    PubMed

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. PMID:26505528

  1. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    PubMed Central

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-01-01

    Aims: To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Results: Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different. PMID:24347881

  2. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  3. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  4. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata.

    PubMed

    Martín, M T; Cuesta, M J; Martín, L

    2014-01-01

    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes.

  5. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing.

    PubMed

    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua

    2014-06-01

    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  6. A new tetra-primer ARMS-PCR for genotyping bovine kappa-casein polymorphisms.

    PubMed

    Fonseca, P A S; Rosse, I C; Demiranda, M; Machado, M A; Verneque, R S; Peixoto, M G C D; Carvalho, M R S

    2013-12-11

    Kappa-casein (κ-casein) is one of the most abundant milk proteins. Its main function is to avoid the aggregation of casein micelles, keeping them, and therefore calcium phosphate, in pockets in solution. In bovines, a κ-casein functional polymorphism has been associated with fat, calcium, and protein milk contents and faster curd contraction in cheese production. Quicker curd contraction reduces the loss of milk solids, enhancing cheese yield. This polymorphism induces a double amino acid substitution (Thr136Ile and Ala148Asp). The polymorphism is normally detected by PCR-RFLP, which is a laborious method. An interesting methodological alternative is the tetra-primer amplification refractory mutation system PCR (tetra-primer ARMS-PCR). A tetra-primer ARMS-PCR for the detection of this κ-casein polymorphism has been described. However, specificity was not achieved, probably due to problems with primer design. We developed a new tetra-primer ARMS-PCR for the detection of the κ-casein polymorphism. This new method was validated in a double-blind test, by comparison with the results obtained for 50 Guzerá bulls formerly genotyped by PCR-RFLP. This new method achieved 100% sensitivity and specificity. We conclude that this method is a useful, cost-efficient alternative for the detection of functional κ-casein polymorphisms.

  7. Cloning flanking sequence by single-primer PCR in transgenic plants.

    PubMed

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  8. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    PubMed

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.

  9. Synchrotron FTIR characterisation of automotive primer surfacer paint coatings for forensic purposes.

    PubMed

    Maric, Mark; van Bronswijk, Wilhelm; Lewis, Simon W; Pitts, Kari

    2014-01-01

    Synchrotron FTIR microspectroscopy was used to characterise and assess the chemical diversity of electrocoat primer, primer surfacer and basecoats of automotive paint samples from 75 vehicles representing a range of international car manufacturers. Significant diversity was found in the synchrotron FTIR data from the primer surfacer coats. Classification using principal component analysis revealed 14 discrete groups, which could be associated with the country of manufacture, the specific manufacturer and manufacturing plant, the year of manufacture of the vehicle and in some instances the number of layers in the paint system. The model generated from the primer surfacer was significantly more discriminating than a previous model generated from FTIR analysis of clear coats of the same vehicles. Analysis of the primer surfacer also avoids issues of possible environmental degradation and component migration seen with FTIR analysis of automotive clear coats. Providing such information concerning vehicle origin would aid in the development of investigative leads from the analysis of questioned automotive paint samples located at the scene of a crime or on the body/clothing of a hit and run victim.

  10. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software.

  11. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  12. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    SciTech Connect

    Lech, L.M.

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  13. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences.

    PubMed

    Rose, T M; Schultz, E R; Henikoff, J G; Pietrokovski, S; McCallum, C M; Henikoff, S

    1998-04-01

    We describe a new primer design strategy for PCR amplification of unknown targets that are related to multiply-aligned protein sequences. Each primer consists of a short 3' degenerate core region and a longer 5' consensus clamp region. Only 3-4 highly conserved amino acid residues are necessary for design of the core, which is stabilized by the clamp during annealing to template molecules. During later rounds of amplification, the non-degenerate clamp permits stable annealing to product molecules. We demonstrate the practical utility of this hybrid primer method by detection of diverse reverse transcriptase-like genes in a human genome, and by detection of C5DNA methyltransferase homologs in various plant DNAs. In each case, amplified products were sufficiently pure to be cloned without gel fractionation. This COnsensus-DEgenerate Hybrid Oligonucleotide Primer (CODEHOP) strategy has been implemented as a computer program that is accessible over the World Wide Web (http://blocks.fhcrc.org/codehop.html) and is directly linked from the BlockMaker multiple sequence alignment site for hybrid primer prediction beginning with a set of related protein sequences.

  14. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis.

    PubMed

    Xu, Wentao; Zhai, Zhifang; Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5'-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on.

  15. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php.

  16. Kisspeptin: a new neuronal target of primer pheromones in the control of reproductive function in mammals.

    PubMed

    Jouhanneau, Mélanie; Szymanski, Laura; Martini, Mariangela; Ella, Arsène; Keller, Matthieu

    2013-07-01

    Pheromones are known to trigger either short-term behavioral responses, usually referred to as "releaser effects", or more long-term physiological changes, known as "primer effects", which especially affect reproductive function at the level of the gonadotrope axis. The precise mechanisms through which pheromones interact with the gonadotrope axis in the hypothalamus is not fully known. We propose that the neuropeptide Kisspeptin, could be a specific target of primer pheromones, allowing these pheromones to modulate the gonadotrope axis and GnRH activity. This emerging hypothesis is discussed in the context of puberty acceleration in female mice and the male effect in female ungulates (sheep or goat). These examples have been chosen to illustrate the diversity of the reproductive contexts in mammals and potential mechanisms affected by primer effects at the level of the gonadotrope axis.

  17. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  18. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera).

    PubMed

    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P

    2014-11-01

    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice. PMID:26309297

  19. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  20. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  1. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  2. Efficient newly designed primers for the amplification and sequencing of bird mitochondrial genomes.

    PubMed

    Amer, Sayed A M; Ahmed, Mohamed Mohamed; Shobrak, Mohammed

    2013-01-01

    In the present study, 27 mitochondrial genomes of diverse avian supra-orders were collected from the Genbank database and their genes were aligned separately. From the alignments, the conserved sequences were selected to design novel conserved primers for amplification and sequencing of the different mitochondrial genes. The reproducibility of these primers was tested in the amplification and sequencing of diverse avian supra-order mitochondrial genomes and was confirmed. This method helped in designing a new set of primers to accelerate both the amplification and the sequencing of bird mitogenomes. It also aids in building mitogenome markers in studying the genetic framework of endemic birds as a preliminary strategy for conservation management of them.

  3. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification. PMID:27086303

  4. Tail variation of the folding primer affects the SmartAmp2 process differently.

    PubMed

    Kimura, Yasumasa; Oguchi-Katayama, Atsuko; Kawai, Yuki; Naito, Kana; Mitani, Yasumasa; Morlighem, Jean-Etienne; Hayashizaki, Yoshihide; Lezhava, Alexander

    2009-06-12

    Folding primer (FP), together with turn-back primer (TP) and boost primer (BP), is one of the major components of SmartAmp2, a rapid amplification-based method for SNP detection. FP has a unique design where the annealing region is combined with a tail that can fold back. FP tails can be classified as either "strong" or "weak", depending on the melting temperature and free energy of the hairpin structure. We report that FP tails affect the amplification process differently; by changing the FP concentration, we can increase the amplification reaction speed with "strong tails". Unlike "strong tails", concentration change of FP with "weak tails" did not show significant impact on the amplification speed. The comparative analyses using gel electrophoresis demonstrate that the FP type and FP ratio in the reaction change the amplification pattern. The above observations can be used to optimize the reaction and manipulate the reaction speed of SmartAmp2.

  5. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  6. Primers for low-copy nuclear genes in the Melastomataceae1

    PubMed Central

    Reginato, Marcelo; Michelangeli, Fabián A.

    2016-01-01

    Premise of the study: Low-copy nuclear gene primers were developed for phylogenetic studies across the Melastomataceae. Methods and Results: Total genomic libraries from eight species in the Melastomataceae along with one transcriptome were used for marker identification and primer design. Eight exon-primed intron-crossing markers were amplified with success in taxa of nine tribes in the Melastomataceae. The new markers were directly sequenced for eight samples of closely related species of Miconia (Chaenanthera clade) in the tribe Miconieae. The DNA sequences for the eight loci ranged from 660 to 818 aligned base pairs. Compared with four commonly used markers in other studies, the loci developed here had a higher number of variable sites than plastid spacers (7–16 vs. 26–45) and comparable variation to the ribosomal spacers (28–39). Conclusions: The novel primer pairs should be useful for a broad range of studies of systematics and evolution in the diverse Melastomataceae. PMID:26819862

  7. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  8. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  9. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    PubMed Central

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

    2014-01-01

    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  10. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

    PubMed

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

    2014-09-01

    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms.

  11. The Roles of Tryptophans in Primer Synthesis by the DNA Primase of Bacteriophage T7*

    PubMed Central

    Zhang, Huidong; Lee, Seung-Joo; Richardson, Charles C.

    2012-01-01

    DNA primases catalyze the synthesis of oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Prokaryotic primases consist of a zinc-binding domain (ZBD) necessary for recognition of a specific template sequence and a catalytic RNA polymerase domain. Interactions of both domains with the DNA template and ribonucleotides are required for primer synthesis. Five tryptophan residues are dispersed in the primase of bacteriophage T7: Trp-42 in the ZBD and Trp-69, -97, -147, and -255 in the RNA polymerase domain. Previous studies showed that replacement of Trp-42 with alanine in the ZBD decreases primer synthesis, whereas substitution of non-aromatic residues for Trp-69 impairs both primer synthesis and delivery. However, the roles of tryptophan at position 97, 147, or 255 remain elusive. To investigate the essential roles of these residues, we replaced each tryptophan with the structurally similar tyrosine and examined the effect of this subtle alteration on primer synthesis. The substitution at position 42, 97, or 147 reduced primer synthesis, whereas substitution at position 69 or 255 did not. The functions of the tryptophans were further examined at each step of primer synthesis. Alteration of residue 42 disturbed the conformation of the ZBD and resulted in partial loss of the zinc ion, impairing binding to the ssDNA template. Replacement of Trp-97 with tyrosine reduced the binding affinity to NTP and the catalysis step. The replacement of Trp-147 with tyrosine also impaired the catalytic step. Therefore, Trp-42 is important in maintaining the conformation of the ZBD for template binding; Trp-97 contributes to NTP binding and the catalysis step; and Trp-147 maintains the catalysis step. PMID:22605336

  12. Design and Implementation of Degenerate Microsatellite Primers for the Mammalian Clade

    PubMed Central

    Buschiazzo, Emmanuel; Beck, Josephine S.; Gemmell, Neil J.

    2011-01-01

    Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1) identify conserved microsatellite loci from a multiple genome alignments, (2) design degenerate primer pairs, with (3) a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ∼1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120–160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced. PMID:22216321

  13. Impact of primer choice on characterization of orchid mycorrhizal communities using 454 pyrosequencing.

    PubMed

    Waud, Michael; Busschaert, Pieter; Ruyters, Stefan; Jacquemyn, Hans; Lievens, Bart

    2014-07-01

    Although the number of studies investigating mycorrhizal associations in orchids has increased in recent years, the fungal communities associating with orchids and how they differ between species and sites remain unclear. Recent research has indicated that individual orchid plants may associate with several fungi concurrently, implying that to study mycorrhizal associations in orchids the fungal community should be assessed, rather than the presence of individual dominant fungal species or strains. High-throughput sequencing methods, such as 454 pyrosequencing, are increasingly used as the primary tool for such analyses. However, many studies combine universal primers from previous phylogenetic or ecological studies to generate amplicons suitable for 454 pyrosequencing without first critically evaluating their performance, potentially resulting in biased fungal community descriptions. Here, following in silico primer analysis we evaluated the performance of different combinations of existing PCR primers to characterize orchid mycorrhizal communities using 454 pyrosequencing by analysis of both an artificially assembled community of mycorrhizal fungi isolated from diverse orchid species and root samples from three different orchid species (Anacamptis morio, Ophrys tenthredinifera and Serapias lingua). Our results indicate that primer pairs ITS3/ITS4OF and ITS86F/ITS4, targeting the internal transcribed spacer-2 (ITS-2) region, outperformed other tested primer pairs in terms of number of reads, number of operational taxonomic units recovered from the artificial community and number of different orchid mycorrhizal associating families detected in the orchid samples. Additionally, we show the complementary specificity of both primer pairs, making them highly suitable for tandem use when studying the diversity of orchid mycorrhizal communities.

  14. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    PubMed Central

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  15. Establishment of quantitative analysis method for genetically modified maize using a reference plasmid and novel primers.

    PubMed

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-12-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×10(1)~10(5) copies of pGMmaize and the R(2) values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods.

  16. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail

  17. Lead-free precussion primer mixes based on metastable interstitial composite (MIC) technology

    DOEpatents

    Dixon, George P.; Martin, Joe A.; Thompson, Don

    1998-01-01

    A lead-free percussion primer composition and a percussion cup containing e composition. The lead-free percussion primer composition is comprised of a mixture of about 45 wt % aluminum powder having an outer coating of aluminum oxide and molybdenum trioxide powder or a mixture of about 50 wt % aluminum powder having an outer coating of aluminum oxide and polytetrafluoroethylene powder. The aluminum powder, molybdenum trioxide powder and polytetrafluoroethylene powder has a particle size of 0.1 .mu.m or less, more preferably a particle size of from about 200-500 angstroms.

  18. Sources and Spatial Distribution of Metal Pollutants in Soils near the El Paso Smelter: A Forensic Study with Pb and Pu Isotopes.

    NASA Astrophysics Data System (ADS)

    Ketterer, Michael; Moan, Matthew; Gremillion, Paul

    2010-05-01

    Lead and copper smelting has been conducted at El Paso since the late 1800's, and as a result, environmental media near the smelter have become contaminated. A study has been conducted to investigate the sources and spatial distribution of metal pollutants (Pb, Cd, Zn, Hg, As, Cu) and concomitant tracers (Ag, In, Sb, Bi) in soils from the smelter vicinity. Sampled locations were residential and non-residential locations in El Paso (Texas, USA), Anapra (New Mexico, USA) and Ciudad Juarez (Chihuahua, Mexico). Lead isotope studies indicate that the soil Pb is derived from smelting, and is consistent with two-component mixing between lead ores from Chihuahua (northern Mexico) having 206Pb/204Pb of 18.6 - 18.8 and ores from the Hanover, New Mexico (USA) mining district with 206Pb/204Pb of ~ 17.6. The Pb isotope results also exclude other common anthropogenic Pb sources such as paint and gasoline emissions as being major contributors. Concentrations of Hg and Pb of up to 10 and 11,000 ppm were found in surface soils within 1 km of the smelter. The metal concentration results clearly indicate that soils near the smelter (< 5 km) exhibit much higher concentrations of smelter-related elements than do soils from control locations (> 10 km distant). A general trend of decreasing concentrations vs. distance from the smelter was also observed. However, the results indicate that metal concentrations vary widely even at a fixed distance from the smelter point source. This phenomenon results from a combination of natural and anthropogenic processes that disturb and re-distribute soils in the surface environment. The site conditions consist of a very arid environment with little vegetation cover that is frequently disturbed by high winds and severe episodic rainfall. To study these effects, we have investigated stratospheric fallout plutonium (239+240Pu) as a proxy measure of disturbed vs. undisturbed soil conditions. The premise is that 'undisturbed' locations will have high 239

  19. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    NASA Astrophysics Data System (ADS)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  20. Combustion-generated nanoparticulates in the El Paso, TX, USA / Juarez, Mexico Metroplex: their comparative characterization and potential for adverse health effects.

    PubMed

    Murr, L E; Soto, K F; Garza, K M; Guerrero, P A; Martinez, F; Esquivel, E V; Ramirez, D A; Shi, Y; Bang, J J; Venzor, J

    2006-03-01

    In this paper we report on the collection of fine (PM1) and ultrafine (PM0.1), or nanoparticulate, carbonaceous materials using thermophoretic precipitation onto silicon monoxide/formvar-coated 3 mm grids which were examined in the transmission electron microscope (TEM). We characterize and compare diesel particulate matter (DPM), tire particulate matter (TPM), wood burning particulate matter, and other soot (or black carbons (BC)) along with carbon nanotube and related fullerene nanoparticle aggregates in the outdoor air, as well as carbon nanotube aggregates in the indoor air; and with reference to specific gas combustion sources. These TEM investigations include detailed microstructural and microdiffraction observations and comparisons as they relate to the aggregate morphologies as well as their component (primary) nanoparticles. We have also conducted both clinical surveys regarding asthma incidence and the use of gas cooking stoves as well as random surveys by zip code throughout the city of El Paso. In addition, we report on short term (2 day) and longer term (2 week) in vitro assays for black carbon and a commercial multiwall carbon nanotube aggregate sample using a murine macrophage cell line, which demonstrate significant cytotoxicity; comparable to a chrysotile asbestos nanoparticulate reference. The multi-wall carbon nanotube aggregate material is identical to those collected in the indoor and outdoor air, and may serve as a surrogate. Taken together with the plethora of toxic responses reported for DPM, these findings prompt concerns for airborne carbonaceous nanoparticulates in general. The implications of these preliminary findings and their potential health effects, as well as directions for related studies addressing these complex issues, will also be examined.